CHAF1A–PCNA interaction promotes cervical cancer progression via the PI3K/AKT/FoxO1 signaling pathway

preprint OA: closed
Full text JSON View at publisher
⚙ AI-generated summary by qwen3.7-flash, 2026-09-29 ⓘ

CHAF1A interacts with PCNA to promote cervical cancer progression by activating the PI3K/AKT/FoxO1 signaling pathway, as demonstrated through in vitro and in vivo experiments.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

⚙ AI-generated deep summary by qwen3.7-flash, 2026-09-29 · read from full text ⓘ

This preprint investigates the role of the histone chaperone CHAF1A in cervical cancer progression, finding that its high expression correlates with poor prognosis. The study demonstrates that CHAF1A promotes cell proliferation and migration while inhibiting apoptosis by activating the PI3K/AKT/FoxO1 signaling pathway. Additionally, the authors identified a direct physical interaction between CHAF1A and proliferating cell nuclear antigen (PCNA) that further drives tumor development in vitro and in xenograft models. Relevance to endometriosis: listed as one indication for GnRH antagonists, though the paper's main focus is uterine fibroids.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background An increasing number of studies demonstrate that histone chaperones play critical roles in tumorigenesis and development. In previous research, we confirmed that CHAF1A was highly expressed in cervical cancer (CC) and was correlated with poor prognosis. However, the biological function and specific mechanism of CHAF1A in the development of CC have not been reported. Methods CHAF1A knockdown in SiHa and HeLa.cells by lentivirus vector is verified by RT-PCR and Western blot analysis.CCK-8, flow cytometry assays, colony formation, cell migration assay and real-time cell analysis assay were performed to determine the cellular function of CHAF1A in CC.Tumor xenograft assay was conducted on nude mice to assess the effect of CHAF1A in vivo. Cell immunofluorescence and co-immunoprecipitation were applied to examine the interaction between CHAF1A and PCNA. Results We found that CHAF1A knockdown in SiHa and HeLa cell lines inhibited proliferation and promotedits apoptosis. Further research indicated that CHAF1A promoted proliferation and inhibited apoptosis in CC by activating the PI3K/Akt/FoxO1 signaling pathway. Moreover, CHAF1A directly interacts with PCNA and co-promotes CC progression. Conclusions The discovery of the mechanism of action of CHAF1A in CC may provide a new direction for the treatment of CC.
Full text 81,330 characters · extracted from preprint-html · click to expand
CHAF1A–PCNA interaction promotes cervical cancer progression via the PI3K/AKT/FoxO1 signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Help Center Sign In Submit a Preprint Cite Share Download PDF Primary research CHAF1A–PCNA interaction promotes cervical cancer progression via the PI3K/AKT/FoxO1 signaling pathway Li Wen, Yuli Luo, Zhaoning Duan, Xiaoge Li, Ying Jia This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-390228/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background An increasing number of studies demonstrate that histone chaperones play critical roles in tumorigenesis and development. In previous research, we confirmed that CHAF1A was highly expressed in cervical cancer (CC) and was correlated with poor prognosis. However, the biological function and specific mechanism of CHAF1A in the development of CC have not been reported. Methods CHAF1A knockdown in SiHa and HeLa.cells by lentivirus vector is verified by RT-PCR and Western blot analysis.CCK-8, flow cytometry assays, colony formation, cell migration assay and real-time cell analysis assay were performed to determine the cellular function of CHAF1A in CC.Tumor xenograft assay was conducted on nude mice to assess the effect of CHAF1A in vivo. Cell immunofluorescence and co-immunoprecipitation were applied to examine the interaction between CHAF1A and PCNA. Results We found that CHAF1A knockdown in SiHa and HeLa cell lines inhibited proliferation and promotedits apoptosis. Further research indicated that CHAF1A promoted proliferation and inhibited apoptosis in CC by activating the PI3K/Akt/FoxO1 signaling pathway. Moreover, CHAF1A directly interacts with PCNA and co-promotes CC progression. Conclusions The discovery of the mechanism of action of CHAF1A in CC may provide a new direction for the treatment of CC. Cancer Biology Cervical cancer,CHAF1A,PCNA,Interaction Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Cervical cancer (CC) is one of the most common malignant tumors worldwide. It is the second most common malignant tumor in females(1). However, despite significant advancements in CC therapies, such as surgical resection, chemotherapy, and radiotherapy, the prognoses of patients with CC remain poor. CC continues to be a major cause of death from cancer worldwide (1) . Persistent human papillomavirus infectionis the main etiological factor for CC development. CC is a multistep process involving the deregulation of multiple genes. The mechanisms of carcinogenesis are quite complex, and both genetic and epigenetic alterations can lead to carcinogenesis. In the last decade of cancer research, abnormalities in epigenetics have been consistently observed. Aberrations of epigenetics in cancer mainly involve aberrant histone modifications and altered DNA methylation (2, 3) . Accumulating evidence suggests that cancer initiation, progression and the involvement of histone variants and their partners are closely linked (4, 5) . CAF-1 is a trimeric complex protein that includes P150, P60, and p48. CAF-1 is important for chromatin assembly during DNA synthesis, and interfering with CAF expression may affect DNA synthesis, leading to DNA damage or even programmed cell death (6-11). As the largest subunit of CAF-1 and a major component exercising biological functions, CHAF1A plays a very important role in DNA mismatch repair, epigenetic regulation of embryonic stem cells, and diverse biological behaviors such as cell division and, proliferation, among others (7, 11-13) . An increasing number of studies have confirmed that the dysregulated expression of CHAF1A is associated with the development and progression of several tumors, such as: glioblastoma, hepatocellular carcinoma, colorectal cancer, and gastric cancer (14-22). Our previous study verified its high expression in CC by immunohistochemistry and association with the poor prognosis of CC (23). However, the specific biological functions and mechanisms of action of CHAF1A in cervical cancer have not been reported. In the present study, we clarfied that CHAF1A could promote cell proliferation in CC, thereby inhibiting apoptosis and enhancing migration. Moreover, CHAF1A and proliferating cell nuclear antigen (PCNA) interacted to promote CC progression. PCNA can regulate CHAF1A expression. Materials And Methods 2.1 Cell culture Caksi, HaCat and C33A cells were purchased from the Cell Bank of the Chinese Academy of Sciences in 2018. The CC cell lines HeLa and SiHa cells were purchased from Shanghai Jikai Gene (Shanghai, CHN). HeLa cells were maintained in DMEM, supplemented with 10% fetal bovine serum (FBS); HaCat cells were cultured in the RPMI-1640 medium; and SiHa, C33A, and Caksi were cultured in MEM with 10% FBS. All cells were cultured with 1% penicillin–streptomycin antibiotics (Beyotime, China). 2.2 Lentivirus-mediated assay Lentivirus sh-CHAF1A was purchased from Shanghai Genechem Co. Ltd. (Shanghai, China). PCNA lentiviruses and vectors were supplied by Genecopoeia (GeneCopoeia, Rockville, MD, USA). The following were the shRNA target sequences: 5′- ACCCGGAATGCAGATATTT -3′ for CHAF1A. The negative control was 5′- TTCTCCGAACGTGTCACGT -3′. The PCNA control lentiviral(sh-ctrl:5′-CGCTAGTATTTGAAGCACCTCAAGAGGGTGCTTCAAATACTAGCGCC3′); Sh-PCNA5′GCTTCGCGCCGTAGTCTTATCAAGAGTAAGACTACGGCGCGAAGC3′. The multiplicity of infection was determined before lentiviral transfection. The cells were passaged and seeded at 2 × 10 4 cells / well in 6 well plates. After the cells were plated for 24 h, the original medium was discarded and the fresh medium containing lentiviral particlees and polybrene was added (the concentration of polybrene used was in accordance with the amount recommended by the manufacture).The medium was then replaced with completely fresh medium after 24 h.After the cells were allowed recover and grow further for 24 h, they were switched to 2.5 ug/mL of puromycin for week-long culture and selection of cells successfully transfected with the lentivirus.The culture was further maintained for a week with purinomycin, and the culture medium was replaced with the complete medium. The cells that were successfully transfected with lentiviral particles were subcultured for subsequent experiments. 2.3 RT-PCR RT-PCR was performed using a RT-PCR kit (Takara, Shiga, Japan) in accordance with the instructions provided by manufacturer. Total RNAs from cells were extracted using TRIzol Reagent, and then reversely transcribed into cDNA by using the Prime Script RT Reagent Kit (TaKaRa), RT-qPCR was performed with the S1000 Real-Time System (Bio-Rad, Hercules, California, USA). SYBR Green (SYBR Premix Ex Taq TM II; TaKaRa) was used for fluorescent quantification. The following cycling conditions were used for RT-PCR: pre-denaturation (95 °C, for 30 s), denaturation ,95 °C, for 5 s, and 40 cycles; annealing 60°C for 30 s), The relative mRNA expression was calculated using the 2−∆∆Ct method. All RT-PCR results were repeated at least 3 times. The primers used are listed in Table 1 . 2.4 Flow cytometry The effects of CHAF1A knockdown on cell cycle and apoptosis were assessed by flow cytometry. When the total number of cells reached 1.0 × 10 6 in the culture flask, the cells were trypsinized. Cells were collected after centrifugation at 1000g for 5 min, washed three times with PBS, and resuspended in 100 µL of PBS solution. Subsequently 500µL pre-cooled 75% alcohol in a lysis buffer containing 1 mg / mL RNase, 0.05% Triton X-100, 1 mg / mL. RNase, and 50 mg / mL propidium iodide (Sigma, Aldrich, St. Louis, MO, USA) was fixed in their solution, incubated in the dark at room temperature for 30 min, and immediately analyzed using a FACS Calibur instrument (Becton Dickinson, CA, USA). Apoptotic samples were resuspended in 500 μL of PBS without ethanol. The cell instrument was analyzed and the results were recorded. 2.5 Colony Formation Assay Cells (500 cells/well) were seeded in a 6- well plate and then incubated for the next 14 d until cell colonies appeared. The cells were subsequently fixed with 4% paraformaldehyde for 15 min and then stained with Giemsa for 20 min. The rate cell clone formation was ultimately calculated. 2.6 CCK8 Assay Cell Counting Kit-8 (CCK8) (Boiss, Beijing, China) was used to determine cell viability. The cells were counted after digestion and the concentration was adjusted to 2000 cells / 100 UL, Two sets of control and experimental samples with five replicate wells per set were then set up. The plates were seeded for 24, 48, 72, 96, and 120 h and left to stand for 1 h, in accordance with the instructions provided by the manufacturer, The 450 nm was then determined. 2.7 Real-time cell analysis (Proliferation) Baseline values were first verified by adding 100 UL of the complete medium per well onto a dedicated 16 well electronic plate.The HeLa and SiHa cells were digested, centrifuged, resuspended, and seeded onto a baseline 16 well electronic plate containing 5000 cells / well with gold microelectrode arrays attached.The cell index was monitored using the xCELLigence system (Roche, Mannheim, Germany) for 96 h with measurements taken every 15 min.The results were analyzed using the RTCA software (version 2.0). 2.8 Cell Migration Assay Cell migration was quantified using the in vitro scratch wound assay. HeLa and Siha cells (1 × 10 6 /well) were seeded in a 6-well plate. After adhesion, a linear wound was made using a 10 µL micropipette tip. The scratched wells were washed whith PBSseveral times to remove the detached debris caused by scratching. Images of the wounds (0, 24 h) were taken with a light microscope (20× magnification). After 24 h images were again recorded. The number of migrated cells was then determined. 2.9 Real-time cell analysis (Migration) The baseline values were determined. The mediumwas placed in the lower chamber of a 16-well electronic plate, and a cell culture medium containing 10% FBS was added. The upper chamber was mounted, and 30 µL of the serum-free medium in the upper chamber electronic well plate for 1 h at 37 °C and 5% CO2 incubator. 100 UL of serum-free medium (100 UL containing 50000 cells) was seeded into each well of the upper chamber of the cell migration plate. The cell migration index was recorded every 15 min for approximately 90 h. 2.10 Western blot analysis Proteins were extracted from cervical cancer cells and prepared using RIPA lysis and an extraction buffer was supplemented with a protease and phosphatase inhibitor cocktail for 30 min on ice. Cell lysates were ultrasonically disrupted three times for 10 s each, followed by centrifugation at 12000 g for 15 min at 4 °C. Supernatants were collected, denatured by boiling after the addition of the Laemmli sample buffer without a reducing agent, and then assayed. Protein samples after quantification were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). The membranes were then blocked and.then incubated with a specific primary antibody diluent in a room at 4 °C overnight. Details of the primary antibodies are listed in Table 1. The membranes were then washed with TBST 3 times and then incubated with a secondary antibody (1:7500 dilution) for 1 h. The blots were washed 3 times in TBST. The immunoblots were detected with an ECL kit and visualized using an imaging system (Fusion, Germany). 2.11 Cell immunofluorescence The CC cell lines SiHa and HeLa were seeded in 24-well plates. The well surfaces were covered with 13 mm glass coverslips. Immunofluorescence assay was performed when the cell confluence reached 90%. The cell culture medium was discarded. The cells were washed three times with PBS, fixed in 4% paraformaldehyde for 10 min at room temperature, washed again with PBS three times , permeabilized with 0.3% Triton X-100 for 10 min, and blocked with 5% goat serum for 30min. The samples were incubated with the primary antibody (mouse polyclonal PCNA antibody, 1:2400; rabbit polyclonal CHAF1A antibody, 1:200) overnight in a room at 4 °C. The samples were washed 3 times with PBS solution and then incubated in the dark at room temperature for Alexa Fluor 488 conjugated Goat anti rabbit (Abcam, ab150115) and Alexa Fluor 647 conjugated goat anti mouse antibodies (Abcam, 150077) (both 1:1000). DAPI containing fluorescence quenched coverslips were added and then observed by confocal laser scanning microscopy. 2.12 Co-immunoprecipitation Protein immunoblotting and co-immunoprecipitation were performed to investigate the interactions of the proteins. Protein interaction was verified using the Pierce Co Immunoprecipitation Kit (Thermo Scientific, 26149). Specific experimental procedures were conducted, strictly following the instructions provided in the kit. Cells were lysed using a kit-specific cell lysate for 15 min, sonicated for 10 s three times, and centrifuged at 12000 × g for 10 min. Upper protein lysate was aspirated, and the protein was incubated with 10 μg corresponding antibody overnight at 4 ° C. About 50 μ g of a mock antibody (Rabbit Anti mouse IgG) was used as a control. The next day the resin bound to the protein was washed 4 times following the instructions provided in the kit. Specifically, 50 μL of the eluate was used. Eluted proteins were immediately boiled and denatured for Western blot analysis. 2.11 Tumor xenografts Ten BALB/c female nude mice ((aged 5 weeks, with an average weight of 20 g).) were provided by China Chongqing Ensville Biotechnology Co. Ltd. The mice were divided into two groups consisting of five mice each .All mice were given water and chow ad libitum . Control cells and cells with stable CHAF1A knockdown (shCHAF1A) were suspended in cold PBS.The right forelimb of each nude mouse was subcutaneously injected with 1.0 × 106 cells. On Day 5 of modeling, the width (W), weight and length (L), of the tumor were measured for 3 d (volume [V] = W 2 × L × 0.52). The nude mice were sacrificed using 2% isoflurane anesthesia.High concentration of CO2 asphyxia led to death by asphyxiation 21 d after injection, and the transplanted tumors were removed. Part of the tumor was sent for immunohistochemistry. The research protocol for this animal study conformed to the ethical guidelines in laboratory animal research and the Declaration of Helsinki.A approval was obtained from the ethics committee of the First Affiliated Hospital of Chongqing Medical University (accession number 2021-11). 2.12 Statistical analysis All statistical analyses were performed using GraphPad Prism 7.0. The data are expressed as mean ± standard deviation (SD). Between-group comparisons were conducted using a 2-tailed paired Student t-test to test for statistical significance. Statistical differences between groups were determined using one-way ANOVA. P ≤ 0.05 was considered statistically significant in all cases. All experiments were performed in triplicate. Results 3.1 Knockdown of CHAF1A inhibits cervical cancer cell proliferation The expression of CHAF1A in cervical cancer cell lines was significantly higher than that in HaCat cells( P <0.05,Fig.1A).To evaluate the functional proliferation of CHAF1A overexpression in CC, we performed CHAF1A knockdown in CC cells and evaluated the cellular outcomes. CHAF1A cells were depleted in SiHa and HeLa cells by RNA interference, and CHAF1A knockdown efficiency after lentiviral transfection was verified by qRT PCR and Western blot analysis. Knockdown efficacy in both SiHa and HeLa cells is shown in Figs. 1.B and 1.C. The stable transfected cells were selected for the subsequent experiment. Cell proliferation was observed using the CCK8 assay. The reduced CHAF1A expression in the HeLa and SiHa cells was found to inhibit cell proliferation. Moreover, the colony formation assay and RTCA presented a trend similar to that of the CCK8 assay after CHAF1A knockdown ( P <0.05, Figs. 1D–1F). 3.2 Induction of cell cycle arrest and promotion of apoptosis in cervical cancer cells upon inhibition of CHAF1A expression We further validate the biological function of CHAF1A in CC cells by conducting additional in vitro experiments. The cell cycle was analyzed by flow cytometry. CHAF1A knockdown resulted in a significant increase in the percentage of cells in the peak G1 / G0 phase and a decrease in the percentage of cells in peak S phases. CHAF1A inhibition was found to induce G1 arrest in CC cells (Fig. 1G). The number of apoptotic cells in the cells of the CHAF1A knockdown group was significantly higher than that in the cells of the control group (Figs.2A,2B). On the basis of these findings, we speculated that CHAF1A could regulate the abnormal proliferation of CC by interferingwith the cell cycle to inhibit apoptosis. 3.3 CHAF1A promotes the migration of cervical cancer To examine the migratory properties of SiHa and HeLa, we conducted a scratch wound assay. Using a scratch assay, we found that CHAF1A silencing resulted in decreased cell migration (Figs. 2C, 2D). Meanwhile, RTCA assays were used to examine SiHa and HeLa cell migration after transfection with the sh-CHAF1A. The results indicated that the migration of SiHa and HeLa cells was inhibited by CHAF1A knockdown (Fig. 2E). 3.4 CHAF1A promotes cervical cancer progression via the PI3K / Akt signaling pathway Activation of the PI3K / Akt signaling pathway mainly promotes cell growth and survival.We detected the proteins related to PI3K / Akt / FoxO1 by Western blot assay.The results showed that the phosphorylated PI3K (tyr458) and Akt (ser473) levelswere decreased after CHAF1A knockdown,whereas PI3K and Akt levels remained unchanged in the total protein relative to the control group (Fig. 3E).This finding suggested that the high expression of CHAF1A could induce CC cell proliferation and invasionvia the PI3K / Akt pathway. 3.5 CHAF1A interaction with PCNA promotes tumor progression Localization was determined by confocal immunofluorescence microscopy, which revealed the colocalization of CHAF1A and PCNA proteins in the nucleus (Fig. 3A). These proteins were localized in the nucleus (Fig. 3A), suggesting that they could interact with each other in the nucleus. This interaction was confirmed by co-immunoprecipitation. We first co-precipitated the PCNA protein with the CHAF1A antibody (Fig. 3B), and the CHAF1A protein was precipitated with PCNA (Fig. 3B). We also found that CHAF1A expression was decreased after PCNA knockdown, which was verified by both mRNA and protein levels (Figs. 3C, 3D). 3.6 Effects of CHAF1A on tumorigenicity in vivo To further validate the biological role of CHAF1A in vivo, HeLa cells with control and lentiviral knockdown were injected into the right flank of nude mice (Fig.4A). The diameter of the tumor was measured every 3 d to observe tumorigenesis and the average tumor volume was calculated. The mice were sacrificed 20 d after subcutaneous injection, Subsequently, the size and weight of the tumors were determined. The tumor volumes (Fig. 4B) and tumor weights (Fig. 4C) of the nude mice were significantly higher than those of the mice in the control group. Moreover, the tumorigenicity assay of the nude mice and immunohistochemistry showed that CHAF1A knockdown inhibited cell proliferation in the tumor. Ki67 and PCNA immunostaining indicated high proliferative indexes within these control groups (Figs. 4D, 4E). Discussion Increasing evidence suggests that histone chaperones play an important role in tumor development. The anti-silencing function 1A(ASF1A), Aprataxin and PNK-like factor, and the FAcilitates Chromatin Transcription complex were highly expressed in tumor tissues and poor prognosis was predicted(24-26). The histone chaperone CAF-1 is similarly involved in multiple biological processes and plays an irreplaceable role (6-11). CAF-1 has been shown to cause severe loss of cell viability, as well as delay S-phase progression and impaired DNA synthesis in human cells if they are unable to perform poor prognosis of their normal function (12, 27, 28).CHAF1A, as the core component of CAF-1, participated in the progression of various tumor diseases, tumor proliferation, differentiation, and invasiveness. High expression of CHAF1A in a variety of human tumors is strongly associated with poor tumor outcome (14-22). In our previous research, we confirmed by immunohistochemical experiments that CHAF1A and PCNA were highly expressed in CC tissues; moreover, they were positively correlated, and their high expression was associated with poor prognosis (23) . We demonstrated through numerous experiments the biological function of CHAF1A in CC. Finally, we found that overexpressed CHAF1A is involved in tumor cell proliferation and migration, and inhibits apoptosis. We used CRISPR / Cas9 technology for CHAF1A knockdown and then inhibited the activation of the PI3K / Akt signaling pathway. Thus, we confirmed that CHAF1A overexpression promotes tumorigenesis and the progression of cervical cancer. This finding was further confirmed by our tumorigenesis experiments in nude mice. Upon lentiviral knockdown of CHAF1A, the growth of tumor cells was significantly slower than the negative control. The transplanted tumor tissue was removed from the nude mice and the immunohistochemical expression levels of the proliferation markers Ki67 and PCNA were lower in the experimental group than in the control group. To further explore the specific mechanism of CHAF1A in CC, we first confirmed that in the SiHa and HeLa cells, both CHAF1A and PCNA were localized in the nucleus, as determined by cell immunofluorescence experiments. This result suggests, their direct interaction. We precipitated the protein extracted from HeLa cells with CHAF1A and PCNA antibodies and then detected the protein precipitated by the immunoprecipitation (IP) antibody with another antibody. The results showed that both antibodies could precipitate the other protein, confirming the interaction between CHAF1A and PCNA in HeLa cells. This conclusion is consistent with previous studies (29-32). After the PCNA gene expression was knocked out by CRISPR/Cas9 technology, CHAF1A expression was significantly reduced. This decrease suggests that PCNA acts directly on CHAF1A and regulates CHAF1A expression. Previous studies have reported that PCNA-driven DNA synthesis can also attract CAF-1 to the S site of DNA repair, such as nucleotide excision repair (33, 34). Meanwhile, specific PCNA mutation weakens the role of CAF-1 in telomeric silencing in S accharomyces cerevisiae, and PCNA mutations reduce its interaction with CAF-1(32, 35) . Whether they act directly and interact with the target of the other has yet to be determined. Overall, the present study confirmed that the oncogenic role of CHAF1A in CC. CHAF1A overexpression could promote CC cell proliferation and inhibit cell apoptosis, which predicted a poor outcome in CC patients. The mechanism of CHAF1A in CC was thoroughly discussed, which could provide a new direction for precisely targeted therapy for cervical cancer. Meanwhile, the interaction of CHAF1A with PCNA promotes DNA replication and cell proliferation(9). Studies have reported that CHAF1A can be used as a marker for cell quiescence and proliferation(36-38). The combined results of this study and previous studies, indicate that CHAF1A may serve as a biomarker for predicting postoperative recurrence and malignancyin cervical cancer. Declarations Ethics approval and consent to participate Our study was approved by the Ethics Review Board of the First Affiliated Hospital of Chongqing University (number 2021-11). Consent for publication All authors agreed to publish the manuscript. Availability of data and materials The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.. Competing interests The authors declare that they have no competing interests. Funding This study was supported by grants from the Science and Technology Project of Chongqing City (Grant No: estc2016jcyAX0022). Authors ’ contributions YJ(Corresponding author)and LW conceived and designed the experiments and wrote the paper. LY, YL , XLand ZD performed the experiments and statistical analysis. Funding acquisition, YL and YJ. All authors read and approved the final manuscript. Acknowledgements : Not applicable. References Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394-424. Sarris M, Nikolaou K, Talianidis I. Context-specific regulation of cancer epigenomes by histone and transcription factor methylation. Oncogene. 2014;33(10):1207-17. Vogelstein B, Papadopoulos N, Velculescu VE, Zhou S, Diaz LA, Jr., Kinzler KW. Cancer genome landscapes. Science. 2013;339(6127):1546-58. Burgess RJ, Zhang Z. Histone chaperones in nucleosome assembly and human disease. Nat Struct Mol Biol. 2013;20(1):14-22. Vardabasso C, Hasson D, Ratnakumar K, Chung CY, Duarte LF, Bernstein E. Histone variants: emerging players in cancer biology. Cell Mol Life Sci. 2014;71(3):379-404. Doyen CM, Moshkin YM, Chalkley GE, Bezstarosti K, Demmers JA, Rathke C, et al. Subunits of the histone chaperone CAF1 also mediate assembly of protamine-based chromatin. Cell Rep. 2013;4(1):59-65. Hoek M, Stillman B. Chromatin assembly factor 1 is essential and couples chromatin assembly to DNA replication in vivo. Proc Natl Acad Sci U S A. 2003;100(21):12183-8. Kadyrova LY, Blanko ER, Kadyrov FA. CAF-I-dependent control of degradation of the discontinuous strands during mismatch repair. Proc Natl Acad Sci U S A. 2011;108(7):2753-8. Smith CL, Matheson TD, Trombly DJ, Sun X, Campeau E, Han X, et al. A separable domain of the p150 subunit of human chromatin assembly factor-1 promotes protein and chromosome associations with nucleoli. Mol Biol Cell. 2014;25(18):2866-81. Takami Y, Ono T, Fukagawa T, Shibahara K, Nakayama T. Essential role of chromatin assembly factor-1-mediated rapid nucleosome assembly for DNA replication and cell division in vertebrate cells. Mol Biol Cell. 2007;18(1):129-41. Verreault A, Kaufman PD, Kobayashi R, Stillman B. Nucleosome assembly by a complex of CAF-1 and acetylated histones H3/H4. Cell. 1996;87(1):95-104. Reese BE, Bachman KE, Baylin SB, Rountree MR. The methyl-CpG binding protein MBD1 interacts with the p150 subunit of chromatin assembly factor 1. Mol Cell Biol. 2003;23(9):3226-36. Tchenio T, Casella JF, Heidmann T. A truncated form of the human CAF-1 p150 subunit impairs the maintenance of transcriptional gene silencing in mammalian cells. Mol Cell Biol. 2001;21(6):1953-61. Barbieri E, De Preter K, Capasso M, Chen Z, Hsu DM, Tonini GP, et al. Histone chaperone CHAF1A inhibits differentiation and promotes aggressive neuroblastoma. Cancer Res. 2014;74(3):765-74. Barbieri E, De Preter K, Capasso M, Johansson P, Man TK, Chen Z, et al. A p53 drug response signature identifies prognostic genes in high-risk neuroblastoma. PLoS One. 2013;8(11):e79843. Bethke L, Webb E, Murray A, Schoemaker M, Johansen C, Christensen HC, et al. Comprehensive analysis of the role of DNA repair gene polymorphisms on risk of glioma. Hum Mol Genet. 2008;17(6):800-5. Camilo V, Henrique R. Oncogenic potential of CHAF1A in gastric cancer: A novel link with Helicobacter pylori-driven carcinogenesis? EBioMedicine. 2018;38:3-4. Glinsky GV, Glinskii AB, Stephenson AJ, Hoffman RM, Gerald WL. Gene expression profiling predicts clinical outcome of prostate cancer. Journal of Clinical Investigation. 2004;113(6):913-23. Peng H, Du B, Jiang H, Gao J. Over-expression of CHAF1A promotes cell proliferation and apoptosis resistance in glioblastoma cells via AKT/FOXO3a/Bim pathway. Biochem Biophys Res Commun. 2016;469(4):1111-6. Wu Z, Cui F, Yu F, Peng X, Jiang T, Chen D, et al. Up-regulation of CHAF1A, a poor prognostic factor, facilitates cell proliferation of colon cancer. Biochem Biophys Res Commun. 2014;449(2):208-15. Xu M, Jia Y, Liu Z, Ding L, Tian R, Gu H, et al. Chromatin assembly factor 1, subunit A (P150) facilitates cell proliferation in human hepatocellular carcinoma. Onco Targets Ther. 2016;9:4023-35. Zheng L, Liang X, Li S, Li T, Shang W, Ma L, et al. CHAF1A interacts with TCF4 to promote gastric carcinogenesis via upregulation of c-MYC and CCND1 expression. EBioMedicine. 2018;38:69-78. Luo Y, Wang Q, Tian P, Jia Y. [Highly expressed CHAF1A and PCNA are positively associated with malignancy of cervical squamous cell carcinoma]. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2017;33(12):1696-701. Garcia H, Miecznikowski JC, Safina A, Commane M, Ruusulehto A, Kilpinen S, et al. Facilitates chromatin transcription complex is an "accelerator" of tumor transformation and potential marker and target of aggressive cancers. Cell Rep. 2013;4(1):159-73. Liang X, Yuan X, Yu J, Wu Y, Li K, Sun C, et al. Histone Chaperone ASF1A Predicts Poor Outcomes for Patients With Gastrointestinal Cancer and Drives Cancer Progression by Stimulating Transcription of beta-Catenin Target Genes. EBioMedicine. 2017;21:104-16. Majumder A, Syed KM, Mukherjee A, Lankadasari MB, Azeez JM, Sreeja S, et al. Enhanced expression of histone chaperone APLF associate with breast cancer. Mol Cancer. 2018;17(1):76. Nabatiyan A, Krude T. Silencing of chromatin assembly factor 1 in human cells leads to cell death and loss of chromatin assembly during DNA synthesis. Mol Cell Biol. 2004;24(7):2853-62. Ye X, Franco AA, Santos H, Nelson DM, Kaufman PD, Adams PD. Defective S phase chromatin assembly causes DNA damage, activation of the S phase checkpoint, and S phase arrest. Mol Cell. 2003;11(2):341-51. Krawitz DC, Kama T, Kaufman PD. Chromatin assembly factor I mutants defective for PCNA binding require Asf1/Hir proteins for silencing. Mol Cell Biol. 2002;22(2):614-25. Moggs JG, Grandi P, Quivy JP, Jonsson ZO, Hubscher U, Becker PB, et al. A CAF-1-PCNA-mediated chromatin assembly pathway triggered by sensing DNA damage. Mol Cell Biol. 2000;20(4):1206-18. Rolef Ben-Shahar T, Castillo AG, Osborne MJ, Borden KL, Kornblatt J, Verreault A. Two fundamentally distinct PCNA interaction peptides contribute to chromatin assembly factor 1 function. Mol Cell Biol. 2009;29(24):6353-65. Zhang Z, Shibahara K, Stillman B. PCNA connects DNA replication to epigenetic inheritance in yeast. Nature. 2000;408(6809):221-5. Gaillard PHL, Moggs JG, Roche DM, Quivy JP, Becker PB, Wood RD, et al. Initiation and bidirectional propagation of chromatin assembly from a target site for nucleotide excision repair. EMBO J. 1997;16(20):6281-9. Green CM, Almouzni G. Local action of the chromatin assembly factor CAF-1 at sites of nucleotide excision repair in vivo. EMBO J. 2003;22(19):5163-74. Sharp JA, Fouts ET, Krawitz DC, Kaufman PD. Yeast histone deposition protein Asf1p requires Hir proteins and PCNA for heterochromatic silencing. Curr Biol. 2001;11(7):463-73. Polo SE, Theocharis SE, Grandin L, Gambotti L, Antoni G, Savignoni A, et al. Clinical significance and prognostic value of chromatin assembly factor-1 overexpression in human solid tumours. Histopathology. 2010;57(5):716-24. Polo SE, Theocharis SE, Klijanienko J, Savignoni A, Asselain B, Vielh P, et al. Chromatin assembly factor-1, a marker of clinical value to distinguish quiescent from proliferating cells. Cancer Res. 2004;64(7):2371-81. Staibano S, Mascolo M, Rocco A, Lo Muzio L, Ilardi G, Siano M, et al. The proliferation marker Chromatin Assembly Factor-1 is of clinical value in predicting the biological behaviour of salivary gland tumours. Oncol Rep. 2011;25(1):13-22. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-390228","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Primary research","associatedPublications":[],"authors":[{"id":20724122,"identity":"f493129a-f2f4-43a0-b186-b4d065a3880d","order_by":0,"name":"Li Wen","email":"","orcid":"","institution":"Department of Gynecology, the First Affiliated Hospital of Chongqing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Wen","suffix":""},{"id":20724123,"identity":"5f51f069-5d55-4742-b37e-f0d6d51179eb","order_by":1,"name":"Yuli Luo","email":"","orcid":"","institution":"Obstetrics and Gynecology, People's Hospital of Hechuan District, Chongqing Municipality","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yuli","middleName":"","lastName":"Luo","suffix":""},{"id":20724124,"identity":"ece400ae-c572-4f3c-84a1-1d08e2f5d17a","order_by":2,"name":"Zhaoning Duan","email":"","orcid":"","institution":"Department of Gynecology, the First Affiliated Hospital of Chongqing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhaoning","middleName":"","lastName":"Duan","suffix":""},{"id":20724125,"identity":"590e9f64-728e-4f22-93cc-6c9e7cea01a4","order_by":3,"name":"Xiaoge Li","email":"","orcid":"","institution":"Department of Gynecology, the First Affiliated Hospital of Chongqing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaoge","middleName":"","lastName":"Li","suffix":""},{"id":20724126,"identity":"55027fb7-a4bc-4c50-9414-bf5ef520f1c0","order_by":4,"name":"Ying Jia","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABIUlEQVRIie2Pv0vDQBTHn5xclgeuGWz7L1wJpA6lf8uFQrLYSRBBrYVCsojOgn/EifhrCxyYJX9Aikuz3NTBSeqkF2PqcjSrw304jse99+HdF8Bi+YfszPXFAboM6mJ/05m1KF6tcMBWpSEQUK9pV0hClFs+n0dPTqKW5XqE4MiHe4RhR6RELY0fo74b5Nnk5TIfMM7HCBgevyGEnkjpgJmzaCV+nYjikLqcEwQXfa3IQKRIXaPifFRKxIpIaeWiUb62KFhtOeOs4L5WZKOk25SjgyBO+yKvsoQZUp1lccvG3o3UMQ1K/zq7W3zG0x7LElWuh6fdPUc+FquTUecqmyujMoNd/S6rmsLvzX4OEMO8pqc77wDTPwXqeYvFYrFs+AYtxWFvp9PP2AAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-1602-3122","institution":"Department of Gynecology, the First Affiliated Hospital of Chongqing Medical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Jia","suffix":""}],"badges":[],"createdAt":"2021-04-03 19:45:58","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-390228/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-390228/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":7917796,"identity":"c2d09bba-63b7-4608-a01e-7163b6a57f41","added_by":"auto","created_at":"2021-04-12 16:40:26","extension":"tif","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2728441,"visible":true,"origin":"","legend":"CHAF1A knockdown suppresed cervical cancer cell proliferation. (A)The expression of CHAF1A mRNA in cervical cancer cell was significantly higher than that inhuman normal immortalized epithelial cells (P \u003c0.0001). (B) Real time PCR analysis of CHAF1A mRNA in SiHa and HeLa cells infected with EGFP shRNA and CHAF1A shRNA revealed significant levels of CHAF1A downregulation (P \u003c0.05). (C)Western blot analysis of CHAF1A protein expression in SiHa and HeLa cells after lentiviral infection. (D)After CHAF1A knowndown , cell proliferation was significantly suppressed. The number of cell clones formed was also significantly reduced in the CHAF1A shRNA group relative to that in the experimental control group (P \u003c0.01).(E)Hela and SiHa cell proliferation was measured by CCK8 assay.(F)RTCA showed that the proliferation index of the control group was significantly higher than that of the knockdown group.(F) Using flow cytometry to analyze the effects of high CHAF1A expression on the cell cycle, we found that CHAF1A knockdown significantly induced G1 arrest in SiHa and HeLa cells .****represents P \u003c 0.0001,*** represents P \u003c 0.001, and ** represents P \u003c 0.01.","description":"","filename":"Fig1..tif","url":"https://assets-eu.researchsquare.com/files/rs-390228/v1/dcb5e46c1a70a03668989b01.tif"},{"id":7918044,"identity":"1302b16e-cf19-4eea-959e-c8bd781e3f6f","added_by":"auto","created_at":"2021-04-12 16:43:27","extension":"tif","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":9179016,"visible":true,"origin":"","legend":"Knockdown of CHAF1A affects the apoptosis and invasive ability of cervical cancer cells. (A) The effect on apoptosis after CHAF1A knockdown was examined by Annexin V / PI staining and flow cytometry. This histogram shows the statistical apoptosis rate in (B). The calculation was as follows: Apoptosis rate = Q1-LR + Q1-UR(P \u003c 0.05). (C) An invasive wound healing assay was performed to evaluate the influence of CHAF1A on cell migration ability. This technique showed that CHAF1A silencing significantly delayed the mobility of SiHa and HeLa cells (magnification, ×40). The histogram indicated a statistically significant difference (P \u003c0.05). (D) Cell migration in real time was further analyzed using the xCELLigence RTCA system.","description":"","filename":"Fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-390228/v1/0f198931d90228f4c5b2417b.tif"},{"id":7918042,"identity":"2f5330a2-ecb6-41ab-9b2e-4426981e29af","added_by":"auto","created_at":"2021-04-12 16:43:27","extension":"tif","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3340757,"visible":true,"origin":"","legend":"CHAF1A–PCNA interaction promotes cell proliferation and inhibits apoptosis. (A) CHAF1A is co-localized with PCNA in SiHa and HeLa cells. They are all localized in the nucleus. (B) PCNA is co-immunoprecipitated by CHAF1A, which is then \nco-immunoprecipitated by PCNA. The results are confirmed by Western blot experiments. (C) Real-time PCR analysis of PCNA mRNA expression in SiHa and HeLa cells infected with the EGFP shRNA and PCNA shRNA lentivirus. The mRNA level is significantly reduced (P \u003c 0.05). CHAF1A protein expression also decreased after PCNA knockdown. As shown in (D). (F) CHAF1A promotes cell proliferation and inhibits apoptosis via the PI3K/AKT/FoXO1 pathway in both SiHa and HeLa cells.\n","description":"","filename":"Fig3.tif","url":"https://assets-eu.researchsquare.com/files/rs-390228/v1/ccad1b182b8e796beb83826c.tif"},{"id":7918045,"identity":"dc404d0e-946d-4f11-8f77-ddc833bb3dd5","added_by":"auto","created_at":"2021-04-12 16:43:28","extension":"tif","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":5930632,"visible":true,"origin":"","legend":"Tumor-promoting effect of CHAF1A on a human cervical cancer (CC) HeLa cell xenograft model. (A) Nude mice transplanted with human CC HeLa cell xenografts are randomly divided into 2 groups; the right forelimb is administered with HeLa-transfected negative control cells and sh-CHAF1 A-transfected cells via axillary injection. Representative photographs of tumor xenograft nude mice. (B) Representative photographs of the tumors 3 weeks after injection. (C) Photographs of the tumor volume, expressed as mean (+SD) (n=5 for each group). (C) Histopathological examination of tumor tissues; expression of Ki67 and PCNA proliferation-related markers, as determined by immunohistochemistry.","description":"","filename":"Fig4.tif","url":"https://assets-eu.researchsquare.com/files/rs-390228/v1/ff309db2e14c96e990510e41.tif"},{"id":13685473,"identity":"8ea2f0d6-21b8-47e8-9d75-478df36accc9","added_by":"auto","created_at":"2021-09-17 12:12:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7706364,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-390228/v1/c2ba2f0d-8dfe-4595-acf4-68389e9135c3.pdf"}],"financialInterests":"","formattedTitle":"CHAF1A–PCNA interaction promotes cervical cancer progression via the PI3K/AKT/FoxO1 signaling pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCervical cancer (CC) is one of the most common malignant tumors worldwide. It is the second most common malignant tumor in females(1). However, despite significant advancements in\u0026nbsp;CC therapies, such as\u0026nbsp;surgical\u0026nbsp;resection, chemotherapy, and radiotherapy,\u0026nbsp;the\u0026nbsp;prognoses\u0026nbsp;of\u0026nbsp;patients with\u0026nbsp;CC\u0026nbsp;remain poor. CC\u0026nbsp;continues to be a major cause\u0026nbsp;of\u0026nbsp;death from cancer worldwide \u003csup\u003e(1)\u003c/sup\u003e. Persistent human papillomavirus infectionis the main etiological factor for CC development. CC\u003c/p\u003e\n\u003cp\u003eis\u0026nbsp;a\u0026nbsp;multistep process involving\u0026nbsp;the\u0026nbsp;deregulation\u0026nbsp;of\u0026nbsp;multiple genes. The mechanisms of carcinogenesis are quite complex, and both genetic and epigenetic alterations can lead to carcinogenesis. In the last decade of cancer research, abnormalities in epigenetics have been consistently observed. Aberrations of epigenetics in cancer mainly involve aberrant histone modifications and altered DNA methylation (2, 3) . Accumulating evidence suggests that cancer initiation, progression and the involvement of histone variants and their partners are closely linked (4, 5) . CAF-1 is a trimeric complex protein that includes P150, P60, and p48. CAF-1 is important for chromatin assembly during DNA synthesis, and interfering with CAF expression may affect DNA synthesis, leading to DNA damage or even programmed cell death (6-11). As the largest subunit of CAF-1 and a major component exercising biological functions, CHAF1A plays a very important role in DNA mismatch repair, epigenetic regulation of embryonic stem cells, and diverse biological behaviors such as cell division and, proliferation, among others (7, 11-13) .\u003c/p\u003e\n\u003cp\u003eAn increasing number of studies have confirmed that the dysregulated expression of CHAF1A\u003c/p\u003e\n\u003cp\u003eis associated with the development and progression of several tumors, such as: glioblastoma,\u003c/p\u003e\n\u003cp\u003ehepatocellular carcinoma, colorectal cancer, and gastric cancer (14-22). Our previous study verified its high expression in CC by immunohistochemistry and association with the poor prognosis of CC (23). However, the specific biological functions and mechanisms of action of CHAF1A in cervical cancer have not been reported. In the present study, we clarfied that CHAF1A could promote cell proliferation in CC, thereby inhibiting apoptosis and enhancing migration. Moreover, CHAF1A and proliferating cell nuclear antigen (PCNA) interacted to promote CC\u003c/p\u003e\n\u003cp\u003eprogression. PCNA can regulate CHAF1A expression.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e2.1 Cell culture\u003c/p\u003e\n\u003cp\u003eCaksi, HaCat and C33A cells were purchased from the\u0026nbsp;Cell\u0026nbsp;Bank of the Chinese Academy of Sciences in 2018. The CC cell lines HeLa and SiHa cells were purchased from Shanghai Jikai Gene (Shanghai, CHN). HeLa cells were maintained in DMEM, supplemented with 10% fetal bovine serum (FBS); HaCat cells were cultured in the RPMI-1640 medium; and SiHa, C33A, and Caksi were cultured in MEM with 10% FBS. All cells were cultured with 1% penicillin\u0026ndash;streptomycin antibiotics (Beyotime, China).\u003c/p\u003e\n\u003cp\u003e2.2 Lentivirus-mediated assay\u003c/p\u003e\n\u003cp\u003eLentivirus sh-CHAF1A was purchased from Shanghai Genechem Co. Ltd. (Shanghai, China). PCNA lentiviruses and vectors were supplied by Genecopoeia (GeneCopoeia, Rockville, MD, USA). The following were the shRNA target sequences: 5\u0026prime;- ACCCGGAATGCAGATATTT -3\u0026prime; for CHAF1A. The negative control was 5\u0026prime;- TTCTCCGAACGTGTCACGT -3\u0026prime;. The PCNA control lentiviral(sh-ctrl:5\u0026prime;-CGCTAGTATTTGAAGCACCTCAAGAGGGTGCTTCAAATACTAGCGCC3\u0026prime;); Sh-PCNA5\u0026prime;GCTTCGCGCCGTAGTCTTATCAAGAGTAAGACTACGGCGCGAAGC3\u0026prime;.\u003c/p\u003e\n\u003cp\u003eThe multiplicity of infection was determined before lentiviral transfection. The cells were passaged and seeded at 2 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells / well in 6 well plates. After the cells were plated for 24 h, the original medium was discarded and the fresh medium containing lentiviral particlees and polybrene was added (the concentration of polybrene used was in accordance with the amount recommended by the manufacture).The medium was then replaced with completely fresh medium after 24 h.After the cells were allowed recover and grow further for 24 h, they were switched to 2.5 ug/mL of puromycin for week-long culture and selection of cells successfully transfected with the lentivirus.The culture was further maintained for a week with purinomycin, and the culture medium was replaced with the complete medium.\u003c/p\u003e\n\u003cp\u003eThe cells that were successfully transfected with lentiviral particles were subcultured for subsequent experiments.\u003c/p\u003e\n\u003ch3\u003e2.3 RT-PCR\u003c/h3\u003e\n\u003cp\u003eRT-PCR was performed using a RT-PCR kit (Takara, Shiga, Japan) in accordance with the instructions provided by manufacturer. Total RNAs from cells were extracted using TRIzol Reagent, and then reversely transcribed into cDNA by using the Prime Script RT Reagent Kit (TaKaRa), RT-qPCR was performed with the S1000 Real-Time System (Bio-Rad, Hercules, California, USA). SYBR Green (SYBR Premix Ex Taq\u003csup\u003eTM\u003c/sup\u003e II; TaKaRa) was used for fluorescent quantification. The following cycling conditions were used for RT-PCR: pre-denaturation (95 \u0026deg;C, for 30 s), denaturation ,95 \u0026deg;C, for 5 s, and 40 cycles; annealing 60\u0026deg;C for 30 s), The relative mRNA expression was calculated using the 2\u0026minus;∆∆Ct method. All RT-PCR results were repeated at least 3 times. The primers used are listed in Table\u0026nbsp;\u003ca href=\"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6433645/table/bph14591-tbl-0001/\"\u003e1\u003c/a\u003e.\u003c/p\u003e\n\u003cp\u003e2.4 Flow cytometry\u003c/p\u003e\n\u003cp\u003eThe effects of CHAF1A knockdown on cell cycle and apoptosis were assessed by flow cytometry. When the total number of cells reached 1.0 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e in the culture flask, the cells were trypsinized. Cells were collected after centrifugation at 1000g for 5 min, washed three times with PBS, and resuspended in 100 \u0026micro;L of PBS solution. Subsequently 500\u0026micro;L pre-cooled 75% alcohol in a lysis buffer containing 1 mg / mL RNase, 0.05% Triton X-100, 1 mg / mL. RNase, and 50 mg / mL propidium iodide (Sigma, Aldrich, St. Louis, MO, USA) was fixed in their solution, incubated in the dark at room temperature for 30 min, and immediately analyzed using\u003c/p\u003e\n\u003cp\u003ea FACS Calibur instrument (Becton Dickinson, CA, USA). Apoptotic samples were resuspended in 500 \u0026mu;L of PBS without ethanol. The cell instrument was analyzed and the results were recorded.\u003c/p\u003e\n\u003ch3\u003e2.5 Colony Formation Assay\u003c/h3\u003e\n\u003cp\u003eCells (500 cells/well) were seeded in a 6- well plate and then incubated for the next 14 d until cell colonies appeared. The cells were subsequently fixed with\u0026nbsp;4% paraformaldehyde for 15 min and then stained with Giemsa for 20 min. The rate cell clone formation was ultimately calculated.\u003c/p\u003e\n\u003cp\u003e2.6 CCK8 Assay\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Cell Counting Kit-8 (CCK8) (Boiss, Beijing, China) was used to determine cell viability. The cells were counted after digestion and the concentration was adjusted to 2000 cells / 100 UL, Two sets of control and experimental samples with five replicate wells per set were then\u003c/p\u003e\n\u003cp\u003eset up. The plates were seeded for 24, 48, 72, 96, and 120 h and left to stand for 1 h, in accordance with the instructions provided by the manufacturer, The 450 nm was then determined.\u003c/p\u003e\n\u003ch3\u003e2.7 Real-time cell analysis (Proliferation)\u003c/h3\u003e\n\u003ch3\u003eBaseline values were first verified by adding 100 UL of the complete medium per well onto a dedicated 16 well electronic plate.The HeLa and SiHa cells were digested, centrifuged, resuspended, and seeded onto a baseline 16 well electronic plate containing 5000 cells / well with gold microelectrode arrays attached.The cell index was monitored using the xCELLigence system (Roche, Mannheim, Germany) for 96 h with measurements taken every 15 min.The results were analyzed using the RTCA software (version 2.0).\u003c/h3\u003e\n\u003ch3\u003e2.8 Cell Migration Assay\u003c/h3\u003e\n\u003ch3\u003eCell migration was quantified using the in vitro scratch wound assay. HeLa and Siha cells (1\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e6\u003c/sup\u003e/well) were seeded in a 6-well plate. After adhesion, a linear wound was made using a 10 \u0026micro;L micropipette tip. The scratched wells were washed whith PBSseveral times to remove the detached debris caused by scratching. Images of the wounds (0, 24 h) were taken with a light microscope (20\u0026times; magnification). After 24 h images were again recorded. The\u0026nbsp;number\u0026nbsp;of\u0026nbsp;migrated\u0026nbsp;cells\u0026nbsp;was then determined.\u003c/h3\u003e\n\u003cp\u003e2.9 Real-time cell analysis (Migration)\u003c/p\u003e\n\u003cp\u003eThe baseline values were determined. The mediumwas placed in the lower chamber of a 16-well electronic plate, and a cell culture medium containing 10% FBS was added. The upper chamber was mounted, and 30 \u0026micro;L of the serum-free medium in the upper chamber electronic well plate for 1 h at 37 \u0026deg;C and 5% CO2 incubator. 100 UL of serum-free medium (100 UL containing 50000 cells) was seeded into each well of the upper chamber of the cell migration plate. The cell migration index was recorded every 15 min for approximately 90 h.\u003c/p\u003e\n\u003ch3\u003e2.10 Western blot analysis\u003c/h3\u003e\n\u003cp\u003eProteins were extracted from cervical cancer cells and prepared using RIPA lysis and an extraction buffer was supplemented with a protease and phosphatase inhibitor cocktail for 30\u0026nbsp;min on ice. Cell lysates were ultrasonically disrupted three times for 10 s each, followed by centrifugation at 12000 g for 15 min at 4 \u0026deg;C. Supernatants were collected, denatured by boiling after the addition of the Laemmli sample buffer without a reducing agent, and then assayed. Protein samples after quantification were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). The membranes were then blocked and.then incubated with a specific primary antibody diluent in a room at 4 \u0026deg;C overnight. Details of the primary antibodies are listed in Table 1. The membranes were then washed with TBST 3 times and then incubated with a secondary antibody (1:7500 dilution) for 1 h. The blots were washed 3 times in TBST.\u0026nbsp;The immunoblots were detected with an ECL kit and visualized using an imaging system (Fusion, Germany).\u003c/p\u003e\n\u003cp\u003e2.11 Cell immunofluorescence\u003c/p\u003e\n\u003ch3\u003eThe CC cell lines SiHa and HeLa were seeded in 24-well plates. The well surfaces were covered with 13 mm glass coverslips. Immunofluorescence assay was performed when the cell confluence reached 90%. The cell culture medium was discarded. The cells were washed three times with PBS, fixed in 4% paraformaldehyde for 10 min at room temperature, washed again with PBS three times , permeabilized with 0.3% Triton X-100 for 10 min, and blocked with 5% goat serum for 30min. The samples were incubated with the primary antibody (mouse polyclonal PCNA antibody, 1:2400; rabbit polyclonal CHAF1A antibody, 1:200) overnight in a room at 4 \u0026deg;C. The samples were washed 3 times with PBS solution and then incubated in the dark at room temperature for Alexa Fluor 488 conjugated Goat anti rabbit (Abcam, ab150115) and Alexa Fluor 647 conjugated goat anti mouse antibodies (Abcam, 150077) (both 1:1000). DAPI containing fluorescence quenched coverslips were added and then observed by confocal laser scanning microscopy.\u003c/h3\u003e\n\u003ch3\u003e2.12 Co-immunoprecipitation\u003c/h3\u003e\n\u003cp\u003eProtein immunoblotting and co-immunoprecipitation were performed to investigate the interactions of the proteins. Protein interaction was verified using the Pierce Co Immunoprecipitation Kit (Thermo Scientific, 26149). Specific experimental procedures were conducted, strictly following the instructions provided in the kit. Cells were lysed using a kit-specific cell lysate for 15 min, sonicated for 10 s three times, and centrifuged at 12000 \u0026times; g for 10 min. Upper protein lysate was aspirated, and the protein was incubated with 10 \u0026mu;g corresponding antibody overnight at 4 \u0026deg; C. About 50 \u0026mu; g of a mock antibody (Rabbit Anti mouse IgG) was used as a control. The next day the resin bound to the protein was washed 4 times following the instructions provided in the kit. Specifically, 50 \u0026mu;L of the eluate was used. Eluted proteins were immediately boiled and denatured for Western blot analysis.\u003c/p\u003e\n\u003ch3\u003e2.11 Tumor xenografts\u003c/h3\u003e\n\u003cp\u003eTen BALB/c female nude mice ((aged 5\u0026nbsp;weeks, with an average weight of 20\u0026nbsp;g).) were provided by China Chongqing Ensville Biotechnology Co. Ltd. The mice were divided into two groups consisting of five mice each .All mice were given water and chow \u003cem\u003ead libitum\u003c/em\u003e. Control cells and cells with stable CHAF1A knockdown (shCHAF1A) were suspended in cold PBS.The right forelimb of each nude mouse was subcutaneously injected with 1.0 \u0026times; 106 cells.\u003c/p\u003e\n\u003cp\u003eOn Day 5 of modeling, the width (W), weight and length (L), of the tumor were measured for 3 d (volume [V]\u0026nbsp;=\u0026nbsp;W\u003csup\u003e\u0026nbsp;2\u003c/sup\u003e\u0026nbsp;\u0026times;\u0026nbsp;L\u0026nbsp;\u0026times;\u0026nbsp;0.52). The nude mice were sacrificed using 2% isoflurane anesthesia.High concentration of CO2 asphyxia led to death by asphyxiation 21 d after injection, and the transplanted tumors were removed. Part of the tumor was sent for immunohistochemistry. The research protocol for this animal study conformed to the ethical guidelines in laboratory animal research and the Declaration of Helsinki.A approval was obtained from the ethics committee of the First Affiliated Hospital of Chongqing Medical University (accession number 2021-11).\u003c/p\u003e\n\u003cp\u003e2.12 Statistical analysis\u003c/p\u003e\n\u003cp\u003eAll statistical analyses were performed using GraphPad Prism 7.0. The data are expressed as\u003c/p\u003e\n\u003cp\u003emean \u0026plusmn; standard deviation (SD). Between-group comparisons were conducted using a 2-tailed paired Student t-test to test for statistical significance. Statistical differences between groups were determined using\u0026nbsp;one-way\u0026nbsp;ANOVA. \u003cem\u003eP\u003c/em\u003e \u0026le; 0.05 was considered statistically significant in all cases. All experiments were performed in triplicate.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e3.1 \u003cstrong\u003eKnockdown of CHAF1A inhibits cervical cancer cell proliferation \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression of CHAF1A in cervical cancer cell lines was significantly higher than that in HaCat cells(\u003cem\u003eP\u003c/em\u003e <0.05,Fig.1A).To evaluate the functional proliferation of CHAF1A overexpression in CC, we performed CHAF1A knockdown in CC cells and evaluated the cellular outcomes.\u0026nbsp;CHAF1A cells were depleted in SiHa and HeLa cells by RNA interference, and CHAF1A knockdown efficiency after lentiviral transfection was verified by qRT PCR and Western blot analysis. Knockdown efficacy in both SiHa and HeLa cells is shown in Figs. 1.B and 1.C. The stable transfected cells were selected for the subsequent experiment. Cell proliferation was observed using the CCK8 assay. The reduced CHAF1A expression in the HeLa and SiHa cells was found to inhibit cell proliferation. Moreover, the colony formation assay and RTCA presented a trend similar to that of the CCK8 assay after CHAF1A knockdown (\u003cem\u003eP \u003c/em\u003e\u0026lt;0.05, Figs. 1D\u0026ndash;1F).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 Induction of cell cycle arrest and promotion of apoptosis in cervical cancer cells upon inhibition of CHAF1A expression \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe further validate the biological function of CHAF1A in CC cells by conducting additional\u003c/p\u003e\n\u003cp\u003ein vitro experiments. The cell cycle was analyzed by flow cytometry. CHAF1A knockdown resulted in a significant increase in the percentage of cells in the peak G1 / G0 phase and a decrease in the percentage of cells in peak S phases. CHAF1A inhibition was found to induce G1 arrest in CC cells (Fig. 1G). The number of apoptotic cells in the cells of the CHAF1A knockdown group was significantly higher than that in the cells of the control group (Figs.2A,2B). On the basis of these findings, we speculated that CHAF1A could regulate the abnormal proliferation of CC by interferingwith the cell cycle to inhibit apoptosis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 CHAF1A promotes the\u0026nbsp;migration\u0026nbsp;of cervical cancer\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo examine the migratory properties of SiHa and HeLa, we conducted a scratch wound assay. Using a scratch assay, we found that CHAF1A silencing resulted in decreased cell migration (Figs. 2C, 2D). Meanwhile, RTCA assays were used to examine SiHa and HeLa cell migration after transfection with the sh-CHAF1A. The results indicated that the migration of SiHa and HeLa cells was inhibited by CHAF1A knockdown (Fig.\u0026nbsp;2E).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4 CHAF1A promotes cervical cancer progression via the PI3K / Akt signaling pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eActivation of the PI3K / Akt signaling pathway mainly promotes cell growth and survival.We detected the proteins related to PI3K / Akt / FoxO1 by Western blot assay.The results showed that the phosphorylated PI3K (tyr458) and Akt (ser473) levelswere decreased after CHAF1A knockdown,whereas PI3K and Akt levels remained unchanged in the total protein relative to the control group (Fig. 3E).This finding suggested that the high expression of CHAF1A could induce CC cell proliferation and invasionvia the PI3K / Akt pathway.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5 CHAF1A interaction with PCNA promotes\u0026nbsp;tumor\u0026nbsp;progression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLocalization was determined by confocal\u0026nbsp;immunofluorescence\u0026nbsp;microscopy, which revealed the colocalization of CHAF1A and PCNA proteins in\u0026nbsp;the\u0026nbsp;nucleus\u0026nbsp;(Fig. 3A). These proteins were localized in\u0026nbsp;the\u0026nbsp;nucleus\u0026nbsp;(Fig.\u0026nbsp;3A), suggesting that\u0026nbsp;they\u0026nbsp;could interact\u0026nbsp;with each other in\u0026nbsp;the\u0026nbsp;nucleus. This interaction was confirmed by co-immunoprecipitation. We first co-precipitated the PCNA protein with the CHAF1A antibody (Fig. 3B), and the CHAF1A protein was precipitated with PCNA (Fig. 3B). We also found that CHAF1A expression was decreased after PCNA knockdown, which was verified by both mRNA and protein levels (Figs. 3C, 3D).\u003c/p\u003e\n\u003ch3\u003e3.6 Effects of CHAF1A on tumorigenicity \u003cem\u003ein vivo\u003c/em\u003e\u003c/h3\u003e\n\u003cp\u003eTo further validate the biological role of CHAF1A in vivo, HeLa cells with control and lentiviral knockdown were injected into the right flank of nude mice (Fig.4A). The diameter of the tumor was measured every 3 d to observe tumorigenesis and the average tumor volume was calculated. The mice were sacrificed 20 d after subcutaneous injection, Subsequently, the size and weight of the tumors were determined. The tumor volumes (Fig. 4B) and tumor weights (Fig. 4C) of the nude mice were significantly higher than those of the mice in the control group. Moreover, the tumorigenicity assay of the nude mice and immunohistochemistry showed that CHAF1A knockdown inhibited cell proliferation in the tumor. Ki67\u0026nbsp;and PCNA immunostaining indicated high proliferative indexes within these control groups (Figs. 4D, 4E).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIncreasing evidence suggests that histone chaperones play an important role in tumor development. The anti-silencing function 1A(ASF1A), Aprataxin and PNK-like factor, and the FAcilitates Chromatin Transcription complex were highly expressed in tumor tissues and poor prognosis was predicted(24-26). The histone chaperone CAF-1 is similarly involved in multiple biological processes and plays an irreplaceable role (6-11). CAF-1 has been shown to cause severe loss\u003c/p\u003e\n\u003cp\u003eof cell viability, as well as delay S-phase progression and impaired DNA synthesis in human\u003c/p\u003e\n\u003cp\u003ecells if they are unable to perform poor prognosis of their normal function (12, 27, 28).CHAF1A, as the core component of CAF-1, participated in the progression of various tumor diseases, tumor proliferation, differentiation, and invasiveness. High expression of CHAF1A in a variety of human tumors is strongly associated with poor tumor outcome (14-22). In our previous research, we confirmed by immunohistochemical experiments that CHAF1A and PCNA were highly expressed in CC tissues; moreover, they were positively correlated, and their high expression was associated with poor prognosis (23) . We demonstrated through numerous experiments the biological function of CHAF1A in CC. Finally, we found that overexpressed CHAF1A is involved in tumor cell proliferation and migration, and inhibits apoptosis. We used CRISPR / Cas9 technology for CHAF1A knockdown and then inhibited the activation of the PI3K / Akt signaling pathway. Thus, we confirmed that CHAF1A overexpression promotes tumorigenesis and the progression of cervical cancer. This finding was further confirmed by our tumorigenesis experiments in nude mice. Upon lentiviral knockdown of CHAF1A, the growth of tumor cells was significantly slower than the negative control. The transplanted tumor tissue was removed from the nude mice and the immunohistochemical expression levels of the proliferation markers Ki67 and PCNA were lower in the experimental group than in the control group. To further explore the specific mechanism of CHAF1A in CC, we first confirmed that in the SiHa and HeLa cells, both CHAF1A and PCNA were localized in the nucleus, as determined by cell immunofluorescence experiments. This result suggests, their direct interaction. We precipitated the protein extracted from HeLa cells with CHAF1A and PCNA antibodies and then detected the protein precipitated by the immunoprecipitation (IP) antibody with another antibody. The results showed that both antibodies could precipitate the other protein, confirming the interaction between CHAF1A and PCNA in HeLa cells. This conclusion is consistent with previous studies (29-32). After the PCNA gene expression was knocked out by CRISPR/Cas9 technology, CHAF1A expression was significantly reduced. This decrease suggests that PCNA acts directly on CHAF1A and regulates CHAF1A expression. Previous studies have reported that PCNA-driven DNA synthesis can also attract CAF-1 to the S site of DNA repair, such as nucleotide excision repair (33, 34). Meanwhile, specific PCNA mutation weakens the role of CAF-1 in telomeric silencing in \u003cem\u003eS\u003c/em\u003eaccharomyces cerevisiae, and PCNA mutations reduce its interaction with CAF-1(32, 35) . Whether they act directly and interact with the target of the other has yet to be determined.\u003c/p\u003e\n\u003cp\u003eOverall, the present study confirmed that the oncogenic role of CHAF1A in CC. CHAF1A overexpression could promote CC cell proliferation and inhibit cell apoptosis, which predicted a\u003c/p\u003e\n\u003cp\u003epoor outcome in CC patients. The mechanism of CHAF1A in CC was thoroughly discussed,\u003c/p\u003e\n\u003cp\u003ewhich could provide a new direction for precisely targeted therapy for cervical cancer. Meanwhile, the interaction of CHAF1A with PCNA promotes DNA replication and cell proliferation(9). Studies have reported that CHAF1A can be used as a marker for cell quiescence and proliferation(36-38). The combined results of this study and previous studies, indicate that CHAF1A may serve as a biomarker for predicting postoperative recurrence and malignancyin cervical cancer.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur study was approved by the Ethics Review Board of the First Affiliated Hospital of Chongqing University (number 2021-11).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors agreed to publish the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request..\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by grants from the Science and Technology Project of Chongqing City (Grant No: estc2016jcyAX0022).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u003c/strong\u003e\u003cstrong\u003e\u0026rsquo;\u003c/strong\u003e\u003cstrong\u003econtributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYJ(Corresponding author)and LW conceived and designed the experiments and wrote the paper. LY, YL , XLand ZD performed the experiments and statistical analysis. Funding acquisition, YL and YJ.\u003c/p\u003e\n\u003cp\u003eAll authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394-424.\u003c/li\u003e\n\u003cli\u003eSarris M, Nikolaou K, Talianidis I. Context-specific regulation of cancer epigenomes by histone and transcription factor methylation. Oncogene. 2014;33(10):1207-17.\u003c/li\u003e\n\u003cli\u003eVogelstein B, Papadopoulos N, Velculescu VE, Zhou S, Diaz LA, Jr., Kinzler KW. Cancer genome landscapes. Science. 2013;339(6127):1546-58.\u003c/li\u003e\n\u003cli\u003eBurgess RJ, Zhang Z. Histone chaperones in nucleosome assembly and human disease. Nat Struct Mol Biol. 2013;20(1):14-22.\u003c/li\u003e\n\u003cli\u003eVardabasso C, Hasson D, Ratnakumar K, Chung CY, Duarte LF, Bernstein E. Histone variants: emerging players in cancer biology. Cell Mol Life Sci. 2014;71(3):379-404.\u003c/li\u003e\n\u003cli\u003eDoyen CM, Moshkin YM, Chalkley GE, Bezstarosti K, Demmers JA, Rathke C, et al. Subunits of the histone chaperone CAF1 also mediate assembly of protamine-based chromatin. Cell Rep. 2013;4(1):59-65.\u003c/li\u003e\n\u003cli\u003eHoek M, Stillman B. Chromatin assembly factor 1 is essential and couples chromatin assembly to DNA replication in vivo. Proc Natl Acad Sci U S A. 2003;100(21):12183-8.\u003c/li\u003e\n\u003cli\u003eKadyrova LY, Blanko ER, Kadyrov FA. CAF-I-dependent control of degradation of the discontinuous strands during mismatch repair. Proc Natl Acad Sci U S A. 2011;108(7):2753-8.\u003c/li\u003e\n\u003cli\u003eSmith CL, Matheson TD, Trombly DJ, Sun X, Campeau E, Han X, et al. A separable domain of the p150 subunit of human chromatin assembly factor-1 promotes protein and chromosome associations with nucleoli. Mol Biol Cell. 2014;25(18):2866-81.\u003c/li\u003e\n\u003cli\u003eTakami Y, Ono T, Fukagawa T, Shibahara K, Nakayama T. Essential role of chromatin assembly factor-1-mediated rapid nucleosome assembly for DNA replication and cell division in vertebrate cells. Mol Biol Cell. 2007;18(1):129-41.\u003c/li\u003e\n\u003cli\u003eVerreault A, Kaufman PD, Kobayashi R, Stillman B. Nucleosome assembly by a complex of CAF-1 and acetylated histones H3/H4. Cell. 1996;87(1):95-104.\u003c/li\u003e\n\u003cli\u003eReese BE, Bachman KE, Baylin SB, Rountree MR. The methyl-CpG binding protein MBD1 interacts with the p150 subunit of chromatin assembly factor 1. Mol Cell Biol. 2003;23(9):3226-36.\u003c/li\u003e\n\u003cli\u003eTchenio T, Casella JF, Heidmann T. A truncated form of the human CAF-1 p150 subunit impairs the maintenance of transcriptional gene silencing in mammalian cells. Mol Cell Biol. 2001;21(6):1953-61.\u003c/li\u003e\n\u003cli\u003eBarbieri E, De Preter K, Capasso M, Chen Z, Hsu DM, Tonini GP, et al. Histone chaperone CHAF1A inhibits differentiation and promotes aggressive neuroblastoma. Cancer Res. 2014;74(3):765-74.\u003c/li\u003e\n\u003cli\u003eBarbieri E, De Preter K, Capasso M, Johansson P, Man TK, Chen Z, et al. A p53 drug response signature identifies prognostic genes in high-risk neuroblastoma. PLoS One. 2013;8(11):e79843.\u003c/li\u003e\n\u003cli\u003eBethke L, Webb E, Murray A, Schoemaker M, Johansen C, Christensen HC, et al. Comprehensive analysis of the role of DNA repair gene polymorphisms on risk of glioma. Hum Mol Genet. 2008;17(6):800-5.\u003c/li\u003e\n\u003cli\u003eCamilo V, Henrique R. Oncogenic potential of CHAF1A in gastric cancer: A novel link with Helicobacter pylori-driven carcinogenesis? EBioMedicine. 2018;38:3-4.\u003c/li\u003e\n\u003cli\u003eGlinsky GV, Glinskii AB, Stephenson AJ, Hoffman RM, Gerald WL. Gene expression profiling predicts clinical outcome of prostate cancer. Journal of Clinical Investigation. 2004;113(6):913-23.\u003c/li\u003e\n\u003cli\u003ePeng H, Du B, Jiang H, Gao J. Over-expression of CHAF1A promotes cell proliferation and apoptosis resistance in glioblastoma cells via AKT/FOXO3a/Bim pathway. Biochem Biophys Res Commun. 2016;469(4):1111-6.\u003c/li\u003e\n\u003cli\u003eWu Z, Cui F, Yu F, Peng X, Jiang T, Chen D, et al. Up-regulation of CHAF1A, a poor prognostic factor, facilitates cell proliferation of colon cancer. Biochem Biophys Res Commun. 2014;449(2):208-15.\u003c/li\u003e\n\u003cli\u003eXu M, Jia Y, Liu Z, Ding L, Tian R, Gu H, et al. Chromatin assembly factor 1, subunit A (P150) facilitates cell proliferation in human hepatocellular carcinoma. Onco Targets Ther. 2016;9:4023-35.\u003c/li\u003e\n\u003cli\u003eZheng L, Liang X, Li S, Li T, Shang W, Ma L, et al. CHAF1A interacts with TCF4 to promote gastric carcinogenesis via upregulation of c-MYC and CCND1 expression. EBioMedicine. 2018;38:69-78.\u003c/li\u003e\n\u003cli\u003eLuo Y, Wang Q, Tian P, Jia Y. [Highly expressed CHAF1A and PCNA are positively associated with malignancy of cervical squamous cell carcinoma]. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2017;33(12):1696-701.\u003c/li\u003e\n\u003cli\u003eGarcia H, Miecznikowski JC, Safina A, Commane M, Ruusulehto A, Kilpinen S, et al. Facilitates chromatin transcription complex is an \"accelerator\" of tumor transformation and potential marker and target of aggressive cancers. Cell Rep. 2013;4(1):159-73.\u003c/li\u003e\n\u003cli\u003eLiang X, Yuan X, Yu J, Wu Y, Li K, Sun C, et al. Histone Chaperone ASF1A Predicts Poor Outcomes for Patients With Gastrointestinal Cancer and Drives Cancer Progression by Stimulating Transcription of beta-Catenin Target Genes. EBioMedicine. 2017;21:104-16.\u003c/li\u003e\n\u003cli\u003eMajumder A, Syed KM, Mukherjee A, Lankadasari MB, Azeez JM, Sreeja S, et al. Enhanced expression of histone chaperone APLF associate with breast cancer. Mol Cancer. 2018;17(1):76.\u003c/li\u003e\n\u003cli\u003eNabatiyan A, Krude T. Silencing of chromatin assembly factor 1 in human cells leads to cell death and loss of chromatin assembly during DNA synthesis. Mol Cell Biol. 2004;24(7):2853-62.\u003c/li\u003e\n\u003cli\u003eYe X, Franco AA, Santos H, Nelson DM, Kaufman PD, Adams PD. Defective S phase chromatin assembly causes DNA damage, activation of the S phase checkpoint, and S phase arrest. Mol Cell. 2003;11(2):341-51.\u003c/li\u003e\n\u003cli\u003eKrawitz DC, Kama T, Kaufman PD. Chromatin assembly factor I mutants defective for PCNA binding require Asf1/Hir proteins for silencing. Mol Cell Biol. 2002;22(2):614-25.\u003c/li\u003e\n\u003cli\u003eMoggs JG, Grandi P, Quivy JP, Jonsson ZO, Hubscher U, Becker PB, et al. A CAF-1-PCNA-mediated chromatin assembly pathway triggered by sensing DNA damage. Mol Cell Biol. 2000;20(4):1206-18.\u003c/li\u003e\n\u003cli\u003eRolef Ben-Shahar T, Castillo AG, Osborne MJ, Borden KL, Kornblatt J, Verreault A. Two fundamentally distinct PCNA interaction peptides contribute to chromatin assembly factor 1 function. Mol Cell Biol. 2009;29(24):6353-65.\u003c/li\u003e\n\u003cli\u003eZhang Z, Shibahara K, Stillman B. PCNA connects DNA replication to epigenetic inheritance in yeast. Nature. 2000;408(6809):221-5.\u003c/li\u003e\n\u003cli\u003eGaillard PHL, Moggs JG, Roche DM, Quivy JP, Becker PB, Wood RD, et al. Initiation and bidirectional propagation of chromatin assembly from a target site for nucleotide excision repair. EMBO J. 1997;16(20):6281-9.\u003c/li\u003e\n\u003cli\u003eGreen CM, Almouzni G. Local action of the chromatin assembly factor CAF-1 at sites of nucleotide excision repair in vivo. EMBO J. 2003;22(19):5163-74.\u003c/li\u003e\n\u003cli\u003eSharp JA, Fouts ET, Krawitz DC, Kaufman PD. Yeast histone deposition protein Asf1p requires Hir proteins and PCNA for heterochromatic silencing. Curr Biol. 2001;11(7):463-73.\u003c/li\u003e\n\u003cli\u003ePolo SE, Theocharis SE, Grandin L, Gambotti L, Antoni G, Savignoni A, et al. Clinical significance and prognostic value of chromatin assembly factor-1 overexpression in human solid tumours. Histopathology. 2010;57(5):716-24.\u003c/li\u003e\n\u003cli\u003ePolo SE, Theocharis SE, Klijanienko J, Savignoni A, Asselain B, Vielh P, et al. Chromatin assembly factor-1, a marker of clinical value to distinguish quiescent from proliferating cells. Cancer Res. 2004;64(7):2371-81.\u003c/li\u003e\n\u003cli\u003eStaibano S, Mascolo M, Rocco A, Lo Muzio L, Ilardi G, Siano M, et al. The proliferation marker Chromatin Assembly Factor-1 is of clinical value in predicting the biological behaviour of salivary gland tumours. Oncol Rep. 2011;25(1):13-22.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Cervical cancer,CHAF1A,PCNA,Interaction","lastPublishedDoi":"10.21203/rs.3.rs-390228/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-390228/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eAn increasing number of studies demonstrate that histone chaperones play critical roles in tumorigenesis and development. In previous research, we confirmed that CHAF1A was highly expressed in cervical cancer (CC) and was correlated with poor prognosis. However, the biological function and specific mechanism of CHAF1A in the development of CC have not been reported.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eCHAF1A knockdown in SiHa and HeLa.cells by lentivirus vector is verified by RT-PCR and Western blot analysis.CCK-8, flow cytometry assays, colony formation, cell migration assay and real-time cell analysis assay were performed to determine the cellular function of CHAF1A in CC.Tumor xenograft assay was conducted on nude mice to assess the effect of CHAF1A in vivo. Cell immunofluorescence and co-immunoprecipitation were applied to examine the interaction between CHAF1A and PCNA.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eWe found that CHAF1A knockdown in SiHa and HeLa cell lines inhibited proliferation and promotedits apoptosis. Further research indicated that CHAF1A promoted proliferation and inhibited apoptosis in CC by activating the PI3K/Akt/FoxO1 signaling pathway. Moreover, CHAF1A directly interacts with PCNA and co-promotes CC progression.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThe discovery of the mechanism of action of CHAF1A in CC may provide a new direction for the treatment of CC.\u003c/p\u003e","manuscriptTitle":"CHAF1A–PCNA interaction promotes cervical cancer progression via the PI3K/AKT/FoxO1 signaling pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-04-12 16:40:24","doi":"10.21203/rs.3.rs-390228/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4a01403b-60b0-4d6f-9f51-61af354a0cf7","owner":[],"postedDate":"April 12th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":3586970,"name":"Cancer Biology"}],"tags":[],"updatedAt":"2021-04-12T16:43:26+00:00","versionOfRecord":[],"versionCreatedAt":"2021-04-12 16:40:24","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-390228","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-390228","identity":"rs-390228","version":["v1"]},"buildId":"re_ckhLnmML6MCF96OHNJ","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

⚙ Ask this paper AI returns verbatim quotes from the full text · source: preprint-html ⓘ

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00