Differential transcriptomic host responses in the early phase of viral and bacterial infections in human lung tissue explants ex vivo

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background . The first 24 hours of infection represent a critical time window in interactions between pathogens and host tissue. However, it is not possible to study such early events in human lung during natural infection due to lack of clinical access to tissue this early in infection. We, therefore, applied RNA sequencing to ex vivo cultured human lung tissue explants (HLTE) from patients with emphysema to study global changes in small noncoding RNA, mRNA, and long noncoding RNA (lncRNA, lincRNA) populations during the first 24 hours of infection with influenza A virus (IAV), Mycobacterium bovis Bacille Calmette-Guerin (BCG), and Pseudomonas aeruginosa. Results. P. aeruginosa caused the strongest expression changes and was the only pathogen that notably affected expression of microRNA and PIWI-associated RNA. The major classes of long RNAs (> 100 nt) were represented similarly among the RNAs that were differentially expressed upon infection with the three pathogens (mRNA 77–82%; lncRNA 15–17%; pseudogenes 4–5%), but lnc-DDX60-1, RP11-202G18.1, and lnc-THOC3-2 were part of an RNA signature (additionally containing SNX10 and SLC8A1) specifically associated with IAV infection. IAV infection induced brisk interferon responses, CCL8 being the most strongly upregulated mRNA. Single-cell RNAseq identified airway epithelial cells and macrophages as the predominant IAV host cells, but inflammatory responses were also detected in cell types expressing few or no IAV transcripts. Combined analysis of bulk and single-cell RNAseq data identified a set of 6 mRNAs (IFI6, IFI44L, IRF7, ISG15, MX1, MX2) as the core transcriptomic response to IAV infection. The two bacterial pathogens induced qualitatively very similar changes in mRNA expression and predicted signaling pathways, but the magnitude of change was greater in P. aeruginosa infection. Upregulation of GJB2, VNN1, DUSP4, SerpinB7, and IL10, and downregulation of PKMYT1, S100A4, GGTA1P, and SLC22A31 were most strongly associated with bacterial infection. Conclusions. Human lung tissue mounted substantially different transcriptomic responses to infection by IAV than by BCG and P. aeruginosa, whereas responses to these two divergent bacterial pathogens were surprisingly similar. This HLTE model should prove useful for RNA-directed pathogenesis research and biomarker discovery during the early phase of infections, both at the tissue and single-cell level.
Full text 193,175 characters · extracted from preprint-html · click to expand
Differential transcriptomic host responses in the early phase of viral and bacterial infections in human lung tissue explants ex vivo | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Differential transcriptomic host responses in the early phase of viral and bacterial infections in human lung tissue explants ex vivo Aaqib Sohail, Fakhar Waqas, Peter Braubach, Laurien Czichon, Mohamed Samir, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4499225/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background . The first 24 hours of infection represent a critical time window in interactions between pathogens and host tissue. However, it is not possible to study such early events in human lung during natural infection due to lack of clinical access to tissue this early in infection. We, therefore, applied RNA sequencing to ex vivo cultured human lung tissue explants (HLTE) from patients with emphysema to study global changes in small noncoding RNA, mRNA, and long noncoding RNA (lncRNA, lincRNA) populations during the first 24 hours of infection with influenza A virus (IAV), Mycobacterium bovis Bacille Calmette-Guerin (BCG), and Pseudomonas aeruginosa . Results. P. aeruginosa caused the strongest expression changes and was the only pathogen that notably affected expression of microRNA and PIWI-associated RNA. The major classes of long RNAs (> 100 nt) were represented similarly among the RNAs that were differentially expressed upon infection with the three pathogens (mRNA 77–82%; lncRNA 15–17%; pseudogenes 4–5%), but lnc-DDX60-1 , RP11-202G18.1 , and lnc-THOC3-2 were part of an RNA signature (additionally containing SNX10 and SLC8A1 ) specifically associated with IAV infection. IAV infection induced brisk interferon responses, CCL8 being the most strongly upregulated mRNA. Single-cell RNAseq identified airway epithelial cells and macrophages as the predominant IAV host cells, but inflammatory responses were also detected in cell types expressing few or no IAV transcripts. Combined analysis of bulk and single-cell RNAseq data identified a set of 6 mRNAs ( IFI6 , IFI44L , IRF7 , ISG15, MX1 , MX2 ) as the core transcriptomic response to IAV infection. The two bacterial pathogens induced qualitatively very similar changes in mRNA expression and predicted signaling pathways, but the magnitude of change was greater in P. aeruginosa infection. Upregulation of GJB2 , VNN1 , DUSP4 , SerpinB7 , and IL10 , and downregulation of PKMYT1 , S100A4 , GGTA1P , and SLC22A31 were most strongly associated with bacterial infection. Conclusions. Human lung tissue mounted substantially different transcriptomic responses to infection by IAV than by BCG and P. aeruginosa , whereas responses to these two divergent bacterial pathogens were surprisingly similar. This HLTE model should prove useful for RNA-directed pathogenesis research and biomarker discovery during the early phase of infections, both at the tissue and single-cell level. Biomarker emphysema gene expression human lung tissue infection long noncoding RNA pneumonia miRNA PIWI-associated RNA prokineticin 2 transcription. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction The first 24 h of infection form a critical time window in interactions between many pathogens and host tissue, as they include attachment to and invasion of target cells, recognition of pathogens by cellular sensors and, in many cases, the first replication cycles of the pathogen. Insights into changes in host RNA expression are particularly important for our understanding of this early phase because they mediate a major part of the immediate early cell and tissue responses by enabling the required coordinated changes in gene expression. In addition, due to the high dynamic range in expression change of long RNAs and the association of small RNAs such as microRNA (miRNA) with central regulatory switches, RNA molecules have proven high potential as accurate biomarkers for disease-specific processes. For pulmonary infections, this has predominantly been shown by analysis of peripheral blood RNA from patients with established disease (e.g., ( 1 – 3 )). However, to better capture pathophysiological processes in the target organ itself, it would be highly desirable to analyze lung tissue directly. While this is technically possible by transbronchial biopsy and may be clinically justified in difficult-to-diagnose cases, it is usually not clinically or ethically feasible within the very early phase of infection with a known causative pathogen. Even though there are well-established animal and cell culture models to study human lower respiratory tract infections, they cannot fully represent the events seen in intact human lung tissue. Organotypic culture of human lung tissue explants (HLTE) has been successfully used to overcome some of these drawbacks. The HLTE model is based on ex vivo cultivation of human lung tissue that has been removed for medical reasons, for instance in the context of tumor surgery or lung transplantation. The majority of studies have featured a refined version of the HLTE model based on precision cut lung slices (PCLS, reviewed in ( 4 , 5 )). In this model, the tissue is embedded in low-melting agarose and then sectioned, thus preserving tissue architecture better during subsequent culture. However, the PCLS model is labor-intensive and embedding the tissue in agarose may interfere with subsequent analyses of the tissue, for instance by RNA sequencing. The classic organotypic HLTE model, therefore, still constitutes an attractive option, in particular if more sophisticated tissue analyses by –omics technologies are planned. Regarding respiratory infections, it has been demonstrated that HLTEs can support invasion and replication of viral, bacterial, and fungal pathogens and reproduce cardinal aspects of the expected host responses ( 6 – 17 ). Tumor-free tissue margins from lung tumor surgery were used in most of these studies, but tissue from patients with chronic obstructive pulmonary disease (COPD) was successfully used to study cytokine responses to H. influenza and influenza A virus (IAV) ( 14 , 17 , 18 ) and the anti-inflammatory effect of citraconic acid on IAV infection ( 19 ). Explanted lung tissue from patients with an indication for lung transplantation for lung failure from obstructive lung disease would, therefore, be an attractive source of HLTEs for studies of lower respiratory infections in medical centers with a high volume of lung transplantation. However, it remains unknown whether tissue which has been compromised by a long-standing disease process leading to respiratory insufficiency not only supports replication of key human pathogens ex vivo but also yields valid data about transcriptomic host responses. RNA sequencing enables profiling of both long and small RNAs of different classes from a single sample, which is referred to as integrative RNA sequencing. For infection research, a particularly attractive feature is that expression of viral RNAs is also captured from the same sample, allowing to identify infected host cells and to compare host responses in infected vs. noninfected (bystander) cells. Both bulk and single-cell RNA sequencing have been employed to characterize RNA expression changes in human lung tissue. For instance, Alfi et al. applied bulk RNA sequencing to HLTEs from tumor surgery to assess transcriptomic responses to SARS-CoV-2 in upper and lower respiratory tract ( 16 ), whereas single-cell RNA sequencing (scRNAseq) of PCLS was recently used to study antiviral drugs against SARS-CoV-2 ( 20 ). However, there are no studies featuring bulk or scRNAseq of organotypic HLTEs to compare transcriptomic tissue responses to viral vs. bacterial pathogens. The aims of the present study were (i) to describe differences in early transcriptomic host responses due to viral vs. bacterial infections of human lung tissue ex vivo , (ii) to dissect host responses to IAV at the single-cell level, and (iii) to identify IAV infected cell types. Specifically, we have adapted HLTE culture of tissue from patients with indication for lung transplantation due to advanced emphysema and used (i) integrated RNA sequencing of small and long RNA classes to evaluate early RNA expression changes following infection with IAV, Mycobacterium bovis Bacille Calmette-Guerin (BCG), and Pseudomonas aeruginosa , and (ii) single-cell RNA sequencing to identify host mRNA expression changes and expression of viral transcripts in IAV infection at the single cell level. We find that the tissue explants faithfully reproduce the expected pathogen-specific responses at the tissue and single-cell level and allow (i) validating, in human tissue, RNA biomarkers that had been previously identified in cellular or animal models, and (ii) the discovery of novel infection-associated RNA molecules that can be validated in future studies. Results Establishment of the infection model. The work flow of a typical experiment is shown in Fig. 1 A. In order to optimize RNA quality for RNAseq, we compared two methods for RNA isolation. In the first method, the lung tissue pieces were incubated with RNAlater for 24 h at 4°C and then stored at -80°C in RNAlater prior to extraction. In the second method, they were snap frozen in liquid nitrogen and then stored at -80°C. The liquid nitrogen method yielded significantly higher RNA Integrity Numbers (Fig. 1 B) and was thus used throughout. We measured LDH release in uninfected and IAV-infected HLTEs in order to assess spontaneous degradation of tissue during culturing and potential virus-induced cytopathic effects. LDH was released throughout the 72 h time course, reaching maximum values of about 7% and 12% in uninfected and infected HLTEs, respectively, indicating a mild-moderate cytopathic effect (Fig. 1 C). To assess whether the HLTE model supports release of active IAV particles, we employed the immuno-foci assay to quantify replication-competent virus particles in the supernatant and measured viral RNA transcription through HA mRNA quantification. An apparent decline of replication-competent virus particles in the supernatant was noted over a 72 h period ( Figure S1 A ). This was likely due to the fact that the initial viral inoculum was not replaced by virus-free medium, and it was thus concluded that viral titers in supernatant could not be used to measure viral replication. On the other hand, viral HA mRNA expression increased steadily and peaked by 48 h post infection (p.i.) (Fig. 1 D). However, significant inter- and intra-donor variation was observed, likely due to differences in tissue integrity and cell type proportions between samples. To verify whether the tissues could mount the expected differential responses to IAV and the two bacterial pathogens ( P. aeruginosa and BCG) in the first 24 h of infection, we measured several classic cytokines in supernatants and the corresponding mRNAs in tissue lysates (Fig. 1 E). As expected, CXCL10 and IFNγ levels were highest in influenza infection, whereas IL6, IL10, IL1β, and PROK2 (which is highly inducible in macrophages by LPS and other TLR2/4 agonists ( 21 )) reached higher levels in the bacterial infections. Taken together, these results suggested that HLTEs from emphysema patients constituted a valid model to study early transcriptomic tissue responses to viral and bacterial infections ex vivo . Modest reprogramming of small noncoding RNA (sncRNA) populations. Small (< 50 nucleotides long) RNA sequencing of total RNA extracted 24 h p.i. revealed the expected sequencing depth: a mean 8.3*10 7 reads were obtained per sample; a mean 4.4*10 7 of these passed the length filter, of which 2.8*10 7 could be mapped to the human genome (hg38) (Fig. 2 A). By sncRNA class, most reads mapped to miRNAs and substantially fewer to PIWI-interacting RNA (piRNA) and small nucleolar RNA (snoRNA) (Fig. 2 B). Very few reads mapped to small nuclear RNA (snRNA) and ribosomal RNA (rRNA), which was consistent with the high quality of the input RNA. After filtering out lowly expressed sncRNA (< 20 reads in the four experimental groups combined), piRNA contributed the highest number of sncRNA species, followed by miRNA. However, the majority of the differentially expressed (DE; p -Adj ≤ 0.1) sncRNA species were miRNA followed by piRNA (Fig. 2 C,D). A principal component analysis (PCA) did not reveal global differences in the sncRNA populations of the 4 groups (Fig. 2 E). Indeed, there were only 2 DE piRNAs in IAV infection vs. uninfected tissue and 1 DE piRNA in BCG infection vs. uninfected tissue, and their expression in uninfected tissue was already low, indicating that their functional significance is uncertain (Fig. 2 F,G ) . On the other hand, more substantial expression changes were observed in P. aeruginosa infection. 20 sncRNA were DE: 13 miRNA, 6 piRNA, and 1 snRNA (Fig. 2 H). Among the DE miRNAs, mir-410-5p and miR-665 have been linked to increased cell proliferation and are candidate biomarkers for cancer. Decreased expression of one of the downregulated miRNA, miR-7974, has been reported in hypoxia ( 22 ) and oxidative stress ( 23 ), and increased expression in breast tumor tissue ( 24 ). A gene set enrichment (GSEA) analysis of predicted mRNA targets of the miRNA DE in P. aeruginosa infection suggested activation of pathways related to peroxisomes, inflammation, and cell cycle (Fig. 2 I). However, statistical significance was modest. Nonetheless, DE of about 10% of the predicted mRNA targets could be verified in the long RNAseq dataset ( Figure S1 B ) and DE of additional predicted targets would be expected at later time points. piRNAs were the 2nd most significantly DE sncRNA class in P. aeruginosa infection and were notably overrepresented among the most strongly DE sncRNA (e.g., piR_010299). piRNAs have been implicated in tissue responses to infections in humans ( 3 ) and animals ( 25 ), suggesting that their DE in this HLTE model is pathophysiologically significant. Marked reprogramming in long RNA (mRNA, long noncoding RNA, pseudogene RNA) populations reveals signatures for bacterial vs. viral infection. Sequencing of long RNA (> 100 nucleotides long) revealed deep coverage in all samples in that we obtained a mean (SD) 42.1 x 10 6 (±7.3 x 10 6 ) reads mapping to protein-coding RNA (mRNA), long noncoding RNA (lncRNA and long intervening noncoding RNA, lincRNA), and pseudogene RNA species. To examine the spread of RNAseq data across the four groups, we generated a graphical representation of Fragments Per Kilobase Million (FPM) for each group. The plot illustrates that the data are equally distributed across all groups ( Figure S2 A ). With respect to both total and DE RNA, the majority of reads mapped to protein-coding RNA, followed by lncRNA and then pseudogene RNA in infection with all three pathogens ( Figure S2 B-D ), whereby the percentages of the four captured RNA classes (protein-coding RNA, lncRNA, lincRNA, pseudogenes) in the DE RNAs were similar across infection with the three pathogens ( Figure S2 E ). A PCA based on all species of long RNA suggested similarities between IAV infection and control samples on the one hand and between the two bacterial infections on the other hand (Fig. 3 A). Still, no clear separation was seen even though expression changes were substantially greater than in the sncRNA populations. Nonetheless, it was evident that the extent of differential expression increased from IAV (n = 131 DE RNAs) over BCG (n = 964 DE RNAs) to P. aeruginosa (n = 2423 DE RNAs) (Fig. 3 B). High levels of mRNA corresponding to all 8 IAV genome segments were detected in the IAV-infected samples, but only background signals in the other three groups, thus evidencing successful IAV infection of the HLTEs used for the RNAseq analysis ( Figure S3 ). Volcano plots were then used to visualize differences between the three pathogens in DE with respect to uninfected tissue (Fig. 3 C-H). In IAV infection, 131 RNAs were DE with respect to uninfected tissue. Several mRNAs were highly upregulated which are known to be strongly associated with host responses to influenza virus infection (Fig. 3 C). In particular, CCL8 , CXCL9 , GBP1 , IFI44L , IFI6 , IFNL2 , IL27 , ISG15 , MX1 , and MX2 are all contained in the Gene Ontology (GO) term BP 0009615 response to virus ( Fig. 3 D ) , thus providing further evidence that the HLTE mounted the expected anti-IAV innate immune response. Furthermore, we noted 19 lncRNAs and lincRNAs among the DE RNAs (Fig. 3 E). Of note, lncRNAs ADAM2-2 (ENSG00000253939), SIMALR (suppressor of inflammatory macrophage apoptosis lncRNA, ENSG00000226004), LINC02865 (ENSG00000229922), LGALS17A (ENSG00000226025), and LGALS14 (ENSG00000269460) were among the most highly upregulated transcripts in IAV infection (Fig. 3 E). lnc-ADAM2-2 is a novel gene which encodes antisense RNA to the genes encoding the IDO1 and IDO2 enzymes, both of which have immunomodulatory functions in influenza virus infection ( 26 , 27 ). lncRNA SIMALR and lincRNA LINC02865 (a suppressor of inflammatory macrophage apoptosis) are transcribed from overlapping sequences on chromosome 6. They have emerged as novel regulators of macrophage biology by suppressing inflammatory macrophage apoptosis via Netrin-1 (NTN1) ( 28 ) and are located just downstream of the gene encoding the anti-inflammatory deubiquitinase TNFAIP3 (also known as A20). LGALS17A and its downstream lncRNA lnc-LGALS14 share a genomic location on Chromosome 19 with galectins, which possess antiviral functionality in IAV infection ( 29 ). LGALS17A and lnc-LGALS14 are derived from a galectin pseudogene, and LGALS17A has previously been identified as an IFN-stimulated transcript ( 30 ). In addition, they are located downstream of a gene cluster relating to type III IFN responses, of which INFL2 was significantly upregulated in the current dataset, whereas upregulation of IFNL1 and 3 was less significant ( p Adj > 0.1). We then aimed to validate the expression of a subset of the DE lncRNA, lincRNA and pseudogene RNAs by RT-qPCR. Robust PCR assays could be established for RP11-202G18.1 , GBP1P1 , SIMALR , AC093063.1 , and LGALS17A. Indeed, expression of all five increased significantly 24 h after IAV infection, but to lower levels than CXCL10 mRNA, which was measured for comparison ( Figure S4 ). Transcriptomic tissue responses to the two bacterial pathogens were much more extensive than to IAV (Fig. 3 F,G), and there was considerable overlap in DE RNAs, even though P. aeruginosa and BCG belong to two different phyla and differ significantly in their interactions with host cells. 781 long RNA species were DE (with respect to uninfected tissue) in infection by both bacterial pathogens, but not in IAV infection (Fig. 3 B), and a four-way plot based on Wald statistic suggested that all genes that were DE by both bacterial pathogens were regulated in the same direction ( Figure S5 ). This plot identified GJB2 as the gene that was most robustly upregulated in both bacterial infections. GJB2 encodes gap junction binding protein 2, a connexin which plays roles in epithelial barrier integrity ( 30 ) and is known for its importance in lung adenocarcinoma. Little is known about its role in inflammation or infections, but it is listed in GO:BP gene set RESPONSE_TO_BACTERIUM (GO:0009617). VNN1 encodes vanin 1, an oxidative stress sensor that is part of the tissue response to oxidative stress and inflammation in a variety of organs ( 31 ). The most specifically and strongly regulated RNAs were found in P. aeruginosa infection. In addition to GJB2 and VNN1 , the most significantly (Wald test statistic) upregulated mRNAs were DUSP4 (encoding dual specificity phosphatase 4, a protein tyrosine/serine/threonine phosphatase involved in mitogenic signal transduction), IL10 (encoding a predominantly anti-inflammatory cytokine ( 32 )), and SERPINB7 (encoding a member of the serpin family of protease inhibitors, which have anti-inflammatory and anticoagulant properties and counteract proteolytic tissue destruction ( 33 )). The RNAs that were most significantly downregulated by both pathogens were PKMYT1 (encoding a kinase that inhibits G2/M transition in the cell cycle ( 34 )), GGTA1P (encoding an enzymatically inactive alpha-1,3-galactosyltransferase involved in immune regulation (e.g., ( 35 )), and S100A4 (encoding the S100 Ca ++ -binding protein S4, which furthers cell motility, migration, and invasion ( 36 )). All three genes were downregulated more significantly by P. aeruginosa than by BCG. In spite of the strong agreement between P. aeruginosa and BCG in terms of directionality of DE, some degree of DE between the two bacterial infections was apparent. This is evidenced in the four-way plot (see RNAs marked in green [significant only in BCG infection] and violet [significant only in P. aeruginosa infection] in Figure S5 as well as in the volcano plot shown in Fig. 3 H. In hierarchical clustering analysis based on the 75 most significantly DE RNA selected by ANOVA across all four experimental groups ( p values: 3.6E-06–7.8E-04), there was a remarkably clear separation in that the bacterial infections clustered in one clade and within it BCG and P. aeruginosa into separate subclades (Fig. 4 ). Separation of IAV infection from uninfected tissue was also excellent in that only one IAV-infected and one control sample were classified in the same subclade. Even though there were much fewer DE RNAs in IAV infection than in the bacterial infections, this hierarchical clustering analysis revealed a distinct “viral” signature, which consisted of 5 upregulated RNAs (marked red in Fig. 3 I). Three of these ( lnc-DDX60-1 [ENSG00000248601,] lnc-THOC3-2 [ENSG00000248596)], and RP11-202G18.1 [ENSG00000227531] are transcripts of unknown function which may arise during transcription of neighboring genes related to cellular responses to infection and inflammation. SLC8A1 encodes the Na + /Ca ++ exchange channel NCX1, which is expressed in a variety of cell types and plays roles in mediating airway smooth muscle responses to inflammation ( 37 ) and thrombin-induced increased endothelial permeability ( 38 ). SNX10 (sorting nexin 10) is an important differentiation factor of myeloid cells and supports a proinflammatory phenotype of macrophages ( 39 ). GSEA analysis based on Hallmark pathways revealed pathogen-specific regulation of functional pathways, but also common features shared among the three types of infection (Fig. 5 ). Several pathways were commonly upregulated by all three pathogens. These related to innate immune system signaling ( IFNG response , IFNA response , inflammatory response , IL6_JAK_Stat3 signaling , TNFA signaling via NFKB ), other aspects of innate immune activation ( allograft rejection , complement activation ), and apoptosis. One commonly downregulated pathway was cell cycle progression: E2F targets , indicating inhibition of cell proliferation by all three pathogens. The two bacterial infections could be distinguished from IAV infection by weaker induction of type I and type II IFN signaling, but stronger enrichment of signaling pathways such as IL2_Stat5_signaling , IL6_STAT3 signaling , programmed cell death , and KRAS signaling (upregulated genes) . In contrast, depletion of myc targets , reflecting decreased cellular processes and cell cycle, and enrichment of KRAS signaling (downregulated genes) were unique for IAV infection. The pathways uniquely regulated in P. aeruginosa infection reflected a more vigorous induction of compensatory tissue responses such as formation of tight junctions, protein secretion , and metabolism of xenobiotics . Adipocyte development and p53 pathway were the only two pathways that were uniquely differentially regulated in BCG-infected tissue only. Taken together, these results provide further evidence that this HLTE model recapitulates classic tissue responses to infectious agents and reveals pathophysiologically plausible differences between the responses to viral vs. bacterial pathogens. Cell type-specific responses to IAV infection. We then tested whether the HLTE could be used to dissect interactions between IAV and lung tissue at the single cell level and applied the 10x genomics single-cell RNA sequencing (scRNAseq) platform to single cell suspensions from IAV infected and uninfected HLTE from the same donor (a patient with indication for lung transplantation due to COPD) 24 h after IAV or mock infection. To correct for differences among individual HLTE pieces, single cell suspensions from 12 infected and 12 uninfected HLTE pieces were pooled to yield one infected and one uninfected sample for single cell analysis. After excluding dead cells by FACS, we loaded cells (n = 4500) for a targeted recovery of 3500 cells from each pooled sample at a sequencing depth to obtain 50 k reads per cell. Using cell-specific markers to identify cell clusters allowed identification of 11 cell types (Fig. 6 A). These included the expected functional cell types of lower airways (airway epithelial cells, multiciliated cells, endothelial cells) and the major immune cell types: macrophages, monocytes, mast cells, B cells, CD4 + and CD8 + T cells, and NK cells. Mito_high T cells correspond to apoptotic T cells with high mitochondrial DNA content, indicating cell death, and were excluded from the host cell gene expression analyses. We then aimed to identify cells containing viral RNAs ( Figure S7 ). Since IAV is a negative sense RNA virus, viral mRNA is transcribed from the negative sense (-) strand, and identification of a viral transcript (+ strand) therefore reflects viral transcription. However, by scRNAseq it is not easily possible to distinguish between intracellular viral mRNA synthesis in infected cells and uptake or binding of free viral mRNA from the extracellular environment. Of the eight viral genome segments, RNA corresponding to the segment encoding M1 and M2 proteins could not be detected for unknown reasons. Of the remaining seven segments, NS and HA mRNAs were the most abundant, which is consistent with the viral life cycle. Strongest viral mRNA expression per infected cell was seen in epithelial cells, the main host cell supporting productive IAV infection, followed by macrophages, which are known to support a nonproductive IAV infection and contribute to antiviral immune responses. However, there was clear evidence of viral transcripts also in association with the other cell types, whereby levels were lowest in endothelial cells, mast cells, and monocytes. Comparing DE between the same cell types in single cell suspensions from infected and uninfected HLTE enabled us to assess transcriptomic responses in the 10 cell types (Fig. 6 B-G, Figure S8 ). CD4 T cells (72 DE genes), CD8 T cells ( 43 ), macrophages ( 42 ), NK cells ( 26 ), and mast cells ( 25 ) mounted the briskest transcriptional responses, whereas only weak responses were seen in multiciliated cells (0), B cells ( 1 ), endothelial cells ( 2 ), epithelial cells ( 1 ), and monocytes ( 1 ). Thus, the most robust antiviral host responses did not originate from the main target cells supporting viral transcription (epithelial cells) but from other cell types with less or no evidence of viral mRNA. A comparison of DE genes identified by bulk RNAseq and scRNAseq showed that scRNAseq identified 19% of the DE genes that were identified by bulk RNAseq, but it also demonstrated that 89 DE genes were revealed by scRNAseq only (Fig. 7 A). Of note, six genes ( IFI44L , MX1 , MX2 , IRF7 , IFI6 , and ISG15 ) were identified by scRNAseq as DE in all major immune cells as well as by bulk RNAseq and thus constituted the core of the anti-IAV transcriptomic tissue response in this early time window of IAV infection (Fig. 7 B). Thus, this analysis supported the notion that IAV infects the expected cell types in this HLTE model, that antiviral and inflammatory responses are to some extent due to responses in noninfected “bystander” cells, and that scRNAseq may identify DE transcripts that are not detected as differentially expressed by bulk RNAseq. We then assessed differences among the cell types in terms of functional responses to IAV infection (Fig. 7 C). GSEA (Hallmark) revealed that type 1 and 2 IFN responses were induced in all cell types except B cells. CD4 + T cells and macrophages were the most responsive in that the most pathways (six in each cell type) were regulated. Notably, TNFA signaling induced by NFKB was enriched only in macrophages and monocytes. We then compared GSEA in each of the cell types to the GSEA performed at the tissue level (bulk RNAseq). Regulation of hallmark pathways ( 40 ) related to interferon response, inflammation, and MYC targets was detected at the tissue and the single-cell level, whereas five pathways were detected only by scRNAseq. Discussion We have characterized transcriptomic changes in ex vivo HLTEs from patients with end-stage emphysema in response to in vitro infection with IAV and two phylogenetically distinct bacterial pathogens during the first 24 h of infection. The validity of this model is supported by the expected cytokine responses and, in the case of IAV, viral RNA replication. Ex vivo infections of human lung tissue are usually performed in histologically normal tissue such as tumor-free margins from tissue resected during lung tumor surgery. However, in centers with a high volume of lung transplantation, explants from patients with terminal pulmonary disease may be available more frequently. This additional source of human lung tissue will, hopefully, enhance the use of HLTEs for ex vivo infections, thus helping to reduce the use of animal models. However, certain limitations should be considered when interpreting results from HLTEs. Firstly, since the tissue is washed and mostly bloodless, there are no intravascularly circulating immune cells. Secondly, depending on the underlying disease leading to the need for lung transplantation, the tissue may already possess an elevated state of inflammation (“pre-inflamed”) and some cell types may not be fully functional, may be underrepresented, or even absent. Nonetheless, scRNAseq demonstrated the presence of all cardinal target cells and the expected cellular responses to IAV infection in the various cell types. We focused on emphysema because it is a frequent indication for lung transplantation at our center. After an early pilot study, we excluded HLTEs from patients with cystic fibrosis because of overgrowth with pathogenic bacteria including P. aeruginosa and we excluded HLTEs from patients with pulmonary fibrosis because they did not support IAV RNA replication well (Sohail, Samir & Pessler, unpublished data). Further studies should explore the usefulness of HLTEs from other disease indications for lung transplantation such as pulmonary hypertension, sarcoidosis, and others. Overall, our data suggest that this model is not optimal for identifying infection-associated sncRNAs, at least for IAV and BCG infection. Nonetheless, DE of pathophysiologically plausible miRNA could be identified in P. aeruginosa infection. Of note, we also found that expression of the lesser-known sncRNA classes (notably piRNA) changed substantially during P. aeruginosa infection. Bulk RNAseq of both coding and noncoding long RNAs revealed strong transcriptomic “footprints” which differed substantially between IAV and the bacterial infections. As expected from an acute P. aeruginosa infection, transcriptomic changes (with respect to uninfected tissue) were substantially more pronounced than in BCG infection. However, only very few genes were DE in a two–group comparison between P. aeruginosa and BCG, suggesting that the interactions of these two distinct pathogens with host tissue ex vivo in the first 24 h of infection share cardinal features and differ mostly in terms of intensity of the interaction. P. aeruginosa more commonly causes colonization or subacute disease, and BCG only causes clinical disease in immunocompromised individuals. Thus, pathogens that cause acute lower airway infections, e.g. pneumococci, would likely lead to even more pronounced transcriptome changes in this HLTE model. We validated several genes that had been implicated in host responses to bacterial infections in other models, notably GJB2, VNN1 , and DUSP4. These results underscore the value of this HLTE model for the validation of genes that were identified in the context of other pathogens, species or model types such as cellular models. We found weak expression of viral transcripts in mast cells. Influenza A virus infection of mast cells is of considerable clinical interest, as this virus can trigger hypersensitivity reactions such as asthma and COPD exacerbation in susceptible individuals ( 41 , 42 ). Our results suggest that only a small percentage of mast cells harbored IAV mRNA. Further research is, therefore, required to determine the role of direct infection of mass cells to these hypersensitivity reactions. The identification of the 5-gene ”IAV signature” is particularly intriguing. The sequences encoding the three lncRNAs in this signature are all located adjacent to protein-coding genes involved in inflammation and host responses to influenza viruses and are likely co-transcribed with these genes. For instance, lnc-DDX60-1 is located downstream of the DDX60 gene, which encodes an RNA binding protein involved in antiviral responses ( 43 ), and RP11-202G18.1 is located upstream of LPAR1 , which encodes a G-protein coupled receptor involved in pulmonary fibrosis and response to tissue damage and infectious agents ( 44 ). Thus, they may mostly reflect induction of antiviral responses in lung tissue but it is unclear whether they play any functional role. There is a great clinical need for biomarkers that can distinguish between viral and bacterial infections early in the infection in order to start the correct antibacterial or antiviral treatment as early as possible. Further research is necessary to test whether expression of these RNAs can be measured in easier-to-obtain biosamples such as peripheral blood, sputum, or bronchoalveolar lavage and to test whether they are consistently more highly expressed in viral than bacterial infections. The scRNAseq analysis identified cells with low levels or no IAV mRNA as important sources of IFN responses. This agrees well with previous reports of inflammatory responses originating from such bystander cells. For instance, in a study of IAV infection of human PBMCs we found that viral transcripts were only associated with monocytes, but interferon responses also with T cells, B cells, and NK cells ( 18 ). Regulation of cell cycle was a recurring theme in the GSEAs, with a preponderance of cell cycle inhibition. It is well known that IAV infection favors a G0/G1-phase cell cycle arrest in infected cells in order to channel cell resources into production of progeny virions ( 45 ). Further research is required to assess the functional implications of the observed cell cycle arrest in the bacterially infected HLTEs. In conclusion, our results demonstrate the usefulness of “upcycling” explanted lung tissue from patients with terminal emphysema to study transcriptomic tissue responses in the early phase of viral and bacterial infections. Further research should assess the usefulness of tissue explants from patients with other underlying diagnoses, the validity of the model for infections with other pathogens, and the functional significance of the novel RNA tissue biomarkers identified herein, such as the noncoding RNAs induced by IAV infection. Methods and Materials Preparation and maintenance of Human Lung Tissue Explants (HLTEs). Bronchial lung tissue explanted from patients with terminal COPD for clinical reasons was obtained from the Institute of Pathology, Hannover Medical School. The tissue was further dissected into small pieces with an average size of approx. 27 mm 3 (3x3x3 mm) and an average weight of approx. 30 mg. These pieces (HLTEs) were cultured in RPMI medium without any supplement. Tissue pieces were cultured overnight in a humidified tissue culture incubator at 37°C, 5% CO 2 ; this step was termed overnight washing. After 12–16 h of washing, tissues were infected with the respective pathogen. This protocol was developed by combining already published methods ( 8 , 46 ). Infections. Influenza virus (A/Giessen/6/2009 H1N1; abbreviated IAV). Infection medium containing 2.0 x 10 5 ffu/ml in RPMI medium was added to a 24 well plate, placing one HLTE piece per well. Plates were incubated at 37°C for the durations indicated in the figure legends. Mycobacterium bovis Bacillus Calmette–Guérin (BCG) was grown under agitation to mid-log phase in 50 ml of Middlebrook 7H9 (Difco) liquid culture medium supplemented with 0.5% glycerol, 0.15% Tween-80 and 10% oleic acid-albumin-dextrose-catalase (BD Biosciences). Bacterial cells were collected in a 50 ml Falcon tube and then washed twice with 45 ml PBS (Gibco) by centrifugation at 4000G. Bacterial optical density was measured with a spectrophotometer at an absorbance of 600 nm. Infection medium containing 5X10 6 CFU/ml was prepared and HLTEs were subjected to infection in a 24 well plate. P. aeruginosa strain PA14 was cultured in Luria-Bertani broth at 37°C in a shaker incubator and harvested at log phase. CFU were estimated according to the OD value measured as described by Kim et al ( 47 ), and infection medium was prepared containing 1x10 8 CFU/ml in RPMI medium. HLTEs were incubated in 24 well plates for 2 h at 37°C. After infection, HLTEs were washed and incubated in RPMI medium containing 50 µg/ml gentamycin in order to arrest growth of extracellular bacteria. Focus forming assay. Cell culture supernatants containing IAV were serially diluted in PBS supplemented with 0.2% BSA and 1% Ca/Mg solution. Recently confluent monolayers of MDCK cells in 96-well plates were rinsed with PBS and each well infected with 50 µl of 10-fold serially diluted virus for 1 h at room temperature. After infection, the inoculum was aspirated and 150 µl Avicel-media 1% Avicel in MEM media supplemented with 0.5% BSA, 2 µg/ml Trypsin and 1% Dextran) was added to the cell monolayer. The plates were then incubated at 37°C, 5% CO 2 for 24 h, followed by removal of the Avicel media and fixation of cells by 4% PFA and 1% Triton X-100. Cells were stained by mouse-anti-NP-antibody followed by anti-mouse-HRP-antibody. AEC-staining-solution was used to visualize the IAV positive cells ( 48 ). LDH release assay. Supernatants and tissue were collected from HLTE cultures at 0, 24, 48 and 72 h post incubation and stored at 4°C until collection of the 72 h time point. Tissue was lysed in 1% Triton X-100 lysis buffer, tissue lysate and supernatant were diluted and added to 96-well microplates. Catalyst and dye solution were mixed and added to samples according to the protocol of the Roche LDH cytotoxicity detection kit. Color development was measured by OD at 492 nm (background control at 630 nm). LDH release in percentage was calculated as follows: (100 / LDH of lysate) x LDH of sample. ELISA. Supernatants collected from HLTE cultures were immediately stored at -20°C. Samples were thawed at 4°C before measuring concentrations by commercial kits for the following proteins; IP10, IL-1β, IL-6, IL-10, IFN-γ, PROK2. In brief, ELISA plates were coated with specific capture antibodies overnight at 4°C, followed by washing and blocking with 3% BSA (Roth, 8076.5). Plates were washed and then incubated with standard proteins or sample supernatants (diluted in 1% BSA) for 2 h. After binding of protein antigens to coated antibodies, detection antibodies were added, followed by adding avidin conjugated with HRP. This was followed by a final quadruple wash step, after which the chromomeric substrate 3,3’5,5’-tetramethylbenzidine (TMB) was added and incubated in the dark. After approximately 15 minutes, the reaction was stopped by adding 0.3 M sulphuric acid (H 2 SO 4 ) solution. Plates were read on an ELISA reader (BioTeK, Synergy 2.0) at OD 450 nm and background OD that was earlier measured at 570 was subtracted. Protein concentrations were calculated by comparison with standard curves. Comparison of two tissue preservation methods before RNA extraction. To identify the best HLTE preservation method for RNA extraction, HLTE samples were either stored in RNAlater for 24 h at 4°C or snap-frozen in liquid nitrogen. Tissues from RNAlater were transferred to -80°C after 24 h, whereas snap-frozen tissues were immediately transferred to -80°C until RNA extraction. RNA extraction. HLTEs were snap-frozen in liquid nitrogen immediately after collection. RNA extraction of HLTEs was performed using miRNeasy Qiagen Kit (Qiagen, 74104) according to the manufacturer’s instructions with a few modifications. Briefly, Qiazol lysis reagent was added directly to frozen tissue, and disruption and homogenization of HLTE was performed using the Ultra-Turrax® (T10, IKA, 0003737000) for 20–30 sec. at the highest speed. Chloroform was added and the resulting mixture was centrifuged 12,000xg for 15 min at 4°C. The colorless upper layer was transferred to RNA binding columns with 100% ethanol. After two washings of RNA with RPE buffer, DNA was digested by treatment with DNAse I. RNA was eluted into 50 µl RNAse free water. The resulting sample contains total RNA including small RNA (< 50 nt) and therefore can be used for both mRNA and sncRNA profiling. RNA quality control. The RNA quality and quantity were determined using the NanoDrop spectrophotometer (Manufacturer). A 260/280 ratio between 2.0–2.2 indicated RNA without contamination. The RNA Integrity Number (RIN) was determined with an Agilent Bioanalyzer using Eukaryote Total RNA Nano Series II chips (Agilent, 5067 − 1511). Complementary DNA (cDNA) generation. Following RNA extraction, cDNA was prepared using the RT PrimeScript™ Master Mix (Takara) following the manufacturer’s instructions. Briefly, 400 ng of RNA was reverse transcribed by adding 2 µl master mix (5x) and making a total reaction volume of 10 µl, followed by incubation at 37°C for 15 min. Afterward, all samples were heated to 85°C for 10 sec to inactivate the enzymes. The cDNA thus synthesized was diluted further in RNase free water to get a final RNA concentration of 5 ng/µl of the cDNA. Gene expression analysis using real-time PCR. Primers (Table 1 ) were designed using either PrimerBLAST (National Center for Biotechnology Information, National Institutes of Health) or the Primer3 online tool ( 49 ). Primers were designed to span exon-intron boundaries, have annealing temperatures around 60°C and generate amplicons of 100 bp − 300 bp. RT-qPCR reactions were set up in a final volume of 20 µl, using the SensiFast™ SYBR® No-ROX Kit (Bioline, Taunton, MA) and the primers listed. RT-qPCR was performed in a LightCycler® 2.0 instrument (Roche, Mannheim, Germany), using 45 cycles of the following program: 95°C for 15 sec., 60°C for 15 sec., and 72°C for 15 sec. To exclude artifacts resulting from primer dimer formation, melting curve analysis was performed using the sequence 95°C for 15 sec., 60°C for 15 sec., 95°C for 1 min. and 37°C for 30 sec. Relative expression of the mRNA targets was calculated using the 2 −ΔΔCT method ( 50 ). Amplification of a single amplicon was confirmed by obtaining dissociation curve (melt curve) profiles as well as using gel electrophoresis to verify the size of the reaction product. Table 1 List of PCR primers used Gene name Primer name Sequence (5’-3’) IL-6 IL6-F CTACATTTGCCGAAGAGCCC IL6-R CCCTGACCCAACCACAAATG HPRT HPRT-F GAACGTCTTGCTCGAGATGTG HPRT-R CCAGCAGGTCAGCAAAGAATT PROK2 PROK2-F TGACAAGGACTCCCAATGTG PROK2-R TACGAGTCAGTGGATGGCAG IL1B IL-1β-F TACCCAAAGAAGAAGATGGAA IL-1β-R GAGGTGCTGATGTACCAGTTG CXCL10 CxCL10_F CTGCTTTGGGGTTTATCAGA CxCL10_R CCACTGAAAGAATTTGGGC IL10 IL10-F TACCTGGGTTGCCAAGCCT IL10-R AGAAATCGATGACAGCGCC HA HA-F CTCGTGCTATGGGGCATTCA HA-R TTGCAATCGTGGACTGGTGT RP11-202G18 .1 (ENSG00000227531) AL414.1-F ACCAGTGCACCTCATTCAGA AL414.1-R TCCTCCATGCCTTTTCCACT GBP1P1 (ENSG00000225492) GBP1P1-F TGGAACGTGTGAAAGCTGAG GBP1P1-R CAGTTCAGGCTGGACAGACA SIMALR (ENSG00000226004) LINC02528-F ACCTACCTACCGAGAGACCT LINC02528-R CACACCACTGACAGAAACGT AC093063.1 (ENSG00000268088) LGALS14-F CTGAGTGCACTTTGGCCATT LGALS14-R ATCTCTCCACACTTGCACCA LGALS17A (ENSG00000226025) LGALS17A-F GCCTTCCATTTCCGAGTGTA LGALS17A-R TGTAATGGTGGTGGCAAAGA Small non-coding RNA (sncRNA) sequencing. Libraries were prepared using the NEBNext® Small RNA Library Prep Set for Illumina and 1 µg of input RNA. The synthesized cDNA was amplified with 12 PCR cycles. Libraries were prepared separately for each biological replicate. Samples were sequenced on an Illumina HiSeq2500 (2x 50 bp paired-end), generating 50 bp single reads and ≈ 16 million reads passing filter for each sample. FASTAQ files obtained after small RNA sequencing were used to annotate the transcripts using the OASIS 2.0 web tool ( 51 ). Briefly, FASTAQ files were compressed using the OASIS compressor and then uploaded to the web tool for annotation. The annotation process comprises removing 3' adapters, quality control, mapping to the reference genome ( Homo sapiens – hg38 ), and the counting of reads in each sncRNA for each sample. Contaminating viral or bacterial RNA sequences were removed. Bulk RNA sequencing of long RNAs (mRNA, lncRNA, lincRNA, pseudogenes). Quality and integrity of bulk RNA was checked on an Agilent Technologies 2100 Bioanalyzer (Agilent Technologies; Waldbronn, Germany). The RNA sequencing library was generated from 10 ng total RNA using NEBNext® Single Cell/Low Input RNA Library according to the manufacturer´s protocols. The libraries were sequenced on an Illumina NovaSeq 6000, using the NovaSeq 6000 S1 Reagent Kit (100 cycles, paired-end run 2x 50 bp) with an average of 5 x10 7 reads per RNA sample. Large sets of high-throughput sequencing reads were mapped against the Homo sapiens hg38 reference genome via STAR 2.7.3a tool. Transcript normalization and differential expression analysis. The following analyses were done using the R environment and programming code. DESeq2 was used to normalize the counts of each gene to account for differences in sequencing depth and low count variability. The DESeq2 normalization metric is based on the median of ratios method. Following normalization, DESeq2 was run in a pairwise manner, identifying significantly differentially expressed genes with higher levels of expression in the infection group in comparison to the uninfected group. This method provided functionality for a pair-wise comparison (identifying differentially expressed genes between two groups) in the form of a Wald test, and for multiple comparisons (classically used for time-series data) in the form of a likelihood ratio test. The output contained nominal p-values, False Discovery Rate (FDR) or P-adjusted values (correction for multiple tests computed with the Benjamini–Hochberg procedure) and fold change. DESeq2 used an empirical Bayes shrinkage to detect and correct for dispersion and log2-fold change (LFC) estimates. The R software package Visualization of Differential Gene Expression using R (ViDGER) was used to display differential expression outputs uniformly. To present differential expression using DESeq2 output files, volcano plots were generated using the EnhancedVolcano package. Analysis of Variance (ANOVA) was employed to compare the means of all genes across different groups. The top 75 DE genes were selected based on the resulting p-values and presented in a heatmap along with adjusted p-values from the pairwise comparisons (DESeq2). Heatmaps and hierarchical clustering were generated using the pheatmap R package, with gene counts scaled by 'row'. Additionally, a four-way plot was created using ggplot2 to visualize Wald statistic values from the DESeq2 analysis, where BCG Wald statistic values were plotted on the x-axis, and PA infection Wald statistic values on the y-axis. Output from the DESeq2 analysis is found in Tables S1 (sncRNAs) and S2 (long RNAs). Preparation of single-cell suspensions. After 24 hpi, tissues were collected and processed to prepare a single-cell suspension for flow cytometry and cell sorting. Briefly, lung tissues were chopped in digestion buffer (1 mg/ml collagenase D (Roche, 10269638001), 2.0 U/ml Dispase II (Roche, 04942078001) and 0.1 mg/ml DNase I (DNase I, D4527) in Hepes-buffer) with surgical scissors and homogenized with an Ultra-Turrax® dispersing tool (T10, IKA-Werke GmbH, Staufen, Germany) for 40–60 sec. The homogenate was incubated for 30 minutes at 37°C with mild agitation and then passed through a 30G syringe. The resulting single-cell suspension was filtered through a 40 µm nylon cell strainer and erythrocytes were lysed using ACK (Ammonium-Chloride-Potassium) lysing buffer. Cells were counted using an automated cell counter (Scepter, Millipore, PHCC00000). Live/dead cell and apoptosis detection. Single-cell suspension was washed 1x with PBS and 1x with binding buffer. Cells were incubated with fluorochrome-conjugated Annexin V (FITC) for 15 min. After incubation, cells were washed again and resuspended in propidium iodide staining solution. After staining, cells were sorted and analyzed by FACS (Cell Sorter Facility MHH). Dead and duplets cells were excluded from further analysis. Single-cell RNAseq. Sorted live single cells were processed for single-cell transcriptomics. Single-cell 3’ RNA-Seq libraries were prepared using Chromium Single Cell V3 Reagent Kit and Controller (10x Genomics) as described in the user guide. In brief, cells (n = 4500) for a targeted recovery of 3500 along with gel beads, master mix and partitioning oil were loaded in designated wells on a chromium chip. The chip was placed in a Chromium Controller and run for Gel Bead-in-Emulsion (GEMs) preparation. After completion of the run, GEMs were run in PCR tubes for RT incubation in a thermal cycler. Post GEM-RT incubation, cDNA was cleaned up and amplified. cDNA was washed and quality was evaluated. Gene expression libraries were constructed and then libraries were assessed for quality (TapeStation 4200, Agilent). Libraries were sequenced by NextSeq550 using the NextSeq 500 High Output Kit v2.5 (1x75 cycles 400M cluster). We created a reference package for two species genomes (Human and IAV H1N1) and ran the sequences against this genome package. Initial data processing was performed using the Cell Ranger version 2.0 pipeline (10x Genomics). Single-cell RNA data analysis. Cell Ranger output files “outs” contained raw counts for each sequenced genes (Human and H1N1 virus) of each cell. These files were used as input for further processing using the R package Seurat 5.0. Following the standard pre-processing workflow, cells were filtered that have unique feature counts over 2,500 or less than 200. Raw counts were normalized by the global-scaling normalization method “LogNormalize”. Principal component analysis score was used to determine the ‘dimensionality’ of all the cells. Cell clusters were identified as different cell populations based on the expression of their canonical markers recently published. Differential expression was determined for each cell type by comparing the IAV infected cells with uninfected cells. IAV infected cells were identified by the presence of IAV encoded transcripts. Gene Set Enrichment Analysis (GSEA). The gene list and their Wald statistic values from DESeq2 analysis for each pathogen were applied against Hallmark gene set collection databases ( 40 ) or Gene Ontology Biological ( 52 )using the online gene enrichment tool WEB-based Gene SeT AnaLysis Toolkit (WebGestalt, www.webgestalt.org)(53) . The R package ggplot2 was used to generate plots displaying gene set terms, their normalized enrichment score, and FDR values. Statistics. Statistical tools used are detailed in the respective text in results or the figure legends. Briefly, GraphPad Prism 8.0.2 (GraphPad Software, Boston, MA) was used to analyze RT-qPCR, ELISA, metabolomics and LDH release assay results. The Wilcoxon–Mann–Whitney U or unpaired t test were used to assess significance of between-group differences. P values were abbreviated as ≤ 0.0001 = ****, ≤ 0.001 = ***, ≤ 0.01 = **, and ≤ 0.05 = *. Data are shown as mean ± SEM. The number of biological replicates is specified in the figure captions as indicated. For transcriptome data, DESeq2 analysis was applied which returned log 2 -fold change, p -adjusted values, and p values. Declarations Ethics approval and consent to participate The study was approved by the Ethics Committee of Hannover Medical School (file no. 2923-2015). All participants gave informed consent for use of their lung explants for research purposes. Consent for publication Not applicable as no personally identifying data are contained in the manuscript. Availability of data and materials The Results of the DE analysis with DeSeq2 are provided as Supplemental Tables S1 and S2 . The underlying RNAseq datasets are available at GEO https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE192864, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE192528, and https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE268542. Competing interests None of the authors have a competing interest relating to conduct of the study or publication of the manuscript. Funding This work was supported by iMed, the Helmholtz Association’s Cross-Programme Initiative on Personalized Medicine and by the Innovative Medicines Initiative Joint Undertaking (IMI-JU) under grant agreements no. 115523, COMBACTE (www.combacte.com), resources of which are composed of financial contribution from the European Union's Seventh Framework Programme (FP7/2007-2013) and EFPIA companies’ in kind contribution. Additional support was provided by iMed, the Helmholtz Association’s Initiative on Personalized Medicine. Authors' contributions A.S. and F.P. conceived the study. P.B. provided the lung tissue. R.G. provided RNA sequencing and bioinformatics support. A.S. performed the experiments and analyzed the data. A.I., L.A. provided instruction and support regarding the bacterial infections. L.C. performed the experiment shown in Figure S3. M.S. provided instruction and support regarding the HLTE model. A.S. and F.P. wrote the first draft of the manuscript. A.S. and F.H.W. prepared the figures. S.P. provided viral stocks. FP coordinated the study and wrote the final version of the manuscript. All authors edited the manuscript and approved the final version. Acknowledgments First and foremost, we thank the patients for donating their lung tissue to the study. We thank Janine Rasch (Technical University Braunschweig, Germany) and Mohamed Tantawy (National Research Centre Cairo, Egypt) for their support in the early phases of the project, and Katharina Sewald and Armin Braun (Fraunhofer ITEM Institute for Toxicology and Experimental Medicine, Hannover, Germany) for helpful discussion and sharing the protocol for RNA isolation from snap‑frozen tissue. References Dunning J, Blankley S, Hoang LT, Cox M, Graham CM, James PL, et al. Progression of whole-blood transcriptional signatures from interferon-induced to neutrophil-associated patterns in severe influenza. Nat Immunol. 2018;19(6):625–35. de Araujo LS, Ribeiro-Alves M, Wipperman MF, Vorkas CK, Pessler F, Saad MHF. Transcriptomic Biomarkers for Tuberculosis: Validation of NPC2 as a Single mRNA Biomarker to Diagnose TB, Predict Disease Progression, and Monitor Treatment Response. Cells. 2021;10(10). de Araujo LS, Ribeiro-Alves M, Leal-Calvo T, Leung J, Duran V, Samir M, et al. Reprogramming of Small Noncoding RNA Populations in Peripheral Blood Reveals Host Biomarkers for Latent and Active Mycobacterium tuberculosis Infection. mBio. 2019;10(6):e01037–19. Viana F, O'Kane CM, Schroeder GN. Precision-cut lung slices: A powerful ex vivo model to investigate respiratory infectious diseases. Mol Microbiol. 2022;117(3):578–88. Sewald K, Danov O. Infection of Human Precision-Cut Lung Slices with the Influenza Virus. Methods Mol Biol. 2022;2506:119–34. Fatykhova D, Rabes A, Machnik C, Guruprasad K, Pache F, Berg J, et al. Serotype 1 and 8 Pneumococci Evade Sensing by Inflammasomes in Human Lung Tissue. PLoS ONE. 2015;10(8):e0137108. Weinheimer VK, Becher A, Tonnies M, Holland G, Knepper J, Bauer TT, et al. Influenza A viruses target type II pneumocytes in the human lung. J Infect Dis. 2012;206(11):1685–94. Jager J, Marwitz S, Tiefenau J, Rasch J, Shevchuk O, Kugler C, et al. Human lung tissue explants reveal novel interactions during Legionella pneumophila infections. Infect Immun. 2014;82(1):275–85. Hoppe J, Unal CM, Thiem S, Grimpe L, Goldmann T, Gassler N, et al. PilY1 Promotes Legionella pneumophila Infection of Human Lung Tissue Explants and Contributes to Bacterial Adhesion, Host Cell Invasion, and Twitching Motility. Front Cell Infect Microbiol. 2017;7:63. Droemann D, Rupp J, Goldmann T, Uhlig U, Branscheid D, Vollmer E, et al. Disparate innate immune responses to persistent and acute Chlamydia pneumoniae infection in chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 2007;175(8):791–7. Szymanski KV, Toennies M, Becher A, Fatykhova D, N'Guessan PD, Gutbier B, et al. Streptococcus pneumoniae-induced regulation of cyclooxygenase-2 in human lung tissue. Eur Respir J. 2012;40(6):1458–67. Abdullah M, Kahler D, Vock C, Reiling N, Kugler C, Dromann D, et al. Pulmonary haptoglobin and CD163 are functional immunoregulatory elements in the human lung. Respiration. 2012;83(1):61–73. Koppen K, Fatykhova D, Holland G, Rauch J, Tappe D, Graff M, et al. Ex vivo infection model for Francisella using human lung tissue. Front Cell Infect Microbiol. 2023;13:1224356. Nicholas B, Staples KJ, Moese S, Meldrum E, Ward J, Dennison P, et al. A novel lung explant model for the ex vivo study of efficacy and mechanisms of anti-influenza drugs. J Immunol. 2015;194(12):6144–54. Schaller MA, Sharma Y, Dupee Z, Nguyen D, Uruena J, Smolchek R et al. Ex vivo SARS-CoV-2 infection of human lung reveals heterogeneous host defense and therapeutic responses. JCI Insight. 2021;6(18). Alfi O, Yakirevitch A, Wald O, Wandel O, Izhar U, Oiknine-Djian E, et al. Human Nasal and Lung Tissues Infected Ex Vivo with SARS-CoV-2 Provide Insights into Differential Tissue-Specific and Virus-Specific Innate Immune Responses in the Upper and Lower Respiratory Tract. J Virol. 2021;95(14):e0013021. Dromann D, Rupp J, Rohmann K, Osbahr S, Ulmer AJ, Marwitz S, et al. The TGF-beta-pseudoreceptor BAMBI is strongly expressed in COPD lungs and regulated by nontypeable Haemophilus influenzae. Respir Res. 2010;11(1):67. Sohail A, Iqbal AA, Sahini N, Chen F, Tantawy M, Waqas F, et al. Itaconate and derivatives reduce interferon responses and inflammation in influenza A virus infection. PLoS Pathog. 2022;18(1):e1010219. Chen F, Elgaher WAM, Winterhoff M, Bussow K, Waqas FH, Graner E, et al. Citraconate inhibits ACOD1 (IRG1) catalysis, reduces interferon responses and oxidative stress, and modulates inflammation and cell metabolism. Nat Metab. 2022;4(5):534–46. Pechous RD, Malaviarachchi PA, Banerjee SK, Byrum SD, Alkam DH, Ghaffarieh A et al. An ex vivo human precision-cut lung slice platform provides insight into SARS-CoV-2 pathogenesis and antiviral drug efficacy. bioRxiv. 2023. Pessler F, Mayer CT, Jung SM, Behrens EM, Dai L, Menetski JP, et al. Identification of novel monosodium urate crystal regulated mRNAs by transcript profiling of dissected murine air pouch membranes. Arthritis Res Ther. 2008;10(3):R64. Agrawal R, Pandey P, Jha P, Dwivedi V, Sarkar C, Kulshreshtha R. Hypoxic signature of microRNAs in glioblastoma: insights from small RNA deep sequencing. BMC Genomics. 2014;15:686. Pallares-Albanell J, Zomeno-Abellan MT, Escaramis G, Pantano L, Soriano A, Segura MF, et al. A High-Throughput Screening Identifies MicroRNA Inhibitors That Influence Neuronal Maintenance and/or Response to Oxidative Stress. Mol Ther Nucleic Acids. 2019;17:374–87. Lai J, Wang H, Pan Z, Su F. A novel six-microRNA-based model to improve prognosis prediction of breast cancer. Aging. 2019;11(2):649–62. Samir M, Vidal RO, Abdallah F, Capece V, Seehusen F, Geffers R, et al. Organ-specific small non-coding RNA responses in domestic (Sudani) ducks experimentally infected with highly pathogenic avian influenza virus (H5N1). RNA Biol. 2020;17(1):112–24. Merlo LMF, Peng W, Mandik-Nayak L. Impact of IDO1 and IDO2 on the B Cell Immune Response. Front Immunol. 2022;13:886225. Fox JM, Crabtree JM, Sage LK, Tompkins SM, Tripp RA. Interferon Lambda Upregulates IDO1 Expression in Respiratory Epithelial Cells After Influenza Virus Infection. J Interferon Cytokine Res. 2015;35(7):554–62. Cynn E, Li DY, O'Reilly ME, Wang Y, Bashore AC, Jha A, et al. Human Macrophage Long Intergenic Noncoding RNA, SIMALR, Suppresses Inflammatory Macrophage Apoptosis via NTN1 (Netrin-1). Arterioscler Thromb Vasc Biol. 2023;43(2):286–99. Lin CY, Yang ZS, Wang WH, Urbina AN, Lin YT, Huang JC et al. The Antiviral Role of Galectins toward Influenza A Virus Infection-An Alternative Strategy for Influenza Therapy. Pharmaceuticals (Basel). 2021;14(5). Lilly E, Strickler M, Milstone LM, Bunick CG. Alterations in connexin 26 protein structure from lethal keratitis-ichthyosis-deafness syndrome mutations A88V and G45E. J Dermatol Sci. 2019;95(3):119–22. Bartucci R, Salvati A, Olinga P, Boersma YL. Vanin 1: Its Physiological Function and Role in Diseases. Int J Mol Sci. 2019;20(16). Saraiva M, Vieira P, O'Garra A. Biology and therapeutic potential of interleukin-10. J Exp Med. 2020;217(1). Kelly-Robinson GA, Reihill JA, Lundy FT, McGarvey LP, Lockhart JC, Litherland GJ et al. The Serpin Superfamily and Their Role in the Regulation and Dysfunction of Serine Protease Activity in COPD and Other Chronic Lung Diseases. Int J Mol Sci. 2021;22(12). Fattaey A, Booher RN. Myt1: a Wee1-type kinase that phosphorylates Cdc2 on residue Thr14. Prog Cell Cycle Res. 1997;3:233–40. Zeyland J, Lipinski D, Slomski R. The current state of xenotransplantation. J Appl Genet. 2015;56(2):211–8. Wang T. The function of S100A4 in pulmonary disease: A review. Med (Baltim). 2023;102(14):e33466. Wen J, Meng X, Xuan B, Zhou T, Gao H, Dong H, et al. Na(+)/Ca(2+) Exchanger 1 in Airway Smooth Muscle of Allergic Inflammation Mouse Model. Front Pharmacol. 2018;9:1471. Andrikopoulos P, Kieswich J, Harwood SM, Baba A, Matsuda T, Barbeau O, et al. Endothelial Angiogenesis and Barrier Function in Response to Thrombin Require Ca2 + Influx through the Na+/Ca2 + Exchanger. J Biol Chem. 2015;290(30):18412–28. Lou J, Li X, Huang W, Liang J, Zheng M, Xu T, et al. SNX10 promotes phagosome maturation in macrophages and protects mice against Listeria monocytogenes infection. Oncotarget. 2017;8(33):53935–47. Liberzon A, Birger C, Thorvaldsdottir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 2015;1(6):417–25. Zarnegar B, Westin A, Evangelidou S, Hallgren J. Innate Immunity Induces the Accumulation of Lung Mast Cells During Influenza Infection. Front Immunol. 2018;9:2288. Graham AC, Temple RM, Obar JJ. Mast cells and influenza a virus: association with allergic responses and beyond. Front Immunol. 2015;6:238. Miyashita M, Oshiumi H, Matsumoto M, Seya T. DDX60, a DEXD/H box helicase, is a novel antiviral factor promoting RIG-I-like receptor-mediated signaling. Mol Cell Biol. 2011;31(18):3802–19. Zhang C, Li W, Lei X, Xie Z, Qi L, Wang H, et al. Targeting lysophospholipid acid receptor 1 and ROCK kinases promotes antiviral innate immunity. Sci Adv. 2021;7(38):eabb5933. He Y, Xu K, Keiner B, Zhou J, Czudai V, Li T, et al. Influenza A virus replication induces cell cycle arrest in G0/G1 phase. J Virol. 2010;84(24):12832–40. Sohail A, Iqbal AA, Sahini N, Chen F, Tantawy M, Waqas SFH, et al. Itaconate and derivatives reduce interferon responses and inflammation in influenza A virus infection. PLoS Pathog. 2022;18(1):e1010219. Kim D-j, Chung S-g, Lee S, Choi JJAJMR. Relation of microbial biomass to counting units for Pseudomonas aeruginosa. 2012;6(21):4620–2. Ma W, Brenner D, Wang Z, Dauber B, Ehrhardt C, Hogner K, et al. The NS segment of an H5N1 highly pathogenic avian influenza virus (HPAIV) is sufficient to alter replication efficiency, cell tropism, and host range of an H7N1 HPAIV. J Virol. 2010;84(4):2122–33. Koressaar T, Lepamets M, Kaplinski L, Raime K, Andreson R, Remm M. Primer3_masker: integrating masking of template sequence with primer design software. Bioinformatics. 2018;34(11):1937–8. Rao X, Huang X, Zhou Z, Lin X. An improvement of the 2^(-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat Bioinforma Biomath. 2013;3(3):71–85. Rahman RU, Gautam A, Bethune J, Sattar A, Fiosins M, Magruder DS, et al. Oasis 2: improved online analysis of small RNA-seq data. BMC Bioinformatics. 2018;19(1):54. Harris MA, Clark J, Ireland A, Lomax J, Ashburner M, Foulger R, et al. The Gene Ontology (GO) database and informatics resource. Nucleic Acids Res. 2004;32(Database issue):D258–61. Liao Y, Wang J, Jaehnig EJ, Shi Z, Zhang B. WebGestalt 2019: gene set analysis toolkit with revamped UIs and APIs. Nucleic Acids Res. 2019;47(W1):W199–205. Supplementary Files TableS1Sohailetal.DEanalysisofsncRNA.xlsx TableS2Sohailetal.DEanalysisofbulkRNA.xlsx floatimage8.png Figure S1A, Determination of viable virus particles in tissue culture supernatants within 72 h of infection (foci-forming assay). The initial viral inoculum was not removed, and the curve mostly reflects the declining viability of the inoculum ( n = 5). Figure S1B, Agreement between predicted targets of DE miRNAs in P. aeruginosa infection and DE genes observed by long RNA sequencing. Abbreviation: PA, P. aeruginosa. floatimage9.jpeg Figure S2. A, Fragments per kilobase of transcript per million mapped reads (FPKM) plot indicating equally high RNAseq efficiency across the four experimental groups. B, Frequency distribution of detected RNA species corresponding to protein-coding (mRNA), lncRNA, pseudogene transcripts, sncRNA precursors, and misc. RNA. C, Frequency distribution of DE ( p- Adj. ≤0.1) RNA species corresponding to protein-coding (mRNA), lncRNA, pseudogene transcripts, sncRNA precursors, and misc. RNA. D,E, Frequency distribution of RNA classes in infection with each of the three pathogens according to number of RNA species (D) and relative distribution (%) of each RNA class (E). Only polyadenylated lncRNA and pseudogenes are captured by the RNAseq strategy used. The total number of lncRNA and pseudogenes would be higher if polyadenylated species were included. Abbreviations: IAV, influenza A virus; BCG, Mycobacterium bovis Bacille Calmette-Guerin; PA, Pseudomonas aeruginosa. floatimage10.png Figure S3. Expression of mRNAs derived from the 8 IAV gene segments, as determined by bulk RNAseq of HLTEs 24 h p.i.. Data correspond to normalized log2 transformed CPM values. n = 5. Means, ±SEM. floatimage11.png Figure S4. Induction of five long noncoding RNA species in HLTEs by IAV. Using independently collected lung explants (n=25 tissue pieces from 14 donors), expression of RP11-202G18.1 , GBP1P1 , SIMALR , AC093063.1 , and LGALS17A RNA was measured by RT-qPCR by the Ct method, using HPRT mRNA as internal control. Expression in uninfected HLTEs was assigned the reference value of 1. CXCL10 mRNA expression was measured for comparison. ****, p < 0.0001 (Mann-Whitney U test). floatimage12.png Figure S5. Four-way plot illustrating shared and distinct regulation of gene expression by the two bacterial pathogens. Wald statistics for protein-coding RNA, lncRNA, and pseudogene RNA were plotted for PA (y-axis) and BCG infection (x-axis). A Wald statistic of ≥|2| was defined as significant. Positive values indicate upregulation, and negative values downregulation. The plot illustrates that the most significantly differentially expressed RNAs (orange dots) are regulated in the same direction by both pathogens and that the magnitude of significant differential expression was generally higher in P. aeruginosa infection. The empty quadrants (upper left and lower right) would contain genes that are regulated in opposite directions. floatimage13.png Figure S6. Gene set enrichment analysis (Hallmark Biological Pathways) based on bulk RNAseq, contrasting common and distinct biological pathways affected by infection with IAV, BCG, and P. aeruginosa. The pathways are arranged in ascending alphabetical order, with a break between “n” and “o”. NES, normalized enrichment ratio. floatimage14.jpeg Figure S7. Cell-type specific expression of 7 IAV genome segments. Mean expression and percentage of cells of the respective cell type that are infected are indicated by color and size of the dots, respectively. The background signal detected in uninfected tissue is shown in the lower half of the panel. floatimage15.jpeg Figure S8. Vulcano plots indicating differential expression in scRNAseq analysis: cell types not shown in the main figure (Figure 6). Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4499225","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":311250681,"identity":"2edbff7e-efc6-4a0d-bd4d-b44f60f7d49a","order_by":0,"name":"Aaqib Sohail","email":"","orcid":"","institution":"TWINCORE Center of Experimental and Clinical Infection Research: TWINCORE Zentrum fur Experimentelle und Klinische Infektionsforschung GmbH","correspondingAuthor":false,"prefix":"","firstName":"Aaqib","middleName":"","lastName":"Sohail","suffix":""},{"id":311250682,"identity":"f9b79e68-aa30-4f91-b995-44c606aa06be","order_by":1,"name":"Fakhar Waqas","email":"","orcid":"","institution":"TWINCORE Center of Experimental and Clinical Infection Research: TWINCORE Zentrum fur Experimentelle und Klinische Infektionsforschung GmbH","correspondingAuthor":false,"prefix":"","firstName":"Fakhar","middleName":"","lastName":"Waqas","suffix":""},{"id":311250683,"identity":"128cb868-08c7-4417-b711-4f563e366950","order_by":2,"name":"Peter Braubach","email":"","orcid":"","institution":"Hannover Medical School: Medizinische Hochschule Hannover","correspondingAuthor":false,"prefix":"","firstName":"Peter","middleName":"","lastName":"Braubach","suffix":""},{"id":311250684,"identity":"4feae004-515b-4d03-8d6f-13575b9c630d","order_by":3,"name":"Laurien Czichon","email":"","orcid":"","institution":"TWINCORE Center of Experimental and Clinical Infection Research: TWINCORE Zentrum fur Experimentelle und Klinische Infektionsforschung GmbH","correspondingAuthor":false,"prefix":"","firstName":"Laurien","middleName":"","lastName":"Czichon","suffix":""},{"id":311250685,"identity":"18ea1d49-fd17-4909-9fd8-8c93c9cb2c83","order_by":4,"name":"Mohamed Samir","email":"","orcid":"","institution":"TWINCORE Center of Experimental and Clinical Infection Research: TWINCORE Zentrum fur Experimentelle und Klinische Infektionsforschung GmbH","correspondingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"","lastName":"Samir","suffix":""},{"id":311250686,"identity":"f9031c92-092d-42dd-9cb1-531cb5ac4531","order_by":5,"name":"Azeem Iqbal","email":"","orcid":"","institution":"TWINCORE Center of Experimental and Clinical Infection Research: TWINCORE Zentrum fur Experimentelle und Klinische Infektionsforschung GmbH","correspondingAuthor":false,"prefix":"","firstName":"Azeem","middleName":"","lastName":"Iqbal","suffix":""},{"id":311250687,"identity":"b21ff4da-5592-4cdc-9568-3c0133bba208","order_by":6,"name":"Leonardo de Araujo","email":"","orcid":"","institution":"TWINCORE Center of Experimental and Clinical Infection Research: TWINCORE Zentrum fur Experimentelle und Klinische Infektionsforschung GmbH","correspondingAuthor":false,"prefix":"","firstName":"Leonardo","middleName":"","lastName":"de Araujo","suffix":""},{"id":311250688,"identity":"f8ba2b33-5553-435a-8619-78aeb1613b9d","order_by":7,"name":"Stephan Pleschka","email":"","orcid":"","institution":"Justus-Liebig-Universität Gießen: Justus-Liebig-Universitat Giessen","correspondingAuthor":false,"prefix":"","firstName":"Stephan","middleName":"","lastName":"Pleschka","suffix":""},{"id":311250689,"identity":"c565adf3-1de3-41cf-93c2-dee33fcbda60","order_by":8,"name":"Michael Steinert","email":"","orcid":"","institution":"Technische Universität Braunschweig: Technische Universitat Braunschweig","correspondingAuthor":false,"prefix":"","firstName":"Michael","middleName":"","lastName":"Steinert","suffix":""},{"id":311250690,"identity":"17ef6cd4-36d7-4cfb-b633-619c731901b3","order_by":9,"name":"Robert Geffers","email":"","orcid":"","institution":"Helmholtz-Zentrum für Infektionsforschung GmbH: Helmholtz-Zentrum fur Infektionsforschung GmbH","correspondingAuthor":false,"prefix":"","firstName":"Robert","middleName":"","lastName":"Geffers","suffix":""},{"id":311250691,"identity":"6108af07-688e-4f90-bd7b-80faa6d39923","order_by":10,"name":"Frank Pessler","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABNklEQVRIie2QMUvDQBTH31FIl7PdJCHQfIULgRRB8KtcEDoVR4lQmgtCXISsHYJ+hUyZcxzEJcXVIUOKkKmDLqKLmKsiSFJxdLjf8u7d/368uwNQKP4hQwaA2G45aIufwwgwQN32RAa4q+D8W5GlzEGTxyj9q4KiH4rMexRTNJsVVBMr5uHjxU010Q7XvPZelzAdCwZbv6uMZlM7hcYhD96lvc4aRzPPTgmlGhwxzlBSdpQTDK5Rg/BSHUVGmAkvMueuTikOUh6ywUHUnYKHL1IJbmN+9RYmIvhSdCACtcp7j4JdIwVBIfciFDJBtU+FACmkwvqUc2NFGjtt32KwQtjtFIfQGQVSIsaTou9imXHtV5YVC/7MFsIam3O7fjpeArm/29TbRfeXd5B8T7Bv//dIoVAoFB/cj26c7zvlqQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-3434-2311","institution":"Helmholtz Centre for Infection Research","correspondingAuthor":true,"prefix":"","firstName":"Frank","middleName":"","lastName":"Pessler","suffix":""}],"badges":[],"createdAt":"2024-05-29 21:00:55","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4499225/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4499225/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":59123283,"identity":"070068c4-94ab-456c-a4f4-5121624f8281","added_by":"auto","created_at":"2024-06-26 15:12:49","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":600548,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExperimental design and functional validation of the human lung tissue explants (HLTE) model.\u003c/strong\u003e \u003cstrong\u003eA,\u003c/strong\u003e Outline of the experimental procedure. After removal from the explanted lung, tissue was divided into pieces of approx. 30 mg and then incubated in medium overnight. HLTE pieces were infected with 2.0x10\u003csup\u003e5\u003c/sup\u003e FFU/ml of influenza virus strain A/Giessen /6/2009 H1N1 (in short IAV), 5x10\u003csup\u003e6 \u003c/sup\u003eCFU/ml \u003cem\u003eM. bovis\u003c/em\u003e strain H37Rv (BCG), or 1x10\u003csup\u003e8\u003c/sup\u003e/ml \u003cem\u003eP. aeruginosa \u003c/em\u003estrain PA14. All analyses were performed 24 h post infection (p.i.) unless indicated otherwise. \u003cstrong\u003eB\u003c/strong\u003e, Comparison of two methods of tissue preservation before RNA extraction. HLTE pieces were either snap frozen in liquid nitrogen (\u003cem\u003en \u003c/em\u003e= 20) or incubated in RNAlater at 4°C overnight (n=38) before storage at ‑80°C, followed by RNA extraction. Y-axis = RNA integrity number (RIN). \u003cstrong\u003eC,\u003c/strong\u003e Time course of LDH release from uninfected or IAV-infected HLTE pieces (\u003cem\u003en\u003c/em\u003e = 3 per group). LDH was measured in tissue culture supernatants and is expressed as % of LDH extracted from lysed tissue control. \u003cstrong\u003eD\u003c/strong\u003e, Time course of IAV hemagglutinin (HA) mRNA levels (RT-qPCR), indicating transcription of viral RNA (\u003cem\u003en\u003c/em\u003e = 6). \u003cstrong\u003eE,\u003c/strong\u003e Differences in cytokine/chemokine induction by infection with IAV, BCG, and \u003cem\u003eP. aeruginosa\u003c/em\u003e. Upper row: protein concentrations measured by EIA. Bottom row: mRNA levels measured by RT-qPCR relative to mock-infected HLTE, using GAPDH as internal reference. \u003cem\u003en\u003c/em\u003e = 9.\u0026nbsp; *, \u003cem\u003ep\u003c/em\u003e ≤0.05; **, \u003cem\u003ep\u003c/em\u003e ≤0.01; ***, \u003cem\u003ep\u003c/em\u003e ≤0.001; ****, \u003cem\u003ep\u003c/em\u003e ≤0.0001; \u003cstrong\u003eB-D\u003c/strong\u003e = unpaired parametric T test; \u003cstrong\u003eE\u003c/strong\u003e = Mann–Whitney U test. Data represent means ±SEM.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/5ae2f0756628fee47d1a8626.jpeg"},{"id":59122405,"identity":"d0b7224f-fd02-4b5c-9027-c00d0191f87a","added_by":"auto","created_at":"2024-06-26 15:04:49","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":602463,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eModest reprogramming in sncRNA expression in HLTE in viral and bacterial infections.\u003c/strong\u003esncRNA populations were determined by sncRNAseq 24 h after infection with IAV, BCG, and \u003cem\u003eP. aeruginosa\u003c/em\u003e, or after mock infection. Results of the DE analysis with DEseq2 are found in \u003cstrong\u003eTable S1\u003c/strong\u003e. \u0026nbsp;\u003cstrong\u003eA\u003c/strong\u003e, Detection efficiency (no. of reads) of all sncRNAs vs. sncRNAs mapping to human genome hg38. \u003cstrong\u003eB\u003c/strong\u003e, Abundance of the major sncRNA subpopulations miRNA, piRNA, snoRNA, and snRNA. \u003cstrong\u003eC, \u003c/strong\u003eAbundance of sncRNA subtypes detected at a total of ≥20 reads in all samples. \u003cstrong\u003eD\u003c/strong\u003e, Abundance of differentially expressed sncRNA subtypes (pAdj. ≤0.1). \u003cstrong\u003eE,\u003c/strong\u003ePCA showing poor separation of the four groups based on sncRNA. \u003cstrong\u003eF-H\u003c/strong\u003e, Volcano plots showing DE sncRNAs (pAdj ≤0.1, fold change [FC], ≥|2|). \u003cstrong\u003eF,\u003c/strong\u003eIAV vs. uninfected tissue. \u003cstrong\u003eG\u003c/strong\u003e, BCG vs. uninfected tissue. \u003cstrong\u003eH\u003c/strong\u003e, \u003cem\u003eP. aeruginosa\u003c/em\u003e vs. uninfected tissue. \u003cstrong\u003eI\u003c/strong\u003e, Hallmark GSEA analysis of predicted targets of DE miRNA in \u003cem\u003eP. aeruginosa\u003c/em\u003e infection.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/5c1856853f5fe852256c70c8.jpeg"},{"id":59122404,"identity":"6810facf-d149-469a-9b21-e9111ab1f44c","added_by":"auto","created_at":"2024-06-26 15:04:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":331788,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDifferential reprogramming of RNA populations by viral and bacterial infection.\u003c/strong\u003e Using RNA from the same total RNA samples as used for small RNA sequencing (Figure 2), long RNA populations were determined by RNAseq 24 h after infection or mock treatment. \u003cstrong\u003eA\u003c/strong\u003e, PCA indicating somewhat better separation than with sncRNAseq (compare Figure 2E). \u003cstrong\u003eB\u003c/strong\u003e, Venn diagram showing the number of DE mRNAs (pAdj ≤0.1, FC ≥|2| with respect to uninfected tissue) unique to each pathogen, shared between any two pathogens, or common to all three. \u003cstrong\u003eC-H\u003c/strong\u003e, Volcano plots identifying DE mRNA and lncRNA species with respect to uninfected tissue in infection with IAV (\u003cstrong\u003eC-E\u003c/strong\u003e), BCG\u003cstrong\u003e (F)\u003c/strong\u003e, and \u003cem\u003eP. aeruginosa\u003c/em\u003e (\u003cstrong\u003eG\u003c/strong\u003e), and comparing \u003cem\u003eP. aeruginosa\u003c/em\u003e vs. BCG infected HLTEs (\u003cstrong\u003eH\u003c/strong\u003e). Cutoffs were set at FC = |2| (i.e. log2 = |1|) and \u003cem\u003ep\u003c/em\u003e-Adj 0.1 (i.e. -log10 = 1).\u003c/p\u003e","description":"","filename":"floatimage312.png","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/02ae6fa3de52edb5d82d6915.png"},{"id":59122396,"identity":"6a2e3ee1-637c-4fe8-91d3-ce88be0aae60","added_by":"auto","created_at":"2024-06-26 15:04:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":54140,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eViral and bacterial infections leave different RNA signatures in HLTEs\u003c/strong\u003e. Unsupervised hierarchical biclustering analysis based on the 75 most significantly up- or downregulated mRNA and lncRNA (\u003cem\u003ep\u003c/em\u003e-value \u0026lt;7.8E-04, ANOVA across all four groups). Red bracket: RNAs comprising a 5-transcript “viral signature”. The color scheme in the 3 columns on the left shows \u003cem\u003ep\u003c/em\u003e-Adj values for DE due to infection with each pathogen compared with uninfected tissue.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/b001d0017b35822ecc026341.png"},{"id":59122401,"identity":"d942e1df-3153-4273-8201-bbdc5879cb23","added_by":"auto","created_at":"2024-06-26 15:04:49","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":590285,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGene set enrichment analysis (GSEA) based on Hallmark pathways identifies common and distinct signaling pathways in bacterial and viral infection of explanted human lung tissue\u003c/strong\u003e. mRNA expression data were extracted from the bulk RNAseq data set used for Figure 3, and a GSEA was performed using the prerank gene list from Deseq2 analysis against the Hallmark gene set collection. Significantly enriched or depleted Hallmark pathways are indicated by the triangles as detailed in the legend next to the figure. A GSEA based on Gene Ontology Biological Process (GO:BP) is shown in \u003cstrong\u003eFigure S6\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/e34840e594e2ba1cbb20778c.jpeg"},{"id":59122412,"identity":"f09ec8aa-1576-453a-8a6b-4e33637d3ba7","added_by":"auto","created_at":"2024-06-26 15:04:49","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":869096,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSingle-cell RNA sequencing identifies strongest induction of antiviral host responses in CD4, CD8+ T, NK cells, mast cells, and macrophages.\u003c/strong\u003e Single cell transcriptomes were determined in pooled single cell suspensions derived from HLTEs from donors with emphysema due to COPD 24 h after IAV infection or mock infection. \u003cstrong\u003eA, \u003c/strong\u003eIdentification of 11 cell subpopulations by uniform manifold approximation and projection (UMAP). \u003cstrong\u003eB-G,\u003c/strong\u003e Volcano plots identifying DE genes in the major immune cell types and vascular ECs. The dotted lines identify cutoffs FC = |2| (i.e. log\u003csub\u003e2\u003c/sub\u003e = |1|) and \u003cem\u003ep\u003c/em\u003e-Adj 0.1 (i.e. -log\u003csub\u003e10\u003c/sub\u003e = 1). DE in the other cell types is shown in \u003cstrong\u003eFigure S8\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/017854b215d81576a7059361.jpeg"},{"id":59123281,"identity":"f025f08e-e6e8-4619-bf53-563adedc6668","added_by":"auto","created_at":"2024-06-26 15:12:49","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":64831,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eComparison of DE Genes and functional pathways in IAV-infected HLTEs detected at the tissue or the single cell level 9. A, B. \u003c/strong\u003eVenn diagrams illustrating the relationships between DE genes identified by bulk RNAseq and by scRNAseq in different cell types. \u003cstrong\u003eA\u003c/strong\u003e, Bulk RNAseq vs. scRNAseq (pool of all cell types); \u003cstrong\u003eB\u003c/strong\u003e, Bulk RNAseq vs. scRNAseq (individual cell types indicated in the diagram). The arrow points to 6 mRNAs making up the core tissue response identified by bulk and scRNAseq. \u003cstrong\u003eC.\u003c/strong\u003e GSEA of IAV infection based on the bulk RNAseq data or scRNAseq data. Hallmark pathways (40) are listed on the vertical axis in reverse alphabetical order (top to bottom). Significantly (FDR ≤ 0.05) enriched or depleted pathways are marked with triangles as indicated in the legend on the right.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/6e0ffbcb07d9c260d78221f1.png"},{"id":59208574,"identity":"373cc105-525a-4da9-922e-bc9b3cf94afe","added_by":"auto","created_at":"2024-06-27 16:30:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4194830,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/d6e3d078-a104-4456-b069-64d751bb5782.pdf"},{"id":59122400,"identity":"f23c8a15-599c-4943-bb46-01bd854908dd","added_by":"auto","created_at":"2024-06-26 15:04:49","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1513923,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1Sohailetal.DEanalysisofsncRNA.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/cd24b1b4729e15845ca18044.xlsx"},{"id":59123282,"identity":"e726b8c6-5840-4825-ba33-85b253607aa5","added_by":"auto","created_at":"2024-06-26 15:12:49","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":8408776,"visible":true,"origin":"","legend":"","description":"","filename":"TableS2Sohailetal.DEanalysisofbulkRNA.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/73fce017a62d6ad518e5894e.xlsx"},{"id":59122397,"identity":"902377da-fbf9-40ec-aeaa-770c86a8b7bd","added_by":"auto","created_at":"2024-06-26 15:04:49","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":47262,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure S1A,\u003c/strong\u003e Determination of viable virus particles in tissue culture supernatants within 72 h of infection (foci-forming assay). The initial viral inoculum was not removed, and the curve mostly reflects the declining viability of the inoculum (\u003cem\u003en\u003c/em\u003e = 5).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFigure S1B, \u003c/strong\u003eAgreement between\u003cstrong\u003e \u003c/strong\u003epredicted targets of DE miRNAs in \u003cem\u003eP. aeruginosa\u003c/em\u003e infection\u003cstrong\u003e \u003c/strong\u003eand DE genes observed by long RNA sequencing. Abbreviation: PA, \u003cem\u003eP. aeruginosa.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/d4a61f06c3b8a310e03f1805.png"},{"id":59122399,"identity":"3a84f0ff-41ff-43bc-8f23-24fbb20e2e22","added_by":"auto","created_at":"2024-06-26 15:04:49","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":534751,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure S2. A\u003c/strong\u003e, Fragments per kilobase of transcript per million mapped reads (FPKM) plot indicating equally high RNAseq efficiency across the four experimental groups. \u003cstrong\u003eB\u003c/strong\u003e, Frequency distribution of detected RNA species corresponding to protein-coding (mRNA), lncRNA, pseudogene transcripts, sncRNA precursors, and misc. RNA. \u003cstrong\u003eC, \u003c/strong\u003eFrequency distribution of DE (\u003cem\u003ep-\u003c/em\u003eAdj. ≤0.1) RNA species corresponding to protein-coding (mRNA), lncRNA, pseudogene transcripts, sncRNA precursors, and misc. RNA. \u003cstrong\u003eD,E\u003c/strong\u003e, Frequency distribution of RNA classes in infection with each of the three pathogens according to number of RNA species (\u003cstrong\u003eD\u003c/strong\u003e) and relative distribution (%) of each RNA class (\u003cstrong\u003eE\u003c/strong\u003e). Only polyadenylated lncRNA and pseudogenes are captured by the RNAseq strategy used. The total number of lncRNA and pseudogenes would be higher if polyadenylated species were included. Abbreviations: IAV, influenza A virus; BCG, \u003cem\u003eMycobacterium bovis\u003c/em\u003e Bacille Calmette-Guerin; PA, \u003cem\u003ePseudomonas aeruginosa.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/c689adc8dad21fc8f233162d.jpeg"},{"id":59122408,"identity":"597f9ad5-058d-4f42-abe9-353f538c59e6","added_by":"auto","created_at":"2024-06-26 15:04:49","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":45267,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure S3.\u003c/strong\u003e Expression of mRNAs derived from the 8 IAV gene segments, as determined by bulk RNAseq of HLTEs 24 h p.i.. Data correspond to normalized log2 transformed CPM values. \u0026nbsp;\u003cem\u003en\u003c/em\u003e = 5. Means, ±SEM.\u003c/p\u003e","description":"","filename":"floatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/afc44d3e5660c3467be148ea.png"},{"id":59122411,"identity":"ade3abf3-f2e0-48f5-a6b2-58c4502e14ef","added_by":"auto","created_at":"2024-06-26 15:04:49","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":47470,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure S4. Induction of five long noncoding RNA species in HLTEs by IAV. \u003c/strong\u003eUsing independently collected lung explants (n=25 tissue pieces from 14 donors), expression of\u003cem\u003e RP11-202G18.1\u003c/em\u003e, \u003cem\u003eGBP1P1\u003c/em\u003e, \u003cem\u003eSIMALR\u003c/em\u003e, \u003cem\u003eAC093063.1\u003c/em\u003e, and \u003cem\u003eLGALS17A\u003c/em\u003e RNA was measured by RT-qPCR by the Ct method, using \u003cem\u003eHPRT\u003c/em\u003e mRNA as internal control. Expression in uninfected HLTEs was assigned the reference value of 1. \u003cem\u003eCXCL10\u003c/em\u003e mRNA expression was measured for comparison. ****, p \u0026lt; 0.0001 (Mann-Whitney U test).\u003c/p\u003e","description":"","filename":"floatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/adb215274703bd52b0ce3881.png"},{"id":59122410,"identity":"6d772b2d-7738-48ff-b08c-ef01e5a6cb5d","added_by":"auto","created_at":"2024-06-26 15:04:49","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":128216,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure S5.\u003c/strong\u003e Four-way plot illustrating shared and distinct regulation of gene expression by the two bacterial pathogens. Wald statistics for protein-coding RNA, lncRNA, and pseudogene RNA were plotted for PA (y-axis) and BCG infection (x-axis). A Wald statistic of ≥|2| was defined as significant. Positive values indicate upregulation, and negative values downregulation. The plot illustrates that the most significantly differentially expressed RNAs (orange dots) are regulated in the same direction by both pathogens and that the magnitude of significant differential expression was generally higher in \u003cem\u003eP. aeruginosa\u003c/em\u003e infection. The empty quadrants (upper left and lower right) would contain genes that are regulated in opposite directions.\u003c/p\u003e","description":"","filename":"floatimage12.png","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/bd5aed352f608d5ce51aa7df.png"},{"id":59122409,"identity":"424f1021-c5d8-4610-8e52-77d1f3335f6b","added_by":"auto","created_at":"2024-06-26 15:04:49","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":89245,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure S6.\u003c/strong\u003e Gene set enrichment analysis (Hallmark Biological Pathways) based on bulk RNAseq, contrasting common and distinct biological pathways affected by infection with IAV, BCG, and \u003cem\u003eP. aeruginosa. \u003c/em\u003eThe pathways are arranged in ascending alphabetical order, with a break between “n” and “o”. NES, normalized enrichment ratio.\u003c/p\u003e","description":"","filename":"floatimage13.png","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/796c52091aff5fd237f8f1bb.png"},{"id":59122413,"identity":"a01b0a25-5ed1-423c-9249-3ac9cb45267a","added_by":"auto","created_at":"2024-06-26 15:04:49","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":536608,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure S7.\u003c/strong\u003e \u003cstrong\u003eCell-type specific expression of 7 IAV genome segments.\u003c/strong\u003e Mean expression and percentage of cells of the respective cell type that are infected are indicated by color and size of the dots, respectively. The background signal detected in\u003cstrong\u003e \u003c/strong\u003euninfected tissue is shown in the lower half of the panel.\u003c/p\u003e","description":"","filename":"floatimage14.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/836ce6a9a8a13ff36694b225.jpeg"},{"id":59122407,"identity":"e615c9f3-a621-4a0f-b9bf-0ea0f47cf489","added_by":"auto","created_at":"2024-06-26 15:04:49","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":422666,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure S8. \u003c/strong\u003eVulcano plots indicating differential expression in scRNAseq analysis: cell types not shown in the main figure (\u003cstrong\u003eFigure 6\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"floatimage15.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4499225/v1/169209df772205b482415e2d.jpeg"}],"financialInterests":"","formattedTitle":"Differential transcriptomic host responses in the early phase of viral and bacterial infections in human lung tissue explants ex vivo","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe first 24 h of infection form a critical time window in interactions between many pathogens and host tissue, as they include attachment to and invasion of target cells, recognition of pathogens by cellular sensors and, in many cases, the first replication cycles of the pathogen. Insights into changes in host RNA expression are particularly important for our understanding of this early phase because they mediate a major part of the immediate early cell and tissue responses by enabling the required coordinated changes in gene expression. In addition, due to the high dynamic range in expression change of long RNAs and the association of small RNAs such as microRNA (miRNA) with central regulatory switches, RNA molecules have proven high potential as accurate biomarkers for disease-specific processes. For pulmonary infections, this has predominantly been shown by analysis of peripheral blood RNA from patients with established disease (e.g., (\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e)). However, to better capture pathophysiological processes in the target organ itself, it would be highly desirable to analyze lung tissue directly. While this is technically possible by transbronchial biopsy and may be clinically justified in difficult-to-diagnose cases, it is usually not clinically or ethically feasible within the very early phase of infection with a known causative pathogen. Even though there are well-established animal and cell culture models to study human lower respiratory tract infections, they cannot fully represent the events seen in intact human lung tissue. Organotypic culture of human lung tissue explants (HLTE) has been successfully used to overcome some of these drawbacks. The HLTE model is based on \u003cem\u003eex vivo\u003c/em\u003e cultivation of human lung tissue that has been removed for medical reasons, for instance in the context of tumor surgery or lung transplantation. The majority of studies have featured a refined version of the HLTE model based on precision cut lung slices (PCLS, reviewed in (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e)). In this model, the tissue is embedded in low-melting agarose and then sectioned, thus preserving tissue architecture better during subsequent culture. However, the PCLS model is labor-intensive and embedding the tissue in agarose may interfere with subsequent analyses of the tissue, for instance by RNA sequencing. The classic organotypic HLTE model, therefore, still constitutes an attractive option, in particular if more sophisticated tissue analyses by \u0026ndash;omics technologies are planned. Regarding respiratory infections, it has been demonstrated that HLTEs can support invasion and replication of viral, bacterial, and fungal pathogens and reproduce cardinal aspects of the expected host responses (\u003cspan additionalcitationids=\"CR7 CR8 CR9 CR10 CR11 CR12 CR13 CR14 CR15 CR16\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). Tumor-free tissue margins from lung tumor surgery were used in most of these studies, but tissue from patients with chronic obstructive pulmonary disease (COPD) was successfully used to study cytokine responses to \u003cem\u003eH. influenza\u003c/em\u003e and influenza A virus (IAV) (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e) and the anti-inflammatory effect of citraconic acid on IAV infection (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Explanted lung tissue from patients with an indication for lung transplantation for lung failure from obstructive lung disease would, therefore, be an attractive source of HLTEs for studies of lower respiratory infections in medical centers with a high volume of lung transplantation. However, it remains unknown whether tissue which has been compromised by a long-standing disease process leading to respiratory insufficiency not only supports replication of key human pathogens \u003cem\u003eex vivo\u003c/em\u003e but also yields valid data about transcriptomic host responses.\u003c/p\u003e \u003cp\u003eRNA sequencing enables profiling of both long and small RNAs of different classes from a single sample, which is referred to as integrative RNA sequencing. For infection research, a particularly attractive feature is that expression of viral RNAs is also captured from the same sample, allowing to identify infected host cells and to compare host responses in infected vs. noninfected (bystander) cells. Both bulk and single-cell RNA sequencing have been employed to characterize RNA expression changes in human lung tissue. For instance, Alfi et al. applied bulk RNA sequencing to HLTEs from tumor surgery to assess transcriptomic responses to SARS-CoV-2 in upper and lower respiratory tract (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e), whereas single-cell RNA sequencing (scRNAseq) of PCLS was recently used to study antiviral drugs against SARS-CoV-2 (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). However, there are no studies featuring bulk or scRNAseq of organotypic HLTEs to compare transcriptomic tissue responses to viral vs. bacterial pathogens.\u003c/p\u003e \u003cp\u003eThe aims of the present study were (i) to describe differences in early transcriptomic host responses due to viral vs. bacterial infections of human lung tissue \u003cem\u003eex vivo\u003c/em\u003e, (ii) to dissect host responses to IAV at the single-cell level, and (iii) to identify IAV infected cell types. Specifically, we have adapted HLTE culture of tissue from patients with indication for lung transplantation due to advanced emphysema and used (i) integrated RNA sequencing of small and long RNA classes to evaluate early RNA expression changes following infection with IAV, \u003cem\u003eMycobacterium bovis\u003c/em\u003e Bacille Calmette-Guerin (BCG), and \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e, and (ii) single-cell RNA sequencing to identify host mRNA expression changes and expression of viral transcripts in IAV infection at the single cell level. We find that the tissue explants faithfully reproduce the expected pathogen-specific responses at the tissue and single-cell level and allow (i) validating, in human tissue, RNA biomarkers that had been previously identified in cellular or animal models, and (ii) the discovery of novel infection-associated RNA molecules that can be validated in future studies.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eEstablishment of the infection model.\u003c/b\u003e The work flow of a typical experiment is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. In order to optimize RNA quality for RNAseq, we compared two methods for RNA isolation. In the first method, the lung tissue pieces were incubated with RNAlater for 24 h at 4\u0026deg;C and then stored at -80\u0026deg;C in RNAlater prior to extraction. In the second method, they were snap frozen in liquid nitrogen and then stored at -80\u0026deg;C. The liquid nitrogen method yielded significantly higher RNA Integrity Numbers (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) and was thus used throughout. We measured LDH release in uninfected and IAV-infected HLTEs in order to assess spontaneous degradation of tissue during culturing and potential virus-induced cytopathic effects. LDH was released throughout the 72 h time course, reaching maximum values of about 7% and 12% in uninfected and infected HLTEs, respectively, indicating a mild-moderate cytopathic effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). To assess whether the HLTE model supports release of active IAV particles, we employed the immuno-foci assay to quantify replication-competent virus particles in the supernatant and measured viral RNA transcription through HA mRNA quantification. An apparent decline of replication-competent virus particles in the supernatant was noted over a 72 h period (\u003cb\u003eFigure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA\u003c/b\u003e). This was likely due to the fact that the initial viral inoculum was not replaced by virus-free medium, and it was thus concluded that viral titers in supernatant could not be used to measure viral replication. On the other hand, viral HA mRNA expression increased steadily and peaked by 48 h post infection (p.i.) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). However, significant inter- and intra-donor variation was observed, likely due to differences in tissue integrity and cell type proportions between samples. To verify whether the tissues could mount the expected differential responses to IAV and the two bacterial pathogens (\u003cem\u003eP. aeruginosa\u003c/em\u003e and BCG) in the first 24 h of infection, we measured several classic cytokines in supernatants and the corresponding mRNAs in tissue lysates (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). As expected, CXCL10 and IFNγ levels were highest in influenza infection, whereas IL6, IL10, IL1β, and PROK2 (which is highly inducible in macrophages by LPS and other TLR2/4 agonists (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e)) reached higher levels in the bacterial infections. Taken together, these results suggested that HLTEs from emphysema patients constituted a valid model to study early transcriptomic tissue responses to viral and bacterial infections \u003cem\u003eex vivo\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eModest reprogramming of small noncoding RNA (sncRNA) populations.\u003c/b\u003e Small (\u0026lt;\u0026thinsp;50 nucleotides long) RNA sequencing of total RNA extracted 24 h p.i. revealed the expected sequencing depth: a mean 8.3*10\u003csup\u003e7\u003c/sup\u003e reads were obtained per sample; a mean 4.4*10\u003csup\u003e7\u003c/sup\u003e of these passed the length filter, of which 2.8*10\u003csup\u003e7\u003c/sup\u003e could be mapped to the human genome (hg38) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). By sncRNA class, most reads mapped to miRNAs and substantially fewer to PIWI-interacting RNA (piRNA) and small nucleolar RNA (snoRNA) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Very few reads mapped to small nuclear RNA (snRNA) and ribosomal RNA (rRNA), which was consistent with the high quality of the input RNA. After filtering out lowly expressed sncRNA (\u0026lt;\u0026thinsp;20 reads in the four experimental groups combined), piRNA contributed the highest number of sncRNA species, followed by miRNA. However, the majority of the differentially expressed (DE; \u003cem\u003ep\u003c/em\u003e-Adj\u0026thinsp;\u0026le;\u0026thinsp;0.1) sncRNA species were miRNA followed by piRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC,D). A principal component analysis (PCA) did not reveal global differences in the sncRNA populations of the 4 groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Indeed, there were only 2 DE piRNAs in IAV infection vs. uninfected tissue and 1 DE piRNA in BCG infection vs. uninfected tissue, and their expression in uninfected tissue was already low, indicating that their functional significance is uncertain (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF,G\u003cb\u003e)\u003c/b\u003e. On the other hand, more substantial expression changes were observed in \u003cem\u003eP. aeruginosa\u003c/em\u003e infection. 20 sncRNA were DE: 13 miRNA, 6 piRNA, and 1 snRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). Among the DE miRNAs, mir-410-5p and miR-665 have been linked to increased cell proliferation and are candidate biomarkers for cancer. Decreased expression of one of the downregulated miRNA, miR-7974, has been reported in hypoxia (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e) and oxidative stress (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e), and increased expression in breast tumor tissue (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). A gene set enrichment (GSEA) analysis of predicted mRNA targets of the miRNA DE in \u003cem\u003eP. aeruginosa\u003c/em\u003e infection suggested activation of pathways related to peroxisomes, inflammation, and cell cycle (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI). However, statistical significance was modest. Nonetheless, DE of about 10% of the predicted mRNA targets could be verified in the long RNAseq dataset (\u003cb\u003eFigure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB\u003c/b\u003e) and DE of additional predicted targets would be expected at later time points. piRNAs were the 2nd most significantly DE sncRNA class in \u003cem\u003eP. aeruginosa\u003c/em\u003e infection and were notably overrepresented among the most strongly DE sncRNA (e.g., piR_010299). piRNAs have been implicated in tissue responses to infections in humans (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) and animals (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e), suggesting that their DE in this HLTE model is pathophysiologically significant.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMarked reprogramming in long RNA (mRNA, long noncoding RNA, pseudogene RNA) populations reveals signatures for bacterial vs. viral infection.\u003c/b\u003e Sequencing of long RNA (\u0026gt;\u0026thinsp;100 nucleotides long) revealed deep coverage in all samples in that we obtained a mean (SD) 42.1 x 10\u003csup\u003e6\u003c/sup\u003e (\u0026plusmn;7.3 x 10\u003csup\u003e6\u003c/sup\u003e) reads mapping to protein-coding RNA (mRNA), long noncoding RNA (lncRNA and long intervening noncoding RNA, lincRNA), and pseudogene RNA species. To examine the spread of RNAseq data across the four groups, we generated a graphical representation of Fragments Per Kilobase Million (FPM) for each group. The plot illustrates that the data are equally distributed across all groups (\u003cb\u003eFigure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eA\u003c/b\u003e). With respect to both total and DE RNA, the majority of reads mapped to protein-coding RNA, followed by lncRNA and then pseudogene RNA in infection with all three pathogens (\u003cb\u003eFigure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eB-D\u003c/b\u003e), whereby the percentages of the four captured RNA classes (protein-coding RNA, lncRNA, lincRNA, pseudogenes) in the DE RNAs were similar across infection with the three pathogens (\u003cb\u003eFigure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eE\u003c/b\u003e). A PCA based on all species of long RNA suggested similarities between IAV infection and control samples on the one hand and between the two bacterial infections on the other hand (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Still, no clear separation was seen even though expression changes were substantially greater than in the sncRNA populations. Nonetheless, it was evident that the extent of differential expression increased from IAV (n\u0026thinsp;=\u0026thinsp;131 DE RNAs) over BCG (n\u0026thinsp;=\u0026thinsp;964 DE RNAs) to \u003cem\u003eP. aeruginosa\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;2423 DE RNAs) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eHigh levels of mRNA corresponding to all 8 IAV genome segments were detected in the IAV-infected samples, but only background signals in the other three groups, thus evidencing successful IAV infection of the HLTEs used for the RNAseq analysis (\u003cb\u003eFigure S3\u003c/b\u003e). Volcano plots were then used to visualize differences between the three pathogens in DE with respect to uninfected tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-H). In IAV infection, 131 RNAs were DE with respect to uninfected tissue. Several mRNAs were highly upregulated which are known to be strongly associated with host responses to influenza virus infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). In particular, \u003cem\u003eCCL8\u003c/em\u003e, \u003cem\u003eCXCL9\u003c/em\u003e, \u003cem\u003eGBP1\u003c/em\u003e, \u003cem\u003eIFI44L\u003c/em\u003e, \u003cem\u003eIFI6\u003c/em\u003e, \u003cem\u003eIFNL2\u003c/em\u003e, \u003cem\u003eIL27\u003c/em\u003e, \u003cem\u003eISG15\u003c/em\u003e, \u003cem\u003eMX1\u003c/em\u003e, and \u003cem\u003eMX2\u003c/em\u003e are all contained in the Gene Ontology (GO) term \u003cem\u003eBP 0009615 response to virus\u003c/em\u003e \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e, thus providing further evidence that the HLTE mounted the expected anti-IAV innate immune response. Furthermore, we noted 19 lncRNAs and lincRNAs among the DE RNAs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Of note, lncRNAs \u003cem\u003eADAM2-2\u003c/em\u003e (ENSG00000253939), \u003cem\u003eSIMALR\u003c/em\u003e (suppressor of inflammatory macrophage apoptosis lncRNA, ENSG00000226004), \u003cem\u003eLINC02865\u003c/em\u003e (ENSG00000229922), \u003cem\u003eLGALS17A\u003c/em\u003e (ENSG00000226025), and \u003cem\u003eLGALS14\u003c/em\u003e (ENSG00000269460) were among the most highly upregulated transcripts in IAV infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). \u003cem\u003elnc-ADAM2-2\u003c/em\u003e is a novel gene which encodes antisense RNA to the genes encoding the IDO1 and IDO2 enzymes, both of which have immunomodulatory functions in influenza virus infection (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). lncRNA \u003cem\u003eSIMALR\u003c/em\u003e and lincRNA \u003cem\u003eLINC02865\u003c/em\u003e (a suppressor of inflammatory macrophage apoptosis) are transcribed from overlapping sequences on chromosome 6. They have emerged as novel regulators of macrophage biology by suppressing inflammatory macrophage apoptosis via Netrin-1 (NTN1) (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e) and are located just downstream of the gene encoding the anti-inflammatory deubiquitinase TNFAIP3 (also known as A20). \u003cem\u003eLGALS17A\u003c/em\u003e and its downstream lncRNA \u003cem\u003elnc-LGALS14\u003c/em\u003e share a genomic location on Chromosome 19 with galectins, which possess antiviral functionality in IAV infection (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). \u003cem\u003eLGALS17A\u003c/em\u003e and \u003cem\u003elnc-LGALS14\u003c/em\u003e are derived from a galectin pseudogene, and \u003cem\u003eLGALS17A\u003c/em\u003e has previously been identified as an IFN-stimulated transcript (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). In addition, they are located downstream of a gene cluster relating to type III IFN responses, of which INFL2 was significantly upregulated in the current dataset, whereas upregulation of IFNL1 and 3 was less significant (\u003cem\u003ep\u003c/em\u003e Adj\u0026thinsp;\u0026gt;\u0026thinsp;0.1). We then aimed to validate the expression of a subset of the DE lncRNA, lincRNA and pseudogene RNAs by RT-qPCR. Robust PCR assays could be established for \u003cem\u003eRP11-202G18.1\u003c/em\u003e, \u003cem\u003eGBP1P1\u003c/em\u003e, \u003cem\u003eSIMALR\u003c/em\u003e, \u003cem\u003eAC093063.1\u003c/em\u003e, and \u003cem\u003eLGALS17A.\u003c/em\u003e Indeed, expression of all five increased significantly 24 h after IAV infection, but to lower levels than \u003cem\u003eCXCL10\u003c/em\u003e mRNA, which was measured for comparison (\u003cb\u003eFigure S4\u003c/b\u003e).\u003c/p\u003e \u003cp\u003eTranscriptomic tissue responses to the two bacterial pathogens were much more extensive than to IAV (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF,G), and there was considerable overlap in DE RNAs, even though \u003cem\u003eP. aeruginosa\u003c/em\u003e and BCG belong to two different phyla and differ significantly in their interactions with host cells. 781 long RNA species were DE (with respect to uninfected tissue) in infection by both bacterial pathogens, but not in IAV infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), and a four-way plot based on Wald statistic suggested that all genes that were DE by both bacterial pathogens were regulated in the same direction (\u003cb\u003eFigure S5\u003c/b\u003e). This plot identified \u003cem\u003eGJB2\u003c/em\u003e as the gene that was most robustly upregulated in both bacterial infections. \u003cem\u003eGJB2\u003c/em\u003e encodes gap junction binding protein 2, a connexin which plays roles in epithelial barrier integrity (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e) and is known for its importance in lung adenocarcinoma. Little is known about its role in inflammation or infections, but it is listed in GO:BP gene set RESPONSE_TO_BACTERIUM (GO:0009617). \u003cem\u003eVNN1\u003c/em\u003e encodes vanin 1, an oxidative stress sensor that is part of the tissue response to oxidative stress and inflammation in a variety of organs (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). The most specifically and strongly regulated RNAs were found in \u003cem\u003eP. aeruginosa\u003c/em\u003e infection. In addition to \u003cem\u003eGJB2\u003c/em\u003e and \u003cem\u003eVNN1\u003c/em\u003e, the most significantly (Wald test statistic) upregulated mRNAs were \u003cem\u003eDUSP4\u003c/em\u003e (encoding dual specificity phosphatase 4, a protein tyrosine/serine/threonine phosphatase involved in mitogenic signal transduction), \u003cem\u003eIL10\u003c/em\u003e (encoding a predominantly anti-inflammatory cytokine (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e)), and \u003cem\u003eSERPINB7\u003c/em\u003e (encoding a member of the serpin family of protease inhibitors, which have anti-inflammatory and anticoagulant properties and counteract proteolytic tissue destruction (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e)). The RNAs that were most significantly downregulated by both pathogens were \u003cem\u003ePKMYT1\u003c/em\u003e (encoding a kinase that inhibits G2/M transition in the cell cycle (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e)), \u003cem\u003eGGTA1P\u003c/em\u003e (encoding an enzymatically inactive alpha-1,3-galactosyltransferase involved in immune regulation (e.g., (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e)), and \u003cem\u003eS100A4\u003c/em\u003e (encoding the S100 Ca\u003csup\u003e++\u003c/sup\u003e-binding protein S4, which furthers cell motility, migration, and invasion (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e)). All three genes were downregulated more significantly by \u003cem\u003eP. aeruginosa\u003c/em\u003e than by BCG. In spite of the strong agreement between \u003cem\u003eP. aeruginosa\u003c/em\u003e and BCG in terms of directionality of DE, some degree of DE between the two bacterial infections was apparent. This is evidenced in the four-way plot (see RNAs marked in green [significant only in BCG infection] and violet [significant only \u003cem\u003ein P. aeruginosa\u003c/em\u003e infection] in \u003cb\u003eFigure S5\u003c/b\u003e as well as in the volcano plot shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH.\u003c/p\u003e \u003cp\u003eIn hierarchical clustering analysis based on the 75 most significantly DE RNA selected by ANOVA across all four experimental groups (\u003cem\u003ep\u003c/em\u003e values: 3.6E-06\u0026ndash;7.8E-04), there was a remarkably clear separation in that the bacterial infections clustered in one clade and within it BCG and \u003cem\u003eP. aeruginosa\u003c/em\u003e into separate subclades (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Separation of IAV infection from uninfected tissue was also excellent in that only one IAV-infected and one control sample were classified in the same subclade. Even though there were much fewer DE RNAs in IAV infection than in the bacterial infections, this hierarchical clustering analysis revealed a distinct \u0026ldquo;viral\u0026rdquo; signature, which consisted of 5 upregulated RNAs (marked red in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI). Three of these (\u003cem\u003elnc-DDX60-1\u003c/em\u003e [ENSG00000248601,] \u003cem\u003elnc-THOC3-2\u003c/em\u003e [ENSG00000248596)], and \u003cem\u003eRP11-202G18.1\u003c/em\u003e [ENSG00000227531] are transcripts of unknown function which may arise during transcription of neighboring genes related to cellular responses to infection and inflammation. \u003cem\u003eSLC8A1\u003c/em\u003e encodes the Na\u003csup\u003e+\u003c/sup\u003e/Ca\u003csup\u003e++\u003c/sup\u003e exchange channel NCX1, which is expressed in a variety of cell types and plays roles in mediating airway smooth muscle responses to inflammation (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e) and thrombin-induced increased endothelial permeability (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). \u003cem\u003eSNX10\u003c/em\u003e (sorting nexin 10) is an important differentiation factor of myeloid cells and supports a proinflammatory phenotype of macrophages (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGSEA analysis based on Hallmark pathways revealed pathogen-specific regulation of functional pathways, but also common features shared among the three types of infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Several pathways were commonly upregulated by all three pathogens. These related to innate immune system signaling (\u003cem\u003eIFNG response\u003c/em\u003e, \u003cem\u003eIFNA response\u003c/em\u003e, \u003cem\u003einflammatory response\u003c/em\u003e, \u003cem\u003eIL6_JAK_Stat3 signaling\u003c/em\u003e, \u003cem\u003eTNFA signaling via NFKB\u003c/em\u003e), other aspects of innate immune activation (\u003cem\u003eallograft rejection\u003c/em\u003e, \u003cem\u003ecomplement activation\u003c/em\u003e), and apoptosis. One commonly downregulated pathway was \u003cem\u003ecell cycle progression: E2F targets\u003c/em\u003e, indicating inhibition of cell proliferation by all three pathogens. The two bacterial infections could be distinguished from IAV infection by weaker induction of type I and type II IFN signaling, but stronger enrichment of signaling pathways such as \u003cem\u003eIL2_Stat5_signaling\u003c/em\u003e, \u003cem\u003eIL6_STAT3 signaling\u003c/em\u003e, \u003cem\u003eprogrammed cell death\u003c/em\u003e, and \u003cem\u003eKRAS signaling (upregulated genes)\u003c/em\u003e. In contrast, depletion of \u003cem\u003emyc targets\u003c/em\u003e, reflecting decreased cellular processes and cell cycle, and enrichment of \u003cem\u003eKRAS signaling (downregulated genes)\u003c/em\u003e were unique for IAV infection. The pathways uniquely regulated in \u003cem\u003eP. aeruginosa\u003c/em\u003e infection reflected a more vigorous induction of compensatory tissue responses such as \u003cem\u003eformation of tight junctions, protein secretion\u003c/em\u003e, and \u003cem\u003emetabolism of xenobiotics\u003c/em\u003e. \u003cem\u003eAdipocyte development\u003c/em\u003e and \u003cem\u003ep53 pathway\u003c/em\u003e were the only two pathways that were uniquely differentially regulated in BCG-infected tissue only. Taken together, these results provide further evidence that this HLTE model recapitulates classic tissue responses to infectious agents and reveals pathophysiologically plausible differences between the responses to viral vs. bacterial pathogens.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCell type-specific responses to IAV infection.\u003c/b\u003e We then tested whether the HLTE could be used to dissect interactions between IAV and lung tissue at the single cell level and applied the 10x genomics single-cell RNA sequencing (scRNAseq) platform to single cell suspensions from IAV infected and uninfected HLTE from the same donor (a patient with indication for lung transplantation due to COPD) 24 h after IAV or mock infection. To correct for differences among individual HLTE pieces, single cell suspensions from 12 infected and 12 uninfected HLTE pieces were pooled to yield one infected and one uninfected sample for single cell analysis. After excluding dead cells by FACS, we loaded cells (n\u0026thinsp;=\u0026thinsp;4500) for a targeted recovery of 3500 cells from each pooled sample at a sequencing depth to obtain 50 k reads per cell. Using cell-specific markers to identify cell clusters allowed identification of 11 cell types (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). These included the expected functional cell types of lower airways (airway epithelial cells, multiciliated cells, endothelial cells) and the major immune cell types: macrophages, monocytes, mast cells, B cells, CD4\u0026thinsp;+\u0026thinsp;and CD8\u0026thinsp;+\u0026thinsp;T cells, and NK cells. Mito_high T cells correspond to apoptotic T cells with high mitochondrial DNA content, indicating cell death, and were excluded from the host cell gene expression analyses. We then aimed to identify cells containing viral RNAs (\u003cb\u003eFigure S7\u003c/b\u003e). Since IAV is a negative sense RNA virus, viral mRNA is transcribed from the negative sense (-) strand, and identification of a viral transcript (+\u0026thinsp;strand) therefore reflects viral transcription. However, by scRNAseq it is not easily possible to distinguish between intracellular viral mRNA synthesis in infected cells and uptake or binding of free viral mRNA from the extracellular environment. Of the eight viral genome segments, RNA corresponding to the segment encoding M1 and M2 proteins could not be detected for unknown reasons. Of the remaining seven segments, NS and HA mRNAs were the most abundant, which is consistent with the viral life cycle. Strongest viral mRNA expression per infected cell was seen in epithelial cells, the main host cell supporting productive IAV infection, followed by macrophages, which are known to support a nonproductive IAV infection and contribute to antiviral immune responses. However, there was clear evidence of viral transcripts also in association with the other cell types, whereby levels were lowest in endothelial cells, mast cells, and monocytes. Comparing DE between the same cell types in single cell suspensions from infected and uninfected HLTE enabled us to assess transcriptomic responses in the 10 cell types (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB-G, \u003cb\u003eFigure S8\u003c/b\u003e). CD4 T cells (72 DE genes), CD8 T cells (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e), macrophages (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e), NK cells (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e), and mast cells (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e) mounted the briskest transcriptional responses, whereas only weak responses were seen in multiciliated cells (0), B cells (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e), endothelial cells (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e), epithelial cells (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e), and monocytes (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Thus, the most robust antiviral host responses did not originate from the main target cells supporting viral transcription (epithelial cells) but from other cell types with less or no evidence of viral mRNA.\u003c/p\u003e \u003cp\u003eA comparison of DE genes identified by bulk RNAseq and scRNAseq showed that scRNAseq identified 19% of the DE genes that were identified by bulk RNAseq, but it also demonstrated that 89 DE genes were revealed by scRNAseq only (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). Of note, six genes (\u003cem\u003eIFI44L\u003c/em\u003e, \u003cem\u003eMX1\u003c/em\u003e, \u003cem\u003eMX2\u003c/em\u003e, \u003cem\u003eIRF7\u003c/em\u003e, \u003cem\u003eIFI6\u003c/em\u003e, and \u003cem\u003eISG15\u003c/em\u003e) were identified by scRNAseq as DE in all major immune cells as well as by bulk RNAseq and thus constituted the core of the anti-IAV transcriptomic tissue response in this early time window of IAV infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eThus, this analysis supported the notion that IAV infects the expected cell types in this HLTE model, that antiviral and inflammatory responses are to some extent due to responses in noninfected \u0026ldquo;bystander\u0026rdquo; cells, and that scRNAseq may identify DE transcripts that are not detected as differentially expressed by bulk RNAseq.\u003c/p\u003e \u003cp\u003eWe then assessed differences among the cell types in terms of functional responses to IAV infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). GSEA (Hallmark) revealed that type 1 and 2 IFN responses were induced in all cell types except B cells. CD4\u0026thinsp;+\u0026thinsp;T cells and macrophages were the most responsive in that the most pathways (six in each cell type) were regulated. Notably, \u003cem\u003eTNFA signaling induced by NFKB\u003c/em\u003e was enriched only in macrophages and monocytes. We then compared GSEA in each of the cell types to the GSEA performed at the tissue level (bulk RNAseq). Regulation of hallmark pathways (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e) related to interferon response, inflammation, and MYC targets was detected at the tissue and the single-cell level, whereas five pathways were detected only by scRNAseq.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eWe have characterized transcriptomic changes in \u003cem\u003eex vivo\u003c/em\u003e HLTEs from patients with end-stage emphysema in response to \u003cem\u003ein vitro\u003c/em\u003e infection with IAV and two phylogenetically distinct bacterial pathogens during the first 24 h of infection. The validity of this model is supported by the expected cytokine responses and, in the case of IAV, viral RNA replication. \u003cem\u003eEx vivo\u003c/em\u003e infections of human lung tissue are usually performed in histologically normal tissue such as tumor-free margins from tissue resected during lung tumor surgery. However, in centers with a high volume of lung transplantation, explants from patients with terminal pulmonary disease may be available more frequently. This additional source of human lung tissue will, hopefully, enhance the use of HLTEs for \u003cem\u003eex vivo\u003c/em\u003e infections, thus helping to reduce the use of animal models. However, certain limitations should be considered when interpreting results from HLTEs. Firstly, since the tissue is washed and mostly bloodless, there are no intravascularly circulating immune cells. Secondly, depending on the underlying disease leading to the need for lung transplantation, the tissue may already possess an elevated state of inflammation (\u0026ldquo;pre-inflamed\u0026rdquo;) and some cell types may not be fully functional, may be underrepresented, or even absent. Nonetheless, scRNAseq demonstrated the presence of all cardinal target cells and the expected cellular responses to IAV infection in the various cell types. We focused on emphysema because it is a frequent indication for lung transplantation at our center. After an early pilot study, we excluded HLTEs from patients with cystic fibrosis because of overgrowth with pathogenic bacteria including \u003cem\u003eP. aeruginosa\u003c/em\u003e and we excluded HLTEs from patients with pulmonary fibrosis because they did not support IAV RNA replication well (Sohail, Samir \u0026amp; Pessler, unpublished data). Further studies should explore the usefulness of HLTEs from other disease indications for lung transplantation such as pulmonary hypertension, sarcoidosis, and others.\u003c/p\u003e \u003cp\u003eOverall, our data suggest that this model is not optimal for identifying infection-associated sncRNAs, at least for IAV and BCG infection. Nonetheless, DE of pathophysiologically plausible miRNA could be identified in \u003cem\u003eP. aeruginosa\u003c/em\u003e infection. Of note, we also found that expression of the lesser-known sncRNA classes (notably piRNA) changed substantially during \u003cem\u003eP. aeruginosa\u003c/em\u003e infection. Bulk RNAseq of both coding and noncoding long RNAs revealed strong transcriptomic \u0026ldquo;footprints\u0026rdquo; which differed substantially between IAV and the bacterial infections. As expected from an acute \u003cem\u003eP. aeruginosa\u003c/em\u003e infection, transcriptomic changes (with respect to uninfected tissue) were substantially more pronounced than in BCG infection. However, only very few genes were DE in a two\u0026ndash;group comparison between \u003cem\u003eP. aeruginosa\u003c/em\u003e and BCG, suggesting that the interactions of these two distinct pathogens with host tissue \u003cem\u003eex vivo\u003c/em\u003e in the first 24 h of infection share cardinal features and differ mostly in terms of intensity of the interaction. P. aeruginosa more commonly causes colonization or subacute disease, and BCG only causes clinical disease in immunocompromised individuals. Thus, pathogens that cause acute lower airway infections, e.g. pneumococci, would likely lead to even more pronounced transcriptome changes in this HLTE model.\u003c/p\u003e \u003cp\u003eWe validated several genes that had been implicated in host responses to bacterial infections in other models, notably \u003cem\u003eGJB2, VNN1\u003c/em\u003e, and \u003cem\u003eDUSP4.\u003c/em\u003e These results underscore the value of this HLTE model for the validation of genes that were identified in the context of other pathogens, species or model types such as cellular models. We found weak expression of viral transcripts in mast cells. Influenza A virus infection of mast cells is of considerable clinical interest, as this virus can trigger hypersensitivity reactions such as asthma and COPD exacerbation in susceptible individuals (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). Our results suggest that only a small percentage of mast cells harbored IAV mRNA. Further research is, therefore, required to determine the role of direct infection of mass cells to these hypersensitivity reactions. The identification of the 5-gene \u0026rdquo;IAV signature\u0026rdquo; is particularly intriguing. The sequences encoding the three lncRNAs in this signature are all located adjacent to protein-coding genes involved in inflammation and host responses to influenza viruses and are likely co-transcribed with these genes. For instance, \u003cem\u003elnc-DDX60-1\u003c/em\u003e is located downstream of the \u003cem\u003eDDX60\u003c/em\u003e gene, which encodes an RNA binding protein involved in antiviral responses (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e), and \u003cem\u003eRP11-202G18.1\u003c/em\u003e is located upstream of \u003cem\u003eLPAR1\u003c/em\u003e, which encodes a G-protein coupled receptor involved in pulmonary fibrosis and response to tissue damage and infectious agents (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). Thus, they may mostly reflect induction of antiviral responses in lung tissue but it is unclear whether they play any functional role. There is a great clinical need for biomarkers that can distinguish between viral and bacterial infections early in the infection in order to start the correct antibacterial or antiviral treatment as early as possible. Further research is necessary to test whether expression of these RNAs can be measured in easier-to-obtain biosamples such as peripheral blood, sputum, or bronchoalveolar lavage and to test whether they are consistently more highly expressed in viral than bacterial infections.\u003c/p\u003e \u003cp\u003eThe scRNAseq analysis identified cells with low levels or no IAV mRNA as important sources of IFN responses. This agrees well with previous reports of inflammatory responses originating from such bystander cells. For instance, in a study of IAV infection of human PBMCs we found that viral transcripts were only associated with monocytes, but interferon responses also with T cells, B cells, and NK cells (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRegulation of cell cycle was a recurring theme in the GSEAs, with a preponderance of cell cycle inhibition. It is well known that IAV infection favors a G0/G1-phase cell cycle arrest in infected cells in order to channel cell resources into production of progeny virions (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e). Further research is required to assess the functional implications of the observed cell cycle arrest in the bacterially infected HLTEs.\u003c/p\u003e \u003cp\u003eIn conclusion, our results demonstrate the usefulness of \u0026ldquo;upcycling\u0026rdquo; explanted lung tissue from patients with terminal emphysema to study transcriptomic tissue responses in the early phase of viral and bacterial infections. Further research should assess the usefulness of tissue explants from patients with other underlying diagnoses, the validity of the model for infections with other pathogens, and the functional significance of the novel RNA tissue biomarkers identified herein, such as the noncoding RNAs induced by IAV infection.\u003c/p\u003e"},{"header":"Methods and Materials","content":"\u003cp\u003e \u003cb\u003ePreparation and maintenance of Human Lung Tissue Explants (HLTEs).\u003c/b\u003e Bronchial lung tissue explanted from patients with terminal COPD for clinical reasons was obtained from the Institute of Pathology, Hannover Medical School. The tissue was further dissected into small pieces with an average size of approx. 27 mm\u003csup\u003e3\u003c/sup\u003e (3x3x3 mm) and an average weight of approx. 30 mg. These pieces (HLTEs) were cultured in RPMI medium without any supplement. Tissue pieces were cultured overnight in a humidified tissue culture incubator at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e; this step was termed overnight washing. After 12\u0026ndash;16 h of washing, tissues were infected with the respective pathogen. This protocol was developed by combining already published methods (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eInfections.\u003c/b\u003e \u003cb\u003eInfluenza virus\u003c/b\u003e (A/Giessen/6/2009 H1N1; abbreviated IAV). Infection medium containing 2.0 x 10\u003csup\u003e5\u003c/sup\u003e ffu/ml in RPMI medium was added to a 24 well plate, placing one HLTE piece per well. Plates were incubated at 37\u0026deg;C for the durations indicated in the figure legends. \u003cb\u003eMycobacterium bovis\u003c/b\u003e \u003cem\u003eBacillus Calmette\u0026ndash;Gu\u0026eacute;rin (BCG)\u003c/em\u003e was grown under agitation to mid-log phase in 50 ml of Middlebrook 7H9 (Difco) liquid culture medium supplemented with 0.5% glycerol, 0.15% Tween-80 and 10% oleic acid-albumin-dextrose-catalase (BD Biosciences). Bacterial cells were collected in a 50 ml Falcon tube and then washed twice with 45 ml PBS (Gibco) by centrifugation at 4000G. Bacterial optical density was measured with a spectrophotometer at an absorbance of 600 nm. Infection medium containing 5X10\u003csup\u003e6\u003c/sup\u003e CFU/ml was prepared and HLTEs were subjected to infection in a 24 well plate. \u003cb\u003eP. aeruginosa\u003c/b\u003e \u003cb\u003estrain PA14\u003c/b\u003e was cultured in Luria-Bertani broth at 37\u0026deg;C in a shaker incubator and harvested at log phase. CFU were estimated according to the OD value measured as described by Kim et al (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e), and infection medium was prepared containing 1x10\u003csup\u003e8\u003c/sup\u003e CFU/ml in RPMI medium. HLTEs were incubated in 24 well plates for 2 h at 37\u0026deg;C. After infection, HLTEs were washed and incubated in RPMI medium containing 50 \u0026micro;g/ml gentamycin in order to arrest growth of extracellular bacteria.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFocus forming assay.\u003c/b\u003e Cell culture supernatants containing IAV were serially diluted in PBS supplemented with 0.2% BSA and 1% Ca/Mg solution. Recently confluent monolayers of MDCK cells in 96-well plates were rinsed with PBS and each well infected with 50 \u0026micro;l of 10-fold serially diluted virus for 1 h at room temperature. After infection, the inoculum was aspirated and 150 \u0026micro;l Avicel-media 1% Avicel in MEM media supplemented with 0.5% BSA, 2 \u0026micro;g/ml Trypsin and 1% Dextran) was added to the cell monolayer. The plates were then incubated at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e for 24 h, followed by removal of the Avicel media and fixation of cells by 4% PFA and 1% Triton X-100. Cells were stained by mouse-anti-NP-antibody followed by anti-mouse-HRP-antibody. AEC-staining-solution was used to visualize the IAV positive cells (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eLDH release assay.\u003c/b\u003e Supernatants and tissue were collected from HLTE cultures at 0, 24, 48 and 72 h post incubation and stored at 4\u0026deg;C until collection of the 72 h time point. Tissue was lysed in 1% Triton X-100 lysis buffer, tissue lysate and supernatant were diluted and added to 96-well microplates. Catalyst and dye solution were mixed and added to samples according to the protocol of the Roche LDH cytotoxicity detection kit. Color development was measured by OD at 492 nm (background control at 630 nm). LDH release in percentage was calculated as follows: (100 / LDH of lysate) x LDH of sample.\u003c/p\u003e \u003cp\u003e \u003cb\u003eELISA.\u003c/b\u003e Supernatants collected from HLTE cultures were immediately stored at -20\u0026deg;C. Samples were thawed at 4\u0026deg;C before measuring concentrations by commercial kits for the following proteins; IP10, IL-1β, IL-6, IL-10, IFN-γ, PROK2. In brief, ELISA plates were coated with specific capture antibodies overnight at 4\u0026deg;C, followed by washing and blocking with 3% BSA (Roth, 8076.5). Plates were washed and then incubated with standard proteins or sample supernatants (diluted in 1% BSA) for 2 h. After binding of protein antigens to coated antibodies, detection antibodies were added, followed by adding avidin conjugated with HRP. This was followed by a final quadruple wash step, after which the chromomeric substrate 3,3\u0026rsquo;5,5\u0026rsquo;-tetramethylbenzidine (TMB) was added and incubated in the dark. After approximately 15 minutes, the reaction was stopped by adding 0.3 M sulphuric acid (H\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e) solution. Plates were read on an ELISA reader (BioTeK, Synergy 2.0) at OD 450 nm and background OD that was earlier measured at 570 was subtracted. Protein concentrations were calculated by comparison with standard curves.\u003c/p\u003e \u003cp\u003e \u003cb\u003eComparison of two tissue preservation methods before RNA extraction.\u003c/b\u003e To identify the best HLTE preservation method for RNA extraction, HLTE samples were either stored in RNAlater for 24 h at 4\u0026deg;C or snap-frozen in liquid nitrogen. Tissues from RNAlater were transferred to -80\u0026deg;C after 24 h, whereas snap-frozen tissues were immediately transferred to -80\u0026deg;C until RNA extraction.\u003c/p\u003e \u003cp\u003e \u003cb\u003eRNA extraction.\u003c/b\u003e HLTEs were snap-frozen in liquid nitrogen immediately after collection. RNA extraction of HLTEs was performed using miRNeasy Qiagen Kit (Qiagen, 74104) according to the manufacturer\u0026rsquo;s instructions with a few modifications. Briefly, Qiazol lysis reagent was added directly to frozen tissue, and disruption and homogenization of HLTE was performed using the Ultra-Turrax\u0026reg; (T10, IKA, 0003737000) for 20\u0026ndash;30 sec. at the highest speed. Chloroform was added and the resulting mixture was centrifuged 12,000xg for 15 min at 4\u0026deg;C. The colorless upper layer was transferred to RNA binding columns with 100% ethanol. After two washings of RNA with RPE buffer, DNA was digested by treatment with DNAse I. RNA was eluted into 50 \u0026micro;l RNAse free water. The resulting sample contains total RNA including small RNA (\u0026lt;\u0026thinsp;50 nt) and therefore can be used for both mRNA and sncRNA profiling.\u003c/p\u003e \u003cp\u003e \u003cb\u003eRNA quality control.\u003c/b\u003e The RNA quality and quantity were determined using the NanoDrop spectrophotometer (Manufacturer). A 260/280 ratio between 2.0\u0026ndash;2.2 indicated RNA without contamination. The RNA Integrity Number (RIN) was determined with an Agilent Bioanalyzer using Eukaryote Total RNA Nano Series II chips (Agilent, 5067\u0026thinsp;\u0026minus;\u0026thinsp;1511).\u003c/p\u003e \u003cp\u003e \u003cb\u003eComplementary DNA (cDNA) generation.\u003c/b\u003e Following RNA extraction, cDNA was prepared using the RT PrimeScript\u0026trade; Master Mix (Takara) following the manufacturer\u0026rsquo;s instructions. Briefly, 400 ng of RNA was reverse transcribed by adding 2 \u0026micro;l master mix (5x) and making a total reaction volume of 10 \u0026micro;l, followed by incubation at 37\u0026deg;C for 15 min. Afterward, all samples were heated to 85\u0026deg;C for 10 sec to inactivate the enzymes. The cDNA thus synthesized was diluted further in RNase free water to get a final RNA concentration of 5 ng/\u0026micro;l of the cDNA.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGene expression analysis using real-time PCR.\u003c/b\u003e Primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were designed using either PrimerBLAST (National Center for Biotechnology Information, National Institutes of Health) or the Primer3 online tool (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). Primers were designed to span exon-intron boundaries, have annealing temperatures around 60\u0026deg;C and generate amplicons of 100 bp \u0026minus;\u0026thinsp;300 bp. RT-qPCR reactions were set up in a final volume of 20 \u0026micro;l, using the SensiFast\u0026trade; SYBR\u0026reg; No-ROX Kit (Bioline, Taunton, MA) and the primers listed. RT-qPCR was performed in a LightCycler\u0026reg; 2.0 instrument (Roche, Mannheim, Germany), using 45 cycles of the following program: 95\u0026deg;C for 15 sec., 60\u0026deg;C for 15 sec., and 72\u0026deg;C for 15 sec. To exclude artifacts resulting from primer dimer formation, melting curve analysis was performed using the sequence 95\u0026deg;C for 15 sec., 60\u0026deg;C for 15 sec., 95\u0026deg;C for 1 min. and 37\u0026deg;C for 30 sec. Relative expression of the mRNA targets was calculated using the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e). Amplification of a single amplicon was confirmed by obtaining dissociation curve (melt curve) profiles as well as using gel electrophoresis to verify the size of the reaction product.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of PCR primers used\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eIL-6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIL6-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTACATTTGCCGAAGAGCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIL6-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCTGACCCAACCACAAATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eHPRT\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHPRT-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAACGTCTTGCTCGAGATGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHPRT-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAGCAGGTCAGCAAAGAATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ePROK2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePROK2-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGACAAGGACTCCCAATGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePROK2-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTACGAGTCAGTGGATGGCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eIL1B\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIL-1β-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTACCCAAAGAAGAAGATGGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIL-1β-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGGTGCTGATGTACCAGTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCXCL10\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCxCL10_F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGCTTTGGGGTTTATCAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCxCL10_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCACTGAAAGAATTTGGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eIL10\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIL10-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTACCTGGGTTGCCAAGCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIL10-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGAAATCGATGACAGCGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eHA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHA-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCGTGCTATGGGGCATTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHA-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGCAATCGTGGACTGGTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRP11-202G18\u003cem\u003e.1\u003c/em\u003e (ENSG00000227531)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAL414.1-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCAGTGCACCTCATTCAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAL414.1-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCTCCATGCCTTTTCCACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eGBP1P1\u003c/em\u003e (ENSG00000225492)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGBP1P1-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGAACGTGTGAAAGCTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGBP1P1-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGTTCAGGCTGGACAGACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eSIMALR\u003c/em\u003e (ENSG00000226004)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLINC02528-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCTACCTACCGAGAGACCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLINC02528-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACACCACTGACAGAAACGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eAC093063.1\u003c/em\u003e (ENSG00000268088)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLGALS14-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGAGTGCACTTTGGCCATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLGALS14-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCTCTCCACACTTGCACCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLGALS17A\u003c/em\u003e (ENSG00000226025)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLGALS17A-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCTTCCATTTCCGAGTGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLGALS17A-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTAATGGTGGTGGCAAAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSmall non-coding RNA (sncRNA) sequencing.\u003c/b\u003e Libraries were prepared using the NEBNext\u0026reg; Small RNA Library Prep Set for Illumina and 1 \u0026micro;g of input RNA. The synthesized cDNA was amplified with 12 PCR cycles. Libraries were prepared separately for each biological replicate. Samples were sequenced on an Illumina HiSeq2500 (2x 50 bp paired-end), generating 50 bp single reads and \u0026asymp;\u0026thinsp;16\u0026nbsp;million reads passing filter for each sample. FASTAQ files obtained after small RNA sequencing were used to annotate the transcripts using the OASIS 2.0 web tool (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e). Briefly, FASTAQ files were compressed using the OASIS compressor and then uploaded to the web tool for annotation. The annotation process comprises removing 3' adapters, quality control, mapping to the reference genome (\u003cem\u003eHomo sapiens \u0026ndash; hg38\u003c/em\u003e), and the counting of reads in each sncRNA for each sample. Contaminating viral or bacterial RNA sequences were removed.\u003c/p\u003e \u003cp\u003e \u003cb\u003eBulk RNA sequencing of long RNAs (mRNA, lncRNA, lincRNA, pseudogenes).\u003c/b\u003e Quality and integrity of bulk RNA was checked on an Agilent Technologies 2100 Bioanalyzer (Agilent Technologies; Waldbronn, Germany). The RNA sequencing library was generated from 10 ng total RNA using NEBNext\u0026reg; Single Cell/Low Input RNA Library according to the manufacturer\u0026acute;s protocols. The libraries were sequenced on an Illumina NovaSeq 6000, using the NovaSeq 6000 S1 Reagent Kit (100 cycles, paired-end run 2x 50 bp) with an average of 5 x10\u003csup\u003e7\u003c/sup\u003e reads per RNA sample. Large sets of high-throughput sequencing reads were mapped against the \u003cem\u003eHomo sapiens\u003c/em\u003e hg38 reference genome via STAR 2.7.3a tool.\u003c/p\u003e \u003cp\u003e \u003cb\u003eTranscript normalization and differential expression analysis.\u003c/b\u003e The following analyses were done using the R environment and programming code. DESeq2 was used to normalize the counts of each gene to account for differences in sequencing depth and low count variability. The DESeq2 normalization metric is based on the median of ratios method. Following normalization, DESeq2 was run in a pairwise manner, identifying significantly differentially expressed genes with higher levels of expression in the infection group in comparison to the uninfected group. This method provided functionality for a pair-wise comparison (identifying differentially expressed genes between two groups) in the form of a Wald test, and for multiple comparisons (classically used for time-series data) in the form of a likelihood ratio test. The output contained nominal p-values, False Discovery Rate (FDR) or P-adjusted values (correction for multiple tests computed with the Benjamini\u0026ndash;Hochberg procedure) and fold change. DESeq2 used an empirical Bayes shrinkage to detect and correct for dispersion and log2-fold change (LFC) estimates. The R software package Visualization of Differential Gene Expression using R (ViDGER) was used to display differential expression outputs uniformly. To present differential expression using DESeq2 output files, volcano plots were generated using the EnhancedVolcano package. Analysis of Variance (ANOVA) was employed to compare the means of all genes across different groups. The top 75 DE genes were selected based on the resulting p-values and presented in a heatmap along with adjusted p-values from the pairwise comparisons (DESeq2). Heatmaps and hierarchical clustering were generated using the pheatmap R package, with gene counts scaled by 'row'. Additionally, a four-way plot was created using ggplot2 to visualize Wald statistic values from the DESeq2 analysis, where BCG Wald statistic values were plotted on the x-axis, and PA infection Wald statistic values on the y-axis. Output from the DESeq2 analysis is found in \u003cb\u003eTables S1\u003c/b\u003e (sncRNAs) and \u003cb\u003eS2\u003c/b\u003e (long RNAs).\u003c/p\u003e \u003cp\u003e \u003cb\u003ePreparation of single-cell suspensions.\u003c/b\u003e After 24 hpi, tissues were collected and processed to prepare a single-cell suspension for flow cytometry and cell sorting. Briefly, lung tissues were chopped in digestion buffer (1 mg/ml collagenase D (Roche, 10269638001), 2.0 U/ml Dispase II (Roche, 04942078001) and 0.1 mg/ml DNase I (DNase I, D4527) in Hepes-buffer) with surgical scissors and homogenized with an Ultra-Turrax\u0026reg; dispersing tool (T10, IKA-Werke GmbH, Staufen, Germany) for 40\u0026ndash;60 sec. The homogenate was incubated for 30 minutes at 37\u0026deg;C with mild agitation and then passed through a 30G syringe. The resulting single-cell suspension was filtered through a 40 \u0026micro;m nylon cell strainer and erythrocytes were lysed using ACK (Ammonium-Chloride-Potassium) lysing buffer. Cells were counted using an automated cell counter (Scepter, Millipore, PHCC00000).\u003c/p\u003e \u003cp\u003e \u003cb\u003eLive/dead cell and apoptosis detection.\u003c/b\u003e Single-cell suspension was washed 1x with PBS and 1x with binding buffer. Cells were incubated with fluorochrome-conjugated Annexin V (FITC) for 15 min. After incubation, cells were washed again and resuspended in propidium iodide staining solution. After staining, cells were sorted and analyzed by FACS (Cell Sorter Facility MHH). Dead and duplets cells were excluded from further analysis.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSingle-cell RNAseq.\u003c/b\u003e\u0026nbsp;Sorted live single cells were processed for single-cell transcriptomics. Single-cell 3\u0026rsquo; RNA-Seq libraries were prepared using Chromium Single Cell V3 Reagent Kit and Controller (10x Genomics) as described in the user guide. In brief, cells (n\u0026thinsp;=\u0026thinsp;4500) for a targeted recovery of 3500 along with gel beads, master mix and partitioning oil were loaded in designated wells on a chromium chip. The chip was placed in a Chromium Controller and run for Gel Bead-in-Emulsion (GEMs) preparation. After completion of the run, GEMs were run in PCR tubes for RT incubation in a thermal cycler. Post GEM-RT incubation, cDNA was cleaned up and amplified. cDNA was washed and quality was evaluated. Gene expression libraries were constructed and then libraries were assessed for quality (TapeStation 4200, Agilent). Libraries were sequenced by NextSeq550 using the NextSeq 500 High Output Kit v2.5 (1x75 cycles 400M cluster). We created a reference package for two species genomes (Human and IAV H1N1) and ran the sequences against this genome package. Initial data processing was performed using the Cell Ranger version 2.0 pipeline (10x Genomics).\u003c/p\u003e \u003cp\u003e \u003cb\u003eSingle-cell RNA data analysis.\u003c/b\u003e Cell Ranger output files \u0026ldquo;outs\u0026rdquo; contained raw counts for each sequenced genes (Human and H1N1 virus) of each cell. These files were used as input for further processing using the R package Seurat 5.0. Following the standard pre-processing workflow, cells were filtered that have unique feature counts over 2,500 or less than 200. Raw counts were normalized by the global-scaling normalization method \u0026ldquo;LogNormalize\u0026rdquo;. Principal component analysis score was used to determine the \u0026lsquo;dimensionality\u0026rsquo; of all the cells. Cell clusters were identified as different cell populations based on the expression of their canonical markers recently published. Differential expression was determined for each cell type by comparing the IAV infected cells with uninfected cells. IAV infected cells were identified by the presence of IAV encoded transcripts.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGene Set Enrichment Analysis (GSEA).\u003c/b\u003e The gene list and their Wald statistic values from DESeq2 analysis for each pathogen were applied against Hallmark gene set collection databases (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e) or Gene Ontology Biological (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e)using the online gene enrichment tool WEB-based Gene SeT AnaLysis Toolkit (WebGestalt, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"http://www.webgestalt.org)(53)\" target=\"_blank\"\u003ewww.webgestalt.org)(53)\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.webgestalt.org)(53)\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. The R package ggplot2 was used to generate plots displaying gene set terms, their normalized enrichment score, and FDR values.\u003c/p\u003e \u003cp\u003e \u003cb\u003eStatistics.\u003c/b\u003e Statistical tools used are detailed in the respective text in results or the figure legends. Briefly, GraphPad Prism 8.0.2 (GraphPad Software, Boston, MA) was used to analyze RT-qPCR, ELISA, metabolomics and LDH release assay results. The Wilcoxon\u0026ndash;Mann\u0026ndash;Whitney U or unpaired t test were used to assess significance of between-group differences. \u003cem\u003eP\u003c/em\u003e values were abbreviated as \u0026le;\u0026thinsp;0.0001 = ****, \u0026le;\u0026thinsp;0.001 = ***, \u0026le;\u0026thinsp;0.01 = **, and \u0026le;\u0026thinsp;0.05 = *. Data are shown as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. The number of biological replicates is specified in the figure captions as indicated. For transcriptome data, DESeq2 analysis was applied which returned log\u003csub\u003e2\u003c/sub\u003e-fold change, \u003cem\u003ep\u003c/em\u003e-adjusted values, and \u003cem\u003ep\u003c/em\u003e values.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by the Ethics Committee of Hannover Medical School (file no. 2923-2015). All participants gave informed consent for use of their lung explants for research purposes.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable as no personally identifying data are contained in the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Results of the DE analysis with DeSeq2 are provided \u003cstrong\u003eas Supplemental Tables S1\u003c/strong\u003e and \u003cstrong\u003eS2\u003c/strong\u003e. The underlying RNAseq datasets are available at GEO https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE192864, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE192528, and https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE268542.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone of the authors have a competing interest relating to conduct of the study or publication of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by iMed, the Helmholtz Association\u0026rsquo;s Cross-Programme Initiative on Personalized Medicine and by the Innovative Medicines Initiative Joint Undertaking (IMI-JU) under grant agreements no. 115523, COMBACTE (www.combacte.com), resources of which are composed of financial contribution from the European Union\u0026apos;s Seventh Framework Programme (FP7/2007-2013) and EFPIA companies\u0026rsquo; in kind contribution. Additional support was provided by iMed, the Helmholtz Association\u0026rsquo;s Initiative on Personalized Medicine. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA.S. and F.P. conceived the study. P.B. provided the lung tissue. R.G. provided RNA sequencing and bioinformatics support. A.S. performed the experiments and analyzed the data. A.I., L.A. provided instruction and support regarding the bacterial infections. L.C. performed the experiment shown in Figure S3. M.S. provided instruction and support regarding the HLTE model. A.S. and F.P. wrote the first draft of the manuscript. A.S. and F.H.W. prepared the figures. S.P. provided viral stocks. FP coordinated the study and wrote the final version of the manuscript. All authors edited the manuscript and approved the final version.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFirst and foremost, we thank the patients for donating their lung tissue to the study. We thank Janine Rasch (Technical University Braunschweig, Germany) and Mohamed Tantawy (National Research Centre Cairo, Egypt) for their support in the early phases of the project, and Katharina Sewald and Armin Braun (Fraunhofer ITEM Institute for Toxicology and Experimental Medicine, Hannover, Germany) for helpful discussion and sharing the protocol for RNA isolation from snap‑frozen tissue.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eDunning J, Blankley S, Hoang LT, Cox M, Graham CM, James PL, et al. Progression of whole-blood transcriptional signatures from interferon-induced to neutrophil-associated patterns in severe influenza. Nat Immunol. 2018;19(6):625\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Araujo LS, Ribeiro-Alves M, Wipperman MF, Vorkas CK, Pessler F, Saad MHF. Transcriptomic Biomarkers for Tuberculosis: Validation of NPC2 as a Single mRNA Biomarker to Diagnose TB, Predict Disease Progression, and Monitor Treatment Response. Cells. 2021;10(10).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Araujo LS, Ribeiro-Alves M, Leal-Calvo T, Leung J, Duran V, Samir M, et al. Reprogramming of Small Noncoding RNA Populations in Peripheral Blood Reveals Host Biomarkers for Latent and Active Mycobacterium tuberculosis Infection. mBio. 2019;10(6):e01037\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eViana F, O'Kane CM, Schroeder GN. Precision-cut lung slices: A powerful ex vivo model to investigate respiratory infectious diseases. Mol Microbiol. 2022;117(3):578\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSewald K, Danov O. Infection of Human Precision-Cut Lung Slices with the Influenza Virus. Methods Mol Biol. 2022;2506:119\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFatykhova D, Rabes A, Machnik C, Guruprasad K, Pache F, Berg J, et al. Serotype 1 and 8 Pneumococci Evade Sensing by Inflammasomes in Human Lung Tissue. PLoS ONE. 2015;10(8):e0137108.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeinheimer VK, Becher A, Tonnies M, Holland G, Knepper J, Bauer TT, et al. Influenza A viruses target type II pneumocytes in the human lung. J Infect Dis. 2012;206(11):1685\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJager J, Marwitz S, Tiefenau J, Rasch J, Shevchuk O, Kugler C, et al. Human lung tissue explants reveal novel interactions during Legionella pneumophila infections. Infect Immun. 2014;82(1):275\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoppe J, Unal CM, Thiem S, Grimpe L, Goldmann T, Gassler N, et al. PilY1 Promotes Legionella pneumophila Infection of Human Lung Tissue Explants and Contributes to Bacterial Adhesion, Host Cell Invasion, and Twitching Motility. Front Cell Infect Microbiol. 2017;7:63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDroemann D, Rupp J, Goldmann T, Uhlig U, Branscheid D, Vollmer E, et al. Disparate innate immune responses to persistent and acute Chlamydia pneumoniae infection in chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 2007;175(8):791\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSzymanski KV, Toennies M, Becher A, Fatykhova D, N'Guessan PD, Gutbier B, et al. Streptococcus pneumoniae-induced regulation of cyclooxygenase-2 in human lung tissue. Eur Respir J. 2012;40(6):1458\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdullah M, Kahler D, Vock C, Reiling N, Kugler C, Dromann D, et al. Pulmonary haptoglobin and CD163 are functional immunoregulatory elements in the human lung. Respiration. 2012;83(1):61\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoppen K, Fatykhova D, Holland G, Rauch J, Tappe D, Graff M, et al. Ex vivo infection model for Francisella using human lung tissue. Front Cell Infect Microbiol. 2023;13:1224356.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNicholas B, Staples KJ, Moese S, Meldrum E, Ward J, Dennison P, et al. A novel lung explant model for the ex vivo study of efficacy and mechanisms of anti-influenza drugs. J Immunol. 2015;194(12):6144\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchaller MA, Sharma Y, Dupee Z, Nguyen D, Uruena J, Smolchek R et al. Ex vivo SARS-CoV-2 infection of human lung reveals heterogeneous host defense and therapeutic responses. JCI Insight. 2021;6(18).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlfi O, Yakirevitch A, Wald O, Wandel O, Izhar U, Oiknine-Djian E, et al. Human Nasal and Lung Tissues Infected Ex Vivo with SARS-CoV-2 Provide Insights into Differential Tissue-Specific and Virus-Specific Innate Immune Responses in the Upper and Lower Respiratory Tract. J Virol. 2021;95(14):e0013021.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDromann D, Rupp J, Rohmann K, Osbahr S, Ulmer AJ, Marwitz S, et al. The TGF-beta-pseudoreceptor BAMBI is strongly expressed in COPD lungs and regulated by nontypeable Haemophilus influenzae. Respir Res. 2010;11(1):67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSohail A, Iqbal AA, Sahini N, Chen F, Tantawy M, Waqas F, et al. Itaconate and derivatives reduce interferon responses and inflammation in influenza A virus infection. PLoS Pathog. 2022;18(1):e1010219.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen F, Elgaher WAM, Winterhoff M, Bussow K, Waqas FH, Graner E, et al. Citraconate inhibits ACOD1 (IRG1) catalysis, reduces interferon responses and oxidative stress, and modulates inflammation and cell metabolism. Nat Metab. 2022;4(5):534\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePechous RD, Malaviarachchi PA, Banerjee SK, Byrum SD, Alkam DH, Ghaffarieh A et al. An ex vivo human precision-cut lung slice platform provides insight into SARS-CoV-2 pathogenesis and antiviral drug efficacy. bioRxiv. 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePessler F, Mayer CT, Jung SM, Behrens EM, Dai L, Menetski JP, et al. Identification of novel monosodium urate crystal regulated mRNAs by transcript profiling of dissected murine air pouch membranes. Arthritis Res Ther. 2008;10(3):R64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgrawal R, Pandey P, Jha P, Dwivedi V, Sarkar C, Kulshreshtha R. Hypoxic signature of microRNAs in glioblastoma: insights from small RNA deep sequencing. BMC Genomics. 2014;15:686.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePallares-Albanell J, Zomeno-Abellan MT, Escaramis G, Pantano L, Soriano A, Segura MF, et al. A High-Throughput Screening Identifies MicroRNA Inhibitors That Influence Neuronal Maintenance and/or Response to Oxidative Stress. Mol Ther Nucleic Acids. 2019;17:374\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLai J, Wang H, Pan Z, Su F. A novel six-microRNA-based model to improve prognosis prediction of breast cancer. Aging. 2019;11(2):649\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSamir M, Vidal RO, Abdallah F, Capece V, Seehusen F, Geffers R, et al. Organ-specific small non-coding RNA responses in domestic (Sudani) ducks experimentally infected with highly pathogenic avian influenza virus (H5N1). RNA Biol. 2020;17(1):112\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMerlo LMF, Peng W, Mandik-Nayak L. Impact of IDO1 and IDO2 on the B Cell Immune Response. Front Immunol. 2022;13:886225.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFox JM, Crabtree JM, Sage LK, Tompkins SM, Tripp RA. Interferon Lambda Upregulates IDO1 Expression in Respiratory Epithelial Cells After Influenza Virus Infection. J Interferon Cytokine Res. 2015;35(7):554\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCynn E, Li DY, O'Reilly ME, Wang Y, Bashore AC, Jha A, et al. Human Macrophage Long Intergenic Noncoding RNA, SIMALR, Suppresses Inflammatory Macrophage Apoptosis via NTN1 (Netrin-1). Arterioscler Thromb Vasc Biol. 2023;43(2):286\u0026ndash;99.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin CY, Yang ZS, Wang WH, Urbina AN, Lin YT, Huang JC et al. The Antiviral Role of Galectins toward Influenza A Virus Infection-An Alternative Strategy for Influenza Therapy. Pharmaceuticals (Basel). 2021;14(5).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLilly E, Strickler M, Milstone LM, Bunick CG. Alterations in connexin 26 protein structure from lethal keratitis-ichthyosis-deafness syndrome mutations A88V and G45E. J Dermatol Sci. 2019;95(3):119\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBartucci R, Salvati A, Olinga P, Boersma YL. Vanin 1: Its Physiological Function and Role in Diseases. Int J Mol Sci. 2019;20(16).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaraiva M, Vieira P, O'Garra A. Biology and therapeutic potential of interleukin-10. J Exp Med. 2020;217(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKelly-Robinson GA, Reihill JA, Lundy FT, McGarvey LP, Lockhart JC, Litherland GJ et al. The Serpin Superfamily and Their Role in the Regulation and Dysfunction of Serine Protease Activity in COPD and Other Chronic Lung Diseases. Int J Mol Sci. 2021;22(12).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFattaey A, Booher RN. Myt1: a Wee1-type kinase that phosphorylates Cdc2 on residue Thr14. Prog Cell Cycle Res. 1997;3:233\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeyland J, Lipinski D, Slomski R. The current state of xenotransplantation. J Appl Genet. 2015;56(2):211\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang T. The function of S100A4 in pulmonary disease: A review. Med (Baltim). 2023;102(14):e33466.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWen J, Meng X, Xuan B, Zhou T, Gao H, Dong H, et al. Na(+)/Ca(2+) Exchanger 1 in Airway Smooth Muscle of Allergic Inflammation Mouse Model. Front Pharmacol. 2018;9:1471.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndrikopoulos P, Kieswich J, Harwood SM, Baba A, Matsuda T, Barbeau O, et al. Endothelial Angiogenesis and Barrier Function in Response to Thrombin Require Ca2\u0026thinsp;+\u0026thinsp;Influx through the Na+/Ca2\u0026thinsp;+\u0026thinsp;Exchanger. J Biol Chem. 2015;290(30):18412\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLou J, Li X, Huang W, Liang J, Zheng M, Xu T, et al. SNX10 promotes phagosome maturation in macrophages and protects mice against Listeria monocytogenes infection. Oncotarget. 2017;8(33):53935\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiberzon A, Birger C, Thorvaldsdottir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 2015;1(6):417\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZarnegar B, Westin A, Evangelidou S, Hallgren J. Innate Immunity Induces the Accumulation of Lung Mast Cells During Influenza Infection. Front Immunol. 2018;9:2288.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGraham AC, Temple RM, Obar JJ. Mast cells and influenza a virus: association with allergic responses and beyond. Front Immunol. 2015;6:238.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiyashita M, Oshiumi H, Matsumoto M, Seya T. DDX60, a DEXD/H box helicase, is a novel antiviral factor promoting RIG-I-like receptor-mediated signaling. Mol Cell Biol. 2011;31(18):3802\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang C, Li W, Lei X, Xie Z, Qi L, Wang H, et al. Targeting lysophospholipid acid receptor 1 and ROCK kinases promotes antiviral innate immunity. Sci Adv. 2021;7(38):eabb5933.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe Y, Xu K, Keiner B, Zhou J, Czudai V, Li T, et al. Influenza A virus replication induces cell cycle arrest in G0/G1 phase. J Virol. 2010;84(24):12832\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSohail A, Iqbal AA, Sahini N, Chen F, Tantawy M, Waqas SFH, et al. Itaconate and derivatives reduce interferon responses and inflammation in influenza A virus infection. PLoS Pathog. 2022;18(1):e1010219.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim D-j, Chung S-g, Lee S, Choi JJAJMR. Relation of microbial biomass to counting units for Pseudomonas aeruginosa. 2012;6(21):4620\u0026ndash;2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa W, Brenner D, Wang Z, Dauber B, Ehrhardt C, Hogner K, et al. The NS segment of an H5N1 highly pathogenic avian influenza virus (HPAIV) is sufficient to alter replication efficiency, cell tropism, and host range of an H7N1 HPAIV. J Virol. 2010;84(4):2122\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoressaar T, Lepamets M, Kaplinski L, Raime K, Andreson R, Remm M. Primer3_masker: integrating masking of template sequence with primer design software. Bioinformatics. 2018;34(11):1937\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRao X, Huang X, Zhou Z, Lin X. An improvement of the 2^(-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat Bioinforma Biomath. 2013;3(3):71\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahman RU, Gautam A, Bethune J, Sattar A, Fiosins M, Magruder DS, et al. Oasis 2: improved online analysis of small RNA-seq data. BMC Bioinformatics. 2018;19(1):54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarris MA, Clark J, Ireland A, Lomax J, Ashburner M, Foulger R, et al. The Gene Ontology (GO) database and informatics resource. Nucleic Acids Res. 2004;32(Database issue):D258\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao Y, Wang J, Jaehnig EJ, Shi Z, Zhang B. WebGestalt 2019: gene set analysis toolkit with revamped UIs and APIs. Nucleic Acids Res. 2019;47(W1):W199\u0026ndash;205.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Biomarker, emphysema, gene expression, human lung tissue, infection, long noncoding RNA, pneumonia, miRNA, PIWI-associated RNA, prokineticin 2, transcription.","lastPublishedDoi":"10.21203/rs.3.rs-4499225/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4499225/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003e. The first 24 hours of infection represent a critical time window in interactions between pathogens and host tissue. However, it is not possible to study such early events in human lung during natural infection due to lack of clinical access to tissue this early in infection. We, therefore, applied RNA sequencing to \u003cem\u003eex vivo\u003c/em\u003e cultured human lung tissue explants (HLTE) from patients with emphysema to study global changes in small noncoding RNA, mRNA, and long noncoding RNA (lncRNA, lincRNA) populations during the first 24 hours of infection with influenza A virus (IAV), \u003cem\u003eMycobacterium bovis\u003c/em\u003e Bacille Calmette-Guerin (BCG), and \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e.\u003c/p\u003e\u003ch2\u003eResults.\u003c/h2\u003e \u003cp\u003e \u003cem\u003eP. aeruginosa\u003c/em\u003e caused the strongest expression changes and was the only pathogen that notably affected expression of microRNA and PIWI-associated RNA. The major classes of long RNAs (\u0026gt;\u0026thinsp;100 nt) were represented similarly among the RNAs that were differentially expressed upon infection with the three pathogens (mRNA 77\u0026ndash;82%; lncRNA 15\u0026ndash;17%; pseudogenes 4\u0026ndash;5%), but \u003cem\u003elnc-DDX60-1\u003c/em\u003e, \u003cem\u003eRP11-202G18.1\u003c/em\u003e, and \u003cem\u003elnc-THOC3-2\u003c/em\u003e were part of an RNA signature (additionally containing \u003cem\u003eSNX10\u003c/em\u003e and \u003cem\u003eSLC8A1\u003c/em\u003e) specifically associated with IAV infection. IAV infection induced brisk interferon responses, \u003cem\u003eCCL8\u003c/em\u003e being the most strongly upregulated mRNA. Single-cell RNAseq identified airway epithelial cells and macrophages as the predominant IAV host cells, but inflammatory responses were also detected in cell types expressing few or no IAV transcripts. Combined analysis of bulk and single-cell RNAseq data identified a set of 6 mRNAs (\u003cem\u003eIFI6\u003c/em\u003e, \u003cem\u003eIFI44L\u003c/em\u003e, \u003cem\u003eIRF7\u003c/em\u003e, \u003cem\u003eISG15, MX1\u003c/em\u003e, \u003cem\u003eMX2\u003c/em\u003e) as the core transcriptomic response to IAV infection. The two bacterial pathogens induced qualitatively very similar changes in mRNA expression and predicted signaling pathways, but the magnitude of change was greater in \u003cem\u003eP. aeruginosa\u003c/em\u003e infection. Upregulation of \u003cem\u003eGJB2\u003c/em\u003e, \u003cem\u003eVNN1\u003c/em\u003e, \u003cem\u003eDUSP4\u003c/em\u003e, \u003cem\u003eSerpinB7\u003c/em\u003e, and \u003cem\u003eIL10\u003c/em\u003e, and downregulation of \u003cem\u003ePKMYT1\u003c/em\u003e, \u003cem\u003eS100A4\u003c/em\u003e, \u003cem\u003eGGTA1P\u003c/em\u003e, and \u003cem\u003eSLC22A31\u003c/em\u003e were most strongly associated with bacterial infection.\u003c/p\u003e\u003ch2\u003eConclusions.\u003c/h2\u003e \u003cp\u003eHuman lung tissue mounted substantially different transcriptomic responses to infection by IAV than by BCG and \u003cem\u003eP. aeruginosa\u003c/em\u003e, whereas responses to these two divergent bacterial pathogens were surprisingly similar. This HLTE model should prove useful for RNA-directed pathogenesis research and biomarker discovery during the early phase of infections, both at the tissue and single-cell level.\u003c/p\u003e","manuscriptTitle":"Differential transcriptomic host responses in the early phase of viral and bacterial infections in human lung tissue explants ex vivo","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-26 15:04:44","doi":"10.21203/rs.3.rs-4499225/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ad5171df-98b0-4fe6-87a8-d6d7d5d9e63c","owner":[],"postedDate":"June 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-07-03T07:02:49+00:00","versionOfRecord":[],"versionCreatedAt":"2024-06-26 15:04:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4499225","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4499225","identity":"rs-4499225","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00