Exosomes derived from avian influenza virus-infected chickens modulate host immune responses

Exosomes derived from avian influenza virus-infected chickens modulate host immune responses | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Exosomes derived from avian influenza virus-infected chickens modulate host immune responses Chaeeun Kim, Thi Hoai Phan, Anh Duc Truong, Hyun Soon Lillehoj, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6773730/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Exosomes are emerging as key mediators of host-pathogen interactions, especially as carriers of viral components during infection. This study examined the immunomodulatory role of serum-derived exosomes from chickens infected with low pathogenic avian influenza virus (LPAIV) or highly pathogenic influenza virus (HPAIV). Brown Leghorn chickens were infected with either LPAIV or HPAIV, and serum exosomes were isolated. These exosomes (CTRL-EXO; noninfected, LPAIV-EXO, and HPAIV-EXO) were intramuscularly injected into naïve chickens, and several tissues and serum were collected. Cytokine gene expression in immune-related tissues (lung, spleen, and trachea) was quantified using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) to assess the immune response. Unlike the lung and trachea, the spleen exhibited the strongest immune response following exosome injection, with higher expressions of antiviral cytokines and interferons in the AIV-exosome group. In parallel, the same exosomes were applied to chicken macrophage HD11 cell lines to evaluate their cellular uptake and cytokine expression via RT-qPCR. Furthermore, immunocytochemistry was conducted to detect viral protein NP and NS1 delivered into HD11 cells by exosomes. LPAIV-EXO induced the most pronounced immune activation, as demonstrated by elevated cytokine expression and immunocytochemical detection of viral proteins. These findings indicate that AIV-derived exosomes can modulate host immune responses both in vivo and in vitro , highlighting their potential in immune regulation and vaccine development. Exosome avian influenza virus cytokines viral component chicken Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Avian influenza virus (AIV) remains a major threat to the global poultry industry and public health. AIVs are classified into subtypes based on the antigenicity of their hemagglutinin (HA) and neuraminidase (NA) proteins. Among the HA subtypes, H5, H7, and H9 are the most commonly detected in wild birds. [ 1 ]. The most prominent subtypes, H5 and H7, were mostly identified as LPAIVs with few or no clinical signs, can mutate into HPAIVs, causing severe illness and high mortality in galliformes [ 2 ]. AIV outbreaks have caused devastating poultry losses, with millions of bird deaths reported. Additionally, infections have been confirmed in non-avian species such as pigs [ 3 ], dairy cattle [ 4 ], and humans [ 5 ], highlighting the need for rigorous control measures against this zoonotic disease. Exosomes are small (30–200 nm) membrane-bound vesicles released by all cell types that transport various biomolecules, including proteins, lipids, mRNAs, miRNAs, and other non-coding RNAs between cells [ 6 , 7 ]. They play a key role in intercellular communication, acting as mediators in health and disease [ 8 ]. Exosomal cargo reflects the molecular profile of the originating cell; therefore, exosomes from virus-infected cells can carry viral components such as viral proteins and RNA to recipient cells [ 9 – 11 ]. These features suggest that exosomes may critically influence immune responses [ 12 , 13 ]. However, few studies have investigated exosomes extracted from AIV-infected chickens, especially their immunomodulatory functions in the host. Previous studies indicate that exosomes derived from virus-infected cells can modulate or elicit immune responses, highlighting their potential role as immunoregulatory mediators. For example, exosomes released by influenza A virus-infected A549 can suppress the immune response of nearby uninfected cells by delivering viral mRNA or proteins with immunosuppressive functions, thereby promoting viral replication [ 14 ]. Similarly, exosomes from Theiler’s murine encephalomyelitis virus-infected microglia can deliver viral RNA to bystander central nervous system cells and induce neuroinflammation via innate immune receptors, increasing the expression of interferons, cytokines, and chemokines [ 15 ]. In our previous study, we demonstrated that exosomes derived from HPAIV H5N1-infected chickens trigger antiviral responses in various chicken immune cells, including macrophages, fibroblasts, and T and B cell lines, by inducing type I interferons, pro-inflammatory cytokines, and activating immune signaling pathways [ 10 ]. Although exosome-mediated delivery of viral proteins was linked to antiviral activity, these findings were limited to in vitro analyses, and the mechanisms of exosome function in vivo remain unclear. Therefore, this study aims to evaluate the immunomodulatory potential of exosomes derived from LPAIV- and HPAIV-infected chickens by transferring them to naïve chickens or cultured immune cells. These exosomes were intramuscularly administered to naïve chickens, and systemic immune responses were analyzed in vivo . We also examined whether the injected exosomes altered the content of re-isolated exosomes, including viral components. In parallel, we assessed their cellular uptake and immunological effects in a chicken macrophage cell line. By combining in vivo and in vitro approaches, this study seeks to clarify how virus-associated exosomes modulate host immunity. Elucidating their immunomodulatory role could inform the development of extracellular vesicle-based diagnostics and vaccines. 2. Materials & Methods 2.1 Animal experiment and exosome injection In total, 21 4-week-old specific-pathogen-free Brown Leghorn chickens were used in animal experiments conducted in a biosafety level 2 plus (BSL-2 +) facility at the Department of Biochemistry and Immunology, National Institute of Veterinary Research, Vietnam. Three groups of seven chickens each were assigned as noninfected, LPAIV-infected, and HPAIV-infected. For the LPAIV challenge, seven chickens received 200 µL intranasal inoculation of allantoic fluid containing 1 × 10 4 50% egg infectious dose (EID50) [ 16 ] of A/Chicken/Vietnam/NA11/2021 (H5N6). The HPAIV group was similarly challenged with the same dose of A/chicken/Vietnam/NA01/2019 (H5N1) under identical conditions. After 3 days post-infection (dpi), blood samples were collected from the wing vein of chickens for exosome extraction. Exosomes were extracted from noninfected (CTRL-EXO), LPAIV-infected (LPAIV-EXO), and HPAIV-infected (HPAIV-EXO) chickens and injected into 30 naïve chickens (Table 1 ). Six uninjected chickens served as negative controls (NC). Each exosome group consisted of eight chickens: four received 100 µg, and four received 200 µg of exosomes via intramuscular injection. After 3 dpi, blood was collected for exosome isolation: CTRL-EXO injected exosomes, LPAIV-EXO injected exosomes, and HPAIV-EXO injected exosomes, respectively. Finally, the spleen, lungs, and trachea were harvested from all four groups (NC, CTRL-EXO, LPAIV-EXO, and HPAIV-EXO injected exosomes), respectively. All animal experiments complied with the World Organization for Animal Health (OIE) guidelines. All experimental procedures are schematically illustrated in Fig. 1 . This study was conducted in compliance with the institutional rules for the care and ethical use of laboratory animals, using a protocol approved by the Ministry of Agriculture and Rural Development, Vietnam (TCVN 8402:2010/TCVN 8400-26:2014). 2.2 Exosome isolation and characterization Exosomes from CTRL-EXO, LPAIV-EXO, and HPAIV-EXO serum were isolated and characterized as previously described [ 17 ]. Influenza A virus nucleoprotein (NP) (#PA5-32242, Thermo Fisher Scientific, Waltham, MA, USA) and non-structural protein (NS1) (#GTX125990, Irvine, CA, USA) antibodies were detected by western blotting following established protocols [ 18 ]. 2.3 RNA extraction from exosomes and tissues and detection of viral RNA Total RNA in exosomes was extracted using TRIzol reagent (Thermo Fisher Scientific), following the manufacturer’s protocol. cDNA was synthesized from 2 µg of total RNA using a RevertAid first-strand cDNA synthesis kit (Thermo Fisher Scientific). H5 was amplified using DreamTaq polymerase (Thermo Fisher Scientific) with primers listed in Table 2 , following the recommended procedure [ 19 ]. Polymerase chain reaction (PCR) products were separated on 2% agarose gel stained with Dyne STAR (Dyne Bio, Seongnam, South Korea), an ethidium bromide alternative. Total RNA was extracted from lung, spleen, and trachea tissues by grinding them with a Tissue Grinder Motor (Taeshin Bio Science, Korea). After sample collection, 1 mL of TRIzol reagent (Thermo Fisher Scientific) was added to the homogenized tissues. To separate the aqueous phase, 200 µL of chloroform was added, followed by RNA precipitation with 500 µL of isopropanol. Finally, the RNA pellet was washed with 75% ethanol. 2.4 Western blotting Approximately 40 µg of exosome samples were loaded onto a 15% sodium dodecyl sulfate-polyacrylamide (SDS) gel electrophoresis, and separated proteins were transferred to a polyvinylidene difluoride (PVDF) membrane (Invitrogen). The membrane was blocked with 5% skim milk in phosphate-buffered saline with 0.05% Tween-20 (PBST) (Sigma-Aldrich, St. Louis, MO, USA) and incubated overnight at 4°C with primary antibodies Influenza A NP Polyclonal Antibody (#PA5-32242, Thermo Fisher Scientific) or Influenza A virus NS1 (#GTX125990, Irvine, CA, USA), diluted in PBST containing 2% skim milk. After washing with PBST, the membrane was incubated for 1 h at room temperature RT with horseradish peroxidase-conjugated anti-rabbit secondary antibody (Thermo Fisher Scientific) in 2% skim milk. Protein bands were detected using Western Lightning Plus-ECL substrate (Thermo Fisher Scientific). 2.5 Cell culture and exosome treatment The chicken HD11 macrophage cell line [ 20 ] was cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Thermo Fisher Scientific) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Thermo Fisher Scientific), 100 IU/mL penicillin, and 100 mg/mL streptomycin. HD11 (8×10 5 cells/well) were seeded in 12-well plates (SPL Life Sciences, Pocheon, Korea) and incubated overnight at 41 ℃ in a humidified 5% CO 2 incubator. The medium was replaced with a new exosome-depleted RPMI 1640 medium containing 10% exosome-depleted FBS (#EXO-FBSHI-250A-1; System Bioscience, Palo Alto, CA) and 100 IU/mL penicillin with 100 mg/mL streptomycin. Cells were treated with 50 µg/mL exosomes (CTRL-EXO, LPAIV-EXO, and HPAIV-EXO) for 4 h. Total RNA was extracted from cell culture supernatants using TRIol reagent (Thermo Fisher Scientific) following the manufacturer’s protocol. cDNA was synthesized from 2 ug of total RNA using the RevertAid first-strand cDNA synthesis kit (Thermo Fisher Scientific) following the manufacturer’s instructions. 2.6 Reverse transcription quantitative real-time PCR (RT-qPCR) Oligonucleotide primers for RT-qPCR were designed with Primer-BLAST ( http://www.ncbi.nlm.nih.gov/tools/primer-blast/ ) and synthesized by Genotech (Daejeon, South Korea) as listed in Table 2 . RT-qPCR was performed on a CFX Connect Real-Time PCR System (Bio-Rad, Hercules, CA, USA) using SYBR Green PCR assay and cytokine expression validation was conducted using Dyne qPCR 2X PreMix (Dyne Bio). The amplification conditions were as follows: 40 cycles at 95 ℃ for 30 s, 56–60 ℃ for 30 s, and 72 ℃ for 30 s. GAPDH served as the housekeeping gene, and relative expression was calculated using the 2 −ΔΔCt method [ 21 ]. All RT-qPCR analysis was performed in triplicate. 2.7 Cellular uptake of CTRL-EXO, LPAIV-EXO, and HPAIV-EXO To observe exosome internalization (CTRL-EXO, LPAIV-EXO, and HPAIV-EXO), exosomes were labeled with DiI (#D3911; Sigma-Aldrich) and incubated with HD11 cells cultured in Nunc™ Lab-Tek™ Chamber Slides (#177380, Thermo Fisher Scientific). Exosomes (50 µg/mL) were diluted in 200 µL PBS and 2 µL of 1 mM DiI (prepared in methanol) and incubated for 2 h at RT, covered with foil. After three rounds of centrifugation (18,000 g, 20 min), the supernatant was discarded, and the pellet was washed with 200 uL PBS. DiI-labeled exosomes were added to HD11 cells in an exosome-free medium and incubated for 12 h at 41 ℃ with 5% CO 2 . Cells were fixed cells with 4% paraformaldehyde in PBS (pH 7.4) for 15 min at RT in the dark and stained with DAPI (#P6966; Thermo Fisher Scientific) for 5 min. Stained images were captured using an EVOS FLoid Cell Imaging Station (Thermo Fisher Scientific). 2.8 Immunocytochemistry HD11 cells (6×10 5 cells/well) were cultured in exosome-free complete RPMI 1640 in Nunc™ Lab-Tek™ Chamber Slides (#177380, Thermo Fisher Scientific) for 4 h at 41 ℃ (5% CO 2 ), then treated with 50 µg/mL exosomes (CTRL-EXO, LPAIV-EXO, and HPAIV-EXO) or left untreated (NC) for 24 h. To detect viral NP, the cells were fixed with 4% paraformaldehyde in PBS (pH 7.4) for 15 min at RT and permeabilized with ice-cold methanol (Sigma-Aldrich) for 10 min at -20 ℃. To detect NS1 viral protein, cells were fixed with 100% methanol (Sigma-Aldrich) for 5 min at RT and permeabilized with ice-cold methanol for 10 min at -20 ℃. After overnight incubation at 4°C with primary antibodies (NP, NS1), cells were treated with Alexa Fluor®488-conjugated secondary antibodies (Thermo Fisher Scientific) and incubated for 1 h at RT. The cell nucleus was stained with DAPI for 5 min. Immunostained slides were imaged using a confocal microscope (LSM800, Carl Zeiss, Germany) and analyzed using ZEN v2.6 software. 2.9 Statistical analysis Statistical analysis was performed using SPSS software (IBM, SPSS 28.0 for Windows, Chicago, IL, USA). Data are presented as mean ± standard error of the mean. Groups were compared using one-way ANOVA with Tukey’s test. P < 0.05 was considered significant. Error bars represent fold changes from three technical replicates. 3. Results 3.1 Detection of viral components in exosomes To identify viral particles in exosomes, we conducted PCR and western blot analyses using exosomes isolated from noninfected (CTRL-EXO), LPAIV-infected (LPAIV-EXO), and HPAIV-infected (HPAIV-EXO) chicken serum. H5 AIV RNA was detected in lanes 2, 3, 5, 6, and 10 (Fig. 2 A). Spleen samples injected with AIV-exosomes (lanes 2 and 3) had stronger H5 RNA amplification with LPAIV-EXO than with HPAIV-EXO. However, exosomes themselves (lanes 5 and 6) showed stronger H5 signals with HPAIV-EXO than with LPAIV-EXO. Among exosomes extracted from chickens injected with CTRL-EXO, LPAIV-EXO, HPAIV-EXO, and uninjected controls (lanes 7–10), the viral H5 RNA band appeared only in the HPAIV-EXO sample (lane 10). Figure 2 B confirmed that exosomes reflect influenza A NP and NS1 during infection. Only LPAIV-EXO showed a clear NP band, while HPAIV-EXO displayed a weaker band. NS1 was analyzed under the same conditions, but reliable results were not obtained (data not shown). 3.2 Immune responses induced in chicken tissues by AIV-exosomes injection To examine exosome-mediated immune responses in vivo , naïve chickens were intramuscularly injected with exosomes (NC, CTRL-EXO, LPAIV-EXO, and HPAIV-EXO). Cytokine expression levels were measured by RT-qPCR (Fig. 3 ). In the lungs of AIV-exosome-injected chickens, IFN-β, IFN-γ, and IL-10 expression showed similar patterns and were highly upregulated in the CTRL-EXO group, with 2.73-, 3.44-, and 2.26-fold change, respectively. No significant differences were observed between CTRL-EXO and HPAIV-EXO, although HPAIV-EXO had the second-highest expression levels for these cytokines. IL-4 expression increased 1.12-fold in LPAIV-EXO and decreased by 0.19- and 0.18-fold in CTRL-EXO and HPAIV-EXO, respectively, compared to NC, though the difference between NC and LPAIV-EXO was not statistically significant. IFN-α expression showed a similar pattern with IL-4. IL-6 expression decreased by 0.54-, 0.39-, and 0.89-fold in CTRL-EXO, LPAIV-EXO, and HPAIV-EXO, respectively. IL-1β was significantly downregulated in both the LPAIV-EXO and HPAIV-EXO groups (Fig. 3 A). Cytokine expression was highest in AIV-exosome-injected chicken spleens (Fig. 3 B). IFN-α, IFN-β, IFN-γ, IL-1β, and IL-6 expression were the most upregulated in the HPAIV-EXO group, with fold increases of 1.44, 2.38, 4.96, 1.78, and 2.48, respectively. In contrast, the anti-inflammatory cytokines IL-4 and IL-10 were the most upregulated in the LPAIV-EXO group, showing 4.18- and 6.13-fold increases, respectively. IL-1β expression in the trachea mirrored the downregulation observed in the lungs following AIV-exosome injection (Fig. 3 C). IFN-α expression showed a similar pattern, while IL-6 levels did not differ significantly among groups. IFN-β and IFN-γ were most highly expressed in the LPAIV-EXO group, whereas IL-4 and IL-10 showed the lowest expression in the LPAIV-EXO and HPAIV-EXO groups, respectively. Overall, cytokine expression indicates that the spleen has a stronger immune response than the lung or trachea. 3.3 Cellular uptake of AIV-exosomes in chicken immune cell line To determine whether exosomes from AIV-infected chickens transmit their viral particles and induce immune responses, HD11 cells were treated with 50 µg/mL of exosomes. DiI-labeled CTRL-EXO, LPAIV-EXO, and HPAIV-EXO were internalized into the cytoplasm of HD11 cells (Fig. 4 ). 3.4 HD11 macrophage cell treated with AIV-exosomes induces cytokine expression To evaluate exosome-induced immune responses, HD11 cells were treated with 50 µg/mL exosomes for 4 h. Subsequently, the mRNA levels of type I (IFN-α, IFN-β), type II (IFN-γ) interferons, pro-inflammatory cytokines (IL-1β, IL-18, and TNF-α), anti-inflammatory cytokines (IL-4), and chemokine IL-8 (CXCL8) were measured. The results indicated that the LPAIV-EXO groups had the highest expression levels (Fig. 5 ). However, no statistically significant difference was observed between CTRL-EXO and HPAIV-EXO. These results suggest that LPAIV-EXO elicits a stronger immune response than HPAIV-EXO, likely due to differences in viral components delivered via exosome. 3.5 Viral proteins were delivered via AIV-exosomes in chicken macrophage cell lines Immunocytochemistry confirmed the presence of NP and NS1 in AIV-EXO-treated cells (LPAIV-EXO and HPAIV-EXO), indicating successful exosome-mediated viral component delivery. Notably, NP signals were stronger in the LPAIV-EXO group than in the HPAIV-EXO group (Fig. 6 A). NS1s were detected in LPAIV-EXO but weakly expressed in HPAIV-EXO, with nuclear localization observed (Fig. 6 B). These results suggest a stronger immune response in the LPAIV-EXO group, consistent with RT-qPCR cytokine profiles in exosome-treated HD11 cells (Fig. 6 ). These findings support the enhanced immunomodulatory effect of LPAIV-EXO. 4. Discussion Exosomes have gained attention as biomarkers and diagnostic tools due to their ability to reflect physiological and pathological conditions based on their cellular origin. However, their role in regulating immune responses, particularly in chickens at the whole-animal level, remains underexplored. This study investigated whether exosomes derived from LPAIV- or HPAIV-infected chickens can modulate immune responses in recipient hosts and immune cells. Bedford et al. showed that airway exosomes from the bronchoalveolar lavage fluid of influenza-infected mice transferred viral proteins (HA, NA, NP, M1, and NS1) to uninfected mice and activated antigen-presenting cells [ 9 ]. Exosome-induced pulmonary inflammation is marked by cytokine release, induction of type I and II interferons, and neutrophil recruitment [ 9 ]. Viral RNA within exosomes is typically recognized by Toll-like receptors (TLRs), particularly TLR7, which detects viral RNA within endosomal compartments following viral exposure [ 22 , 23 ]. For instance, exosomes from Human immunodeficiency virus type-1-infected macrophages trigger pro-inflammatory cytokine production by recognizing their RNA cargo in TLRs [ 24 ]. This mechanism enables host cells to package viral RNA into exosomes, thereby modulating innate immunity and influencing the pathogenesis of nearby uninfected cells. Our findings reveal that exosomes from virus-infected chickens can transmit viral components, –including H5 viral RNA, as observed in exosomes from AIV-EXO-injected chickens (Fig. 2 ). These results demonstrate that exosomes serve as delivery systems for viral genetic material, not merely as intracellular signaling messengers, suggesting their involvement in the viral infection pathway. Moreover, they indicate that viral components may affect the cellular state of other organisms without viral infection. However, the exact role of exosomes in viral transmission requires further investigation. We analyzed cytokine expression in the lung, spleen, and trachea of exosome-injected naïve chickens. Notably, the spleen exhibited robust immune activation, especially after HPAIV-EXO treatment (Fig. 3 B). IFN-α, IFN-β, IFN-γ, IL-1β, and IL-6 were significantly upregulated by HPAIV-EXO. Type I and II interferons are key antiviral defenses; IFN-β and IFN-α subtypes stimulate antiviral molecules encoded by IFN-stimulated genes [ 25 , 26 ]. IL-6, a pleiotropic cytokine, is produced in response to tissue damage and viral infection and modulates host immune responses [ 27 ]. Along with TNF-α and IL-1 (including IL-1β), IL-6 is among the most important cytokines in viral infections. IL-1β, an inflammatory plasma marker, showed higher expression in cells treated with AIV H7N9-derived HA protein [ 28 , 29 ], suggesting splenic immune cells are highly responsive to HPAIV-derived exosomal cargo. Anti-inflammatory cytokines IL-4 and IL-10 were remarkably upregulated in the LPAIV-EXO group. These cytokines are primarily involved in the Th2 response and maintain the balance of inflammatory signals during acute viral infection, preventing tissue damage in the host [ 30 , 31 ]. Overall, pro-inflammatory cytokines (IL-1β and IL-6) and antiviral interferons (IFN-α, IFN-β, and IFN-γ) were more highly expressed in HPAIV-EXO than in LPAIV-EXO. Mo et al. reported higher expression of pro-inflammatory genes in HPAIV-infected bone marrow-derived dendritic cells than in LPAIV groups [ 32 ]. This suggests that HPAIV-EXO may contain cytokine-overexpressing cargo that triggers an immune response similar to direct HPAIV infection. Conversely, anti-inflammatory cytokines (IL-4 and IL-10) were elevated in LPAIV-EXO, suggesting that cytokine induction varies with pathogenicity, as HPAIV has a high mortality rate and causes severe symptoms, so the immune system is highly activated due to a strong inflammatory response, whereas LPAIV promotes immune homeostasis. Although uninfected exosomes were not expected to elicit significant immune modulation, some cytokines were differentially expressed between NC and CTRL-EXO. This suggests that exosomes from uninfected hosts may carry bioactive molecules causing minor immune effects or act as foreign particles inducing mild immune activation. Alternatively, injection or subtle physiological differences in donor chickens could explain the variation. Viral components, particularly viral RNA and protein, carried by exosomes act as pathogen-associated molecular patterns that trigger innate immunity via pattern recognition receptors such as TLRs, RIG-I, MDA5, and NLRs [ 33 , 34 ]. Our data demonstrate that the immunomodulatory effects of AIV-derived exosomes are tissue-specific and depend on viral pathogenicity. While HPAIV-EXO strongly stimulates systemic immune responses in lymphoid organs such as the spleen, it limits inflammation in mucosal tissues such as the lung and trachea. Although derived from AIV infection, these exosomes elicit weaker immune responses than direct viral infection. However, in the spleen, which is the second largest lymphoid tissue rich in immune cells [ 35 ], both AIV-EXOs induced strong immune activation. These findings suggest that unlike primary respiratory organs (lungs and trachea) that are the targets of direct AIV infection, viral molecules delivered via exosomes act as viral antigens that preferentially activate immune organs. Furthermore, immune responses may vary by organ characteristics. The lungs, as primary respiratory and mucosal immune organs, protect the host by degrading pathogens and foreign particles through the mucosal barrier and epithelial cells [ 36 , 37 ]. Thus, while intramuscularly injected exosomes may be recognized as foreign substances, unlike the lungs and trachea, which are mucosa-associated lymphoid tissues and directly exposed to external antigens, the spleen more readily detects circulating exosomes and triggers a systemic immune response through innate immune cells. Accumulating evidence shows that exosomes derived from virus-infected cells play a pivotal role in orchestrating cellular immune responses. For example, respiratory syncytial virus infection induced an immune response in human monocytes and airway epithelial cells by delivering viral components via exosomes, inducing cytokine and chemokine release [ 38 ]. Similarly, plasma vesicles from SARS-CoV-2-infected patients activate peripheral immune cells; viral dsRNA recognized by TLR3 stimulates IL-6, IL-8, and TNF-α production, contributing to the cytokine storm [ 39 ]. Our study confirmed exosome-mediated immune responses by showing increased cytokine expression in exosome-treated chicken macrophage cell lines. Type I (IFN-α, IFN-β) and type II (IFN-γ) interferons, pro-inflammatory cytokines (IL-1β, IL-18), the anti-inflammatory cytokine IL-4, tumor necrosis factor-α (TNF-α), and chemokine IL-8 were all detected, with notable high levels in LPAIV-EXO-treated cells (Fig. 5 ). TNF-α, secreted by macrophages and monocytes, acts early to suppress immunopathology during H1N1 influenza infection [ 40 , 41 ]. IL-8, a CXC chemokine, activates neutrophils by binding to CXCR1 and CXCR2 and, together with IL-6, is highly expressed in patients infected with the SARS-CoV-2 virus [ 42 – 45 ]. IL-18, known as the “IFN-γ inducing factor,” belongs to the IL-1 family that regulates innate and adaptive immunity by activating macrophages synergistically with IL-12 [ 46 , 47 ]. In Fig. 6 , Both NP and NS1 showed stronger signals in LPAIV-EXO than in HPAIV-EXO, consistent with the western blot results in Fig. 2 B. Similarly, RT-qPCR revealed higher cytokine expression in LPAIV-EXO, supporting its enhanced immunomodulatory effect. These findings suggest that the stronger viral protein signals in LPAIV-EXO contribute to the elevated cytokine expression. NP, secreted by influenza virus-infected cells, is crucial for viral replication and induces pro-inflammatory cytokines such as IL-1β and IL-6 via TLR4 and NLRP3 inflammasome activation [ 48 , 49 ]. NS1 antagonizes host antiviral responses by inhibiting type I interferons and blocking RIG-I signaling pathways during influenza A virus infection [ 50 , 51 ]. However, NS1 in exosomes may modulate rather than completely inhibit immune activation, depending on the balance between immune evasion and detection in recipient cells. For instance, Dengue virus-derived NS1 induces the production of pro-inflammatory cytokines in human dendritic cells [ 52 ]. Upon AIV-EXO treatment, NS1 showed clear nuclear localization in HD11 cells (Fig. 6 B), consistent with previous studies demonstrating that the influenza A H3N2 subtype virus NS1 protein possesses a C-terminal NLS2/NoLS domain that facilitates nuclear import and interaction with nuclear proteins such as nucleolin and fibrillarin [ 53 ]. Immunocytochemistry confirmed elevated levels NP and NS1 levels in HD11 cells treated with LPAIV-EXO, suggesting that higher NP and NS1 content in LPAIV-EXO may increase cytokine expression in these cells. In our previous study, we demonstrated that exosomal miRNAs from LPAIV- or HPAIV-infected chickens were associated with the MAPK signaling pathway, a key regulator of host immunity. Additionally, we detected viral RNA and proteins in the exosomes, suggesting that both viral molecules and small non-coding RNAs such as miRNAs contribute to the immune response. Since miRNAs regulate host gene expression by targeting immune-related pathways, exosome-mediated delivery of viral or host-derived miRNAs may further modulate immune activation [ 54 – 56 ]. Therefore, the immunostimulatory effects observed in this study likely result from the combined action of viral proteins, RNA, and regulatory non-coding RNAs within exosomes. In summary, our study demonstrates that exosomes from AIV-infected chickens carry viral RNA, and proteins and modulate host immune responses in vivo and in vitro . Notably, HPAIV-derived exosomes induced a strong immune response in the spleen, whereas LPAIV-EXO strongly stimulated HD11 cells. These findings suggest that immune homeostasis and cell interactions in the spleen may limit excessive inflammation, while macrophages directly activate immune genes in response to exosomal viral proteins such as NP and NS1. Overall, these results demonstrate that the immunomodulatory effects of exosomes are influenced by both exosomal cargo and the specific immune environment. Further research is needed to clarify how viral components interact with innate immune receptors to modulate immunity. Understanding these processes will enhance knowledge of viral pathogenesis and guide exosome-based diagnostics, vaccine development, and therapeutic strategies in the poultry industry. Authors’ contributions CEK and YHH designed the experiments; CEK and THP participated in conceiving methodology and conducted investigations; YHH and ADT provided reagents, materials, and analytical tools; CEK performed and visualized the experiments; CEK, HSL, and YHH analyzed and interpreted the data; and CEK, HSL, and YHH wrote and reviewed the manuscript. All the authors have read and approved the final manuscript. Abbreviations AIV Avian influenza virus HPAIV Highly pathogenic AIV LPAIV Low pathogenic AIV RT-qPCR Reverse transcription-quantitative polymerase chain reaction Days-post infection dpi HA Hemagglutinin NA Neuraminidase Declarations Authors’ contributions CEK and YHH designed the experiments; CEK and THP participated in conceiving methodology and conducted investigations; YHH and ADT provided reagents, materials, and analytical tools; CEK performed and visualized the experiments; CEK, HSL, and YHH analyzed and interpreted the data; and CEK, HSL, and YHH wrote and reviewed the manuscript. All the authors have read and approved the final manuscript. Consent for publication. Not applicable. Competing interests The authors declare that they have no conflicts of interest. Acknowledgments The authors thank the Department of Biochemistry and Immunology Laboratory of the National Institute of Veterinary Research, Vietnam, for conducting the animal experiments. Immunocytochemistry analysis was performed at the BT research facility center, Chung-Ang University. Funding This research was funded by the National Research Foundation grant (NRF-2021R1A2C2005236) of the Republic of Korea. Availability of data and materials All data generated or analyzed during this study are included in this published article. Ethics approval and consent to participate. Not applicable. References Shi J, Zeng X, Cui P, Yan C, Chen H (2023) Alarming situation of emerging H5 and H7 avian influenza and effective control strategies. Emerg Microbes Infect 12:2155072 Luczo JM, Stambas J, Durr PA, Michalski WP, Bingham J (2015) Molecular pathogenesis of H5 highly pathogenic avian influenza: the role of the haemagglutinin cleavage site motif. Rev Med Virol 25:406–430 Meseko C, Globig A, Ijomanta J, Joannis T, Nwosuh C, Shamaki D, Harder T, Hoffman D, Pohlmann A, Beer M, Mettenleiter T, Starick E (2018) Evidence of exposure of domestic pigs to Highly Pathogenic Avian Influenza H5N1 in Nigeria. Sci Rep 8:5900 Garg S, Reinhart K, Couture A, Kniss K, Davis CT, Kirby MK, Murray EL, Zhu S, Kraushaar V, Wadford DA, Drehoff C, Kohnen A, Owen M, Morse J, Eckel S, Goswitz J, Turabelidze G, Krager S, Unutzer A, Gonzales ER, Abdul Hamid C, Ellington S, Mellis AM, Budd A, Barnes JR, Biggerstaff M, Jhung MA, Richmond-Crum M, Burns E, Shimabukuro TT, Uyeki TM, Dugan VG, Reed C, Olsen SJ (2025) Highly Pathogenic Avian Influenza A(H5N1) Virus Infections in Humans. N Engl J Med 392:843–854 Subbarao K, Klimov A, Katz J, Regnery H, Lim W, Hall H, Perdue M, Swayne D, Bender C, Huang J, Hemphill M, Rowe T, Shaw M, Xu X, Fukuda K, Cox N (1998) Characterization of an Avian Influenza A (H5N1) Virus Isolated from a Child with a Fatal Respiratory Illness. Science 279:393–396 Bobrie A, Colombo M, Raposo G, Thery C (2011) Exosome secretion: molecular mechanisms and roles in immune responses. Traffic 12:1659–1668 Wang X, Tian L, Lu J, Ng IO-L (2022) Exosomes and cancer - Diagnostic and prognostic biomarkers and therapeutic vehicle. Oncogenesis 11:54 Gurung S, Perocheau D, Touramanidou L, Baruteau J (2021) The exosome journey: from biogenesis to uptake and intracellular signalling. Cell Communication Signal 19:47 Bedford JG, Infusini G, Dagley LF, Villalon-Letelier F, Zheng MZM, Bennett-Wood V, Reading PC, Wakim LM (2020) Airway Exosomes Released During Influenza Virus Infection Serve as a Key Component of the Antiviral Innate Immune Response. Front Immunol 11:887 Hong Y, Truong AD, Vu TH, Lee S, Heo J, Kang S, Lillehoj HS, Hong YH (2022) Exosomes from H5N1 avian influenza virus-infected chickens regulate antiviral immune responses of chicken immune cells. Dev Comp Immunol 130:104368 Peng Y, Yang Y, Li Y, Shi T, Luan Y, Yin C (2023) Exosome and virus infection. Front Immunol 14:1154217 Dreux M, Garaigorta U, Boyd B, Decembre E, Chung J, Whitten-Bauer C, Wieland S, Chisari FV (2012) Short-range exosomal transfer of viral RNA from infected cells to plasmacytoid dendritic cells triggers innate immunity. Cell Host Microbe 12:558–570 Luong N, Olson JK (2021) Exosomes Secreted by Microglia During Virus Infection in the Central Nervous System Activate an Inflammatory Response in Bystander Cells. Front Cell Dev Biol 9:661935 Zabrodskaya Y, Plotnikova M, Gavrilova N, Lozhkov A, Klotchenko S, Kiselev A, Burdakov V, Ramsay E, Purvinsh L, Egorova M, Vysochinskaya V, Baranovskaya I, Brodskaya A, Povalikhin R, Vasin A (2022) Exosomes Released by Influenza-Virus-Infected Cells Carry Factors Capable of Suppressing Immune Defense Genes in Naive Cells. Viruses 14 Luong N, Olson JK (2021) Exosomes Secreted by Microglia During Virus Infection in the Central Nervous System Activate an Inflammatory Response in Bystander Cells. Front Cell Dev Biol Volume 9–2021 Huprikar J, Rabinowitz S (1980) A simplified plaque assay for influenza viruses in Madin-Darby kidney (MDCK) cells. J Virol Methods 1:117–120 Kim C, Phan TH, Vu TH, Truong AD, Lillehoj HS, Hong YH Comparison of exosomal miRNA profiling in highly pathogenic and low pathogenic avian influenza virus-infected chickens, submitted Hong Y, Lee J, Vu TH, Lee S, Lillehoj HS, Hong YH (2021) Immunomodulatory effects of poly(I:C)-stimulated exosomes derived from chicken macrophages. Poult Sci 100:101247 Chaharaein B, Omar AR, Aini I, Yusoff K, Hassan SS (2009) Detection of H5, H7 and H9 subtypes of avian influenza viruses by multiplex reverse transcription-polymerase chain reaction. Microbiol Res 164:174–179 Klasing KC, Peng RK (1987) Influence of cell sources, stimulating agents, and incubation conditions on release of interleukin-1 from chicken macrophages. Dev Comp Immunol 11:385–394 Livak KJ, Schmittgen TD (2001) Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2 – ∆∆CT Method. Methods 25:402–408 Blasius AL, Beutler B (2010) Intracellular toll-like receptors. Immunity 32:305–315 Kawai T, Akira S (2011) Toll-like Receptors and Their Crosstalk with Other Innate Receptors in Infection and Immunity. Immunity 34:637–650 Sampey GC, Saifuddin M, Schwab A, Barclay R, Punya S, Chung MC, Hakami RM, Zadeh MA, Lepene B, Klase ZA, El-Hage N, Young M, Iordanskiy S, Kashanchi F (2016) Exosomes from HIV-1-infected Cells Stimulate Production of Pro-inflammatory Cytokines through Trans-activating Response (TAR) RNA. J Biol Chem 291:1251–1266 Lee AJ, Ashkar AA (2018) The Dual Nature of Type I and Type II Interferons. Front Immunol 9:2061 McNab F, Mayer-Barber K, Sher A, Wack A, O'Garra A (2015) Type I interferons in infectious disease. Nat Rev Immunol 15:87–103 Velazquez-Salinas L, Verdugo-Rodriguez A, Rodriguez LL, Borca MV (2019) The Role of Interleukin 6 During Viral Infections. Front Microbiol Volume 10–2019 Slaats J, Ten Oever J, van de Veerdonk FL, Netea MG (2016) IL-1β/IL-6/CRP and IL-18/ferritin: Distinct Inflammatory Programs in Infections. PLoS Pathog 12:e1005973 Zhang S, Gu D, Ouyang X, Xie W (2015) Proinflammatory effects of the hemagglutinin protein of the avian influenza A (H7N9) virus and microRNA–mediated homeostasis response in THP–1 cells. Mol Med Rep 12:6241–6246 Rojas JM, Avia M, Martín V, Sevilla N (2017) IL-10: A Multifunctional Cytokine in Viral Infections. J Immunol Res 2017:6104054 van den Broek M, Bachmann MF, Köhler G, Barner M, Escher Rd, Zinkernagel R, Kopf M (2000) IL-4 and IL-10 Antagonize IL-12-Mediated Protection Against Acute Vaccinia Virus Infection with a Limited Role of IFN-γ and Nitric Oxide Synthetase 21. J Immunol 164:371–378 Mo J, Segovia K, Chrzastek K, Briggs K, Kapczynski DR (2024) Morphologic characterization and cytokine response of chicken bone-marrow derived dendritic cells to infection with high and low pathogenic avian influenza virus. Front Immunol 15:1374838 Dreux M, Garaigorta U, Boyd B, Décembre E, Chung J, Whitten-Bauer C, Wieland S, Chisari Francis V (2012) Short-Range Exosomal Transfer of Viral RNA from Infected Cells to Plasmacytoid Dendritic Cells Triggers Innate Immunity. Cell Host Microbe 12:558–570 Kawai T, Akira S (2009) The roles of TLRs, RLRs and NLRs in pathogen recognition. Int Immunol 21:317–337 Lewis SM, Williams A, Eisenbarth SC (2019) Structure and function of the immune system in the spleen. Sci Immunol 4 Gopallawa I, Dehinwal R, Bhatia V, Gujar V, Chirmule N (2023) A four-part guide to lung immunology: Invasion, inflammation, immunity, and intervention. Front Immunol Volume 14–2023 Sato S, Kiyono H (2012) The mucosal immune system of the respiratory tract. Curr Opin Virol 2:225–232 Chahar HS, Corsello T, Kudlicki AS, Komaravelli N, Casola A (2018) Respiratory Syncytial Virus Infection Changes Cargo Composition of Exosome Released from Airway Epithelial Cells. Sci Rep 8:387 Chen L, Chen R, Yao M, Feng Z, Yuan G, Ye F, Nguyen K, Karn J, McComsey GA, McIntyre TM, Jin G (2022) COVID-19 plasma exosomes promote proinflammatory immune responses in peripheral blood mononuclear cells. Sci Rep 12:21779 Mohd Zawawi Z, Kalyanasundram J, Mohd Zain R, Thayan R, Basri DF, Yap WB (2023) Prospective Roles of Tumor Necrosis Factor-Alpha (TNF-α) in COVID-19: Prognosis, Therapeutic and Management. Int J Mol Sci 24:6142 Savenkova DA, Gudymo AS, Korablev AN, Taranov OS, Bazovkina DV, Danilchenko NV, Perfilyeva ON, Ivleva EK, Moiseeva AA, Bulanovich YA, Roshchina EV, Serova IA, Battulin NR, Kulikova EA, Yudkin DV (2024) Knockout of the Tnfa Gene Decreases Influenza Virus-Induced Histological Reactions in Laboratory Mice. Int J Mol Sci 25:1156 Cesta MC, Zippoli M, Marsiglia C, Gavioli EM, Mantelli F, Allegretti M, Balk RA (2022) The Role of Interleukin-8 in Lung Inflammation and Injury: Implications for the Management of COVID-19 and Hyperinflammatory Acute Respiratory Distress Syndrome. Front Pharmacol 12–2021 Lee J, Choi JA, Ju H-h, Kim J-E, Paik S-Y, Rao PV (2021) Role of MCP-1 and IL-8 in viral anterior uveitis, and contractility and fibrogenic activity of trabecular meshwork cells. Sci Rep 11:14950 Zhu QC, Li S, Yuan LX, Chen RA, Liu DX, Fung TS (2021) Induction of the Proinflammatory Chemokine Interleukin-8 Is Regulated by Integrated Stress Response and AP-1 Family Proteins Activated during Coronavirus Infection. Int J Mol Sci 22:5646 Zimmermann HW, Seidler S, Gassler N, Nattermann J, Luedde T, Trautwein C, Tacke F (2011) Interleukin-8 is activated in patients with chronic liver diseases and associated with hepatic macrophage accumulation in human liver fibrosis. PLoS ONE 6:e21381 Ihim SA, Abubakar SD, Zian Z, Sasaki T, Saffarioun M, Maleknia S, Azizi G (2022) Interleukin-18 cytokine in immunity, inflammation, and autoimmunity: Biological role in induction, regulation, and treatment. Front Immunol Volume 13–2022 Munder M, Mallo M, Eichmann K, Modolell M (1998) Murine macrophages secrete interferon γ upon combined stimulation with interleukin (IL)-12 and IL-18: a novel pathway of autocrine macrophage activation. J Exp Med 187:2103–2108 Eisfeld AJ, Neumann G, Kawaoka Y (2015) At the centre: influenza A virus ribonucleoproteins. Nat Rev Microbiol 13:28–41 Kim C-U, Jeong Y-J, Lee P, Lee M-S, Park J-H, Kim Y-S, Kim D-J (2022) Extracellular nucleoprotein exacerbates influenza virus pathogenesis by activating Toll-like receptor 4 and the NLRP3 inflammasome. Cell Mol Immunol 19:715–725 Koliopoulos MG, Lethier M, van der Veen AG, Haubrich K, Hennig J, Kowalinski E, Stevens RV, Martin SR, Reis e Sousa, Cusack C, Rittinger S (2018) K. Molecular mechanism of influenza A NS1-mediated TRIM25 recognition and inhibition. Nat Commun 9:1820 Zhang Q, Zhang X, Lei X, Wang H, Jiang J, Wang Y, Bi K, Diao H (2022) Influenza A virus NS1 protein hijacks YAP/TAZ to suppress TLR3-mediated innate immune response. PLoS Pathog 18:e1010505 Alayli F, Scholle F (2016) Dengue virus NS1 enhances viral replication and pro-inflammatory cytokine production in human dendritic cells. Virology 496:227–236 Melén K, Tynell J, Fagerlund R, Roussel P, Hernandez-Verdun D, Julkunen I (2012) Influenza A H3N2 subtype virus NS1 protein targets into the nucleus and binds primarily via its C-terminal NLS2/NoLS to nucleolin and fibrillarin. Virol J 9:167 Chandan K, Gupta M, Sarwat M (2020) Role of Host and Pathogen-Derived MicroRNAs in Immune Regulation During Infectious and Inflammatory Diseases. Front Immunol 10–2019 Vu TH, Heo J, Kang S, Kim C, Lillehoj HS, Hong YH (2023) Chicken miR-26a-5p modulates MDA5 during highly pathogenic avian influenza virus infection. Dev Comp Immunol 149:104921 Vu TH, Hong Y, Heo J, Kang S, Lillehoj HS, Hong YH (2023) Chicken miR-148a-3p regulates immune responses against AIV by targeting the MAPK signalling pathway and IFN-gamma. Vet Res 54:110 Rohde F, Schusser B, Hron T, Farkašová H, Plachý J, Härtle S, Hejnar J, Elleder D, Kaspers B (2018) Characterization of Chicken Tumor Necrosis Factor-α, a Long Missed Cytokine in Birds. Front Immunol Volume 9–2018 Tables Table 1 is available in the Supplementary Files section. Table 2 Primer sequences for RT-qPCR Genes Sequences (5'→3') Accession number H5 F: ACAAAGCTCTATCAAAACCCAAC [ 19 ] R: TACCCATACCAACCATCTACCAT IFN-α F: GAGCAATGCTTGGACAGCAG GU119896.1 R: GAGGTTGTGGATGTGCAGGA IFN-β F: CTTGCCCACAACAAGACGTG NM_001024836.1 R: TGTTTTGGAGTGTGTGGGCT IFN-γ F: AACAACCTTCCTGATGGCGT NM_205149.1 R: TGAAGAGTTCATTCGCGGCT IL-1β F: TGCCTGCAGAAGAAGCCTCG NM_204524.1 R: CTCCGCAGCAGTTTGGTCAT IL-4 F: TTGTTTGGGAGAGCCAGCA NM_001007079.1 R: GACATGGTGCCTTGAGGGAG IL-6 F: GCAGGACGAGATGTGCAAGA NM_204628.1 R: ATTTCTCCTCGTCGAAGCCG IL-8 F: GGCTTGCTAGGGGAAATGA NM_205498.1 R: AGCTGACTCTGACTAGGAAACTGT IL-10 F: GCTTCTACACAGATGAGGTCC NM_001004414.4 R: TCCCGTTCTCATCCATCTTC IL-18 F: GGAATGCGATGCCTTTTG NM_204608.1 R: ATTTTCCCATGCTCTTTCTCA TNFα F: CGCTCAGAACGACGTCAA [ 57 ] R: GTCGTCCACACCAACGAG GAPDH F: TGCTGCCCAGAACATCATCC NM_204305 R: ACGGCAGGTCAGGTCAACAA Additional Declarations No competing interests reported. Supplementary Files Table1.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6773730","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":465865848,"identity":"8db3b337-869d-4e3f-88ab-1113fc26e8bc","order_by":0,"name":"Chaeeun Kim","email":"","orcid":"","institution":"Chung-Ang University","correspondingAuthor":false,"prefix":"","firstName":"Chaeeun","middleName":"","lastName":"Kim","suffix":""},{"id":465865849,"identity":"6d875e8d-9eec-4420-a350-4369734d915b","order_by":1,"name":"Thi Hoai Phan","email":"","orcid":"","institution":"Chung-Ang University","correspondingAuthor":false,"prefix":"","firstName":"Thi","middleName":"Hoai","lastName":"Phan","suffix":""},{"id":465865850,"identity":"82a9ef3a-996e-46b9-89c9-70dc7667a726","order_by":2,"name":"Anh Duc Truong","email":"","orcid":"","institution":"National Institute of Veterinary Research","correspondingAuthor":false,"prefix":"","firstName":"Anh","middleName":"Duc","lastName":"Truong","suffix":""},{"id":465865851,"identity":"a0ec679c-7f6b-4249-8a50-90b24cec1dd7","order_by":3,"name":"Hyun Soon Lillehoj","email":"","orcid":"","institution":"United States Department of Agriculture","correspondingAuthor":false,"prefix":"","firstName":"Hyun","middleName":"Soon","lastName":"Lillehoj","suffix":""},{"id":465865852,"identity":"617aa6c9-3b16-4531-918a-d1283bbfd654","order_by":4,"name":"Yeong Ho Hong","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuUlEQVRIiWNgGAWjYDACCRBRAeMdIFrLGZK1MLaRosXgdvOxh1/n2ckbHGB++IHhzD0itNw5lm4suy3ZcMMBNmMJhhvFRGi5kWMmLbntAOOGAwxmDAwfEojVMueA/YYD7N+I1yL5seFA4oYDPEBbbhChRfJGWpo0w7Hk5JmHeYolEs4QoYXvRvIxyR81drZ9x9s3fvhwjAgtCgcYGJh5QCxmICZCAwODfAMwJn8Qo3IUjIJRMApGLgAAxMQ8/XXdnyMAAAAASUVORK5CYII=","orcid":"","institution":"Chung-Ang University","correspondingAuthor":true,"prefix":"","firstName":"Yeong","middleName":"Ho","lastName":"Hong","suffix":""}],"badges":[],"createdAt":"2025-05-29 07:08:41","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6773730/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6773730/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":84029892,"identity":"2ea77ba6-4cb6-489a-82ef-316610866b1f","added_by":"auto","created_at":"2025-06-06 02:01:10","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1129496,"visible":true,"origin":"","legend":"\u003cp\u003eExperimental workflow. (\u003cstrong\u003eA\u003c/strong\u003e) Animal experiments and (\u003cstrong\u003eB\u003c/strong\u003e) Cell experiments.\u003c/p\u003e","description":"","filename":"Figure1Experimentalworkflow.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6773730/v1/9a2be223acdb686c82aca969.jpg"},{"id":84029887,"identity":"e3b37a90-13bd-47fc-a25b-4729ce3288e1","added_by":"auto","created_at":"2025-06-06 02:01:10","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":279591,"visible":true,"origin":"","legend":"\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Reverse transcription polymerase chain reaction (RT-qPCR) detection of H5 avian influenza viral RNA in spleen, exosomes, and exosome-injected chicken samples. Lanes 1–3 (spleen): 1. Control, 2. LPAIV, 3. HPAIV; lane 4–6 (exosomes): 4. CTRL-EXO, 5. LPAIV-EXO, 6. HPAIV-EXO; lanes 7–10 (exosome-injected chicken exosomes): 7. NC (no exosome injection), 8. CTRL-EXO, 9. LPAIV-EXO, 10. HPAIV-EXO. Lane M: 100 bp DNA ladder. (B) Western blot analysis of viral protein nucleoprotein (NP) expression in exosomes.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6773730/v1/49d66bd6283fdb185d855358.jpg"},{"id":84029889,"identity":"86305cd5-347f-401c-bf63-cf1af916e790","added_by":"auto","created_at":"2025-06-06 02:01:10","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1438669,"visible":true,"origin":"","legend":"\u003cp\u003eCytokine expression in exosome-injected chicken (A) lung, (B) spleen, and (C) trachea tissues using RT-qPCR. NC:\u003cem\u003e \u003c/em\u003eSample from non-exosome injected chickens; CTRL-EXO: sample from CTRL-EXO injected chicken; LPAIV-EXO: sample from LPAIV-EXO injected chicken; HPAIV-EXO: sample from HPAIV-EXO injected chicken. A 200 µg exosome dose was injected, and samples were collected after 3 dpi. Different lowercase letters indicate statistical significance (\u003cem\u003ep\u003c/em\u003e \u0026lt;0.05) by analysis of variance with Tukey’s multiple comparison test. Cq values are presented as mean±SEM, normalized to GAPDH from three independent experiments.\u003c/p\u003e","description":"","filename":"Figure3combined.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6773730/v1/3ee8d3687bcc748190de59d6.jpg"},{"id":84030346,"identity":"8cf1c68f-2a7e-489e-ac66-758d4d9a4898","added_by":"auto","created_at":"2025-06-06 02:09:10","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":458289,"visible":true,"origin":"","legend":"\u003cp\u003eInternalization of DiI-labeled exosomes purified from serum of noninfected (CTRL-EXO), LPAIV-infected (LPAIV-EXO), and HPAIV-infected (HPAIV-EXO) chickens following incubation with HD11 cells. Scale bar = 10 um.\u003c/p\u003e","description":"","filename":"Figure4DiI.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6773730/v1/e304b980524275b26d615b70.jpg"},{"id":84029891,"identity":"b3cb2578-ecc0-4cc3-b68f-2ac65cc4f051","added_by":"auto","created_at":"2025-06-06 02:01:10","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":636115,"visible":true,"origin":"","legend":"\u003cp\u003eRT-qPCR analysis of cytokine expression in chicken macrophage cell lines treated with 50 µg/mL of CTRL-EXO, LPAIV-EXO, and HPAIV-EXO and incubated for 4 h. Data represent mean±SEM from three independent experiments. Different lowercase letters above the error bars indicate statistical significance (\u003cem\u003ep\u003c/em\u003e \u0026lt;0.05) by analysis of variance with Tukey’s test. Relative expression was normalized to GAPDH.\u003c/p\u003e","description":"","filename":"Figure5RTqPCR.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6773730/v1/f0f84f8ada5308d502ca5745.jpg"},{"id":84029893,"identity":"942ec903-69d2-4660-8b42-8046bc5aedf1","added_by":"auto","created_at":"2025-06-06 02:01:11","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":7036616,"visible":true,"origin":"","legend":"\u003cp\u003eConfocal immunocytochemistry of viral proteins NP and NS1 in HD11 macrophage cell lines incubated with 50 µg/mL of CTRL-EXO, LPAIV-EXO, and HPAIV-EXO or untreated (NC) for 24 h. Immunodetection was performed using primary antibodies against (\u003cstrong\u003eA\u003c/strong\u003e) NP and (\u003cstrong\u003eB\u003c/strong\u003e) NS1. The cells were stained with 4’,6-diamidino-2-phenylindole (DAPI, blue). Scale bar = 50 µm.\u003c/p\u003e","description":"","filename":"Figure6ICCFinalCombined.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6773730/v1/eefc0dee82a417c3f26fc120.jpg"},{"id":86954970,"identity":"d6645a0e-a13e-4efb-b2dc-c41481be94f7","added_by":"auto","created_at":"2025-07-17 15:01:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":12945782,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6773730/v1/cfe8aea6-558e-4827-925d-bd4f9ebcf9b8.pdf"},{"id":84029885,"identity":"64486e37-b1cc-46cc-9bd2-66fe7cbaee74","added_by":"auto","created_at":"2025-06-06 02:01:10","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":17931,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-6773730/v1/672ca005ffd658005573cdf1.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Exosomes derived from avian influenza virus-infected chickens modulate host immune responses","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAvian influenza virus (AIV) remains a major threat to the global poultry industry and public health. AIVs are classified into subtypes based on the antigenicity of their hemagglutinin (HA) and neuraminidase (NA) proteins. Among the HA subtypes, H5, H7, and H9 are the most commonly detected in wild birds. [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The most prominent subtypes, H5 and H7, were mostly identified as LPAIVs with few or no clinical signs, can mutate into HPAIVs, causing severe illness and high mortality in galliformes [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. AIV outbreaks have caused devastating poultry losses, with millions of bird deaths reported. Additionally, infections have been confirmed in non-avian species such as pigs [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], dairy cattle [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], and humans [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], highlighting the need for rigorous control measures against this zoonotic disease.\u003c/p\u003e \u003cp\u003eExosomes are small (30\u0026ndash;200 nm) membrane-bound vesicles released by all cell types that transport various biomolecules, including proteins, lipids, mRNAs, miRNAs, and other non-coding RNAs between cells [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. They play a key role in intercellular communication, acting as mediators in health and disease [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Exosomal cargo reflects the molecular profile of the originating cell; therefore, exosomes from virus-infected cells can carry viral components such as viral proteins and RNA to recipient cells [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. These features suggest that exosomes may critically influence immune responses [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. However, few studies have investigated exosomes extracted from AIV-infected chickens, especially their immunomodulatory functions in the host. Previous studies indicate that exosomes derived from virus-infected cells can modulate or elicit immune responses, highlighting their potential role as immunoregulatory mediators. For example, exosomes released by influenza A virus-infected A549 can suppress the immune response of nearby uninfected cells by delivering viral mRNA or proteins with immunosuppressive functions, thereby promoting viral replication [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Similarly, exosomes from Theiler\u0026rsquo;s murine encephalomyelitis virus-infected microglia can deliver viral RNA to bystander central nervous system cells and induce neuroinflammation via innate immune receptors, increasing the expression of interferons, cytokines, and chemokines [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In our previous study, we demonstrated that exosomes derived from HPAIV H5N1-infected chickens trigger antiviral responses in various chicken immune cells, including macrophages, fibroblasts, and T and B cell lines, by inducing type I interferons, pro-inflammatory cytokines, and activating immune signaling pathways [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Although exosome-mediated delivery of viral proteins was linked to antiviral activity, these findings were limited to \u003cem\u003ein vitro\u003c/em\u003e analyses, and the mechanisms of exosome function in vivo remain unclear.\u003c/p\u003e \u003cp\u003eTherefore, this study aims to evaluate the immunomodulatory potential of exosomes derived from LPAIV- and HPAIV-infected chickens by transferring them to na\u0026iuml;ve chickens or cultured immune cells. These exosomes were intramuscularly administered to na\u0026iuml;ve chickens, and systemic immune responses were analyzed \u003cem\u003ein vivo\u003c/em\u003e. We also examined whether the injected exosomes altered the content of re-isolated exosomes, including viral components. In parallel, we assessed their cellular uptake and immunological effects in a chicken macrophage cell line.\u003c/p\u003e \u003cp\u003eBy combining \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e approaches, this study seeks to clarify how virus-associated exosomes modulate host immunity. Elucidating their immunomodulatory role could inform the development of extracellular vesicle-based diagnostics and vaccines.\u003c/p\u003e"},{"header":"2. Materials \u0026 Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Animal experiment and exosome injection\u003c/h2\u003e \u003cp\u003eIn total, 21 4-week-old specific-pathogen-free Brown Leghorn chickens were used in animal experiments conducted in a biosafety level 2 plus (BSL-2 +) facility at the Department of Biochemistry and Immunology, National Institute of Veterinary Research, Vietnam.\u003c/p\u003e \u003cp\u003eThree groups of seven chickens each were assigned as noninfected, LPAIV-infected, and HPAIV-infected. For the LPAIV challenge, seven chickens received 200 \u0026micro;L intranasal inoculation of allantoic fluid containing 1 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e 50% egg infectious dose (EID50) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] of A/Chicken/Vietnam/NA11/2021 (H5N6). The HPAIV group was similarly challenged with the same dose of A/chicken/Vietnam/NA01/2019 (H5N1) under identical conditions. After 3 days post-infection (dpi), blood samples were collected from the wing vein of chickens for exosome extraction.\u003c/p\u003e \u003cp\u003eExosomes were extracted from noninfected (CTRL-EXO), LPAIV-infected (LPAIV-EXO), and HPAIV-infected (HPAIV-EXO) chickens and injected into 30 na\u0026iuml;ve chickens (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Six uninjected chickens served as negative controls (NC). Each exosome group consisted of eight chickens: four received 100 \u0026micro;g, and four received 200 \u0026micro;g of exosomes via intramuscular injection. After 3 dpi, blood was collected for exosome isolation: CTRL-EXO injected exosomes, LPAIV-EXO injected exosomes, and HPAIV-EXO injected exosomes, respectively. Finally, the spleen, lungs, and trachea were harvested from all four groups (NC, CTRL-EXO, LPAIV-EXO, and HPAIV-EXO injected exosomes), respectively. All animal experiments complied with the World Organization for Animal Health (OIE) guidelines. All experimental procedures are schematically illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. This study was conducted in compliance with the institutional rules for the care and ethical use of laboratory animals, using a protocol approved by the Ministry of Agriculture and Rural Development, Vietnam (TCVN 8402:2010/TCVN 8400-26:2014).\u003c/p\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Exosome isolation and characterization\u003c/h2\u003e \u003cp\u003eExosomes from CTRL-EXO, LPAIV-EXO, and HPAIV-EXO serum were isolated and characterized as previously described [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Influenza A virus nucleoprotein (NP) (#PA5-32242, Thermo Fisher Scientific, Waltham, MA, USA) and non-structural protein (NS1) (#GTX125990, Irvine, CA, USA) antibodies were detected by western blotting following established protocols [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 RNA extraction from exosomes and tissues and detection of viral RNA\u003c/h2\u003e \u003cp\u003eTotal RNA in exosomes was extracted using TRIzol reagent (Thermo Fisher Scientific), following the manufacturer\u0026rsquo;s protocol. cDNA was synthesized from 2 \u0026micro;g of total RNA using a RevertAid first-strand cDNA synthesis kit (Thermo Fisher Scientific). H5 was amplified using DreamTaq polymerase (Thermo Fisher Scientific) with primers listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, following the recommended procedure [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Polymerase chain reaction (PCR) products were separated on 2% agarose gel stained with Dyne STAR (Dyne Bio, Seongnam, South Korea), an ethidium bromide alternative.\u003c/p\u003e \u003cp\u003eTotal RNA was extracted from lung, spleen, and trachea tissues by grinding them with a Tissue Grinder Motor (Taeshin Bio Science, Korea). After sample collection, 1 mL of TRIzol reagent (Thermo Fisher Scientific) was added to the homogenized tissues. To separate the aqueous phase, 200 \u0026micro;L of chloroform was added, followed by RNA precipitation with 500 \u0026micro;L of isopropanol. Finally, the RNA pellet was washed with 75% ethanol.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Western blotting\u003c/h2\u003e \u003cp\u003eApproximately 40 \u0026micro;g of exosome samples were loaded onto a 15% sodium dodecyl sulfate-polyacrylamide (SDS) gel electrophoresis, and separated proteins were transferred to a polyvinylidene difluoride (PVDF) membrane (Invitrogen). The membrane was blocked with 5% skim milk in phosphate-buffered saline with 0.05% Tween-20 (PBST) (Sigma-Aldrich, St. Louis, MO, USA) and incubated overnight at 4\u0026deg;C with primary antibodies Influenza A NP Polyclonal Antibody (#PA5-32242, Thermo Fisher Scientific) or Influenza A virus NS1 (#GTX125990, Irvine, CA, USA), diluted in PBST containing 2% skim milk. After washing with PBST, the membrane was incubated for 1 h at room temperature RT with horseradish peroxidase-conjugated anti-rabbit secondary antibody (Thermo Fisher Scientific) in 2% skim milk. Protein bands were detected using Western Lightning Plus-ECL substrate (Thermo Fisher Scientific).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Cell culture and exosome treatment\u003c/h2\u003e \u003cp\u003eThe chicken HD11 macrophage cell line [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] was cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Thermo Fisher Scientific) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Thermo Fisher Scientific), 100 IU/mL penicillin, and 100 mg/mL streptomycin. HD11 (8\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/well) were seeded in 12-well plates (SPL Life Sciences, Pocheon, Korea) and incubated overnight at 41 ℃ in a humidified 5% CO\u003csub\u003e2\u003c/sub\u003e incubator. The medium was replaced with a new exosome-depleted RPMI 1640 medium containing 10% exosome-depleted FBS (#EXO-FBSHI-250A-1; System Bioscience, Palo Alto, CA) and 100 IU/mL penicillin with 100 mg/mL streptomycin. Cells were treated with 50 \u0026micro;g/mL exosomes (CTRL-EXO, LPAIV-EXO, and HPAIV-EXO) for 4 h. Total RNA was extracted from cell culture supernatants using TRIol reagent (Thermo Fisher Scientific) following the manufacturer\u0026rsquo;s protocol. cDNA was synthesized from 2 ug of total RNA using the RevertAid first-strand cDNA synthesis kit (Thermo Fisher Scientific) following the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Reverse transcription quantitative real-time PCR (RT-qPCR)\u003c/h2\u003e \u003cp\u003eOligonucleotide primers for RT-qPCR were designed with Primer-BLAST (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/tools/primer-blast/\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/tools/primer-blast/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and synthesized by Genotech (Daejeon, South Korea) as listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. RT-qPCR was performed on a CFX Connect Real-Time PCR System (Bio-Rad, Hercules, CA, USA) using SYBR Green PCR assay and cytokine expression validation was conducted using Dyne qPCR 2X PreMix (Dyne Bio). The amplification conditions were as follows: 40 cycles at 95 ℃ for 30 s, 56\u0026ndash;60 ℃ for 30 s, and 72 ℃ for 30 s. GAPDH served as the housekeeping gene, and relative expression was calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. All RT-qPCR analysis was performed in triplicate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Cellular uptake of CTRL-EXO, LPAIV-EXO, and HPAIV-EXO\u003c/h2\u003e \u003cp\u003eTo observe exosome internalization (CTRL-EXO, LPAIV-EXO, and HPAIV-EXO), exosomes were labeled with DiI (#D3911; Sigma-Aldrich) and incubated with HD11 cells cultured in Nunc\u0026trade; Lab-Tek\u0026trade; Chamber Slides (#177380, Thermo Fisher Scientific). Exosomes (50 \u0026micro;g/mL) were diluted in 200 \u0026micro;L PBS and 2 \u0026micro;L of 1 mM DiI (prepared in methanol) and incubated for 2 h at RT, covered with foil. After three rounds of centrifugation (18,000 g, 20 min), the supernatant was discarded, and the pellet was washed with 200 uL PBS. DiI-labeled exosomes were added to HD11 cells in an exosome-free medium and incubated for 12 h at 41 ℃ with 5% CO\u003csub\u003e2\u003c/sub\u003e. Cells were fixed cells with 4% paraformaldehyde in PBS (pH 7.4) for 15 min at RT in the dark and stained with DAPI (#P6966; Thermo Fisher Scientific) for 5 min. Stained images were captured using an EVOS FLoid Cell Imaging Station (Thermo Fisher Scientific).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Immunocytochemistry\u003c/h2\u003e \u003cp\u003eHD11 cells (6\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/well) were cultured in exosome-free complete RPMI 1640 in Nunc\u0026trade; Lab-Tek\u0026trade; Chamber Slides (#177380, Thermo Fisher Scientific) for 4 h at 41 ℃ (5% CO\u003csub\u003e2\u003c/sub\u003e), then treated with 50 \u0026micro;g/mL exosomes (CTRL-EXO, LPAIV-EXO, and HPAIV-EXO) or left untreated (NC) for 24 h.\u003c/p\u003e \u003cp\u003eTo detect viral NP, the cells were fixed with 4% paraformaldehyde in PBS (pH 7.4) for 15 min at RT and permeabilized with ice-cold methanol (Sigma-Aldrich) for 10 min at -20 ℃. To detect NS1 viral protein, cells were fixed with 100% methanol (Sigma-Aldrich) for 5 min at RT and permeabilized with ice-cold methanol for 10 min at -20 ℃. After overnight incubation at 4\u0026deg;C with primary antibodies (NP, NS1), cells were treated with Alexa Fluor\u0026reg;488-conjugated secondary antibodies (Thermo Fisher Scientific) and incubated for 1 h at RT. The cell nucleus was stained with DAPI for 5 min. Immunostained slides were imaged using a confocal microscope (LSM800, Carl Zeiss, Germany) and analyzed using ZEN v2.6 software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Statistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis was performed using SPSS software (IBM, SPSS 28.0 for Windows, Chicago, IL, USA). Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean. Groups were compared using one-way ANOVA with Tukey\u0026rsquo;s test. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered significant. Error bars represent fold changes from three technical replicates.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Detection of viral components in exosomes\u003c/h2\u003e \u003cp\u003eTo identify viral particles in exosomes, we conducted PCR and western blot analyses using exosomes isolated from noninfected (CTRL-EXO), LPAIV-infected (LPAIV-EXO), and HPAIV-infected (HPAIV-EXO) chicken serum. H5 AIV RNA was detected in lanes 2, 3, 5, 6, and 10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Spleen samples injected with AIV-exosomes (lanes 2 and 3) had stronger H5 RNA amplification with LPAIV-EXO than with HPAIV-EXO. However, exosomes themselves (lanes 5 and 6) showed stronger H5 signals with HPAIV-EXO than with LPAIV-EXO. Among exosomes extracted from chickens injected with CTRL-EXO, LPAIV-EXO, HPAIV-EXO, and uninjected controls (lanes 7\u0026ndash;10), the viral H5 RNA band appeared only in the HPAIV-EXO sample (lane 10).\u003c/p\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB confirmed that exosomes reflect influenza A NP and NS1 during infection. Only LPAIV-EXO showed a clear NP band, while HPAIV-EXO displayed a weaker band. NS1 was analyzed under the same conditions, but reliable results were not obtained (data not shown).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Immune responses induced in chicken tissues by AIV-exosomes injection\u003c/h2\u003e \u003cp\u003eTo examine exosome-mediated immune responses \u003cem\u003ein vivo\u003c/em\u003e, na\u0026iuml;ve chickens were intramuscularly injected with exosomes (NC, CTRL-EXO, LPAIV-EXO, and HPAIV-EXO). Cytokine expression levels were measured by RT-qPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn the lungs of AIV-exosome-injected chickens, IFN-β, IFN-γ, and IL-10 expression showed similar patterns and were highly upregulated in the CTRL-EXO group, with 2.73-, 3.44-, and 2.26-fold change, respectively. No significant differences were observed between CTRL-EXO and HPAIV-EXO, although HPAIV-EXO had the second-highest expression levels for these cytokines. IL-4 expression increased 1.12-fold in LPAIV-EXO and decreased by 0.19- and 0.18-fold in CTRL-EXO and HPAIV-EXO, respectively, compared to NC, though the difference between NC and LPAIV-EXO was not statistically significant. IFN-α expression showed a similar pattern with IL-4. IL-6 expression decreased by 0.54-, 0.39-, and 0.89-fold in CTRL-EXO, LPAIV-EXO, and HPAIV-EXO, respectively. IL-1β was significantly downregulated in both the LPAIV-EXO and HPAIV-EXO groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eCytokine expression was highest in AIV-exosome-injected chicken spleens (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). IFN-α, IFN-β, IFN-γ, IL-1β, and IL-6 expression were the most upregulated in the HPAIV-EXO group, with fold increases of 1.44, 2.38, 4.96, 1.78, and 2.48, respectively. In contrast, the anti-inflammatory cytokines IL-4 and IL-10 were the most upregulated in the LPAIV-EXO group, showing 4.18- and 6.13-fold increases, respectively.\u003c/p\u003e \u003cp\u003eIL-1β expression in the trachea mirrored the downregulation observed in the lungs following AIV-exosome injection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). IFN-α expression showed a similar pattern, while IL-6 levels did not differ significantly among groups. IFN-β and IFN-γ were most highly expressed in the LPAIV-EXO group, whereas IL-4 and IL-10 showed the lowest expression in the LPAIV-EXO and HPAIV-EXO groups, respectively. Overall, cytokine expression indicates that the spleen has a stronger immune response than the lung or trachea.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Cellular uptake of AIV-exosomes in chicken immune cell line\u003c/h2\u003e \u003cp\u003eTo determine whether exosomes from AIV-infected chickens transmit their viral particles and induce immune responses, HD11 cells were treated with 50 \u0026micro;g/mL of exosomes. DiI-labeled CTRL-EXO, LPAIV-EXO, and HPAIV-EXO were internalized into the cytoplasm of HD11 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.4 HD11 macrophage cell treated with AIV-exosomes induces cytokine expression\u003c/h2\u003e \u003cp\u003eTo evaluate exosome-induced immune responses, HD11 cells were treated with 50 \u0026micro;g/mL exosomes for 4 h. Subsequently, the mRNA levels of type I (IFN-α, IFN-β), type II (IFN-γ) interferons, pro-inflammatory cytokines (IL-1β, IL-18, and TNF-α), anti-inflammatory cytokines (IL-4), and chemokine IL-8 (CXCL8) were measured. The results indicated that the LPAIV-EXO groups had the highest expression levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). However, no statistically significant difference was observed between CTRL-EXO and HPAIV-EXO. These results suggest that LPAIV-EXO elicits a stronger immune response than HPAIV-EXO, likely due to differences in viral components delivered via exosome.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Viral proteins were delivered via AIV-exosomes in chicken macrophage cell lines\u003c/h2\u003e \u003cp\u003eImmunocytochemistry confirmed the presence of NP and NS1 in AIV-EXO-treated cells (LPAIV-EXO and HPAIV-EXO), indicating successful exosome-mediated viral component delivery. Notably, NP signals were stronger in the LPAIV-EXO group than in the HPAIV-EXO group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). NS1s were detected in LPAIV-EXO but weakly expressed in HPAIV-EXO, with nuclear localization observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). These results suggest a stronger immune response in the LPAIV-EXO group, consistent with RT-qPCR cytokine profiles in exosome-treated HD11 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). These findings support the enhanced immunomodulatory effect of LPAIV-EXO.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eExosomes have gained attention as biomarkers and diagnostic tools due to their ability to reflect physiological and pathological conditions based on their cellular origin. However, their role in regulating immune responses, particularly in chickens at the whole-animal level, remains underexplored. This study investigated whether exosomes derived from LPAIV- or HPAIV-infected chickens can modulate immune responses in recipient hosts and immune cells. Bedford et al. showed that airway exosomes from the bronchoalveolar lavage fluid of influenza-infected mice transferred viral proteins (HA, NA, NP, M1, and NS1) to uninfected mice and activated antigen-presenting cells [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Exosome-induced pulmonary inflammation is marked by cytokine release, induction of type I and II interferons, and neutrophil recruitment [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Viral RNA within exosomes is typically recognized by Toll-like receptors (TLRs), particularly TLR7, which detects viral RNA within endosomal compartments following viral exposure [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. For instance, exosomes from Human immunodeficiency virus type-1-infected macrophages trigger pro-inflammatory cytokine production by recognizing their RNA cargo in TLRs [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. This mechanism enables host cells to package viral RNA into exosomes, thereby modulating innate immunity and influencing the pathogenesis of nearby uninfected cells.\u003c/p\u003e \u003cp\u003eOur findings reveal that exosomes from virus-infected chickens can transmit viral components, \u0026ndash;including H5 viral RNA, as observed in exosomes from AIV-EXO-injected chickens (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). These results demonstrate that exosomes serve as delivery systems for viral genetic material, not merely as intracellular signaling messengers, suggesting their involvement in the viral infection pathway. Moreover, they indicate that viral components may affect the cellular state of other organisms without viral infection. However, the exact role of exosomes in viral transmission requires further investigation.\u003c/p\u003e \u003cp\u003eWe analyzed cytokine expression in the lung, spleen, and trachea of exosome-injected na\u0026iuml;ve chickens. Notably, the spleen exhibited robust immune activation, especially after HPAIV-EXO treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). IFN-α, IFN-β, IFN-γ, IL-1β, and IL-6 were significantly upregulated by HPAIV-EXO. Type I and II interferons are key antiviral defenses; IFN-β and IFN-α subtypes stimulate antiviral molecules encoded by IFN-stimulated genes [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. IL-6, a pleiotropic cytokine, is produced in response to tissue damage and viral infection and modulates host immune responses [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Along with TNF-α and IL-1 (including IL-1β), IL-6 is among the most important cytokines in viral infections. IL-1β, an inflammatory plasma marker, showed higher expression in cells treated with AIV H7N9-derived HA protein [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], suggesting splenic immune cells are highly responsive to HPAIV-derived exosomal cargo. Anti-inflammatory cytokines IL-4 and IL-10 were remarkably upregulated in the LPAIV-EXO group. These cytokines are primarily involved in the Th2 response and maintain the balance of inflammatory signals during acute viral infection, preventing tissue damage in the host [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Overall, pro-inflammatory cytokines (IL-1β and IL-6) and antiviral interferons (IFN-α, IFN-β, and IFN-γ) were more highly expressed in HPAIV-EXO than in LPAIV-EXO. Mo et al. reported higher expression of pro-inflammatory genes in HPAIV-infected bone marrow-derived dendritic cells than in LPAIV groups [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. This suggests that HPAIV-EXO may contain cytokine-overexpressing cargo that triggers an immune response similar to direct HPAIV infection. Conversely, anti-inflammatory cytokines (IL-4 and IL-10) were elevated in LPAIV-EXO, suggesting that cytokine induction varies with pathogenicity, as HPAIV has a high mortality rate and causes severe symptoms, so the immune system is highly activated due to a strong inflammatory response, whereas LPAIV promotes immune homeostasis.\u003c/p\u003e \u003cp\u003eAlthough uninfected exosomes were not expected to elicit significant immune modulation, some cytokines were differentially expressed between NC and CTRL-EXO. This suggests that exosomes from uninfected hosts may carry bioactive molecules causing minor immune effects or act as foreign particles inducing mild immune activation. Alternatively, injection or subtle physiological differences in donor chickens could explain the variation.\u003c/p\u003e \u003cp\u003eViral components, particularly viral RNA and protein, carried by exosomes act as pathogen-associated molecular patterns that trigger innate immunity via pattern recognition receptors such as TLRs, RIG-I, MDA5, and NLRs [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Our data demonstrate that the immunomodulatory effects of AIV-derived exosomes are tissue-specific and depend on viral pathogenicity. While HPAIV-EXO strongly stimulates systemic immune responses in lymphoid organs such as the spleen, it limits inflammation in mucosal tissues such as the lung and trachea. Although derived from AIV infection, these exosomes elicit weaker immune responses than direct viral infection. However, in the spleen, which is the second largest lymphoid tissue rich in immune cells [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], both AIV-EXOs induced strong immune activation. These findings suggest that unlike primary respiratory organs (lungs and trachea) that are the targets of direct AIV infection, viral molecules delivered via exosomes act as viral antigens that preferentially activate immune organs.\u003c/p\u003e \u003cp\u003eFurthermore, immune responses may vary by organ characteristics. The lungs, as primary respiratory and mucosal immune organs, protect the host by degrading pathogens and foreign particles through the mucosal barrier and epithelial cells [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Thus, while intramuscularly injected exosomes may be recognized as foreign substances, unlike the lungs and trachea, which are mucosa-associated lymphoid tissues and directly exposed to external antigens, the spleen more readily detects circulating exosomes and triggers a systemic immune response through innate immune cells.\u003c/p\u003e \u003cp\u003eAccumulating evidence shows that exosomes derived from virus-infected cells play a pivotal role in orchestrating cellular immune responses. For example, respiratory syncytial virus infection induced an immune response in human monocytes and airway epithelial cells by delivering viral components via exosomes, inducing cytokine and chemokine release [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Similarly, plasma vesicles from SARS-CoV-2-infected patients activate peripheral immune cells; viral dsRNA recognized by TLR3 stimulates IL-6, IL-8, and TNF-α production, contributing to the cytokine storm [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOur study confirmed exosome-mediated immune responses by showing increased cytokine expression in exosome-treated chicken macrophage cell lines. Type I (IFN-α, IFN-β) and type II (IFN-γ) interferons, pro-inflammatory cytokines (IL-1β, IL-18), the anti-inflammatory cytokine IL-4, tumor necrosis factor-α (TNF-α), and chemokine IL-8 were all detected, with notable high levels in LPAIV-EXO-treated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). TNF-α, secreted by macrophages and monocytes, acts early to suppress immunopathology during H1N1 influenza infection [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. IL-8, a CXC chemokine, activates neutrophils by binding to CXCR1 and CXCR2 and, together with IL-6, is highly expressed in patients infected with the SARS-CoV-2 virus [\u003cspan additionalcitationids=\"CR43 CR44\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. IL-18, known as the \u0026ldquo;IFN-γ inducing factor,\u0026rdquo; belongs to the IL-1 family that regulates innate and adaptive immunity by activating macrophages synergistically with IL-12 [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, Both NP and NS1 showed stronger signals in LPAIV-EXO than in HPAIV-EXO, consistent with the western blot results in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB. Similarly, RT-qPCR revealed higher cytokine expression in LPAIV-EXO, supporting its enhanced immunomodulatory effect. These findings suggest that the stronger viral protein signals in LPAIV-EXO contribute to the elevated cytokine expression. NP, secreted by influenza virus-infected cells, is crucial for viral replication and induces pro-inflammatory cytokines such as IL-1β and IL-6 via TLR4 and NLRP3 inflammasome activation [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. NS1 antagonizes host antiviral responses by inhibiting type I interferons and blocking RIG-I signaling pathways during influenza A virus infection [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. However, NS1 in exosomes may modulate rather than completely inhibit immune activation, depending on the balance between immune evasion and detection in recipient cells. For instance, Dengue virus-derived NS1 induces the production of pro-inflammatory cytokines in human dendritic cells [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Upon AIV-EXO treatment, NS1 showed clear nuclear localization in HD11 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB), consistent with previous studies demonstrating that the influenza A H3N2 subtype virus NS1 protein possesses a C-terminal NLS2/NoLS domain that facilitates nuclear import and interaction with nuclear proteins such as nucleolin and fibrillarin [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Immunocytochemistry confirmed elevated levels NP and NS1 levels in HD11 cells treated with LPAIV-EXO, suggesting that higher NP and NS1 content in LPAIV-EXO may increase cytokine expression in these cells.\u003c/p\u003e \u003cp\u003eIn our previous study, we demonstrated that exosomal miRNAs from LPAIV- or HPAIV-infected chickens were associated with the MAPK signaling pathway, a key regulator of host immunity. Additionally, we detected viral RNA and proteins in the exosomes, suggesting that both viral molecules and small non-coding RNAs such as miRNAs contribute to the immune response. Since miRNAs regulate host gene expression by targeting immune-related pathways, exosome-mediated delivery of viral or host-derived miRNAs may further modulate immune activation [\u003cspan additionalcitationids=\"CR55\" citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Therefore, the immunostimulatory effects observed in this study likely result from the combined action of viral proteins, RNA, and regulatory non-coding RNAs within exosomes.\u003c/p\u003e \u003cp\u003eIn summary, our study demonstrates that exosomes from AIV-infected chickens carry viral RNA, and proteins and modulate host immune responses \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e. Notably, HPAIV-derived exosomes induced a strong immune response in the spleen, whereas LPAIV-EXO strongly stimulated HD11 cells. These findings suggest that immune homeostasis and cell interactions in the spleen may limit excessive inflammation, while macrophages directly activate immune genes in response to exosomal viral proteins such as NP and NS1. Overall, these results demonstrate that the immunomodulatory effects of exosomes are influenced by both exosomal cargo and the specific immune environment. Further research is needed to clarify how viral components interact with innate immune receptors to modulate immunity. Understanding these processes will enhance knowledge of viral pathogenesis and guide exosome-based diagnostics, vaccine development, and therapeutic strategies in the poultry industry.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAuthors\u0026rsquo; contributions\u003c/b\u003e \u003c/p\u003e \u003cp\u003e CEK and YHH designed the experiments; CEK and THP participated in conceiving methodology and conducted investigations; YHH and ADT provided reagents, materials, and analytical tools; CEK performed and visualized the experiments; CEK, HSL, and YHH analyzed and interpreted the data; and CEK, HSL, and YHH wrote and reviewed the manuscript. All the authors have read and approved the final manuscript.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAIV\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Avian influenza virus\u003c/p\u003e\n\u003cp\u003eHPAIV\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Highly pathogenic AIV\u003c/p\u003e\n\u003cp\u003eLPAIV\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Low pathogenic AIV\u003c/p\u003e\n\u003cp\u003eRT-qPCR\u0026nbsp; \u0026nbsp; \u0026nbsp;Reverse transcription-quantitative polymerase chain reaction\u003c/p\u003e\n\u003cp\u003eDays-post infection\u0026nbsp;\u0026nbsp;dpi\u003c/p\u003e\n\u003cp\u003eHA \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Hemagglutinin\u003c/p\u003e\n\u003cp\u003eNA \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Neuraminidase\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCEK and YHH designed the experiments; CEK and THP participated in conceiving methodology and conducted investigations; YHH and ADT provided reagents, materials, and analytical tools; CEK performed and visualized the experiments; CEK, HSL, and YHH analyzed and interpreted the data; and CEK, HSL, and YHH wrote and reviewed the manuscript. All the authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank the Department of Biochemistry and Immunology Laboratory of the National Institute of Veterinary Research, Vietnam, for conducting the animal experiments. Immunocytochemistry analysis was performed at the BT research facility center, Chung-Ang University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by the National Research Foundation grant (NRF-2021R1A2C2005236) of the Republic of Korea.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eShi J, Zeng X, Cui P, Yan C, Chen H (2023) Alarming situation of emerging H5 and H7 avian influenza and effective control strategies. Emerg Microbes Infect 12:2155072\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuczo JM, Stambas J, Durr PA, Michalski WP, Bingham J (2015) Molecular pathogenesis of H5 highly pathogenic avian influenza: the role of the haemagglutinin cleavage site motif. Rev Med Virol 25:406\u0026ndash;430\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeseko C, Globig A, Ijomanta J, Joannis T, Nwosuh C, Shamaki D, Harder T, Hoffman D, Pohlmann A, Beer M, Mettenleiter T, Starick E (2018) Evidence of exposure of domestic pigs to Highly Pathogenic Avian Influenza H5N1 in Nigeria. Sci Rep 8:5900\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarg S, Reinhart K, Couture A, Kniss K, Davis CT, Kirby MK, Murray EL, Zhu S, Kraushaar V, Wadford DA, Drehoff C, Kohnen A, Owen M, Morse J, Eckel S, Goswitz J, Turabelidze G, Krager S, Unutzer A, Gonzales ER, Abdul Hamid C, Ellington S, Mellis AM, Budd A, Barnes JR, Biggerstaff M, Jhung MA, Richmond-Crum M, Burns E, Shimabukuro TT, Uyeki TM, Dugan VG, Reed C, Olsen SJ (2025) Highly Pathogenic Avian Influenza A(H5N1) Virus Infections in Humans. N Engl J Med 392:843\u0026ndash;854\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSubbarao K, Klimov A, Katz J, Regnery H, Lim W, Hall H, Perdue M, Swayne D, Bender C, Huang J, Hemphill M, Rowe T, Shaw M, Xu X, Fukuda K, Cox N (1998) Characterization of an Avian Influenza A (H5N1) Virus Isolated from a Child with a Fatal Respiratory Illness. Science 279:393\u0026ndash;396\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBobrie A, Colombo M, Raposo G, Thery C (2011) Exosome secretion: molecular mechanisms and roles in immune responses. Traffic 12:1659\u0026ndash;1668\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Tian L, Lu J, Ng IO-L (2022) Exosomes and cancer - Diagnostic and prognostic biomarkers and therapeutic vehicle. Oncogenesis 11:54\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGurung S, Perocheau D, Touramanidou L, Baruteau J (2021) The exosome journey: from biogenesis to uptake and intracellular signalling. Cell Communication Signal 19:47\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBedford JG, Infusini G, Dagley LF, Villalon-Letelier F, Zheng MZM, Bennett-Wood V, Reading PC, Wakim LM (2020) Airway Exosomes Released During Influenza Virus Infection Serve as a Key Component of the Antiviral Innate Immune Response. Front Immunol 11:887\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong Y, Truong AD, Vu TH, Lee S, Heo J, Kang S, Lillehoj HS, Hong YH (2022) Exosomes from H5N1 avian influenza virus-infected chickens regulate antiviral immune responses of chicken immune cells. Dev Comp Immunol 130:104368\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng Y, Yang Y, Li Y, Shi T, Luan Y, Yin C (2023) Exosome and virus infection. Front Immunol 14:1154217\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDreux M, Garaigorta U, Boyd B, Decembre E, Chung J, Whitten-Bauer C, Wieland S, Chisari FV (2012) Short-range exosomal transfer of viral RNA from infected cells to plasmacytoid dendritic cells triggers innate immunity. Cell Host Microbe 12:558\u0026ndash;570\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuong N, Olson JK (2021) Exosomes Secreted by Microglia During Virus Infection in the Central Nervous System Activate an Inflammatory Response in Bystander Cells. Front Cell Dev Biol 9:661935\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZabrodskaya Y, Plotnikova M, Gavrilova N, Lozhkov A, Klotchenko S, Kiselev A, Burdakov V, Ramsay E, Purvinsh L, Egorova M, Vysochinskaya V, Baranovskaya I, Brodskaya A, Povalikhin R, Vasin A (2022) Exosomes Released by Influenza-Virus-Infected Cells Carry Factors Capable of Suppressing Immune Defense Genes in Naive Cells. Viruses 14\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuong N, Olson JK (2021) Exosomes Secreted by Microglia During Virus Infection in the Central Nervous System Activate an Inflammatory Response in Bystander Cells. Front Cell Dev Biol Volume 9\u0026ndash;2021\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuprikar J, Rabinowitz S (1980) A simplified plaque assay for influenza viruses in Madin-Darby kidney (MDCK) cells. J Virol Methods 1:117\u0026ndash;120\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim C, Phan TH, Vu TH, Truong AD, Lillehoj HS, Hong YH Comparison of exosomal miRNA profiling in highly pathogenic and low pathogenic avian influenza virus-infected chickens, submitted\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong Y, Lee J, Vu TH, Lee S, Lillehoj HS, Hong YH (2021) Immunomodulatory effects of poly(I:C)-stimulated exosomes derived from chicken macrophages. Poult Sci 100:101247\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaharaein B, Omar AR, Aini I, Yusoff K, Hassan SS (2009) Detection of H5, H7 and H9 subtypes of avian influenza viruses by multiplex reverse transcription-polymerase chain reaction. Microbiol Res 164:174\u0026ndash;179\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKlasing KC, Peng RK (1987) Influence of cell sources, stimulating agents, and incubation conditions on release of interleukin-1 from chicken macrophages. Dev Comp Immunol 11:385\u0026ndash;394\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD (2001) Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2\u0026thinsp;\u0026ndash; ∆∆CT Method. Methods 25:402\u0026ndash;408\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlasius AL, Beutler B (2010) Intracellular toll-like receptors. Immunity 32:305\u0026ndash;315\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKawai T, Akira S (2011) Toll-like Receptors and Their Crosstalk with Other Innate Receptors in Infection and Immunity. Immunity 34:637\u0026ndash;650\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSampey GC, Saifuddin M, Schwab A, Barclay R, Punya S, Chung MC, Hakami RM, Zadeh MA, Lepene B, Klase ZA, El-Hage N, Young M, Iordanskiy S, Kashanchi F (2016) Exosomes from HIV-1-infected Cells Stimulate Production of Pro-inflammatory Cytokines through Trans-activating Response (TAR) RNA. J Biol Chem 291:1251\u0026ndash;1266\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee AJ, Ashkar AA (2018) The Dual Nature of Type I and Type II Interferons. Front Immunol 9:2061\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcNab F, Mayer-Barber K, Sher A, Wack A, O'Garra A (2015) Type I interferons in infectious disease. Nat Rev Immunol 15:87\u0026ndash;103\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVelazquez-Salinas L, Verdugo-Rodriguez A, Rodriguez LL, Borca MV (2019) The Role of Interleukin 6 During Viral Infections. Front Microbiol Volume 10\u0026ndash;2019\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSlaats J, Ten Oever J, van de Veerdonk FL, Netea MG (2016) IL-1β/IL-6/CRP and IL-18/ferritin: Distinct Inflammatory Programs in Infections. PLoS Pathog 12:e1005973\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang S, Gu D, Ouyang X, Xie W (2015) Proinflammatory effects of the hemagglutinin protein of the avian influenza A (H7N9) virus and microRNA\u0026ndash;mediated homeostasis response in THP\u0026ndash;1 cells. Mol Med Rep 12:6241\u0026ndash;6246\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRojas JM, Avia M, Mart\u0026iacute;n V, Sevilla N (2017) IL-10: A Multifunctional Cytokine in Viral Infections. J Immunol Res 2017:6104054\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan den Broek M, Bachmann MF, K\u0026ouml;hler G, Barner M, Escher Rd, Zinkernagel R, Kopf M (2000) IL-4 and IL-10 Antagonize IL-12-Mediated Protection Against Acute Vaccinia Virus Infection with a Limited Role of IFN-γ and Nitric Oxide Synthetase 21. J Immunol 164:371\u0026ndash;378\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMo J, Segovia K, Chrzastek K, Briggs K, Kapczynski DR (2024) Morphologic characterization and cytokine response of chicken bone-marrow derived dendritic cells to infection with high and low pathogenic avian influenza virus. Front Immunol 15:1374838\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDreux M, Garaigorta U, Boyd B, D\u0026eacute;cembre E, Chung J, Whitten-Bauer C, Wieland S, Chisari Francis V (2012) Short-Range Exosomal Transfer of Viral RNA from Infected Cells to Plasmacytoid Dendritic Cells Triggers Innate Immunity. Cell Host Microbe 12:558\u0026ndash;570\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKawai T, Akira S (2009) The roles of TLRs, RLRs and NLRs in pathogen recognition. Int Immunol 21:317\u0026ndash;337\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLewis SM, Williams A, Eisenbarth SC (2019) Structure and function of the immune system in the spleen. Sci Immunol 4\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGopallawa I, Dehinwal R, Bhatia V, Gujar V, Chirmule N (2023) A four-part guide to lung immunology: Invasion, inflammation, immunity, and intervention. Front Immunol Volume 14\u0026ndash;2023\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSato S, Kiyono H (2012) The mucosal immune system of the respiratory tract. Curr Opin Virol 2:225\u0026ndash;232\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChahar HS, Corsello T, Kudlicki AS, Komaravelli N, Casola A (2018) Respiratory Syncytial Virus Infection Changes Cargo Composition of Exosome Released from Airway Epithelial Cells. Sci Rep 8:387\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen L, Chen R, Yao M, Feng Z, Yuan G, Ye F, Nguyen K, Karn J, McComsey GA, McIntyre TM, Jin G (2022) COVID-19 plasma exosomes promote proinflammatory immune responses in peripheral blood mononuclear cells. Sci Rep 12:21779\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohd Zawawi Z, Kalyanasundram J, Mohd Zain R, Thayan R, Basri DF, Yap WB (2023) Prospective Roles of Tumor Necrosis Factor-Alpha (TNF-α) in COVID-19: Prognosis, Therapeutic and Management. Int J Mol Sci 24:6142\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSavenkova DA, Gudymo AS, Korablev AN, Taranov OS, Bazovkina DV, Danilchenko NV, Perfilyeva ON, Ivleva EK, Moiseeva AA, Bulanovich YA, Roshchina EV, Serova IA, Battulin NR, Kulikova EA, Yudkin DV (2024) Knockout of the Tnfa Gene Decreases Influenza Virus-Induced Histological Reactions in Laboratory Mice. Int J Mol Sci 25:1156\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCesta MC, Zippoli M, Marsiglia C, Gavioli EM, Mantelli F, Allegretti M, Balk RA (2022) The Role of Interleukin-8 in Lung Inflammation and Injury: Implications for the Management of COVID-19 and Hyperinflammatory Acute Respiratory Distress Syndrome. Front Pharmacol 12\u0026ndash;2021\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee J, Choi JA, Ju H-h, Kim J-E, Paik S-Y, Rao PV (2021) Role of MCP-1 and IL-8 in viral anterior uveitis, and contractility and fibrogenic activity of trabecular meshwork cells. Sci Rep 11:14950\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu QC, Li S, Yuan LX, Chen RA, Liu DX, Fung TS (2021) Induction of the Proinflammatory Chemokine Interleukin-8 Is Regulated by Integrated Stress Response and AP-1 Family Proteins Activated during Coronavirus Infection. Int J Mol Sci 22:5646\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZimmermann HW, Seidler S, Gassler N, Nattermann J, Luedde T, Trautwein C, Tacke F (2011) Interleukin-8 is activated in patients with chronic liver diseases and associated with hepatic macrophage accumulation in human liver fibrosis. PLoS ONE 6:e21381\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIhim SA, Abubakar SD, Zian Z, Sasaki T, Saffarioun M, Maleknia S, Azizi G (2022) Interleukin-18 cytokine in immunity, inflammation, and autoimmunity: Biological role in induction, regulation, and treatment. Front Immunol Volume 13\u0026ndash;2022\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMunder M, Mallo M, Eichmann K, Modolell M (1998) Murine macrophages secrete interferon γ upon combined stimulation with interleukin (IL)-12 and IL-18: a novel pathway of autocrine macrophage activation. J Exp Med 187:2103\u0026ndash;2108\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEisfeld AJ, Neumann G, Kawaoka Y (2015) At the centre: influenza A virus ribonucleoproteins. Nat Rev Microbiol 13:28\u0026ndash;41\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim C-U, Jeong Y-J, Lee P, Lee M-S, Park J-H, Kim Y-S, Kim D-J (2022) Extracellular nucleoprotein exacerbates influenza virus pathogenesis by activating Toll-like receptor 4 and the NLRP3 inflammasome. Cell Mol Immunol 19:715\u0026ndash;725\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoliopoulos MG, Lethier M, van der Veen AG, Haubrich K, Hennig J, Kowalinski E, Stevens RV, Martin SR, Reis e Sousa, Cusack C, Rittinger S (2018) K. Molecular mechanism of influenza A NS1-mediated TRIM25 recognition and inhibition. Nat Commun 9:1820\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Q, Zhang X, Lei X, Wang H, Jiang J, Wang Y, Bi K, Diao H (2022) Influenza A virus NS1 protein hijacks YAP/TAZ to suppress TLR3-mediated innate immune response. PLoS Pathog 18:e1010505\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlayli F, Scholle F (2016) Dengue virus NS1 enhances viral replication and pro-inflammatory cytokine production in human dendritic cells. Virology 496:227\u0026ndash;236\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMel\u0026eacute;n K, Tynell J, Fagerlund R, Roussel P, Hernandez-Verdun D, Julkunen I (2012) Influenza A H3N2 subtype virus NS1 protein targets into the nucleus and binds primarily via its C-terminal NLS2/NoLS to nucleolin and fibrillarin. Virol J 9:167\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChandan K, Gupta M, Sarwat M (2020) Role of Host and Pathogen-Derived MicroRNAs in Immune Regulation During Infectious and Inflammatory Diseases. Front Immunol 10\u0026ndash;2019\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVu TH, Heo J, Kang S, Kim C, Lillehoj HS, Hong YH (2023) Chicken miR-26a-5p modulates MDA5 during highly pathogenic avian influenza virus infection. Dev Comp Immunol 149:104921\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVu TH, Hong Y, Heo J, Kang S, Lillehoj HS, Hong YH (2023) Chicken miR-148a-3p regulates immune responses against AIV by targeting the MAPK signalling pathway and IFN-gamma. Vet Res 54:110\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRohde F, Schusser B, Hron T, Farkašov\u0026aacute; H, Plach\u0026yacute; J, H\u0026auml;rtle S, Hejnar J, Elleder D, Kaspers B (2018) Characterization of Chicken Tumor Necrosis Factor-α, a Long Missed Cytokine in Birds. Front Immunol Volume 9\u0026ndash;2018\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cb\u003eTable 1 is available in the Supplementary Files section.\u003c/br\u003e\u003c/p\u003e\n\u003c/br\u003e\n\u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for RT-qPCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequences (5'\u0026rarr;3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAccession number\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eH5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACAAAGCTCTATCAAAACCCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TACCCATACCAACCATCTACCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIFN-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GAGCAATGCTTGGACAGCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGU119896.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GAGGTTGTGGATGTGCAGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIFN-β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CTTGCCCACAACAAGACGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001024836.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TGTTTTGGAGTGTGTGGGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIFN-γ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AACAACCTTCCTGATGGCGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_205149.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TGAAGAGTTCATTCGCGGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGCCTGCAGAAGAAGCCTCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_204524.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CTCCGCAGCAGTTTGGTCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TTGTTTGGGAGAGCCAGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001007079.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GACATGGTGCCTTGAGGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCAGGACGAGATGTGCAAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_204628.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: ATTTCTCCTCGTCGAAGCCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGCTTGCTAGGGGAAATGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_205498.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: AGCTGACTCTGACTAGGAAACTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCTTCTACACAGATGAGGTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001004414.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TCCCGTTCTCATCCATCTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGAATGCGATGCCTTTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_204608.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: ATTTTCCCATGCTCTTTCTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTNFα\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CGCTCAGAACGACGTCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GTCGTCCACACCAACGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGCTGCCCAGAACATCATCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_204305\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: ACGGCAGGTCAGGTCAACAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Exosome, avian influenza virus, cytokines, viral component, chicken","lastPublishedDoi":"10.21203/rs.3.rs-6773730/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6773730/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eExosomes are emerging as key mediators of host-pathogen interactions, especially as carriers of viral components during infection. This study examined the immunomodulatory role of serum-derived exosomes from chickens infected with low pathogenic avian influenza virus (LPAIV) or highly pathogenic influenza virus (HPAIV). Brown Leghorn chickens were infected with either LPAIV or HPAIV, and serum exosomes were isolated. These exosomes (CTRL-EXO; noninfected, LPAIV-EXO, and HPAIV-EXO) were intramuscularly injected into na\u0026iuml;ve chickens, and several tissues and serum were collected. Cytokine gene expression in immune-related tissues (lung, spleen, and trachea) was quantified using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) to assess the immune response. Unlike the lung and trachea, the spleen exhibited the strongest immune response following exosome injection, with higher expressions of antiviral cytokines and interferons in the AIV-exosome group. In parallel, the same exosomes were applied to chicken macrophage HD11 cell lines to evaluate their cellular uptake and cytokine expression via RT-qPCR. Furthermore, immunocytochemistry was conducted to detect viral protein NP and NS1 delivered into HD11 cells by exosomes. LPAIV-EXO induced the most pronounced immune activation, as demonstrated by elevated cytokine expression and immunocytochemical detection of viral proteins. These findings indicate that AIV-derived exosomes can modulate host immune responses both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e, highlighting their potential in immune regulation and vaccine development.\u003c/p\u003e","manuscriptTitle":"Exosomes derived from avian influenza virus-infected chickens modulate host immune responses","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-06 02:01:06","doi":"10.21203/rs.3.rs-6773730/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"48f32b90-91f9-4771-9aae-bec9c9912f81","owner":[],"postedDate":"June 6th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-07-17T14:53:45+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-06 02:01:06","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6773730","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6773730","identity":"rs-6773730","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}