Spray-Induced Gene Silencing against Rice Blast Disease Targeting Dicer-like Protein 2 (DCL2) of Pyricularia oryzae

Spray-Induced Gene Silencing against Rice Blast Disease Targeting Dicer-like Protein 2 (DCL2) of Pyricularia oryzae | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Spray-Induced Gene Silencing against Rice Blast Disease Targeting Dicer-like Protein 2 (DCL2) of Pyricularia oryzae Kalupahana Pushpanjie, Lau Wei Hong, Norsazilawati Saad Saad, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4757955/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Rice blast is a devastating disease, caused by the fungal pathogen, Pyricularia oryzae . RNA interference (RNAi) is a novel crop protection method that could control rice blast disease. In this study, dsRNA (PyDCL2–863 bp) was synthesized for silencing of DCL2 transcript of P. oryzae and its efficacy was evaluated. Using slide culture method, P. oryzae mycelial growth was evaluated under different concentrations of PyDCL2-dsRNA molecules i.e. from 0.1 to 10 ng/µl. After 24 hours of incubation, microscopic observations showed abnormal growth with high hyphae branching and vesicle formation in P. oryzae of 10 ng/µl dsRNA-treated slide culture. Disease severity caused by P. oryzae on rice leaves was compared using the detached leaf method with different PyDCL2-dsRNA concentrations, i.e. from 0.1 to 10 ng/µl. It was found that a 10 ng/µl concentration of dsRNA molecules reduced rice blast disease severity by up to 13%. Under glasshouse conditions, PyDCL2-dsRNA was sprayed at 10 ng/µl concentration on rice plants at three-week-old seedlings and disease reduction of rice blast disease was 35.11% six days after dsRNA application compared to unsprayed control. In glasshouse trial, the dsRNA solution with 10 ng/µl concentration was able to perform gene silencing on DCL2 in P. oryzae until 3 days after application. These findings showed a potential for PyDCL2-dsRNA to be developed as a new biofungicide using RNAi-mediated approach for a sustainable disease management of rice blast. dsRNA spray Fungal pathogen Gene silencing Rice blast disease control RNAi Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Rice blast is one of the most devastating diseases in rice. Magnaporthe oryzae (anamorph Pyricularia oryzae ) is the causal agent of this disease. The annual loss due to rice blast is approximately 10–30% in various rice-producing regions ( www.knowledgebank.irri ) (Devanna et al., 2022 ). The application of synthetic fungicides is the most common method used by the farmers to control this fungal disease. Overuse or misuse of synthetic fungicides can cause many acute and chronic health hazards to agriculture workers and food consumers (WHO, 2022). There is a greater need for new environmental-friendly disease management strategies against rice blast fungal pathogen to achieve sustainable agriculture. During the last decade, RNA interference (RNAi) technique was identified as a potential alternative strategy in plant protection (Routhu et al., 2020 ). It is more specific on selected plant pathogens because of its sequence-dependent action. RNAi-based transgenic plants are available in the market utilizing host-induced gene silencing (HIGS) technique (Kuo and Falk, 2020 ) which is still under controversy due to its transgenic nature (Sherman et al., 2015 ). Thus, attention is turned to non-transformative methods such as spray-induced gene silencing (SIGS). In SIGS, specific double-stranded RNA (dsRNA) molecules are used as an external application on plant tissues to control plant pathogens. The dsRNA molecules are now considered an effective agent in crop protection and more experiments are being conducted regarding this new source (Voloudakis et al., 2015 ). In nature, dsRNA molecule is one of the main components in the RNA silencing (RNAi) pathway in higher eukaryotes. It causes degradation of homologous target sequence and gene expression control (Fletcher et al., 2020 ). Dicer-like protein (DCL), RNA-dependent RNA polymerase (RdRP), and Argonaute (AGO) are essential in the bbiogenesis of small RNAs in RNAi pathway of an organism. Losing a single gene among them can lead to a reduced level of small RNAs in P. oryzae (Raman et al., 2017 ). It is important to reduce virulence of a pathogen. There are several successful findings related to SIGS against several pathogens:- dsRNA applications against Penicillium italicum in citrus fruit targeting the DCL gene (Yin et al., 2020 ), Fusarium graminearum in barley leaves targeting dicer and argonaute genes (Werner et al .,2020), Botrytis cinerea in grape wine targeting three fungicide sites of action i.e.; BcCYP51 , Bcchs1 and BcEF2 where BcCYP51 , cytochrome P450 monooxygenase 51, is important in ergosterol biosynthesis, Bcchs1 , chitin synthase 1, plays a role in cell wall polymerization and BcEF2 , elongation factor 2, acts as a catalyzer in protein synthesis (Nerva et al., 2020 ) as well as dicer-like proteins, DCL1 and DCL2 genes of Plasmopara viticola. in grape wine (Haile et al., 2021 ). MoDES1 gene (a host-define suppressor pathogenicity gene) of rice blast pathogen, P. oryzae was targeted in SIGS application and showed partial resistance against the rice blast disease (Sarkar and Roy 2021 ). Chemical control methods that are currently available against rice blast disease post negative effects on the environment and human beings. This study was carried out to develop effective RNAi-mediated gene silencing method targeting DCL2 transcript of P. oryzae and evaluate SIGS effect on the rice blast pathogen via in vitro and in planta applications. Materials and methods Experimental locations The laboratory experiments were conducted at the Department of Plant Protection, Faculty of Agriculture, Universiti Putra Malaysia (UPM), Malaysia. In planta experiments were conducted in the Polytunnel located at Ladang-10, UPM. The relative humidity of the location was 85-95% and the mean temperature was 28±4°C with 12 hours of light and dark cycle. Synthesis of double-stranded RNA The long double-stranded RNA (dsRNA) molecule complementary to the DCL2 transcript of P. oryzae was designed using Snap Dragon software (www.flyrnai.org). The specific primer pair of PDCL2-F and PDCL2-R was designed for PCR amplification of the dsRNA template. T7 promoter sequence was added into the 5' end of each primer (Supplement 01). The total RNA of P. oryzae of seven days old culture was extracted using “One Step RNA Reagent” (Bio Basic, Canada). Template cDNA for PCR amplification was prepared using a Goscript Reverse Transcription Kit (Promega, USA) according to the manufacturer’s procedure and total RNA of P. oryzae . PCR amplification was conducted to produce the PCR fragment that was required for the dsRNA synthesis process. PCR reaction mixture was prepared in a 25 μL reaction containing 12.5 μl of 2X Q5 ® high-fidelity PCR master mix (NEB, USA), 1 μl of 1 μM forward and reverse primers, and 1 μl template cDNA (100 ng). The PCR amplification was done with the following program: Initial denaturation at 98 °C for 1 minute; 30 cycles of 98 °C for 10 s denaturation, 30 s annealing temperature at 65 °C and 72 °C for 1 minute for elongation; and a final extension step of 72 °C for 2 minutes in the thermo cycler (Biometra T– Personal, Germany). In vitro synthesis of dsRNA was done using Megascript RNAi kit (USA) according to the manufacturer’s protocols. Evaluation on the effect of dsRNA against the mycelial growth of P. oryzae using slide culture method A volume of 100 μL melted potato dextrose agar (PDA) (HiMedia Laboratories, The Netherlands) was added onto the sterilized microscopic slide and 10 μL of diluted dsRNA solution was added to each drop of liquid PDA on the slide. A small amount of P. oryzae culture which was obtained from the actively growing edge of seven-day-old culture was placed at one edge of the liquid PDA drop. The liquid PDA drop was covered with a sterilized cover slip. The slide was kept in a sterilized Petri dish sealed with parafilm and incubated for 24 hours under room temperature (25±1 °C). Different concentrations of dsRNA solutions (0.1, 0.5, 1.0, 1.5, 3, 10 ng/μl) were added separately into slide cultures according to above-mentioned method. The experiment was conducted with three replicates. After the incubation period, slide cultures were observed under a light microscope (Leica Microsystems, China) and images were captured with Dino-lite digital microscope camera (AnMo Electronics Corporation, Taiwan) using Dinocapture 2.0 software (Version 1.5.36). Growth pattern and morphology of the fungal mycelia was recorded in both dsRNA-treated and untreated control culture slides. Evaluation of the effect of dsRNA against P. oryzae using i n vitro detached leaf assay In vitro synthesized PyDCL2-dsRNA was diluted to prepare a concentration series of 0, 0.1, 0.5, 1.0, 1.5, 3, 5 and 10 ng/μl with RNase-free water. A sterilized needle was used to make 3 spots of small physical damage on the upper side of the six-week-old detached leaves of healthy rice variety MR219, with a 1 cm distance from each spot. The detached leaves were placed onto Petri dishes that contained 1% water agar and 2 μg/ml kinetin (Coca et al., 2004). Each Petri dish contained five detached leaves and the experiment was conducted in three replications. Inoculation process for detached leaf test was conducted as follows. Two-week-old P. oryzae culture on PDA was used to obtain a 0.5 cm diameter size fungal culture disc for detached leaf inoculation. The upper side of each fungal disc with mycelia was placed on the physically damaged spot of the plant leaf with. One set of Petri dishes was inoculated with PDA discs without fungal mycelia and kept as a healthy control treatment. The Petri dishes were sealed and incubated for two days on a laboratory bench under natural light/dark cycle. After two days, fungal culture discs were removed using sterilized forceps. Different concentrations of dsRNA solutions (200 µl/leaf) were sprayed separately onto the upper surface of detached leaves that were inoculated with P. oryzae (Wang et al. 2016). One set of pathogen-inoculated detached leaves was kept without spraying dsRNA solution but sprayed with RNase-free water as untreated control. Rice blast disease symptoms were observed after 5 days and disease severity was assessed visually in each treatment according to IRRI standards (2002) The percentage of the disease severity was calculated for every replication using the following equation (Madden et al ., 2007): Disease severity (%) = [Σ(r × nr)/(9 × Nr)] × 100 In this equation, r represents the rating value (0-9) and it indicates the fraction of blast lesions of the infected area compared to the total leaf area; nr means the number of infected leaves with a rating of r, and Nr stands for the total number of leaves tested for each replication (each dish). Evaluation of preventive/curative action of dsRNA by detached leaf assay Detached leaves (5 detached leaves/Petri dish) from 6-weeks-old rice plant (MR219) were placed into 1% water agar with kinetin 2 μg/ml. Detached leaves were treated as follows (Treatments T1 to T5: T1 - healthy control, T2 - infected-treated with Fungicide (Difenoconazole 250g/l EC, 0.5ml/1 L water), T3 - infected control (without any chemical treatment), T4 - infected-treated with 10 ng/µl dsRNA as preventive spray, T5 - infected-treated with 10 ng/µl dsRNA as curative spray. Fungal infection was done according to the method in the previous experiment stated in the above section for T2, T3, and T5. For treatment T4, 10 ng/µl concentration of dsRNA solution (200 µl/leaf) was sprayed before inoculation with P. oryzae . Inoculation of the pathogen to detached leaves was done as stated in the above section. One set of detached leaves was kept as a healthy control treatment. Petri dishes were incubated for two days on a laboratory bench under natural light/dark cycle. After two days fungal culture discs were removed by using sterilized forceps. For treatment, T2, T3 and T5, 10 ng/µl concentration of dsRNA solutions (200 µl/leaf) were sprayed separately onto the upper surface of detached leaves that were inoculated with P. oryzae (Wang et al ., 2016). The experiment was conducted in three replications. Evaluation on the effect of dsRNA against conidial germination One-week-old P. oryzae fungal culture grown on PDA was inoculated into 50 ml potato dextrose broth (PDB) in a 100 ml conical flask and shaken under 150 rpm (Tech Lab MFG SDN BHD Protech-719, Malaysia) at room temperature (25±1 °C) for 3 days. The fungal culture was transferred into Corn Meal Agar (HiMedia laboratories, USA) and incubated at room temperature (25±1 °C) for one week to get conidial spores. Then the surface of the culture plate was washed with 5 ml sterilized distilled water to harvest conidial spores and washout was collected into microcentrifuge tubes to harvest spores of P. oryzae . The suspensions were centrifuged at 3000 rpm (rotor type FA 45-24-11, Eppendorf AG – 5424, Germany), 5 minutes to spin down the spores. A volume of 100 μl of the conidial suspension was placed on a hemocytometer and the conidial spores were counted under the light microscope. The count of conidial spores was adjusted to 3x10 5 conidia/ml. 100 μl of dsRNA solution (10 ng/µl concentration with 0.02% Tween 20) (Kanzaki et al ., 2002) was added onto onion epidermal peel that was kept on a sterilized microscope slide and 10 μl of the above conidial spore suspension (Chida and Sisler, 1987). The microscopic slide was kept in a Petri dish with humid conditions and incubated for six hours. The number of spore germination was counted using medium magnification power (4X10) under the light microscope (Leica Mycrosystems, China). Images of germinating spores were captured with a Dino-lite digital microscope under 4X10 magnification (AnMo Electronics Corporation, Taiwan) using Dinocapture 2.0 software (Version 1.5.36). Each treatment was conducted in 10 replicated microscope slides. In planta evaluation of in vitro synthesised dsRNA Top soil was collected from TPU (Taman Pertanian Universiti) farm land-UPM and 5kg of the soil was filled into each pot (29 cm diameter, 29.5 cm depth) for rice plant cultivation and was then placed in a glasshouse. By flooding the soil in those pots for one week, it was stimulated to an actual paddy field condition. A fertilizer mixture (5 g) with N: P: K (150:90:150 ha -1 ) ratio was added to the pot soil before planting rice seedlings. Paddy seeds (MR219 variety) were soaked in water for one day and then placed on a wet paper towel in a Petri dish to start seed germination at room temperature (25±1 °C). After 3 days germinated seeds were planted in plastic boxes (22.7 x 18.6 x 6.9 cm in height/width/depth). Watering in the nursery was done to flood as an actual nursery and kept at 25±3°C temperature. Rice seedlings were transplanted in the pots at their two-leaf growth stage. Those pots with rice seedlings were kept in a polytunnel under natural daylight conditions. Watering the pots was done at two or three days’ time intervals (depending on weather) and kept plants under flooding conditions like natural paddy fields. In vitro synthesized dsRNA solution was diluted up to 10 ng/μl concentration using nuclease-free water. Tween20 (0.02% v/v) was added to the dsRNA solution as a surfactant. That dsRNA solution was applied as a spot application spray onto rice leaves (3 cm length) using 5 ml size spraying bottles. Three-week-old rice seedlings were used in a pot experiment to evaluate the efficacy of dsRNA treatment. The experiment was conducted with four treatments (T1-T4) as below. Spraying applications were done as a curative method to control rice blast disease. T1- Healthy Rice plants, T2- Inoculated plants without any treatment against P. oryzae , T3- Inoculated plants treated with Fungicide (Difenoconazole) foliar spray, T4- Inoculated plants treated with 10 ng/μl dsRNA as foliar spray. In the first treatment, healthy plants were used. In the second treatment plants were inoculated with fungal spores and without any control method. In the third and fourth treatments plants were inoculated with conidial spores of the fungus. In the third treatment plants were sprayed with a recommended fungicide (Difenoconazole) and fourth treatment, inoculated plants were sprayed with dsRNA solution (10 ng/ μl) three days after the pathogen inoculation (200 μl/ leaf). Three-week-old rice seedlings (wounded) (MR219 variety) were inoculated and incubated for three days in a humid chamber (100% RH) before the application of treatments. This experiment was conducted in a Randomized Complete Block Design (RCBD) with four plants per pot and five pots per treatment in each replicate. Inoculated plants without any fungicide/dsRNA application were considered as the control (T2). The severity of the Rice blast caused by P. oryzae in rice leaves was evaluated by visually assessing the lesions. Disease severity was recorded based on IRRI standards (2002). The percentage of the disease severity was calculated for every replication by using the equation presented by Madden et al ., 2007. Disease severity was recorded 6 times in each replicate, starting from 3 days after inoculation of conidial spores and starting application of treatments from that day. Disease severity data collection dates were considered as 0, 3, 6, 9, 12, and 15 days after inoculation. Disease progressive curve (AUDPC) and disease reduction were calculated using recorded disease severity values over time to determine the efficacy of dsRNA treatment. AUDPC was calculated according to the equation below (Gilbert, 2009) Where N is the total number of observations, y i indicates the percent disease severity data recorded at various times (t i ), The average disease severity was calculated as the midpoint of two time points and multiplied by the duration of time between that two points, then calculated the summation of those products during all time. dsRNA treated (T4) and infected untreated (T2) plant sample collection for RNA extraction was done on the same dates as disease severity data was recorded i.e.:- 3, 6, 9, 15 days after inoculation. Three leaf samples were collected from each treatment on each sampling day. Collected plant samples (0.1 g leaf part per one biological sample) were immediately placed in to liquid nitrogen and then stored at -80 °C until the RNA extraction. DCL2 gene expression study of P. oryzae in pot experiments Total RNA extraction, quantification, synthesis of cDNA, and real-time polymerase chain reaction were done according to the following procedure. The frozen leaf tissue sample was used to extract total RNA using One step RNA reagent following the manufacturer's protocol. cDNA synthesis using total RNA extracted from P.oryzae infected plant tissue was carried out according to the procedure. Based on the literature, β- tubulin (MGG_00604) and actin (MGG_03982) were selected as reference genes in the RT-qPCR analysis because of the consistent expression level of those genes in rice (Kadotani et al , 2004; Omar et al 2016). The nucleotide sequences of those reference genes were obtained from NCBI database for primer design. Primers used in the real-time qPCR were QPYBT primer pair for β- tubulin, and QPYAC for actin(Table 1). RT-qPCR primers for DCL2 gene were also designed based on the partial length of DCL2 cDNA sequence (NCBI accession number - MZ351764) i.e.: QDCL2-2 primer pair (Table 1). The primer design was done using Primer 3 Input software (version 0.4.0) (Rozen and Skaletsky, 2000; www.bioinfopop.ufv.br/sistema/primer3): (Thornton, and Basu, 2011). Minimum Information for Publication of Quantitative Real-Time Experiments (MIQE) guideline was followed while designing RT-qPCR primers (Bustin et al , 2009). Real-time PCR analysis was performed using Bio-Rad CFX96 quantification thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA), 0.1 ml PCR 8-strip tubes (Wuxi NEST Biotechnology Co., Ltd., China) and Maxima SYBR Green qPCR Master Mix (2X) (Thermo Fisher Scientific, USA). β- tubulin and actin were used as reference genes. Statistical Analysis In vitro experiments were conducted in Completely Randomized Design (CRD) with three replicates and five leaves per replicate. SAS 9.2 (SAS Institute Inc., Cary, NC, USA) was used to conduct statistical analysis. “Analysis of variance” (ANOVA) was done to find out significant differences between treatments. Mean separation was done using the General linear model (GLM) and Duncans’ multiple range test. The pot experiment was conducted in a Randomized Complete Block Design (RCBD) with four plants per pot and five pots per treatment in each replicate. To calculate AUDPC, disease severity data was recorded according to the IRRI scale for rice blast. SAS 9.2 (SAS Institute Inc., Cary, NC, USA) was used to conduct statistical analysis “Analysis of variance” (ANOVA) to determine the differences among treatments. Mean comparison was done using Duncans’ multiple range test with the General Linear Model (GLM). Results Synthesis of double-stranded RNA A fragment of 863 bp long dsRNA was synthesized (Fig. 01) using PCR amplicons (949 bp) as the template that amplified with PDCL2-F and PDCL2-R primer pair. Evaluation on the effect of PyDCL2-dsRNA against the mycelial growth of P. oryzae using slide culture method Differences in the morphology of fungal hyphae were observed on slide cultures of P. oryzae treated with different PyDCL2-dsRNA concentrations under a light microscope. Compared to the untreated control, 1.5 ng/µl had more branching in fungal filaments. PyDCL2-dsRNA concentrations of 0.1, 0.5, 1.0 ng/µl did not affect fungal filament branching pattern under these experimental conditions. However, 10 ng/µl concentrations of PyDCL2-dsRNA treatments affected fungal mycelial growth. Intense mycelial branching and unusual vesicles formation were observed in mycelia treated with 10 ng/µl PyDCL2-dsRNA (Figure 02). These two phenomena were observed in all three slides under that concentration of PyDCL2-dsRNA. Evaluation of the effect of PyDCL2-dsRNA against P. oryzae using i n vitro detached leaf assay According to the disease symptoms in detached leaves and percent of disease severity (Fig. 3), the treatment 10 ng/µl PyDCL2-dsRNA spray showed the highest disease suppression (13% disease severity) under in vitro conditions. However, all dsRNA concentrations tested except 10 ng/µl did not show good disease suppression (Supplement 03). Evaluation of preventive/curative action of PyDCL2-dsRNA by detached leaf assay In vitro detached leaf assay for the evaluation of preventive and curative activity of PyDCL2-dsRNA against rice blast fungus (Fig. 4) found that the curative method of application has less disease severity (56.7%) compared to the preventive method (70.17%). Both preventive and curative methods were more effective than untreated-inoculated treatment (88.17%). Evaluation on the effect of PyDCL2-dsRNA against conidial germination P. oryzae spore germination was reduced in the presence of 10 ng/µl PyDCL2-dsRNA treatment and the germination percentage was 59.1% (±1.97), while spores in water (control) were able to germinate successfully after six hours with a 96.9% (±0.38) germination percentage. It showed that 10 ng/µl PyDCL2-dsRNA could reduce P. oryzae spore germination. In planta evaluation of PyDCL2-dsRNA on rice plants Rice blast disease severity in the pot experiment after six days of PyDCL2-dsRNA spray applications, the AUDPC value of unsprayed inoculated plants (T1) was the highest (230.44), and fungicide spray treatment (T3) had the lowest AUDPC value (131.29). The AUDPC value of PyDCL2-dsRNA spray treatment (T4) (148.69) was higher than T3 and lower than T1 (Table 01). The Disease Reduction (DR, %) value of T3 (42.75%) was higher than T4 (35.11%). Disease Progression Rate (DPR) was highest in T1 (8.02), followed by T4 (4.93). The lowest DPR value was in T3 (3.86) (Table 02). The AUDPC value of T2 plants was the highest (681.51) after 15 days of treatment application and the lowest AUDPC value was inT3 (370.81). The AUDPC value of T4 plants (496.2) was higher than T3 and lower than T2 (Table 02). The Disease Reduction (DR, %) value of T4 (24.77%) was lower than T3 (46.44%). The lowest Disease Progression Rate (DPR) value was in T3 (1.92) and the highest was in T2 (3.70), followed by T4 (2.82) (Table 03). DCL2 Gene expression study of P. oryzae in pot experiments There was a significant difference in gene expression of DCL2 gene of P. oryzae between different days after PyDCL2-dsRNA spray treatments in the pot experiment. Relative gene expression level of DCL2 gene in P. oryzae at 01 day after dsRNA treatment was down-regulated 0.4 fold-change. Three days after application, relative gene expression level of DCL2 gene was drastically down-regulated to 0.6 fold-change. However, this value was up-regulated at 06 days after dsRNA application and returned to the baseline. At 15 days after application, DCL2 expression was up-regulated to 3 fold-change (Fig. 5). There was no significant difference in DCL2 transcript abundance between day 1 and day 3. Up-regulation of the DCL2 gene on day 15 was significant compared to DCL2 gene expression on other days. Discussion The application of a 10 ng/µl concentration of PyDCL2-dsRNA caused malformations (unusual vesicles formation and intense mycelial branching) in P. oryzae fungal mycelia. The abnormal fungal mycelial branching first appeared at 1.5 ng/µl dsRNA concentrations while the unusual vesicles formation and intense mycelial branching were observed with increased dsRNA concentration at 10 ng/µl. The malformation in fungal mycelia is an indicator of inhibition of mycelial growth (Chakraborty et al, 2020 ). In the detached leaf method, curative application of 10 ng/µl PyDCL2-dsRNA has better disease suppression compared to preventive application. However, this level of dsRNA concentration is higher level compared to some other in vitro experiments, dsRNA application to S. sclerotiorum for silencing several genes (SS1G_01703, SS1G_05899, SS1G_06487 and GFP) i.e. 100–1000 ng/mL dsRNA application (Mcloughlin et al, 2018 ). High dsRNA concentrations i.e. 20 ng/µl, were effective in some other experiments like F. graminearum that targeted the pathogen’s AGO and DCL genes (Werner et al, 2020 ). So it is confirmed that effective dsRNA concentrations in SIGS application vary according to the target organisms and target genes. Some of the target organisms are able to uptake dsRNA molecules effectively, while some other organisms are up taking dsRNA molecules slowly or very weakly (Qiao et al., 2021 ). Even though the target pathogen was the same, the target gene was different (Pathogenicity Gene MoDES1) in the SIGS experiment against rice blast disease that gave different efficacy on gene suppression. In addition, the rate of aplication for ( DES1 )-dsRNA spray (20 µl drops of 300 nM on rice leaf) used by Sarkar and Roy ( 2021 ) was different from this study. Since conidial germination of P. oryzae under 10 ng/µl PyDCL2-dsRNA was reduced to 59.1% in microscopic slide compared to the control, DCL2-dsRNA application could be used to stop disease spreading of a sporulating pathogen. When comparing the disease reduction values of the two treatments of PyDCL2-dsRNA spray (35.11%) and fungicide spray (42.75%) at 6 DAA, both treatments were able to reduce disease severity, but disease reduction due to dsRNA spray was significantly lower compared to fungicide spray (using t-test analysis). Therefore, the application of naked PyDCL2-dsRNA molecule at 10 ng/µl concentration was able to control fungal pathogen up to some extent, but it was less effective compared to fungicide for managing rice blast disease six days after application. The DR% value of the PyDCL2-dsRNA spray treatment declined from 35.11% (day six) to 24.77% after 15 days of application. However, the DR% of the fungicide spray treatment (46.44%) stayed at the same level as day six (42.75%). Consequently, this study showed that the fungicide spray against rice blast disease was effective up to 15 days after application, whereas dsRNA spray application was only effective for six days and lost efficacy at 15 days after application. Application of dsRNA spray to control powdery mildew disease of rubber tree (caused by Erysiphe quercicola fungus) was tested in planta under a growth chamber (at 25 ◦ C and a 12 hours day length for 24 hours), β-tubulin (Tub), Sterol 14α-demethylases (CYP51) and chitin synthase (Chs) were the targeted genes and dsRNA concentration of 20 µg/ml was sprayed onto leaf surface. Ten days after dsRNA application, the reduction in disease severity of powdery mildew disease was up to 50% compared to water-treated leaves (Cao et al., 2023 ). This result showed better performance of a dsRNA molecule, comparing to this study (day 06). However, a higher dsRNA concentration (20 µg/ml) was used and evaluated under artificial environmental condition (growth chamber). In the gene expression study, P. oryzae inoculated rice plants with 10 ng/µl PyDCL2-dsRNA spray application (T4 treatment), DCL2 gene of P. oryzae was up-regulated 3-fold at 15 days after dsRNA treatment, which also had an influence on RNA silencing (down regulation of DCL gene of P. oryzae ) for up to 3 days. The gene expression study findings also showed differences in the severity of rice blast disease in plants sprayed with PyDCL2-dsRNA from Day 6 to Day15. The highest dsRNA-mediated gene silencing effect was detected three days after PyDCL2-dsRNA spray. From Day 1 to Day 3, there was a drop in relative transcript abundance of PyDCL2 indicating that the effect of PyDCL2-dsRNA spray treatment increased from Day 1 to Day 3 but decreased at Day 6. After Day 6, the DCL2 transcript of P. oryzae could not be silenced by PyDCL2-dsRNA molecule in the semi-outdoor conditions of RH 85–95%, mean temperature 28°C, and 12 hours of light and 12 hours of darkness. The instability of the naked dsRNA molecule under UV radiation and RNase enzymes may affect the effectiveness of dsRNA application. Naked dsRNA molecules have a short lifetime under UV light, i.e. dsRNA breakdown in laboratory conditions began 30 minutes after exposure to direct UV radiation (1500 Wcm2 of 254 nm) (Miguel and Scott, 2016 ). In PCR tubes, the half-life of a naked dsRNA solution in outdoor circumstances ranged from 40 to 45 days (Li et al., 2015 ). In tropical countries such as Malaysia, high temperatures and high intensity of sunlight could degrade the dsRNA molecules faster than the findings in temperate countries such as China (Li et al., 2015 ). In addition, the concentration of the applied PyDCL2-dsRNA molecules may not be sufficient to suppress P. oryzae after Day 6 may explain the reason for the lower DR% value at Day 15. A more concentrated application may be necessary for outdoor conditions over a long period, such as 15 days. On the other hand, dsRNA spray applications that are repeated throughout the crop season could perform better to reduce the disease in rice plants warrantying research on spraying intervals. Declarations The authors declare that they have no conflict of interest. Acknowledgment- We would like to pay our acknowledgement to technical staff of Department of Plant Protection, Faculty of Agriculture, UPM, and technical staff of ITAFOS, UPM who supported us during our laboratory experiments and RT-qPCR experiments related to this study. Sri Lanka council for agricultural research policy provided a PhD scholarship to Kalupahana Pushpanjie. A Fundamental Research Grant Scheme (FRGS), Project Code 01-01-19-2183FR, Ministry of Higher Education Malaysia provided partial financial support for research materials. References Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M. W., Shipley, G. L., Vandesompele, J. and Wittwer, C. T. (2009). The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clinical Chemistry , 55(4): 611-622. https://doi: 10.1373/clinchem.2008.112797. Cao, X., Han, Q., and West, J. S. (2023). Spray-induced gene silencing as a potential tool to control rubber tree powdery mildew disease. Physiological and Molecular Plant Pathology , 129: https://doi.org/10.1016/j.pmpp.2023.102182 Chakraborty, M., Mahmud, N. U., Gupta, D. R., Tareq, F. S., Shin, H. J. and Islam, T. (2020). Inhibitory effects of linear lipopeptides from a marine Bacillus subtilis on the wheat blast fungus Magnaporthe oryzae Triticum. Frontiers in Microbiology , 11(665). https://doi.org/10.3389/fmicb.2020.00665. Chida, T. and Sisler, H. D. (1987). Restoration of appressorial penetration ability by melanin precursors in Pyricularia oryzae treated with antipenetrants and in melanin-deficient mutants. Journal of Pesticide Science , 12: 49–55. https://doi.org/10.1584/jpestics.12.49. Coca, M., Bortolotti, C. and Rufat, M. (2004). Transgenic rice plants expressing the antifungal AFP protein from Aspergillus giganteus show enhanced resistance to the rice blast fungus Magnaporthe grisea . Plant Molecular Biology, 54: 245–259. doi: 10.1023/B:PLAN.0000028791.34706.80. Devanna, B. N., Jain, P., Solanke, A. U., Das, A., Thakur, S., Singh, P. K., Kumari, M., Dubey, H., Jaswal, R. and Pawar, D. (2022). Understanding the dynamics of blast resistance in rice- Magnaporthe oryzae interactions. Journal of Fungi , 8(584). https://doi.org/10.3390/jof8060584. Fletcher, S. J., Reeves, P. T., Hoang, B. T. and Mitter, N. (2020). A perspective on RNAi-based biopesticides. Frontiers in Plant Science , 11(51). https://doi.org/10.3389/fpls.2020.00051. Gilbert, M. J., Soanes, D. M., and Talbot, N. J. (2004). Functional genomic analysis of the rice blast fungus Magnaporthe grisea . Applied Mycology and Biotechnology, 4 , 331-352. https://doi.org/10.1016/S1874-5334(04)80017-0. Haile, Z. M., Gebremichael, D. E., Capriotti, L., Molesini, B., Negrini, F., Collina, M., Sabbadini, S., Mezzetti, B. and Baraldi, E. (2021). Double-stranded RNA targeting dicer-like genes compromises the pathogenicity of Plasmopara viticola on grapevine. Frontiers in Plant Science , 135(57390). https://doi.org/10.3389/fpls.2021.667539. http://www.flyrnai.org (Cited on 09.02.2021) http://www.knowledgebank.irri.org (Cited on 05 .08.2019) https://www.who.int/news-room/fact-sheets/detail/pesticide-residues-in-food (Cited on 07 .08.2019) Kadotani, N., Nakayashiki, H. H., Tosa, Y. and Mayama, S. (2004). One of the two dicer-like proteins in the filamentous fungi Magnaporthe oryzae genome is responsible for hairpin RNA-triggered RNA silencing and related small interfering RNA accumulation. The Journal of Biological Chemistry ;279(43):44467-74. . https://doi: 10.1074/jbc.M408259200. Kanzaki, H., Nirasawa, S., Saitoh, H., Ito, M., Nishihara, M., Terauchi, R. and Nakamura, I. (2002). Over expression of the wasabi defensin gene confers enhanced resistance to blast fungus ( Magnaporthe grisea ) in transgenic rice. Theoretical and Applied Genetics , 105(6 and 7): 809-814. https://doi: 10.1007/s00122-001-0817-9 Kuo, Y. and Falk, B. W. (2020). RNA interference approaches for plant disease control. BioTechniques , 69: 469–477. https://doi: 10.2144/btn-2020-0098. Li, H., Guan, R., Guo, H. and Miao, X. (2015). New insights into an RNAi approach for plant defence against piercing-sucking and stem-borer insect pests. Plant Cell and Environment ,38: 227-2285. https://doi: 10.1111/pce.12546. Madden, L. V., Hughes, G. and Van den Bosch, F. (2007). The study of plant disease epidemics (145-171). St. Paul: American Phytopathological Society. https://doi.org/10.1094/9780890545058. Mcloughlin, A. G., Wytinck, N., Walker, P. L., Girard, I. J., Rashid, K. Y., Kievit, T. D., Fernando, W. G. D., Whyard, S. and Belmonte, M. F. (2018). Identification and application of exogenous dsRNA confers plant protection against Sclerotinia sclerotiorum and Botrytis cinerea . Scientific Reports , 8(7320). https://doi: 10.1038/s41598-018-25434-4. Miguel, K. S. and Scott, J. G. ( 2016). The next generation of insecticides: dsRNA is stable as a foliar-applied insecticide. Pest Managment Science , 72(4): 801–809. https://doi: 10.1002/ps.4056. Nerva, L., Sandrini, M., Gambino, G. and Chitarra, W. (2020). Double-stranded RNAs (dsRNAs) as a sustainable tool against gray mold ( Botrytis cinerea ) in Grapevine: Effectiveness of different application methods in an open-air environment. Biomolecules ,10(200). https://doi.org/10.3390/biom10020200. Omar, S. C., Benthly, M. A, Morieri, G., Preston, G. M. and Gurr, S. J. (2016).Validation of reference genes for robust qRT-PCR gene expression analysis in the rice blast fungus Magnaporthe oryzae. PLOS one, 11(8), 0160637. https://doi: 10.1371/journal.pone.0160637. Qiao, L., Lan, C., Capriotti, L., Ah-Fong, A., Sanchez, J. N., Hamby, R., Heller, J., Zhao, H., Glass, N. L., Judelson, H. S., Mezzetti, B., Niu, D. and Jin, H. (2021). Spray-induced gene silencing for disease control is dependent on the efficiency of pathogen RNA uptake. Plant Biotechnology Journal , 19: 1756–1768. https://doi: 10.1111/pbi.13589. Raman, V., Simon, S. A., Demirci, F., Nakano, M., Mayers, B. C. and Donfrio, N. M. (2017). Small RNA functions are required for growth and development of Magnaporthae oryzae . Molecular Plant-Microb . https://doi.org/10.1094/MPMI-11-16-0236-R. Routhu, G., Borah, M., Nath, P. D. and Deb, B. (2020). RNA interference (RNAi) and response of plant cells to double stranded RNA (dsRNA). International Journal of Current Microbiology and Applied Sciences, 9(9): 3114-3125. https://doi: 10.20546/ijcmas.2020.909.384. Rozen, S. and Skaletsky, H. (2000). Primer3 on the WWW for general users and for biologist programmers. Methods in Molecular Biology , 132: 365-386. https://doi: 10.1385/1-59259-192-2:365. Sarkar, A. and Roy, B. S. (2021). Spray-induced silencing of pathogenicity gene MoDES1 via exogenous double-stranded rna can confer partial resistance against fungal blast in rice. Frontiers in Plant Science , 12(733129). https://doi.org/10.3389/fpls.2021.733129. Sherman, J. H., Munyikwa, T., Chan, S. Y., Petrick, J. S., Witwer, K. W. and Choudhuri, S. (2015). RNAi technologies in agricultural biotechnology: The toxicology forum 40th annual summer meeting. Regulatory Toxicology and Pharmacology, 73(671): 680. https://doi: 10.1016/j.yrtph.2015.09.001. Thornton, B. and Basu, C. (2011). Real-Time PCR (qPCR) primer design using free online software. Biochemistry And Molecular Biology Education , 39(2): 145–154. https://doi: 10.1002/bmb.20461. Voloudakis, A. E., Holeva, M. C., Sarin, L. P., Bamford, C. Vargas, M., Poranen, M. M. and Francisco, T. F. (2015). Efficient double-stranded RNA production methods for utilization in plant virus control. Methods in Molecular Biology: Plant Virology Protocols (255–274 pp). New York: Humana Press. https://doi: 10.1007/978-1-4939-1743-3_19. Wang, M., Weiberg, A., Lin, F. M., Thomma, B. P. H. J., Huang, H. D. and Jin, H. (2016). Bidirectional cross-kingdom RNAi and fungal- uptake of external RNAs confer plant protection. Nature Plants, 9(2): 16151. https://doi: 10.1038/nplants.2016.151. Werner, B. T., Gaffar, F. Y., Schuemann, J., Biedenkopf, D. and Wang, A. M. K. (2020). RNA-spray-mediated silencing of Fusarium graminearum AGO and DCL genes improve barley disease resistance. Frontiers in Plant Science , 29. https://doi.org/10.3389/fpls.2020.00476. Yin, C., Zhu, H., Jiang, Y., Shan, Y. and Gong, L. (2020). silencing dicer-like genes reduces virulence and sRNA generation in Penicillium italicum , the cause of citrus blue mold. Cells , 9(2): 363. https://doi: 10.3390/cells9020363. Tables Table 01: Forward and reverse primer pairs designed for qPCR analysis. Primer pair Position in cDNA Length of PCR-product (bp) Sequence of primer Ta / C°) QDCL 2-2 Forward primer Reverse primer 1932 2084 153 CGCTGCACTCAAGGACGACA CGCCAACAAACGCCGTAGTC 59 QPYBT Left primer Right primer 1035 1196 162 CCGAGCGCGGTTACACCTTC TCCGTCGGGAAGCTCGTAGG 59 QPYAC Left primer Right primer 789 943 155 CCACTCTTTCCGCGCTGTCA TTGCGCATCTGGTCCTCGAC 59 Table 02: The effect of dsRNA spraying application on rice blast disease development on rice plant seedling after 6 days Treatment AUDPC (Units) %DR DPR(Unit/day) T1 0(±0) nr 0 (±0) T2 230.44(±7.77) nr 8.02 (±0.41) T3 131.29(±5.27) 42.75(±4.09) 3.86(±0.16) T4 148.69(±10.03) 35.11(±6.34) 4.93(±0.15) T1 = Healthy plant (Healthy Control), T2 = Pathogen inoculated (Infected Control) T3 = Pathogen inoculated + Fungicide spray, and T4 = Pathogen inoculated + PyDCL2-dsRNA spray. AUDPC: Area Under the Disease Progressive Curve, % DR: Disease reduction and DPR: Disease progress rate, nr-not relevant). Table 03: The effect of spraying application on rice blast disease development on rice plant seedling after 15 days Treatment AUDPC (Units) %DR DPR(Unit/day) T1 0 (±0) nr 0 (±0) T2 681.51(±25.91) nr 3.70(±0.11) T3 370.81(±21.37) 46.44(±3.88) 1.92(±0.25) T4 496.2(±10.17) 24.77(±0.48) 2.82(±0.07) T1 = Healthy plant (Healthy Control), T2 = Pathogen inoculated (Infected Control) T3 = Pathogen inoculated + Fungicide spray and, T4 = Pathogen inoculated + PyDCL2-dsRNA spray. AUDPC: area under the curve, % DR: Disease reduction and, DPR: Disease progress rate, nr-not relevant). Supplementary Files Supplements.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4757955","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":333609347,"identity":"2c9a273d-27af-4a26-8515-0792b7fbc7bc","order_by":0,"name":"Kalupahana Pushpanjie","email":"","orcid":"","institution":"Universiti Putra Malaysia","correspondingAuthor":false,"prefix":"","firstName":"Kalupahana","middleName":"","lastName":"Pushpanjie","suffix":""},{"id":333609348,"identity":"0ec83f31-8c8a-4fd8-acbc-30f83dafdb11","order_by":1,"name":"Lau Wei Hong","email":"","orcid":"","institution":"Universiti Putra Malaysia","correspondingAuthor":false,"prefix":"","firstName":"Lau","middleName":"Wei","lastName":"Hong","suffix":""},{"id":333609349,"identity":"86dc7fa3-733c-44f8-861b-a6ebf2dbe9b3","order_by":2,"name":"Norsazilawati Saad Saad","email":"","orcid":"","institution":"Universiti Putra Malaysia","correspondingAuthor":false,"prefix":"","firstName":"Norsazilawati","middleName":"Saad","lastName":"Saad","suffix":""},{"id":333609350,"identity":"0487f180-48fb-4004-aff8-882043b160a6","order_by":3,"name":"Hailing Jin","email":"","orcid":"","institution":"University of California Riverside","correspondingAuthor":false,"prefix":"","firstName":"Hailing","middleName":"","lastName":"Jin","suffix":""},{"id":333609351,"identity":"e023f30c-149d-41f4-bb21-16c309dc60dd","order_by":4,"name":"Mui-Yun Wong","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAs0lEQVRIiWNgGAWjYFACxgYgYQNh85CgJY0kLWBwmAQtujOS26R5d5xP3C52gPHB2zaGaIMDBLSY3UgEajlzO3Hn7ARmw7ltDLkbiNPSdjtxw+0ENiCDeC3nQFrYf5Oi5QDYFmbitJx52Gw5ty3ZeOfsxGbJOeckcmcS1HI8/eGNt212stulkw9+eFNmk9tHSAsQsEiASANInEowKBChhfkDRAsUyDcQ1jIKRsEoGAUjCwAAGwVG17/qxSYAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-6944-4860","institution":"Universiti Putra Malaysia","correspondingAuthor":true,"prefix":"","firstName":"Mui-Yun","middleName":"","lastName":"Wong","suffix":""}],"badges":[],"createdAt":"2024-07-17 17:33:59","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4757955/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4757955/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":63263041,"identity":"78d3f0e8-3701-46ce-844b-7f0264b2775d","added_by":"auto","created_at":"2024-08-26 09:30:41","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":65951,"visible":true,"origin":"","legend":"\u003cp\u003eGel visualization of \u003cem\u003ein vitro\u003c/em\u003e synthesized dsRNA targeting DCL2 of \u003cem\u003eP. oryzae\u003c/em\u003e dsRNA samples (0.5μl/well) were run on 1.5% (w/v) TAE agarose gel which added Florosafe DNA stain. L- 100 bp DNA Ladder (1st Base, Singapore). 863 bp size dsRNA molecule was visualized as the expected band size. Lane 01 contained first elution of synthesized dsRNA.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4757955/v1/f5ae32d37d7d8c3c975719eb.png"},{"id":63261434,"identity":"5db98bcf-26c6-4b3f-a8c4-4dd614697942","added_by":"auto","created_at":"2024-08-26 09:14:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":612452,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMicroscopic observations of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eP. oryzae\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003emycelial growth in the presence of different of PyDCL2-dsRNA and untreated control (with nuclease-free water) (a), 10.0 ng/µl concentration(b)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4757955/v1/c14a04e903470fab0b2dbc0c.png"},{"id":63261436,"identity":"6e411edc-aa76-458f-97c7-73e23878cd25","added_by":"auto","created_at":"2024-08-26 09:14:41","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":53408,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe disease severity (%) of rice blast disease in inoculated detached rice leaves with different PyDCL2-dsRNA concentrations \u003c/strong\u003e(untreated control, 0.1, 0.2, 0.5, 1.0, 1.5, 3.0, 5.0, 10.0 ng/µl dsRNA and non-infected control as treatments). Means with similar letter(s) are not significantly different at P ≤ 0.05 level of Probability using Duncans’ multiple range test.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4757955/v1/75daa7c675c8114fcdc2ccad.png"},{"id":63261431,"identity":"c03a34f7-e679-40f7-9c7b-e8e0d8d03b15","added_by":"auto","created_at":"2024-08-26 09:14:40","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":53599,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe disease severity (%) of rice blast disease in inoculated detached rice leaves with preventive and curative PyDCL2-dsRNA application. \u003c/strong\u003e*Means with similar letter(s) are not significantly different at P≤ 0.05 level of Probability using Duncans’ multiple range test.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4757955/v1/b7d48b7c0d3e89bec0465fff.png"},{"id":63261435,"identity":"572fbd44-5d07-4703-a6db-e8231c37c774","added_by":"auto","created_at":"2024-08-26 09:14:41","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":48700,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRelative expression levels (mean ± SE) of the DCL2 gene based on RT-qPCR analysis\u003c/strong\u003e. \u0026nbsp;DCL2-gene expression of \u003cem\u003eP. oryzae\u003c/em\u003e in infected rice plant leaves were detected at 1, 3, 6, and 15 days after PyDCL2-dsRNA application using spraying. Means with similar letter(s) are not significantly different at P≤ 0.05 level of Probability using Duncans’ multiple range test.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4757955/v1/5d4355bb7e5b9395ced6cd89.png"},{"id":69853330,"identity":"5e0808b9-27bc-4df4-8160-8f890d65e0c4","added_by":"auto","created_at":"2024-11-26 01:58:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1867350,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4757955/v1/8846ad86-1ed4-43ff-b942-46091d55f8f3.pdf"},{"id":63262099,"identity":"2d0dbf88-b05c-4e38-93a3-318b3b165b06","added_by":"auto","created_at":"2024-08-26 09:22:40","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1611150,"visible":true,"origin":"","legend":"","description":"","filename":"Supplements.docx","url":"https://assets-eu.researchsquare.com/files/rs-4757955/v1/18d289b214111819b3ade3f1.docx"}],"financialInterests":"","formattedTitle":"Spray-Induced Gene Silencing against Rice Blast Disease Targeting Dicer-like Protein 2 (DCL2) of Pyricularia oryzae","fulltext":[{"header":"Introduction","content":"\u003cp\u003eRice blast is one of the most devastating diseases in rice. \u003cem\u003eMagnaporthe oryzae\u003c/em\u003e (anamorph \u003cem\u003ePyricularia oryzae\u003c/em\u003e) is the causal agent of this disease. The annual loss due to rice blast is approximately 10\u0026ndash;30% in various rice-producing regions (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"http://www.knowledgebank.irri\" target=\"_blank\"\u003ewww.knowledgebank.irri\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.knowledgebank.irri\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (Devanna et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The application of synthetic fungicides is the most common method used by the farmers to control this fungal disease. Overuse or misuse of synthetic fungicides can cause many acute and chronic health hazards to agriculture workers and food consumers (WHO, 2022). There is a greater need for new environmental-friendly disease management strategies against rice blast fungal pathogen to achieve sustainable agriculture.\u003c/p\u003e \u003cp\u003eDuring the last decade, RNA interference (RNAi) technique was identified as a potential alternative strategy in plant protection (Routhu et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). It is more specific on selected plant pathogens because of its sequence-dependent action. RNAi-based transgenic plants are available in the market utilizing host-induced gene silencing (HIGS) technique (Kuo and Falk, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) which is still under controversy due to its transgenic nature (Sherman et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Thus, attention is turned to non-transformative methods such as spray-induced gene silencing (SIGS). In SIGS, specific double-stranded RNA (dsRNA) molecules are used as an external application on plant tissues to control plant pathogens. The dsRNA molecules are now considered an effective agent in crop protection and more experiments are being conducted regarding this new source (Voloudakis et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In nature, dsRNA molecule is one of the main components in the RNA silencing (RNAi) pathway in higher eukaryotes. It causes degradation of homologous target sequence and gene expression control (Fletcher et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Dicer-like protein (DCL), RNA-dependent RNA polymerase (RdRP), and Argonaute (AGO) are essential in the bbiogenesis of small RNAs in RNAi pathway of an organism. Losing a single gene among them can lead to a reduced level of small RNAs in \u003cem\u003eP. oryzae\u003c/em\u003e (Raman et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). It is important to reduce virulence of a pathogen.\u003c/p\u003e \u003cp\u003eThere are several successful findings related to SIGS against several pathogens:- dsRNA applications against \u003cem\u003ePenicillium italicum\u003c/em\u003e in citrus fruit targeting the DCL gene (Yin et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), \u003cem\u003eFusarium graminearum\u003c/em\u003e in barley leaves targeting dicer and argonaute genes (Werner \u003cem\u003eet al\u003c/em\u003e.,2020), \u003cem\u003eBotrytis cinerea\u003c/em\u003e in grape wine targeting three fungicide sites of action i.e.; \u003cem\u003eBcCYP51\u003c/em\u003e, \u003cem\u003eBcchs1\u003c/em\u003e and \u003cem\u003eBcEF2\u003c/em\u003e where \u003cem\u003eBcCYP51\u003c/em\u003e, cytochrome P450 monooxygenase 51, is important in ergosterol biosynthesis, \u003cem\u003eBcchs1\u003c/em\u003e, chitin synthase 1, plays a role in cell wall polymerization and \u003cem\u003eBcEF2\u003c/em\u003e, elongation factor 2, acts as a catalyzer in protein synthesis (Nerva et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) as well as dicer-like proteins, DCL1 and DCL2 genes of \u003cem\u003ePlasmopara viticola.\u003c/em\u003e in grape wine (Haile et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). MoDES1 gene (a host-define suppressor pathogenicity gene) of rice blast pathogen, \u003cem\u003eP. oryzae\u003c/em\u003e was targeted in SIGS application and showed partial resistance against the rice blast disease (Sarkar and Roy \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Chemical control methods that are currently available against rice blast disease post negative effects on the environment and human beings. This study was carried out to develop effective RNAi-mediated gene silencing method targeting DCL2 transcript of \u003cem\u003eP. oryzae\u003c/em\u003e and evaluate SIGS effect on the rice blast pathogen via \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein planta\u003c/em\u003e applications.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003ch3\u003eExperimental locations\u0026nbsp;\u003c/h3\u003e\n\u003cp\u003eThe laboratory experiments were conducted at the Department of Plant Protection, Faculty of Agriculture, Universiti Putra Malaysia (UPM), Malaysia. \u003cem\u003eIn planta\u003c/em\u003e experiments were conducted in the Polytunnel located at Ladang-10, UPM. The relative humidity of the location was 85-95% and the mean temperature was 28\u0026plusmn;4\u0026deg;C with 12 hours of light and dark cycle.\u003c/p\u003e\n\u003ch3\u003eSynthesis of double-stranded RNA\u0026nbsp;\u003c/h3\u003e\n\u003cp\u003eThe long double-stranded RNA (dsRNA) molecule complementary to the DCL2 transcript of \u003cem\u003eP. oryzae\u003c/em\u003e was designed using Snap Dragon software (www.flyrnai.org). The specific primer pair of PDCL2-F and PDCL2-R was designed for PCR amplification of the dsRNA template. T7 promoter sequence was added into the 5\u0026apos; end of each primer (Supplement 01).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe total RNA of \u003cem\u003eP. oryzae\u0026nbsp;\u003c/em\u003eof seven days old culture was extracted using \u0026ldquo;One Step RNA Reagent\u0026rdquo; (Bio Basic, Canada). Template cDNA for PCR amplification was prepared using a Goscript Reverse Transcription Kit (Promega, USA) according to the manufacturer\u0026rsquo;s procedure and total RNA of \u003cem\u003eP. oryzae\u003c/em\u003e. PCR amplification was conducted to produce the PCR fragment that was required for the dsRNA synthesis process. PCR reaction mixture was prepared in a 25 \u0026mu;L reaction containing 12.5 \u0026mu;l of 2X Q5\u003csup\u003e\u0026reg;\u003c/sup\u003e high-fidelity PCR master mix (NEB, USA), 1 \u0026mu;l of 1 \u0026mu;M forward and reverse primers, and 1 \u0026mu;l template cDNA (100 ng). The PCR amplification was done with the following program: Initial denaturation at 98 \u0026deg;C for 1 minute; 30 cycles of 98 \u0026deg;C for 10 s denaturation, 30 s annealing temperature at 65 \u0026deg;C and 72 \u0026deg;C for 1 minute for elongation; and a final extension step of 72 \u0026deg;C for 2 minutes in the thermo cycler (Biometra T\u0026ndash; Personal, Germany). \u003cem\u003eIn vitro\u003c/em\u003e synthesis of dsRNA was done using Megascript RNAi kit (USA) according to the manufacturer\u0026rsquo;s protocols.\u003c/p\u003e\n\u003ch3\u003eEvaluation on the effect of dsRNA against the mycelial growth of \u003cem\u003eP. oryzae\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003eusing slide culture method\u0026nbsp;\u003c/h3\u003e\n\u003cp\u003eA volume of 100 \u0026mu;L melted potato dextrose agar (PDA) (HiMedia Laboratories, The Netherlands) was added onto the sterilized microscopic slide and 10 \u0026mu;L of diluted dsRNA solution was added to each drop of liquid PDA on the slide. A small amount of \u003cem\u003eP. oryzae\u003c/em\u003e culture which was obtained from the actively growing edge of seven-day-old culture was placed at one edge of the liquid PDA drop. The liquid PDA drop was covered with a sterilized cover slip. The slide was kept in a sterilized Petri dish sealed with parafilm and incubated for 24 hours under room temperature (25\u0026plusmn;1 \u0026deg;C). Different concentrations of dsRNA solutions (0.1, 0.5, 1.0, 1.5, 3, 10 ng/\u0026mu;l) were added separately into slide cultures according to above-mentioned method. The experiment was conducted with three replicates. After the incubation period, slide cultures were observed under a light microscope (Leica Microsystems, China) and images were captured with Dino-lite digital microscope camera (AnMo Electronics Corporation, Taiwan) using Dinocapture 2.0 software (Version 1.5.36). Growth pattern and morphology of the fungal mycelia was recorded in both dsRNA-treated and untreated control culture slides.\u0026nbsp;\u003c/p\u003e\n\u003ch3\u003eEvaluation of the effect of dsRNA against \u003cem\u003eP. oryzae\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003eusing \u003cem\u003ei\u003c/em\u003e\u003cem\u003en vitro\u003c/em\u003e detached leaf assay\u003c/h3\u003e\n\u003cp\u003e\u003cem\u003eIn vitro\u003c/em\u003e synthesized PyDCL2-dsRNA was diluted to prepare a concentration series of 0, 0.1, 0.5, 1.0, 1.5, 3, 5 and 10 ng/\u0026mu;l with RNase-free water. A sterilized needle was used to make 3 spots of small physical damage on the upper side of the six-week-old detached leaves of healthy rice variety MR219, with a 1 cm distance from each spot. The detached leaves were placed onto Petri dishes that contained 1% water agar and 2 \u0026mu;g/ml kinetin (Coca \u003cem\u003eet al.,\u0026nbsp;\u003c/em\u003e2004). \u0026nbsp;Each Petri dish contained five detached leaves and the experiment was conducted in three replications. Inoculation process for detached leaf test was conducted as follows. Two-week-old \u003cem\u003eP. oryzae\u003c/em\u003e culture on PDA was used to obtain a 0.5 cm diameter size fungal culture disc for detached leaf inoculation. The upper side of each fungal disc with mycelia was placed on the physically damaged spot of the plant leaf with. One set of Petri dishes was inoculated with PDA discs without fungal mycelia and kept as a healthy control treatment. \u0026nbsp;The Petri dishes were sealed and incubated for two days on a laboratory bench under natural light/dark cycle. \u0026nbsp;After two days, fungal culture discs were removed using sterilized forceps. Different concentrations of dsRNA solutions (200 \u0026micro;l/leaf) were sprayed separately onto the upper surface of detached leaves that were inoculated with \u003cem\u003eP. oryzae\u003c/em\u003e (Wang\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2016). One set of pathogen-inoculated detached leaves was kept without spraying dsRNA solution but sprayed with RNase-free water as untreated control. Rice blast disease symptoms were observed after 5 days and disease severity was assessed visually in each treatment according to IRRI standards (2002) The percentage of the disease severity was calculated for every replication using the following equation (Madden \u003cem\u003eet al\u003c/em\u003e., 2007):\u003c/p\u003e\n\u003cp\u003eDisease severity (%) = [\u0026Sigma;(r \u0026times; nr)/(9 \u0026times; Nr)] \u0026times; 100\u003c/p\u003e\n\u003cp\u003eIn this equation, r represents the rating value (0-9) and it indicates the fraction of blast lesions of the infected area compared to the total leaf area; nr means the number of infected leaves with a rating of r, and Nr stands for the total number of leaves tested for each replication (each dish).\u003c/p\u003e\n\u003ch3\u003eEvaluation of preventive/curative action of dsRNA by detached leaf assay\u003c/h3\u003e\n\u003cp\u003eDetached leaves (5 detached leaves/Petri dish) from 6-weeks-old rice plant (MR219) were placed into 1% water agar with kinetin 2 \u0026mu;g/ml. Detached leaves were treated as follows (Treatments T1 to T5: \u0026nbsp; T1 - healthy control, T2 - infected-treated with Fungicide (Difenoconazole 250g/l EC, 0.5ml/1 L water), T3 - infected control (without any chemical treatment), T4 - infected-treated with 10 ng/\u0026micro;l dsRNA as preventive spray, T5 - infected-treated with 10 ng/\u0026micro;l dsRNA as curative spray.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFungal infection was done according to the method in the previous experiment stated in the above section for T2, T3, and T5. For treatment T4, 10 ng/\u0026micro;l concentration of dsRNA solution (200 \u0026micro;l/leaf) was sprayed before inoculation with \u003cem\u003eP. oryzae\u003c/em\u003e. Inoculation of the pathogen to detached leaves was done as stated in the above section. One set of detached leaves was kept as a healthy control treatment. Petri dishes were incubated for two days on a laboratory bench under natural light/dark cycle. \u0026nbsp;After two days fungal culture discs were removed by using sterilized forceps. For treatment, T2, T3 and T5, 10 ng/\u0026micro;l concentration of dsRNA solutions (200 \u0026micro;l/leaf) were sprayed separately onto the upper surface of detached leaves that were inoculated with \u003cem\u003eP. oryzae\u003c/em\u003e (Wang \u003cem\u003eet al\u003c/em\u003e., 2016). \u0026nbsp;The experiment was conducted in three replications.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEvaluation\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eon the effect of dsRNA\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eagainst\u0026nbsp;conidial germination\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOne-week-old \u003cem\u003eP. oryzae\u003c/em\u003e fungal culture grown on PDA was inoculated into 50 ml potato dextrose broth (PDB) in a 100 ml conical flask and shaken under 150 rpm (Tech Lab MFG SDN BHD Protech-719, Malaysia) at room temperature (25\u0026plusmn;1 \u0026deg;C) for 3 days. The fungal culture was transferred into Corn Meal Agar (HiMedia laboratories, USA) and incubated at room temperature (25\u0026plusmn;1 \u0026deg;C) for one week to get conidial spores. Then the surface of the culture plate was washed with 5 ml sterilized distilled water to harvest conidial spores and washout was collected into microcentrifuge tubes to harvest spores of \u003cem\u003eP. oryzae\u003c/em\u003e. The suspensions were centrifuged at 3000 rpm\u0026nbsp;(rotor type FA 45-24-11, Eppendorf AG \u0026ndash; 5424, Germany), 5 minutes to spin down the spores. A volume of 100 \u0026mu;l of the conidial suspension was placed on a hemocytometer and the conidial spores were counted under the light microscope. The count of conidial spores was adjusted to 3x10\u003csup\u003e5\u003c/sup\u003e conidia/ml. 100 \u0026mu;l of dsRNA solution (10 ng/\u0026micro;l concentration with 0.02% Tween 20) (Kanzaki \u003cem\u003eet al\u003c/em\u003e., 2002) was added onto onion epidermal peel that was kept on a sterilized microscope slide and 10 \u0026mu;l of the above conidial spore suspension\u0026nbsp;(Chida and Sisler, 1987). The microscopic slide was kept in a Petri dish with humid conditions and incubated for six hours. The number of spore germination was counted using medium magnification power (4X10) under the light microscope (Leica Mycrosystems, China).\u0026nbsp;Images of germinating spores were captured with a Dino-lite digital microscope under 4X10 magnification (AnMo Electronics Corporation, Taiwan) using Dinocapture 2.0 software (Version 1.5.36). Each treatment was conducted in 10 replicated microscope slides.\u003c/p\u003e\n\u003ch3\u003e\u003cem\u003eIn planta\u003c/em\u003e evaluation of \u003cem\u003ein vitro\u003c/em\u003e synthesised dsRNA\u003c/h3\u003e\n\u003cp\u003eTop soil was collected from TPU (Taman Pertanian Universiti) farm land-UPM and 5kg of the soil was filled into each pot\u0026nbsp;(29 cm diameter, 29.5 cm depth)\u0026nbsp;for rice plant cultivation and was then placed in a glasshouse. By flooding the soil in those pots for one week, it was stimulated to an actual paddy field condition. A fertilizer mixture (5 g) with N: P: K (150:90:150 ha\u003csup\u003e-1\u003c/sup\u003e) ratio was added to the pot soil before planting rice seedlings.\u003c/p\u003e\n\u003cp\u003ePaddy seeds (MR219 variety) were soaked in water for one day and then placed on a wet paper towel in a Petri dish to start seed germination at room temperature (25\u0026plusmn;1 \u0026deg;C). After 3 days germinated seeds were planted in plastic boxes (22.7 x 18.6 x 6.9 cm in height/width/depth). Watering in the nursery was done to flood as an actual nursery and kept at 25\u0026plusmn;3\u0026deg;C temperature. Rice seedlings were transplanted in the pots at their two-leaf growth stage. Those pots with rice seedlings were kept in a polytunnel under natural daylight conditions. Watering the pots was done at two or three days\u0026rsquo; time intervals (depending on weather) and kept plants under flooding conditions like natural paddy fields.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIn vitro\u003c/em\u003e synthesized dsRNA solution was diluted up to 10 ng/\u0026mu;l concentration using nuclease-free water. Tween20 (0.02% v/v) was added to the dsRNA solution as a surfactant. That dsRNA solution was applied as a spot application spray onto rice leaves (3 cm length) using 5 ml size spraying bottles. Three-week-old rice seedlings were used in a pot experiment to evaluate the efficacy of dsRNA treatment. The experiment was conducted with four treatments (T1-T4) as below. Spraying applications were done as a curative method to control rice blast disease. T1- Healthy Rice plants, T2- Inoculated plants without any treatment against \u003cem\u003eP. oryzae\u003c/em\u003e,\u0026nbsp;T3-\u0026nbsp;Inoculated plants treated with Fungicide (Difenoconazole) foliar spray,\u0026nbsp;T4-\u0026nbsp;Inoculated plants treated with 10 ng/\u0026mu;l dsRNA as foliar spray.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eIn the first treatment, healthy plants were used. In the second treatment plants were inoculated with fungal spores and without any control method. In the third and fourth treatments plants were inoculated with conidial spores of the fungus. In the third treatment plants were sprayed with a recommended fungicide (Difenoconazole) and fourth treatment, inoculated plants were sprayed with dsRNA solution (10 ng/ \u0026mu;l) three days after the pathogen inoculation (200 \u0026mu;l/ leaf).\u0026nbsp;Three-week-old rice seedlings (wounded) (MR219 variety) were inoculated and incubated for three days in a humid chamber (100% RH) before the application of treatments.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThis experiment was conducted in a Randomized Complete Block Design (RCBD) with four plants per pot and five pots per treatment in each replicate. Inoculated plants without any fungicide/dsRNA application were considered as the control (T2).\u003c/p\u003e\n\u003cp\u003eThe severity of the Rice blast caused by \u003cem\u003eP. oryzae\u003c/em\u003e in rice leaves was evaluated by visually assessing the lesions. Disease severity was recorded based on IRRI standards (2002). \u0026nbsp;The percentage of the disease severity was calculated for every replication by using the equation presented by Madden \u003cem\u003eet al\u003c/em\u003e., 2007. Disease severity was recorded 6 times in each replicate, starting from 3 days after inoculation of conidial spores and starting application of treatments from that day. Disease severity data collection dates were considered as 0, 3, 6, 9, 12, and 15 days after inoculation. Disease progressive curve (AUDPC) and disease reduction were calculated using recorded disease severity values over time to determine the efficacy of dsRNA treatment. AUDPC was calculated according to the equation below (Gilbert, 2009)\u003c/p\u003e\u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAagAAABlCAYAAAAYs3ceAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAABNeSURBVHhe7Z1LjBVFF8cb1j4WulBkI8RxY3xgxoWSSAQXEE0M8UEIjCZkxggkCmJ8LIhCEI2IGKOJz4AaHtEFiCMmoDE6KxLGia7AoG5gXOBCx5i4mu/+invmq2m6+3b37b63b9//L6nMnX5Ud1V11ak6derUnOkGgRBCCFEx5jb/CiGEEJVCAkoIIUQlkYASQghRSSSghBBCVBIJKCGEEJVEAkoIIUQlkYASQghRSSSghBBCVBIJKCGEEJVEAkoIIUQlkYASQghRSSSghBBCVBIJKCGEEJVEAkoIIUQlkYASQghRSSSgRKn8+OOPwdVXXx3MmTMnWLZsWfDPP/80z1zk9ddfd+csfPnll80z+SD+N954I7jxxhvbjksI0V0koESp3HbbbcGFCxeCXbt2Bd98803w3XffNc9c5Omnnw6OHj0aLF26NJiamgruu+8+d3xycjJYuHBh8Oijj7r/04BwWrduXbBjx47gzJkzzaNCiF5FAkp0hPPnzwcDAwPBnj17LhlFnT59OnjqqaeCyy67rHkkCK699trg7Nmzwb59+5pHWsP9hw4dCo4fPx5cddVVzaNCiF5FAkqUDgJp/vz5wUsvvRRMTEwEv/zyS/PMxXMIqNtvv715pPvwfiMjI1IRVgBUxHw3f/zxR/OI6CckoETp0OBffvnlwd133x1ceeWVbhRloNYDzgNCweajouasyubgwYNOzXjPPffMqBtF90BFzMj4pptucmUj+gsJKFE6586dcyMk1Hbr168PxsbG3BwTnDp1yhk0mHoPoTA+Pu5UdMuXL5+l9isbDDY2btzoGsJVq1Y1j4puwzzl3r17XdlQRqJ/kIASpYMQuuaaa9zv1atXu7/79+93f1HvMVrx+fbbb93f8PEyoeHbsmWLawjptYtqQceFsqGMJKT6BwkoUSqo6ObOnTujwmMUtXjx4uCdd95xqj/mFkx4GT/99FNw6623BjfccIP7H0s+3xQ9KrTTaDHPsXPnzmBoaEhqvQpD2VBGlBVlJuqPBJQoFYQQQslX1WGx99dffzlVGsc5b6D6QwXoq/ew5Juenk4MqIHygAB95pln3G/eq1dAaHdjjq7bWBlRZv2W9n5EAkqUCvNP4RESIyNGSFu3br1kjgl1IMKrU+o91mWxPssfsYnqYt9O1Jo6UT8koERp0MP94osvLjEhRyjRE8YQIiyImJOiAWJUtX379rZ6ya1Mk4nbLAqzGGQQ74cffujuwUtGlLqJER3nesHyrJfSQxnxnhC1pk7UjGkhSmDXrl3TfF6EhiCaHh8fb565yNTU1HSj0XN/fYaGhtz1u3fvvuRcGrjfnktYunRpbDy8E8/iuqNHjzaPJuOnywLHfHgez+Vc0vPbgXQWEXdV0pMFyop3ifquRL2QgBJ9izXOeRq6M2fOTC9YsMDdj7AIw/nBwcHKCyij2+nJgt+xCAtTUS+k4hN9C9aCwOLh8DxZK5gLwRoRmGcLq5o4/+677wa33HJLatVhN+ml9FBWlBlYGYp6IgEl+hIaYBridrj55pvd399++23GI4bPp59+GqxZs6b5X/XpxfRECVNRHySghMgJHjDiMD9+7Sz69d0+hcPHH3/sLNlYXxZ1Po8JetnpESIrElBCtAlm8b7FIGu5GG3g9aAdWJg6HVrvZWFoaGhmi5Ko8ydOnMitiisrPUJkRQJKiJxcd911kdt64MYJVZi/ALkXqFt6RO8jASVKBRdEUSqoskLaDQ4ZXdAgF8Gff/45M5+FKoy9r3rZZVIvpYcy7AUjFJEPCShRKjiHHRwcbP5XLcwoIKzSSotvTQaowliYzP5FvUin08McWZ7t+SkrygysDEU9kYASpYJa6MiRI5FCinmUuDmUNIF7R0dHcwtAvFig0vJHDHnBRRPeMZ544omWPXoa/qzb2XeastODcMq7PT9lRZlRdp1yiSW6gwSUKB2EFFtoMKnvgyXahg0bcpsJ03CuWLHCxY2wy4r5dQNcLGUFC7rrr7/e/X7rrbeCtWvXprJyIz+ybmffCTqZHsou7/b8Vlbyn1h/uiqg8O+V5Da/1TYLcT024sRvWPh6enn09pLMdy1w/1133eW8Jn/11VfNmJNJM9+COgO1RtZGGa/g+Kbjnfz48EvG+xGfbVVOGqsGDdLhw4cLF1JA3K+88kqwYMGC5pF0cJ95xz527Fhb7/D888/XaquOotJDXSty/ybKiLKCLP4TDasjWVSK4lJoYzuyFf90l8CfVqPn1NLFzNTU1Cx/Ydxz4MCB5tlk3n//fXdPnHsWO08Iu3fh+tHRUefehfP8TeMOh/tWrlw5Ey/vbs/m7+bNm93xNGkH/x2Gh4cvucc/T6iCK5okeDfe0d7XAvnf7nsTR7gcW2Hvk7Y8wvC8tO52zIccoarlVHR6uCYpPvKcvOe6NNj1efKPdmNgYCB1+yGSoVyztMd56IqAso8M31/nz59vHo3HrqcipK08QNzLli2LfUbaeDnHNVybpiJZxeV6nuFjDWJSpQaOI5C4DgGEL7Q4SJ/5UcuSP93CzwM/tCukyPesAgrsO8h6L/e9+OKLzf/SYc+qYjmVkZ6iBRRlFFWvWsE75LlPJEO5lfk9d1xA+Y1TWgGV1OAn0arByhIv8aR9Z7s2TgBRmEnPJX4bFSUJMR+LM21F7zZlCCnykhFqHrLmH73GPM+qakNZVnrIT66Jg/u4P02+W31Nii+KrGXb6p3rSDtpzlsuaei4gKIS3HnnnS5BaRvfVg1+HGRY0keZJV6rSFzPfXH4DW9cgXGc84Tw+/nCKa0AB96P+9JeXwX8vPJDO0KqHSiXqMbS3pMwOTnpvmFCnnckbWm+tzIpMz1Wp5KCX3/SCii7LmsjaPf5z0zC6h/39QtFpJn8JZ+LzreOCig+QiqCfcRpPhoyL4/6igrz8MMPx2ZY1nitUnN9kuCwCpFUWEkCyvIm6lwSPIv05mlkuomfr34gH7qRFkYSlB2qLns+5eC/W97G3L65rI1s0XQyPTwr6bzVl6RvnTLJM3dk31bahtOuT6rfdaOoNFs5EleebymOjlnxYVmWx58X6zF+/fXXzGsesNaBODNUixeSnGRGwX3cHwUmz6zRiDOB9a2QGh/FrN1msSzCqg0aDXRmK6r58+dntmrqNknWfQ888EBblnV5WLVqVfD7778Hf//998yW4uYCiNBoJJ1VWp585pvp5Hb2cfRSerAW4znUDcomC1m286e9IB1cz7Yj/eDWqcg025KNwrfibwqqUkGi2mjGJDaPTtOTtBFFVglP3Enxcy5rvK1GN2nS5vdeic/w7200HKl6fHXCT78fOMa5OsA3QXpQq23btq3n05UmPWlHUFjUFon/PSU93zZiDH93BL9+1omy0kw+E0eRdbYjIyg2Orvjjjvcor/Gi7v9ZtLAqGtsbMz9ziLh6XWfPHkytmfnj2KK7C35aYsalZGeJ5980v1uFGLw9ttvu99gvT3oxwWIcSMp8qQbI6kyYHO9iYkJN2rZtGlTz412w7SbHtYxLlq0yGkchoeHc20REgejA94NkjQk1DPaioagdCNKtBqNDisd98otpC6KstJs+Uy+mwarbZyYKhF6UOi4DUYrjFp4dJLeGax3leZaH56BiXacFM8Tr98ji7uPY5wj7u+//7559OK96M/tmVE6f390ltTjKwp71zwhS1lkJZzPForslYn6Y7156hz1vRV2fV1HTVEUnWa/XS2qDSt1BBU172SOHhsJaelN2uZzkPD+XE0r0Fn/999/sT26vPEace/+2Wefub/E+/LLL894s8CFzMaNG4OVK1c6v2NhnT+9Rt8XXNY5sTwwv9Uo/1yhTI8JcSOpPF4DRP+SZTt/X6PSL85ny0hzGVvxlyqgGlI0ePbZZ2ep0MzRYyv8DMyqhkNQPPTQQ83/ZuPHi98xhEcafJVBlArOV0du3brVPePChQszjTq/33vvvUjVXWNkMKMaTCO4605YSDV6eM4tlhBpCHf4WmH1j7rXbQOWTlF2msl/yqFdShNQjBLmzZsX62yyVc/GFwhxwiYKBAX61LiRkR9vll65jbog6j5GbWZt2O8CpghsTg4h5c/VCVE0VnerNvebxmdoXGjla7CqaQ5TioDCNHTnzp1OtRfOuPvvv795VTK+S/0sDT4Zj2CMG3H58abtOfijrrj7TL3XjwYORcP389hjjzlV6SeffFK4ai/8TSrUJ+TB6m7V1MhlquGrmuYwhQsoRjCvvvpq8PPPP0dmHOoaaKVeM5f6aXTIBoJkz549iSOuPILEt7DDy3N4VOirFBCmWQscYYoaExCeWdQTdYPv58EHH3S/P//888IsLH2ivkuFeoSsmGq+LFVXFemlNBcuoJh3WrNmTdsNSx5DAQQJetU49Z4VDKQVJNabB4Tr448/7n775FVH+vj35dmbKCtlqg/a4bnnnnOqh6iOgBBpoF6n1br0iqqrSDqR5jwd9SgKFVA27xQ3vMwy0uA8Ej7tdtw2elq/fn2scLSCgTSCBMFDb55RzebNm91cSNQ7t2sVCEuWLJkxCkA9imBMA+lmnyj+ZqGKVnx8P3iQkFGEaJe02/lbZ7CoBjUO6mee7e3LoKw0l7IVf6PBKQTs3lutVfHXQKWxk+carm0VL+e4ptV12PsTH+/AuyRh65YISavc/TS1en4r/HUErPRO2mIDOD8yMtIyLb2ArctqNw+FgDRrHa3dsGuoR1u2bIn9/qyu045kgfjwpNPqfTpBmWm2Okw606w9S0PbAoqEsfCUFyMhcY0q1+GAk+taXetjQsqcRfoZyW8TJK0cXnKdPZvGP9yoN0ZLbnEtC3ztQ+J30jvyPBN6BAp+cnKyeTYfPM/ckPAeu3fvnhUnz6TwebdWae4VrDHhmwiXixB5oF5YQxzXGbbGl2+Puk/7VOb3Z995NwVUmWlOO6DIQlsCyl4oHMIF4Dfi4ZCmUaKBpjFGSPn38j8+wJKESNKzw4H4HnnkkekPPvggMYP9jz8qFFFA7JTrC0sLbFUSFlq9jF9hiup1CQHWo4+rj349TvI8kxaeFycMoQoCqug0G368SXmQlcJUfEJkxf+ou1lpRT2x76vdzo8JOgLxxTXqvSCg0pI2zYalLc21WShtoa4QrdiwYYMz329U6kINL3744YfMRiOifmAA8Nprr7nfGFDlhW+z0QA7o61+cbmVNc2Wv+R3kfkjASW6ApZMZVjssZRg27ZtzpWLECxVYMkC31o71nNY6kK/rJWCtGm2ulzG0hAJKNFxbG3Z0hLcGLGUYHp6OrWPxbrB0oiRkZEZR8UETJsPHjzYt6NKOkCM0vnm8gopnJ+G1w2xXYi/PhAvOWHvOVzTq0SlOYzVZfK3lKUhFzV9QnSGMo0ibM4hjUlsHWHegHylWkeFoucHeg2z+PW380+DfbOtJv/rNAeVJs3kZ56t+LOgEZToGPTg165d6xZL7927t3B1ABtjMqfVL1sm+KDaZDNM29KlUbddGB0dDQYHB9015A3zfv1K1Hb+aWBUXvbW9lWjVZoZOXENI9KsW/FnQQJKdIwyjCJYvW4r9P19x/qN/fv3Oy8q4S1dVqxYERw5csR5OQEEVlovJXWECXw8lmT5/vC8gKoLDzV5vLaESeMZp9u0SjOdSwwiynYPJQElOoK5MYIoL/d5AxUIN1SMGoxObPhYJWg8/v3330g/kUAevfnmm+43Lrls8luko92t7aHM7e3LoIg0F8Ec9HzN30KUAmqAtNustAtmscePH5ej2RCMmu69917XQJY2oS1EwWgEJUrFrHw6RZbtWfoJfzvufhthit5FAkqUir8TcSfIso1/P2GeppmLyutxX4hOIwElSgVVklmUdSKcOHGia/ryKmMdhaTtaISoGhJQQtQcJuOPHTvmRk+rV69uHhWi+khACVFzWPODeT+WfBo9iV5CVnxC1BgW8C5evNip9mS5J3oNCSghaoz5gtu3b5/7K0QvIRWfEDWFxdHnzp0r3CGvEJ1CAkr0JEz8m4ujdrZRqCvkycmTJ4PDhw/LqlH0LBJQoqswR7Jw4cJM2xIgnNatWxfs2LFjlosjcRGEE6MmNpGTcBK9jASU6CpYlZ09ezbTHAmN7qFDh5xLI1wbif+D5w6E00cffRRrsYeAZ9dhIaqOBJQQNYGR0wsvvJAonNjQkC0U8CohRNWRgBJdgcbUPJJX3bNzL0B+4vPw66+/DubNmzeTt+EwMDAQXHHFFcGSJUuadwpRXSSgRFdgP57x8XGnolu+fLlT24W30I4KWKaJ2SCc8Baf1ueh5bcQVUcCSnQN25fIdu1kHopleUlBi00vBWEflVdxQXkoegUJKNE12BSNXTvL3pVTCNGbSECJroB5+djY2Cx1k1R8QggfCSjRFU6dOuUsyUy9B1LxCSF8JKBEVzh9+rRT72EOvX379ras+NiMTwhRPySgRFdg/mliYiI4cOBAsGnTpsxWZagDFy1a5CzXhoeHZaouRA2RN3MhhBCVRCMoIYQQlUQCSgghRCWRgBJCCFFJJKCEEEJUEgkoIYQQlUQCSgghRCWRgBJCCFFJJKCEEEJUEgkoIYQQlUQCSgghRCWRgBJCCFFJJKCEEEJUEgkoIYQQFSQI/ge3aChw2ENnlAAAAABJRU5ErkJggg==\" height=\"101\" width=\"424\"\u003e\u003c/p\u003e\n\u003cp\u003eWhere N is the total number of observations, y\u003csub\u003ei\u003c/sub\u003e indicates the percent disease severity data recorded at various times (t\u003csub\u003ei\u003c/sub\u003e), The average disease severity was calculated as the midpoint of two time points and multiplied by the duration of time between that two points, then calculated \u0026nbsp;the summation of those products during all time.\u003c/p\u003e\n\u003cp\u003edsRNA treated (T4) and infected untreated (T2) plant sample collection for RNA extraction was done on the same dates as disease severity data was recorded i.e.:- 3, 6, 9, 15 days after inoculation. Three leaf samples were collected from each treatment on each sampling day. Collected plant samples (0.1 g leaf part per one biological sample) were immediately placed in to liquid nitrogen and then stored at -80 \u0026deg;C until the RNA extraction.\u003c/p\u003e\n\u003ch3\u003eDCL2 gene expression study of\u003cem\u003e\u0026nbsp;P. oryzae\u003c/em\u003e in pot experiments\u003c/h3\u003e\n\u003cp\u003eTotal RNA extraction, quantification, synthesis of cDNA, and real-time polymerase chain reaction were done according to the following procedure. The frozen leaf tissue sample was used to extract total RNA using One step RNA reagent \u0026nbsp;following the manufacturer\u0026apos;s protocol. cDNA synthesis using total RNA extracted from \u003cem\u003eP.oryzae\u003c/em\u003e infected plant tissue was carried out according to the procedure.\u003c/p\u003e\n\u003cp\u003eBased on the literature, \u003cem\u003e\u0026beta;-\u003c/em\u003etubulin (MGG_00604) and actin\u0026nbsp;(MGG_03982)\u003cem\u003e\u0026nbsp;\u003c/em\u003ewere selected as reference genes in the RT-qPCR analysis because of the consistent expression level of those genes in rice (Kadotani \u003cem\u003eet al\u003c/em\u003e, 2004; Omar \u003cem\u003eet al\u003c/em\u003e 2016). The nucleotide sequences of those reference genes were obtained from NCBI database for primer design. Primers used in the real-time qPCR were QPYBT primer pair for \u003cem\u003e\u0026beta;-\u003c/em\u003etubulin, and QPYAC for actin(Table 1). \u0026nbsp;RT-qPCR primers for DCL2 gene were also designed based on the partial length of DCL2 cDNA sequence (NCBI accession number - MZ351764) i.e.: QDCL2-2 primer pair (Table 1). \u0026nbsp;The primer design was done using Primer 3 Input software (version 0.4.0) (Rozen and Skaletsky, 2000; www.bioinfopop.ufv.br/sistema/primer3): (Thornton, and Basu, 2011). Minimum Information for Publication of Quantitative Real-Time Experiments (MIQE) guideline was followed while designing RT-qPCR primers (Bustin \u003cem\u003eet al\u003c/em\u003e, 2009).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eReal-time PCR analysis was performed using Bio-Rad CFX96 quantification thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA), 0.1 ml PCR 8-strip tubes (Wuxi NEST Biotechnology Co., Ltd., China) and Maxima SYBR Green qPCR Master Mix (2X) (Thermo Fisher Scientific, USA). \u003cem\u003e\u0026beta;-\u003c/em\u003etubulin and actin were used as reference genes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIn vitro\u003c/em\u003e experiments were conducted in Completely Randomized Design (CRD) with three replicates and five leaves per replicate. SAS 9.2 (SAS Institute Inc., Cary, NC, USA) was used to conduct statistical analysis. \u0026ldquo;Analysis of variance\u0026rdquo; (ANOVA) was done to find out significant differences between treatments. Mean separation was done using the General linear model (GLM) and Duncans\u0026rsquo; multiple range test. \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe pot experiment was conducted in a Randomized Complete Block Design (RCBD) with four plants per pot and five pots per treatment in each replicate. To calculate AUDPC, disease severity data was recorded according to the IRRI scale for rice blast. SAS 9.2 (SAS Institute Inc., Cary, NC, USA) was used to conduct statistical analysis \u0026ldquo;Analysis of variance\u0026rdquo; (ANOVA) to determine the differences among treatments. Mean comparison was done using Duncans\u0026rsquo; multiple range test with the General Linear Model (GLM).\u003c/p\u003e"},{"header":"Results","content":"\u003ch3\u003eSynthesis of double-stranded RNA\u003c/h3\u003e\n\u003cp\u003eA fragment of 863 bp long dsRNA was synthesized (Fig. 01) using PCR amplicons (949 bp) as the template that amplified with PDCL2-F and PDCL2-R primer pair.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEvaluation on the effect of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ePyDCL2-dsRNA against the mycelial growth of \u003cem\u003eP. oryzae\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003eusing slide culture method\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDifferences in the morphology of fungal hyphae were observed on slide\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003ecultures of \u003cem\u003eP. oryzae\u003c/em\u003e treated with different PyDCL2-dsRNA concentrations under a light microscope. Compared to the untreated control, 1.5 ng/\u0026micro;l had more branching in fungal filaments. PyDCL2-dsRNA concentrations of 0.1, 0.5, 1.0 ng/\u0026micro;l did not affect fungal filament branching pattern under these experimental conditions. However, 10 ng/\u0026micro;l concentrations of PyDCL2-dsRNA treatments \u0026nbsp;affected fungal mycelial growth. \u0026nbsp;Intense mycelial branching and unusual vesicles formation were observed in mycelia treated with 10 ng/\u0026micro;l PyDCL2-dsRNA (Figure 02). These two phenomena were observed in all three slides under that concentration of PyDCL2-dsRNA.\u003c/p\u003e\n\u003ch3\u003eEvaluation of the effect of PyDCL2-dsRNA against \u003cem\u003eP. oryzae\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003eusing \u003cem\u003ei\u003c/em\u003e\u003cem\u003en vitro\u003c/em\u003e detached leaf assay\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/h3\u003e\n\u003cp\u003eAccording to the disease symptoms in detached leaves \u0026nbsp;and percent of disease severity (Fig. 3), the treatment 10 ng/\u0026micro;l PyDCL2-dsRNA spray showed the highest disease suppression (13% disease severity) under \u003cem\u003ein vitro\u003c/em\u003e conditions. However, all dsRNA concentrations tested except 10 ng/\u0026micro;l did not show good disease suppression (Supplement 03).\u0026nbsp;\u003c/p\u003e\n\u003ch3\u003eEvaluation of preventive/curative action of PyDCL2-dsRNA by detached leaf assay\u0026nbsp;\u003c/h3\u003e\n\u003cp\u003e\u003cem\u003eIn vitro\u003c/em\u003e detached leaf assay for the evaluation of preventive and curative activity of PyDCL2-dsRNA against rice blast fungus (Fig. 4) \u0026nbsp;found that the curative method of application has less disease severity (56.7%) compared to the preventive method (70.17%). Both preventive and curative methods were more effective than untreated-inoculated treatment (88.17%).\u003c/p\u003e\n\u003ch3\u003eEvaluation on the effect of PyDCL2-dsRNA against conidial germination\u0026nbsp;\u003c/h3\u003e\n\u003cp\u003e\u003cem\u003eP. oryzae\u003c/em\u003e spore germination was reduced in the presence of 10 ng/\u0026micro;l PyDCL2-dsRNA treatment and the germination percentage was 59.1% (\u0026plusmn;1.97), while spores in water (control) were able to germinate successfully after six hours with a 96.9% (\u0026plusmn;0.38) germination percentage. It showed that 10 ng/\u0026micro;l PyDCL2-dsRNA could reduce \u003cem\u003eP. oryzae\u003c/em\u003e spore germination.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eIn planta\u003c/em\u003e\u003c/strong\u003e \u003cstrong\u003eevaluation of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ePyDCL2-dsRNA on rice plants\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRice blast disease severity in the pot experiment after six days of\u0026nbsp;PyDCL2-dsRNA\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003espray\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eapplications, the AUDPC value of unsprayed inoculated plants (T1) was the highest (230.44), and fungicide spray treatment (T3) had the lowest AUDPC value (131.29). The AUDPC value of PyDCL2-dsRNA spray treatment (T4) (148.69) was higher than T3 and lower than T1 (Table 01). The Disease Reduction (DR, %) value of T3 (42.75%) was higher than T4 (35.11%). Disease Progression Rate (DPR) was highest in T1 (8.02), followed by T4 (4.93). The lowest DPR value was in T3 (3.86) (Table 02).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The AUDPC value of T2 plants was the highest (681.51) after 15 days of treatment application and the lowest AUDPC value was inT3 (370.81). The AUDPC value of T4 plants (496.2) was higher than T3 and lower than T2 (Table 02). The Disease Reduction (DR, %) value of T4 (24.77%) was lower than T3 (46.44%). The lowest Disease Progression Rate (DPR) value was in T3 (1.92) and the highest was in T2 (3.70), followed by T4 (2.82) (Table 03).\u0026nbsp;\u003c/p\u003e\n\u003ch3\u003eDCL2 Gene expression study of\u003cem\u003e\u0026nbsp;P. oryzae\u003c/em\u003e in pot experiments\u0026nbsp;\u003c/h3\u003e\n\u003cp\u003eThere was a significant difference in gene expression of DCL2 gene of \u003cem\u003eP. oryzae\u003c/em\u003e between different days after PyDCL2-dsRNA spray treatments in the pot experiment.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRelative gene expression level of DCL2 gene in \u003cem\u003eP. oryzae\u0026nbsp;\u003c/em\u003eat 01 day after dsRNA treatment was down-regulated 0.4 fold-change. Three days after application, relative gene expression level of DCL2 gene was drastically down-regulated to 0.6 fold-change. However, this value was up-regulated at 06 days after dsRNA application and returned to the baseline. At 15 days after application, DCL2 expression was up-regulated to 3 fold-change (Fig. 5). There was no significant difference in DCL2 transcript abundance between day 1 and day 3. Up-regulation of the DCL2 gene on day 15 was significant compared to DCL2 gene expression on other days.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe application of a 10 ng/\u0026micro;l concentration of PyDCL2-dsRNA caused malformations (unusual vesicles formation and intense mycelial branching) in \u003cem\u003eP. oryzae\u003c/em\u003e fungal mycelia. The abnormal fungal mycelial branching first appeared at 1.5 ng/\u0026micro;l dsRNA concentrations while the unusual vesicles formation and intense mycelial branching were observed with increased dsRNA concentration at 10 ng/\u0026micro;l. The malformation in fungal mycelia is an indicator of inhibition of mycelial growth (Chakraborty et al, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn the detached leaf method, curative application of 10 ng/\u0026micro;l PyDCL2-dsRNA has better disease suppression compared to preventive application. However, this level of dsRNA concentration is higher level compared to some other \u003cem\u003ein vitro\u003c/em\u003e experiments, dsRNA application to \u003cem\u003eS. sclerotiorum\u003c/em\u003e for silencing several genes (SS1G_01703, SS1G_05899, SS1G_06487 and GFP) i.e. 100\u0026ndash;1000 ng/mL dsRNA application (Mcloughlin et al, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). High dsRNA concentrations i.e. 20 ng/\u0026micro;l, were effective in some other experiments like \u003cem\u003eF. graminearum\u003c/em\u003e that targeted the pathogen\u0026rsquo;s AGO and DCL genes (Werner et al, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). So it is confirmed that effective dsRNA concentrations in SIGS application vary according to the target organisms and target genes. Some of the target organisms are able to uptake dsRNA molecules effectively, while some other organisms are up taking dsRNA molecules slowly or very weakly (Qiao et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Even though the target pathogen was the same, the target gene was different (Pathogenicity Gene MoDES1) in the SIGS experiment against rice blast disease that gave different efficacy on gene suppression. In addition, the rate of aplication for (\u003cem\u003eDES1\u003c/em\u003e)-dsRNA spray (20 \u0026micro;l drops of 300 nM on rice leaf) used by Sarkar and Roy (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) was different from this study. Since conidial germination of \u003cem\u003eP. oryzae\u003c/em\u003e under 10 ng/\u0026micro;l PyDCL2-dsRNA was reduced to 59.1% in microscopic slide compared to the control, DCL2-dsRNA application could be used to stop disease spreading of a sporulating pathogen.\u003c/p\u003e \u003cp\u003eWhen comparing the disease reduction values of the two treatments of PyDCL2-dsRNA spray (35.11%) and fungicide spray (42.75%) at 6 DAA, both treatments were able to reduce disease severity, but disease reduction due to dsRNA spray was significantly lower compared to fungicide spray (using t-test analysis). Therefore, the application of naked PyDCL2-dsRNA molecule at 10 ng/\u0026micro;l concentration was able to control fungal pathogen up to some extent, but it was less effective compared to fungicide for managing rice blast disease six days after application. The DR% value of the PyDCL2-dsRNA spray treatment declined from 35.11% (day six) to 24.77% after 15 days of application. However, the DR% of the fungicide spray treatment (46.44%) stayed at the same level as day six (42.75%). Consequently, this study showed that the fungicide spray against rice blast disease was effective up to 15 days after application, whereas dsRNA spray application was only effective for six days and lost efficacy at 15 days after application. Application of dsRNA spray to control powdery mildew disease of rubber tree (caused by \u003cem\u003eErysiphe quercicola\u003c/em\u003e fungus) was tested \u003cem\u003ein planta\u003c/em\u003e under a growth chamber (at 25 \u003csup\u003e◦\u003c/sup\u003eC and a 12 hours day length for 24 hours), β-tubulin (Tub), Sterol 14α-demethylases (CYP51) and chitin synthase (Chs) were the targeted genes and dsRNA concentration of 20 \u0026micro;g/ml was sprayed onto leaf surface. Ten days after dsRNA application, the reduction in disease severity of powdery mildew disease was up to 50% compared to water-treated leaves (Cao et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). This result showed better performance of a dsRNA molecule, comparing to this study (day 06). However, a higher dsRNA concentration (20 \u0026micro;g/ml) was used and evaluated under artificial environmental condition (growth chamber).\u003c/p\u003e \u003cp\u003eIn the gene expression study, \u003cem\u003eP. oryzae\u003c/em\u003e inoculated rice plants with 10 ng/\u0026micro;l PyDCL2-dsRNA spray application (T4 treatment), DCL2 gene of \u003cem\u003eP. oryzae\u003c/em\u003e was up-regulated 3-fold at 15 days after dsRNA treatment, which also had an influence on RNA silencing (down regulation of DCL gene of \u003cem\u003eP. oryzae\u003c/em\u003e ) for up to 3 days. The gene expression study findings also showed differences in the severity of rice blast disease in plants sprayed with PyDCL2-dsRNA from Day 6 to Day15. The highest dsRNA-mediated gene silencing effect was detected three days after PyDCL2-dsRNA spray. From Day 1 to Day 3, there was a drop in relative transcript abundance of PyDCL2 indicating that the effect of PyDCL2-dsRNA spray treatment increased from Day 1 to Day 3 but decreased at Day 6. After Day 6, the DCL2 transcript of \u003cem\u003eP. oryzae\u003c/em\u003e could not be silenced by PyDCL2-dsRNA molecule in the semi-outdoor conditions of RH 85\u0026ndash;95%, mean temperature 28\u0026deg;C, and 12 hours of light and 12 hours of darkness. The instability of the naked dsRNA molecule under UV radiation and RNase enzymes may affect the effectiveness of dsRNA application. Naked dsRNA molecules have a short lifetime under UV light, i.e. dsRNA breakdown in laboratory conditions began 30 minutes after exposure to direct UV radiation (1500 Wcm2 of 254 nm) (Miguel and Scott, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In PCR tubes, the half-life of a naked dsRNA solution in outdoor circumstances ranged from 40 to 45 days (Li et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In tropical countries such as Malaysia, high temperatures and high intensity of sunlight could degrade the dsRNA molecules faster than the findings in temperate countries such as China (Li et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In addition, the concentration of the applied PyDCL2-dsRNA molecules may not be sufficient to suppress \u003cem\u003eP. oryzae\u003c/em\u003e after Day 6 may explain the reason for the lower DR% value at Day 15. A more concentrated application may be necessary for outdoor conditions over a long period, such as 15 days. On the other hand, dsRNA spray applications that are repeated throughout the crop season could perform better to reduce the disease in rice plants warrantying research on spraying intervals.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003eThe authors declare that they have no conflict of interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgment-\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to pay our acknowledgement to technical staff of Department of Plant Protection, Faculty of Agriculture, UPM, and technical staff of \u0026nbsp;ITAFOS, UPM who supported us during our laboratory experiments \u0026nbsp;and RT-qPCR experiments \u0026nbsp;related to this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSri Lanka council for agricultural research policy provided a PhD scholarship to Kalupahana Pushpanjie. A Fundamental Research Grant Scheme (FRGS), Project Code 01-01-19-2183FR, Ministry of Higher Education Malaysia provided partial financial support for research materials.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eBustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M. W., Shipley, G. L., Vandesompele, J. and Wittwer, C. T. (2009). The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. \u003cem\u003eClinical Chemistry\u003c/em\u003e, 55(4):\u0026nbsp;611-622.\u0026nbsp;https://doi: 10.1373/clinchem.2008.112797.\u003c/li\u003e\n \u003cli\u003eCao, X., Han, Q., and \u0026nbsp;West, J. S. (2023). Spray-induced gene silencing as a potential tool to control rubber tree powdery mildew disease. \u003cem\u003ePhysiological and Molecular Plant Pathology\u003c/em\u003e, 129: https://doi.org/10.1016/j.pmpp.2023.102182\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eChakraborty, M., Mahmud, \u0026nbsp;N. U., Gupta, D. R., Tareq, F. S., Shin, H. J. and Islam, T. (2020). Inhibitory effects of linear lipopeptides from a marine \u003cem\u003eBacillus\u003c/em\u003e \u003cem\u003esubtilis\u003c/em\u003e on the wheat blast fungus \u003cem\u003eMagnaporthe oryzae\u003c/em\u003e Triticum. \u003cem\u003eFrontiers in\u003c/em\u003e \u003cem\u003eMicrobiology\u003c/em\u003e, 11(665). https://doi.org/10.3389/fmicb.2020.00665.\u003c/li\u003e\n \u003cli\u003eChida, T. and Sisler, H. D. (1987). Restoration of appressorial penetration ability by melanin precursors in \u003cem\u003ePyricularia oryzae\u003c/em\u003e treated with antipenetrants and in melanin-deficient mutants. \u003cem\u003eJournal of Pesticide Science\u003c/em\u003e, 12: 49\u0026ndash;55.\u0026nbsp;https://doi.org/10.1584/jpestics.12.49.\u003c/li\u003e\n \u003cli\u003eCoca, M., Bortolotti, C. and Rufat, M. (2004). Transgenic rice plants expressing the antifungal AFP protein from \u003cem\u003eAspergillus giganteus\u003c/em\u003e show enhanced resistance to the rice blast fungus \u003cem\u003eMagnaporthe grisea\u003c/em\u003e. \u003cem\u003ePlant Molecular Biology,\u003c/em\u003e 54: 245\u0026ndash;259.\u0026nbsp;doi: 10.1023/B:PLAN.0000028791.34706.80.\u003c/li\u003e\n \u003cli\u003eDevanna, B. N., Jain, P., Solanke, A. U., Das, A., Thakur, S., Singh, P. K., Kumari, M., Dubey, H., Jaswal, R. and Pawar, D. (2022). Understanding the dynamics of blast resistance in rice-\u003cem\u003eMagnaporthe oryzae\u003c/em\u003e interactions. \u003cem\u003eJournal of \u0026nbsp;Fungi\u003c/em\u003e, \u0026nbsp; 8(584). https://doi.org/10.3390/jof8060584.\u003c/li\u003e\n \u003cli\u003eFletcher, S. J., Reeves, P. T., Hoang, B. T. and Mitter, N. (2020). A perspective on RNAi-based biopesticides. \u003cem\u003eFrontiers in Plant Science\u003c/em\u003e, 11(51).\u0026nbsp;https://doi.org/10.3389/fpls.2020.00051.\u003c/li\u003e\n \u003cli\u003eGilbert, M. J., Soanes, D. M., and Talbot, N. J. (2004). Functional genomic analysis of the rice blast fungus \u003cem\u003eMagnaporthe grisea\u003c/em\u003e. \u003cem\u003eApplied Mycology and Biotechnology, 4\u003c/em\u003e, 331-352.\u0026nbsp;https://doi.org/10.1016/S1874-5334(04)80017-0.\u003c/li\u003e\n \u003cli\u003eHaile, Z. M., Gebremichael, D. E., Capriotti, L., Molesini, B., Negrini, F., Collina, M., Sabbadini, S., Mezzetti, B. and Baraldi, E. (2021). Double-stranded RNA targeting dicer-like genes compromises the pathogenicity of \u003cem\u003ePlasmopara viticola\u003c/em\u003e on grapevine.\u0026nbsp;\u003cem\u003eFrontiers in Plant Science\u003c/em\u003e\u003cem\u003e,\u0026nbsp;\u003c/em\u003e135(57390).\u0026nbsp;https://doi.org/10.3389/fpls.2021.667539.\u003c/li\u003e\n \u003cli\u003ehttp://www.flyrnai.org (Cited on 09.02.2021)\u0026nbsp;\u003c/li\u003e\n \u003cli\u003ehttp://www.knowledgebank.irri.org (Cited on 05 .08.2019)\u003c/li\u003e\n \u003cli\u003ehttps://www.who.int/news-room/fact-sheets/detail/pesticide-residues-in-food\u0026nbsp;(Cited on 07 .08.2019)\u003c/li\u003e\n \u003cli\u003eKadotani, N.,\u0026nbsp;Nakayashiki, H.\u0026nbsp;H., Tosa, Y. and Mayama, S. (2004). One of the two dicer-like proteins in the filamentous fungi \u003cem\u003eMagnaporthe oryzae\u003c/em\u003e genome is responsible for hairpin RNA-triggered RNA silencing and related small interfering RNA accumulation. \u003cem\u003eThe Journal of Biological Chemistry\u003c/em\u003e;279(43):44467-74. . https://doi: 10.1074/jbc.M408259200.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eKanzaki, H., Nirasawa, S., Saitoh, H., Ito, M., Nishihara, M., Terauchi, R. and Nakamura, I. (2002). Over expression of the wasabi defensin gene confers enhanced resistance to blast fungus (\u003cem\u003eMagnaporthe grisea\u003c/em\u003e) in transgenic rice.\u003cem\u003eTheoretical and Applied Genetics\u003c/em\u003e, 105(6 and 7): 809-814.\u0026nbsp;https://doi: 10.1007/s00122-001-0817-9\u003c/li\u003e\n \u003cli\u003eKuo, Y. and Falk, B. W. (2020).\u0026nbsp;RNA interference approaches for plant disease control. \u003cem\u003eBioTechniques\u003c/em\u003e, 69: 469\u0026ndash;477.\u0026nbsp;https://doi: 10.2144/btn-2020-0098.\u003c/li\u003e\n \u003cli\u003eLi, H., Guan, R., Guo, H. and Miao, X. (2015). New insights into an RNAi approach for plant defence against piercing-sucking and stem-borer insect pests. \u003cem\u003ePlant Cell and Environment\u003c/em\u003e,38: 227-2285.\u0026nbsp;https://doi: 10.1111/pce.12546.\u003c/li\u003e\n \u003cli\u003eMadden, L. V., Hughes, G. and Van den Bosch, F. (2007). The study of plant disease epidemics (145-171). St. Paul: American Phytopathological Society.\u0026nbsp;https://doi.org/10.1094/9780890545058.\u003c/li\u003e\n \u003cli\u003eMcloughlin, A. G., Wytinck, N., Walker, P. L., Girard, I. J., Rashid, K. Y., Kievit, T. D., Fernando, W. G. D., Whyard, S. and Belmonte, M. F. (2018). Identification and application of exogenous dsRNA confers plant protection against \u003cem\u003eSclerotinia \u0026nbsp;sclerotiorum\u003c/em\u003e and \u003cem\u003eBotrytis cinerea\u003c/em\u003e. \u003cem\u003eScientific Reports\u003c/em\u003e,\u0026nbsp;8(7320).\u0026nbsp;https://doi: 10.1038/s41598-018-25434-4.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eMiguel, K. S. and Scott, J. G. ( 2016). The next generation of insecticides: dsRNA is stable as a foliar-applied insecticide. \u003cem\u003ePest Managment Science\u003c/em\u003e, 72(4): 801\u0026ndash;809.\u0026nbsp;https://doi: 10.1002/ps.4056.\u003c/li\u003e\n \u003cli\u003eNerva, L., Sandrini, M., Gambino, G. \u0026nbsp;and Chitarra, W. (2020). Double-stranded RNAs (dsRNAs) as a sustainable tool against gray mold (\u003cem\u003eBotrytis\u003c/em\u003e \u003cem\u003ecinerea\u003c/em\u003e) in Grapevine: Effectiveness of different application methods in an open-air environment. \u003cem\u003eBiomolecules\u003c/em\u003e,10(200).\u0026nbsp;\u0026nbsp;https://doi.org/10.3390/biom10020200.\u003c/li\u003e\n \u003cli\u003eOmar, S. C., Benthly, M. A, Morieri, G., Preston, G. M. and Gurr, S. J. (2016).Validation of reference genes for robust qRT-PCR gene expression analysis in the rice blast fungus \u003cem\u003eMagnaporthe oryzae. PLOS one,\u003c/em\u003e 11(8), 0160637.\u0026nbsp;https://doi: 10.1371/journal.pone.0160637.\u003c/li\u003e\n \u003cli\u003eQiao, L., Lan, C., Capriotti, L., Ah-Fong, A., Sanchez, J. N., Hamby, R., Heller, J., Zhao, H., Glass, N. L., Judelson, H. S., Mezzetti, B., Niu, D. and Jin, H. (2021). Spray-induced gene silencing for disease control is dependent on the efficiency of pathogen RNA uptake. \u003cem\u003ePlant Biotechnology Journal\u003c/em\u003e, 19: 1756\u0026ndash;1768.\u0026nbsp;https://doi: 10.1111/pbi.13589.\u003c/li\u003e\n \u003cli\u003eRaman, V., Simon, S. A., Demirci, F., Nakano, M., Mayers, B. C. and Donfrio, N. M. (2017). Small RNA functions are required for growth and development of \u003cem\u003eMagnaporthae oryzae\u003c/em\u003e. \u003cem\u003eMolecular Plant-Microb\u003c/em\u003e. https://doi.org/10.1094/MPMI-11-16-0236-R.\u003c/li\u003e\n \u003cli\u003eRouthu, G., Borah, M., Nath,\u0026nbsp;P. D. and Deb, B. (2020).\u0026nbsp;RNA interference (RNAi) and response of plant cells to double stranded RNA (dsRNA).\u003cem\u003e\u0026nbsp;International Journal of Current Microbiology and Applied Sciences,\u0026nbsp;\u003c/em\u003e9(9): 3114-3125.\u0026nbsp;https://doi: 10.20546/ijcmas.2020.909.384.\u003c/li\u003e\n \u003cli\u003eRozen, S. and Skaletsky, H. (2000). Primer3 on the WWW for general users and for biologist programmers. \u003cem\u003eMethods in Molecular Biology\u003c/em\u003e, 132: 365-386. \u0026nbsp;https://doi: 10.1385/1-59259-192-2:365.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eSarkar, A. and Roy, B. S. (2021). Spray-induced silencing of pathogenicity gene MoDES1 via exogenous double-stranded rna can confer partial resistance against fungal blast in rice.\u0026nbsp;\u003cem\u003eFrontiers in Plant Science\u003c/em\u003e, 12(733129).\u0026nbsp;https://doi.org/10.3389/fpls.2021.733129.\u003c/li\u003e\n \u003cli\u003eSherman, J. H., Munyikwa, T., Chan, S. Y., Petrick, J. S., Witwer, K. W. and Choudhuri, S. (2015). RNAi technologies in agricultural biotechnology: The toxicology forum 40th annual summer meeting. \u003cem\u003eRegulatory Toxicology and Pharmacology, \u0026nbsp;\u003c/em\u003e73(671): 680.\u0026nbsp;\u0026nbsp;https://doi: 10.1016/j.yrtph.2015.09.001.\u003c/li\u003e\n \u003cli\u003eThornton, B. and Basu, C. (2011). Real-Time PCR (qPCR) primer design using free online software. \u003cem\u003eBiochemistry And Molecular Biology Education\u003c/em\u003e, 39(2): 145\u0026ndash;154.\u0026nbsp;https://doi: 10.1002/bmb.20461.\u003c/li\u003e\n \u003cli\u003eVoloudakis, A. E., Holeva, M. C., Sarin, L. P., Bamford, C. Vargas, M., Poranen, M. M. and Francisco, T. F. (2015). Efficient double-stranded RNA production methods for utilization in plant virus control. \u003cem\u003eMethods in Molecular Biology: Plant Virology Protocols\u003c/em\u003e(255\u0026ndash;274 pp). New York: Humana Press.\u0026nbsp;https://doi: 10.1007/978-1-4939-1743-3_19.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eWang, M., Weiberg, A., Lin, F. M., Thomma, B. P. H. J., Huang, H. D. and Jin, H. (2016). Bidirectional cross-kingdom RNAi and fungal- uptake of external RNAs confer plant protection. \u003cem\u003eNature Plants,\u0026nbsp;\u003c/em\u003e9(2): 16151.\u0026nbsp;https://doi: 10.1038/nplants.2016.151.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eWerner, B. T., Gaffar, F. Y., Schuemann, J., Biedenkopf, D. and Wang, A. M. K. (2020). RNA-spray-mediated silencing of \u003cem\u003eFusarium graminearum\u003c/em\u003e AGO and DCL genes improve barley disease resistance. \u003cem\u003eFrontiers in Plant Science\u003c/em\u003e, 29. https://doi.org/10.3389/fpls.2020.00476.\u003c/li\u003e\n \u003cli\u003eYin, C., Zhu, H., Jiang, Y., Shan, Y. and Gong, L. (2020). silencing dicer-like genes reduces virulence and sRNA generation in \u003cem\u003ePenicillium italicum\u003c/em\u003e, the cause of citrus blue mold. \u003cem\u003eCells\u003c/em\u003e, 9(2): 363. https://doi: 10.3390/cells9020363.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 01:\u003c/strong\u003e \u003cstrong\u003eForward and reverse primer pairs designed for qPCR analysis.\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"559\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.059033989266547%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cu\u003ePrimer pair\u003c/u\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.46690518783542%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cu\u003ePosition in cDNA\u003c/u\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.586762075134168%\" valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"11.806797853309481%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cu\u003eLength of PCR-product (bp)\u003c/u\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.64042933810376%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cu\u003eSequence of primer\u0026nbsp;\u003c/u\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.440071556350627%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cu\u003eTa\u0026nbsp;\u003c/u\u003e/ C\u0026deg;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.059033989266547%\" valign=\"top\"\u003e\n \u003cp\u003eQDCL\u003c/p\u003e\n \u003cp\u003e2-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.46690518783542%\" valign=\"top\"\u003e\n \u003cp\u003eForward primer \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003cp\u003eReverse primer \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.586762075134168%\" valign=\"top\"\u003e\n \u003cp\u003e1932\u003c/p\u003e\n \u003cp\u003e2084\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.806797853309481%\" valign=\"top\"\u003e\n \u003cp\u003e153\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.64042933810376%\" valign=\"top\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"397\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" valign=\"top\"\u003e\n \u003cp\u003eCGCTGCACTCAAGGACGACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" valign=\"top\"\u003e\n \u003cp\u003eCGCCAACAAACGCCGTAGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.440071556350627%\" valign=\"top\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.059033989266547%\" valign=\"top\"\u003e\n \u003cp\u003eQPYBT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.46690518783542%\" valign=\"top\"\u003e\n \u003cp\u003eLeft primer\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eRight primer \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.586762075134168%\" valign=\"top\"\u003e\n \u003cp\u003e1035\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e1196\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.806797853309481%\" valign=\"top\"\u003e\n \u003cp\u003e162\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.64042933810376%\" valign=\"top\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"397\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\"\u003e\n \u003cp\u003eCCGAGCGCGGTTACACCTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" valign=\"bottom\"\u003e\n \u003cp\u003eTCCGTCGGGAAGCTCGTAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.440071556350627%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.059033989266547%\" valign=\"top\"\u003e\n \u003cp\u003eQPYAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.46690518783542%\" valign=\"top\"\u003e\n \u003cp\u003eLeft primer \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003cp\u003eRight primer \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.586762075134168%\" valign=\"top\"\u003e\n \u003cp\u003e789\u003c/p\u003e\n \u003cp\u003e943\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.806797853309481%\" valign=\"top\"\u003e\n \u003cp\u003e155\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.64042933810376%\" valign=\"top\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"397\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" valign=\"bottom\"\u003e\n \u003cp\u003eCCACTCTTTCCGCGCTGTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" valign=\"bottom\"\u003e\n \u003cp\u003eTTGCGCATCTGGTCCTCGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.440071556350627%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 02: The effect of dsRNA spraying application on rice blast disease development on rice plant seedling after 6 days\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"94%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.19191919191919%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTreatment\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.323232323232325%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAUDPC (Units)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.232323232323232%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e%DR\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.252525252525253%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eDPR(Unit/day)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.19191919191919%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eT1\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.323232323232325%\" valign=\"top\"\u003e\n \u003cp\u003e0(\u0026plusmn;0)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.232323232323232%\" valign=\"top\"\u003e\n \u003cp\u003enr\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.252525252525253%\" valign=\"top\"\u003e\n \u003cp\u003e0\u0026nbsp;(\u0026plusmn;0)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.19191919191919%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eT2\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.323232323232325%\" valign=\"bottom\"\u003e\n \u003cp\u003e230.44(\u0026plusmn;7.77)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.232323232323232%\" valign=\"top\"\u003e\n \u003cp\u003enr\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.252525252525253%\" valign=\"top\"\u003e\n \u003cp\u003e8.02 (\u0026plusmn;0.41)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.19191919191919%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eT3\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.323232323232325%\" valign=\"bottom\"\u003e\n \u003cp\u003e131.29(\u0026plusmn;5.27)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.232323232323232%\" valign=\"bottom\"\u003e\n \u003cp\u003e42.75(\u0026plusmn;4.09)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.252525252525253%\" valign=\"bottom\"\u003e\n \u003cp\u003e3.86(\u0026plusmn;0.16)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.19191919191919%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eT4\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.323232323232325%\" valign=\"bottom\"\u003e\n \u003cp\u003e148.69(\u0026plusmn;10.03)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.232323232323232%\" valign=\"bottom\"\u003e\n \u003cp\u003e35.11(\u0026plusmn;6.34)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.252525252525253%\" valign=\"bottom\"\u003e\n \u003cp\u003e4.93(\u0026plusmn;0.15)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eT1 = Healthy plant (Healthy Control), T2 = Pathogen inoculated (Infected Control) T3 = Pathogen inoculated + Fungicide spray, and T4 = Pathogen inoculated + PyDCL2-dsRNA spray. AUDPC: Area Under the Disease Progressive Curve, % DR: Disease reduction and DPR: Disease progress rate, nr-not relevant).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 03: The effect of spraying application on rice blast disease development on rice plant seedling after 15 days\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"93%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.21212121212121%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTreatment\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.282828282828284%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAUDPC (Units)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.252525252525253%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e%DR\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.252525252525253%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eDPR(Unit/day)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.21212121212121%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eT1\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.282828282828284%\" valign=\"top\"\u003e\n \u003cp\u003e0\u0026nbsp;(\u0026plusmn;0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.252525252525253%\" valign=\"top\"\u003e\n \u003cp\u003enr\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.252525252525253%\" valign=\"top\"\u003e\n \u003cp\u003e0\u0026nbsp;(\u0026plusmn;0)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.21212121212121%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eT2\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.282828282828284%\" valign=\"bottom\"\u003e\n \u003cp\u003e681.51(\u0026plusmn;25.91)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.252525252525253%\" valign=\"top\"\u003e\n \u003cp\u003enr\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.252525252525253%\" valign=\"bottom\"\u003e\n \u003cp\u003e3.70(\u0026plusmn;0.11)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.21212121212121%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eT3\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.282828282828284%\" valign=\"bottom\"\u003e\n \u003cp\u003e370.81(\u0026plusmn;21.37)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.252525252525253%\" valign=\"bottom\"\u003e\n \u003cp\u003e46.44(\u0026plusmn;3.88)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.252525252525253%\" valign=\"bottom\"\u003e\n \u003cp\u003e1.92(\u0026plusmn;0.25)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.21212121212121%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eT4\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.282828282828284%\" valign=\"bottom\"\u003e\n \u003cp\u003e496.2(\u0026plusmn;10.17)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.252525252525253%\" valign=\"bottom\"\u003e\n \u003cp\u003e24.77(\u0026plusmn;0.48)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.252525252525253%\" valign=\"bottom\"\u003e\n \u003cp\u003e2.82(\u0026plusmn;0.07)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eT1 = Healthy plant (Healthy Control), T2 = Pathogen inoculated (Infected Control) T3 = Pathogen inoculated + Fungicide spray and, T4 = Pathogen inoculated + PyDCL2-dsRNA spray. AUDPC: area under the curve, % DR: Disease reduction and, DPR: Disease progress rate, nr-not relevant).\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"dsRNA spray, Fungal pathogen, Gene silencing, Rice blast disease control, RNAi","lastPublishedDoi":"10.21203/rs.3.rs-4757955/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4757955/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRice blast is a devastating disease, caused by the fungal pathogen, \u003cem\u003ePyricularia oryzae\u003c/em\u003e. RNA interference (RNAi) is a novel crop protection method that could control rice blast disease. In this study, dsRNA (PyDCL2\u0026ndash;863 bp) was synthesized for silencing of DCL2 transcript of \u003cem\u003eP. oryzae\u003c/em\u003e and its efficacy was evaluated. Using slide culture method, \u003cem\u003eP. oryzae\u003c/em\u003e mycelial growth was evaluated under different concentrations of PyDCL2-dsRNA molecules i.e. from 0.1 to 10 ng/\u0026micro;l. After 24 hours of incubation, microscopic observations showed abnormal growth with high hyphae branching and vesicle formation in \u003cem\u003eP. oryzae\u003c/em\u003e of 10 ng/\u0026micro;l dsRNA-treated slide culture. Disease severity caused by \u003cem\u003eP. oryzae\u003c/em\u003e on rice leaves was compared using the detached leaf method with different PyDCL2-dsRNA concentrations, i.e. from 0.1 to 10 ng/\u0026micro;l. It was found that a 10 ng/\u0026micro;l concentration of dsRNA molecules reduced rice blast disease severity by up to 13%. Under glasshouse conditions, PyDCL2-dsRNA was sprayed at 10 ng/\u0026micro;l concentration on rice plants at three-week-old seedlings and disease reduction of rice blast disease was 35.11% six days after dsRNA application compared to unsprayed control. In glasshouse trial, the dsRNA solution with 10 ng/\u0026micro;l concentration was able to perform gene silencing on DCL2 in \u003cem\u003eP. oryzae\u003c/em\u003e until 3 days after application. These findings showed a potential for PyDCL2-dsRNA to be developed as a new biofungicide using RNAi-mediated approach for a sustainable disease management of rice blast.\u003c/p\u003e","manuscriptTitle":"Spray-Induced Gene Silencing against Rice Blast Disease Targeting Dicer-like Protein 2 (DCL2) of Pyricularia oryzae","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-26 09:14:36","doi":"10.21203/rs.3.rs-4757955/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4335386a-d8c9-4b42-b634-0aa68e5c88bb","owner":[],"postedDate":"August 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-11-26T01:50:23+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-26 09:14:36","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4757955","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4757955","identity":"rs-4757955","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}