Generation and characterization of humanization CD4 knock-in mice expressing chimeric mouse/human CD4 protein

Generation and characterization of humanization CD4 knock-in mice expressing chimeric mouse/human CD4 protein | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Generation and characterization of humanization CD4 knock-in mice expressing chimeric mouse/human CD4 protein Pei-Lung Chen, Ka-Man Kam, Tsz-En Shiu, Chien-Ming Hsieh, Wen-Ting Lu, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4299701/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Humanized mouse models have become indispensable tools for investigating human gene function and disease modeling. However, conventional transgenic approaches carry the risk of unforeseen biological consequences. To address this concern, we developed a novel human CD4 knock-in mouse model (hCD4 KI mice) using CRISPR/Cas9 gene editing technology. We replaced the region encoding the first two major extracellular domains of the mouse Cd4 gene, which are critical for interaction with major histocompatibility complex (MHC) class II, with the corresponding human CD4 sequence. Subsequently, we conducted comprehensive physiological and immune system analyses on hCD4 KI mice, including both heterozygous ( CD4 m/h ) and homozygous ( CD4 h/h ) genotypes. Our investigations revealed a dosage-dependent impact of the hCD4 KI, resulting in a decrease population of CD4 + single positive (SP) cells, accompanied by a corresponding increase in CD8 + SP cells within the thymus. These developmental alterations, evident in thymus, were also observed in the peripheral lymphatic system such as the spleen and in the peripheral blood, exhibiting an increased population of mature CD8 + T cells and a decreased proportion of mature CD4 + T cells. Despite these changes, hCD4 KI mice exhibited normal biological characteristics, including T cell activation and proliferation functions, blood composition, tissue structure, and body weight, closely resembling those of wild-type ( CD4 m/m ) mice. Our study underscores hCD4 KI mice as a valuable tool for exploring CD4 and MHC class II interactions, with potential for future integration with humanized MHC class II KI mice, offering insights into immune disease mechanisms. Biological sciences/Immunology/Translational immunology Biological sciences/Immunology/Lymphoid tissues/Spleen Biological sciences/Immunology/Lymphoid tissues/Thymus Biological sciences/Immunology/Haematopoiesis/Lymphopoiesis Biological sciences/Biological techniques/Biological models/Immunological models Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction CD4 + T cells play a fundamental role in adaptive immunity, meticulously orchestrating and regulating the body's immune responses to combat infections effectively 1 – 3 . The development 4 , 5 , activation 6 , 7 , and regulation 8 of CD4 + T cells are heavily dependent on the presence of surface CD4 glycoprotein receptors, which facilitate T cell receptor (TCR) recognition of antigen peptides presented by MHC class II molecules and enable crucial intercellular communication. Specifically, the extracellular domains 1 (D1) and 2 (D2) of the CD4 glycoprotein hold a pivotal position in this process, as they interact with the β2 domain of MHC class II, thereby stabilizing the MHC-TCR complex interaction and finely regulating the activation of CD4 + T cells 9 – 11 . Moreover, these extracellular domains of the CD4 glycoprotein serve as critical targets in human immunodeficiency virus (HIV) infection 12 – 14 . Therefore, understanding the intricate molecular interactions between these domains and MHC class II molecules bears significant importance in the field of molecular immunology, as it holds the potential to inform the development of promising therapeutic strategies and elucidate the underlying pathological mechanisms of immune-related diseases. Humanized mice are valuable tools for studying human gene function and replicating human physiological characteristics 15 . While mouse Cd4 shares an 80% homology with the human CD4 gene sequence 16 , the weak binding affinity between mouse CD4 and human MHC (i.e., the human leukocyte antigen (HLA)) class II molecules 17 has limited the use of mice in studying human CD4 or immunological phenotypes related to class II HLA. To address this challenge, researchers have often inserted full-length human CD4 into the mouse genome through transgenic approaches, which have provided many insights into the gene function of human CD4 and related pathological research 18 – 20 . However, these transgenic models have limitations, such as the risk of random mutations and ectopic expression 21 , the coexistence of endogenous mouse Cd4 gene 22 , and the inability to study individual protein structural domains in vivo. To overcome these limitations, we utilized CRISPR/Cas9 precise gene editing technology 23 to develop hCD4 KI mice. Our optimized design strategy involved replacing the sequence encoding the D1 and D2 domains of mouse Cd4 with the corresponding human CD4 sequence. The resulting hCD4 KI mice exhibited similar overall biological and immunological activity to CD4 m/m mice, albeit with altered thymocyte development. Results Humanization of mouse CD4 in hCD4 KI mice Both mouse and human CD4 proteins' molecular structures and corresponding coding sequences (CDS) have been previously resolved, where their D1 and D2 domains were found to be encoded by exons 3, 4, and 5 24–26 . Our goal was to investigate the interactions of D1 and D2 domains of human CD4 with other molecules while preserving the function of the rest parts of mouse CD4, thus we replaced only the CDS of these domains. To achieve precise and accurate humanization, we utilized the CRISPR/Cas9 technique to replace a portion (27–168 bp) of mouse exon 3 with human exon 3 (27–165 bp), completely replacing mouse exon 4 (162 bp) and exon 5 (237 bp) sequences with human exon 4 (159 bp) and exon 5 (234 bp), while retaining mouse extracellular domain 3 (D3) and domain 4 (D4), transmembrane and cytoplasmic domains (Fig. 1 a), as well as all the mouse intronic sequences. This resulted in the production of chimeric mouse/human CD4 protein. To optimize our targeting strategy and avoid negative effects on CRISPR-Cas9 editing efficiency, we constructed separate donor vectors for exon 3 and exons 4–5, as there is a 6176 bp intron sequence between mouse exon 3 and exon 4. We successfully targeted and introduced exon 3 into the mouse first, followed by the introduction of exons 4–5 (Supplementary Fig. 1). Genotyping results showed that both alleles (exon 3 and exons 4–5) were inherited on the same chromosome (Fig. 1 c). CD4 m/h mice were able to express both DNA and mRNA sequences encoding human and mouse D1 and D2, while CD4 h/h mice only expressed human D1 and D2 sequences, not mouse D1 and D2 (Fig. 1 c-d). Flow cytometry analysis of splenocytes demonstrated that CD4 m/h mice expressed both human CD4-D1 (hCD4-D1) and mouse CD4-D1 (mCD4-D1) 11 proteins on the cell surface, with the expression level of hCD4-D1 protein being approximately half that of CD4 h/h mice. CD4 h/h mice only expressed hCD4-D1 protein, not mCD4-D1 (Fig. 1 e), which was consistent with genotyping and quantitative PCR results. Normal growth, hematology and histology in hCD4 KI mice In our study, we conducted detailed analyses of the appearance, size, cell count, and immunophenotyping of CD4-related immune organs 27 , 28 , specifically the spleen and thymus. For other essential physiological organs, we utilized basic visual comparison for evaluation. Our findings suggest that the overall appearance of hCD4 KI mice, including the condition of their hair, eyes, ears, nose, and other related areas, closely resembles that of CD4 m/m mice (Fig. 2 a) In a comparative analysis of various organs, the size and shape of each organ in the hCD4 KI mice appeared similar to those in CD4 m/m mice (Fig. 2 b). To gain comprehensive insights into the health status of hCD4 KI mice, we performed extensive hematological and histological analyses. The complete blood cell count (CBC) reports revealed no significant variations in blood composition parameters between CD4 m/h and CD4 h/h mice and their CD4 m/m counterparts (Fig. 3 and Table S4 ). Moreover, there were no notable differences observed in body weight measurements (Fig. 2 c-d and Table S3 ). Additionally, hematoxylin and eosin staining (H&E staining) of tissue sections showed no abnormalities or pathological changes, with similar tissue and cellular morphology observed among the groups (Fig. 2 e). Based on these comprehensive findings, we propose that partial humanization of CD4 in mice may not exert a substantial impact on their overall physiological function. Altered thymic development of T lymphocytes in hCD4 KI mice The thymus of hCD4 KI mice displayed similar appearance, weight, length (Table S5), and total cell count to CD4 m/m mice (Fig. 4 a-c). To evaluate the effect of humanized mouse CD4 on T lymphocyte development and lineage selection, we conducted a comprehensive analysis of thymocyte development. Specifically, we utilized the specific antibody against the domain 3 of mouse CD4 (mCD4-D3) 11 to detect the percentage of all CD4 proteins in mice. Our results revealed that both CD4 m/h and CD4 h/h mice displayed an increased percentage of double negative (DN) cells compared to CD4 m/m mice (Fig. 4 d). Furthermore, we examined the proportion of DN cell subsets based on CD25 and CD44 expression, and observed a reduction in DN3 cells in CD4 h/h mice, which subsequently recovered to levels similar to those in CD4 m/m mice at the DN4 stage (Fig. 4 e). Moreover, during the single positive (SP) phase, a dosage-dependent decrease in CD4 + SP cells was observed with the hCD4 KI, while CD8 + SP cells exhibited a corresponding increase (Fig. 4 d). These findings suggest that humanization of the D1 and D2 of mouse CD4 leads to altered T lymphocyte development. Abnormal immune cell composition in the peripheral lymphatic system of hCD4 KI mice The spleen of hCD4 KI mice displayed similar appearance, weight, length (Supplementary Fig. 5), and total cell count to those of CD4 m/m mice (Fig. 5 a-c). We then conducted a comprehensive analysis of the immunophenotype of spleen and peripheral blood mononuclear cells (PBMC) in CD4 m/h and CD4 h/h mice, with CD4 m/m mice as controls, to investigate the abnormal T lymphocyte development observed in the thymus. Consistent with the thymogenesis differences, we observed a dosage-dependent decrease in the percentage of mCD3 + mCD4 + cells and a corresponding increase in the percentage of mCD3 + mCD8 + T cells in the spleen and PBMC of CD4 m/h and CD4 h/h mice, resulting in a lower CD4/CD8 ratio (Fig. 5 f). The results from mCD4-D3 + were confirmed by the summation of mCD4-D1 + , mCD4-D1 + hCD4-D1 + , and hCD4-D1 + percentages (Fig. 5 e). While changes in T cell subsets were detected in the spleen and PBMC, the overall T cell count remained unchanged (Fig. 5 d), indicating compensation by CD8 + T cells for the decreased amount of CD4 + T cells. Additionally, the proportion of B cells was significantly reduced in the spleen of CD4 m/h and CD4 h/h mice, but there was no significant change in the proportion of B cells in PBMC (Fig. 5 d). Interestingly, although normal naive, effector memory (EM), and central memory (CM) CD8 + T cell subpopulations were detected in the spleen and PBMC of CD4 m/h and CD4 h/h mice (Fig. 5 h), the proportion of CM CD4 + T cells in their spleens was significantly increased compared to CD4 m/m mice, while the proportion of EM CD4 + T cells did not significantly differ (Fig. 5 g). These findings suggest active immune memory formation in hCD4 KI mice. Normal in vitro T cell responses in hCD4 KI mice To assess the activation and proliferation potential of T cells in hCD4 KI mice, splenocytes were stimulated with anti-CD3/CD28 for 72 hours. The expression of activation markers CD44 and CD25, as well as the proliferation marker carboxyfluorescein diacetate succinimidyl ester (CFSE), were evaluated to determine the cellular biology and activity state. Our results showed that both mCD4-D3 + and mCD8 + T cells from CD4 m/h and CD4 h/h mice splenocytes were fully activated (Fig. 6 a), and secreted high levels of interferon-γ (Fig. 6 c). Additionally, proliferation analysis revealed that mCD4-D3 + and mCD8 + T cells from CD4 m/h and CD4 h/h mice splenocytes exhibited a robust proliferative response comparable to CD4 m/m mice (Fig. 6 b). Thus, our findings suggest that T cells in hCD4 KI mice display a normal activation and proliferation response under stimulation conditions. Discussion In this study, we employed CRISPR/Cas9 technology to generate hCD4 KI mice and performed a comprehensive physiological analysis. The results confirmed successful expression of chimeric mouse/human CD4 protein in mice. During our investigation, we observed altered T lymphocyte development in the thymus of hCD4 KI mice, characterized by an increase in DN cells and altered ratios of CD4 + and CD8 + SP cells. These findings align with observations made in mCD4-deficient mouse model 29 , 30 , suggesting that humanized CD4-D1 and D2 can influence CD4 + T cell lineage selection. Previous research has indicated that hCD4 might exhibit greater affinity for certain mouse MHC class II molecules compared to mCD4 17 . However, replacing mCD4’s D3 and D4 with those from hCD4 resulted in reduced binding efficiency to TCR, presumably due to a decreased affinity of this chimeric CD4 for mouse MHC class II molecules 31 . Additionally, it has been shown that driving the expression of hCD4, driven by mouse Cd4 gene enhancer, can compensate for mCD4-deficiency, restoring hCD4 + SP cells in the thymus and hCD4 + T cells in the peripheral blood 32 . In our model, the hCD4 KI mice retained all native regulatory elements of mouse Cd4 gene, yet exhibited thymic development similar to mCD4-deficient mice. Therefore, we hypothesize that the observed developmental discrepancies in the thymus are likely due to the differing affinities of mCD4 and the chimeric mouse/human CD4 for mouse MHC class II molecules. This difference in affinity may lead to variations in signal transduction intensity, influencing the differentiation of DP cells 33 . Consequently, hCD4 KI mice tend to favor the production of mouse CD8 + T cells rather than the chimeric mouse/human CD4 + T cells during T cell lineage selection. As a result, the decrease in CD4 + SP cells and the corresponding increase in CD8 + SP cells are associated with the introduction of hCD4 . Our study provides a valuable foundation for further exploration of human CD4 application in mouse models. These insights into T cell development and lineage selection might have important implications for the use of hCD4 KI mice as a research tool in future studies. The abnormal T cell development observed in the thymus of hCD4 KI mice has subsequent impact on the peripheral lymphoid immune system. We found that this disruption led to a decrease in CD4 + T cells and an increase in CD8 + T cells in the spleen and PBMC of hCD4 KI mice, while the total number of T cells remained unchanged. These findings suggest that compensatory mechanisms may exist to maintain a balance in the number of T lymphocytes and to preserve normal immune function in vivo 34 , 35 . However, we also observed an increase in the proportion of naive CD4 + and CM CD4 + cells in the spleen of hCD4 KI mice, indicating that they had been exposed to specific pathogens in the past. Despite the partial compensatory mechanisms, immunodeficiency may still increase susceptibility to pathogens and other health issues, as it is restricted by immune responses 34 , 36 . Therefore, these findings highlight the importance of understanding the impact of disrupted T cell development on the immune system and overall health of humanized mouse models. Further studies are needed to explore the potential long-term consequences of these compensatory mechanisms and their implications for translational research. CD4 + T cells are essential for normal B cell activation and function 2 . In the absence of CD4 + T cells, the stimulatory signals required for proper B cell activation are weakened, leading to abnormal B cell proliferation 37 , 38 . Our study observed a reduction in the percentage of B cells in the spleen of hCD4 KI mice, which we attribute to the lower total number of CD4 + T cells in these mice, resulting in weaker signal stimulation. We also hypothesize that the chimeric mouse/human CD4 may have reduced efficiency in interaction with MHC class II molecules of mouse B cells 39 , which requires further investigation to validate. Our study shows that the chimeric mouse/human CD4 in hCD4 KI mice preserves most of the function of mouse CD4. The T cell function of hCD4 KI mice was evaluated and found to be comparable to CD4 m/m mice. The physiological analyses of hCD4 KI mice also showed no significant differences from CD4 m/m mice in terms of body weight, CBC reports, and tissue staining results. These results suggest that the chimeric mouse/human CD4 can play a similar role when mice partially or completely lack mouse CD4 protein, which is consistent with previous studies on humanized transgenic CD4 mice 30 , 32 , 40 . In addition, our hCD4 KI mouse model not only offers an advantage by exclude potential disruptions from endogenous mouse Cd4 genes, enhancing the accuracy and applicability of investigations of disease mechanisms and therapeutic approaches, but also provides a thorough characterization of hCD4 KI mice, establishing a foundation for their application in immunologically related research. Previous studies have shown normal T and B cell development in humanized mice expressing HLA class II, chimeric mouse/human CD4, T-cell receptor genes, chimeric mouse/human B2M and chimeric mouse/human CD8 41 . This suggests that hCD4 KI mice can be used with HLA class II KI mice, if available in the future, to improve abnormal thymocyte development and splenic B cell compartment. This approach can deepen our understanding of the affinity between chimeric mouse/human CD4 protein and HLA class II molecule, as well as its regulatory mechanism on T and B cells, thus advancing immune molecular biology. Combining these two models will also increase the reliability of hCD4 KI mice in studying immune-related diseases associated with MHC class II and CD4. According to this previous study, the physiological effect of multiple humanized mouse gene has revealed. However, our study uniquely focuses on the specific impact of a single humanized mouse gene on mouse physiology, which provides an important reference basis for future exploration of the role of other related genes. In summary, this study presents a sophisticated design strategy to develops hCD4 KI mice based on precise gene editing using CRISPR/Cas9 technology. The resulting hCD4 KI mice exhibited similar overall biological and immunological activity to CD4 m/m mice, albeit with altered thymocyte development manifested with changed proportion of lymphocyte subtypes in thymus, spleen and peripheral blood. Our study highlights the potential of hCD4 KI mice as a valuable research platform for investigating the dynamic interaction between CD4 and MHC class II molecules. Furthermore, a combined humanized CD4 and humanized MHC mice in the future might offer the opportunity to shed light on the pathogenic mechanisms of human immune-related diseases. Materials and methods Animals Animals were obtained from the National Taiwan University College of Medicine Laboratory Animal Center (NTUCM-LAC) (AAALAC accredited) and maintained in a specific pathogen-free (SPF) area with ad libitum access to food and water. Toes from neonatal mice within 1 week of birth were clipped for identification and genotyping, then housed by gender after weaning. Body weight was recorded weekly (detailed data see Table S3 ) starting at 4 weeks of age. All animal experiments and care were conducted in accordance with the guidelines of the Institutional Animal Care and Use Committee (IACUC) at National Taiwan University College of Medicine. This study's animal use was approved by IACUC 20200108. Generation of hCD4 KI mice We used CRISPR/Cas9 technology to generate hCD4 KI mice on a C57BL/6J background that express the sequence of human CD4-D1 and CD4-D2 (NCBI gene ID: 12504). Cas9 RNA, sgRNA, and single-stranded DNA were designed or obtained using previously published methods 23 . The targeting strategy and sgRNA design of CRISPR/Cas9 are presented in Supplementary Fig. 1. The sgRNA targeting sequences were as follows: sgRNA 1: 5'-TGTCACTCAAGGGAAGACGC-3', sgRNA 2: 5'-TGATTCCAAAAAAGGGGCAT-3', and sgRNA 3: 5'-AGAGTTGCTATCCAAGGTCA-3'. We repaired the mouse genome by inserting human CD4 exon 3 and exon 4–5 sequences using single-stranded DNA. (human CD4 exon 3: 5’- GACAATAACGGTGCACGTGAGGACC ‐3’ and 5’‐ GCTCTGGCTGTCACAGAACTCACTC ‐3’; human CD4 exon 4–5: 5’‐ GTGTTCAGTTTGTAAGAGTGGTTGC ‐3’ and 5’‐ GTCAGAGACCAGGACAATAGGTGTC ‐3’). Fertilized egg cells were injected with sgRNA and Cas9 nucleases, and founder mice were genotyped through PCR and Sanger DNA sequencing. The production of hCD4 KI mice was commissioned to the Transgenic Mouse Models Core Facility of the National Core Facility. Genotyping For experimental grouping, we genotyped each founder mouse's offspring using the KAPA Mouse Genotyping Kit (R&D Systems), following the manufacturer's guidelines. To prepare the KAPA mix, an extraction mix was first created, consisting of 44 µL ddH 2 O, 5 µL 10x KAPA express Buffer, and 1 µL 1U/µL KAPA Express Extract Enzyme. Each mouse toes were then immersed in the KAPA mix and subjected to tissue lysis and DNA extraction by incubating at 75℃ for 30 minutes. The extracted DNA was diluted with ddH2O to 20 times its volume. Next, a PCR master mix was prepared by mixing 1 µL of diluted DNA (template DNA), 5 µL of 2X KAPA2G fast Hot Start Genotyping Mix (including dye), 3 µL of ddH2O, and 1 µL of primer. Two sets of primers were employed for genotyping (sequences see Table S1 ). Finally, PCR amplification was performed under the following conditions: 3 mins at 95℃, 35 cycles of [15 sec at 95℃, 15 sec at 60℃, 30 sec at 72℃], 2 mins at 72℃ and hold at 16℃. Isolation of splenocytes and thymocytes To isolate splenocytes and thymocytes, we first anesthetized 9-10-week-old mice and dislocated each cervical vertebrae to obtain spleen or thymus tissues form CD4 m/m , CD4 m/h , and CD4 h/h mice (the ratios of males to females were similar among the three groups). We then immersed the tissues in 5% fetal bovine serum (FBS) in 1× PBS and gently ground them with a needle barrel before passing the suspension through a 70 µm cell strainer. Next, the single-cell suspension was subjected to red blood cell lysis using a solution containing 8.29g NH 4 Cl, 1g KHCO 3 , and 0.02g EDTA. After washing the cells with 1× PBS, the isolated splenocytes and thymocytes were collected for further experiments. Isolation of PBMC PBMC were isolated from each 9-10-week-old CD4 m/m , CD4 m/h , and CD4 h/h mice (the ratios of males to females were similar among the three groups) using the following protocol. First, approximately 250 µl of blood was collected via cardiac puncture into a 0.5 ml EDTA anticoagulant tube. The blood was then mixed with 10 ml of red blood cell lysis solution and incubated for 10 minutes at room temperature. Next, the PBMC were isolated by washing the blood twice with 1× PBS. The resulting PBMC were then collected and utilized for subsequent immunophenotyping analysis. Quantitative real-time PCR Total RNA was first isolated from splenocytes using TRIzol™ Reagent (Life Technologies). Next, SuperScript™ IV (Life Technologies) was used to reverse transcribe the RNA. Quantitative PCR was then performed on a BIO-RAD CFX Connect real-time PCR machine using the ORA™ SEE qPCR Green ROX (highQu). Primer sequences are available in Table S2 . The PCR conditions included a 3 min initial denaturation at 95℃, followed by 40 cycles of denaturation at 95℃ for 10 sec, annealing and extension at 60℃ for 30 sec, and a final melting curve analysis. B2m was used as an internal control for normalization. The 2-ΔΔCt formula was used for data analysis. All steps were carried out in accordance with the manufacturer's instructions. Immunophenotyping A total of 1×10 6 cells (such as splenocytes, thymocytes or PBMC) were washed in flow staining buffer (2% FBS, 2mM EDTA). Next, the cells were suspended in 50 µl of flow staining buffer containing 1 µg of anti-mouse CD16/CD32 antibody (BioLegend) and incubated for 10 minutes at 4°C. After incubation, the diluted staining reagent (Supplementary Data 2) was added to achieve a final volume of 100 µl. The cells were then further incubated for 30 minutes at 4°C before being washed in flow staining buffer. Flow cytometry analysis was conducted using the Cytek™ Aurora instrument, and the resulting data were analyzed using FlowJo 10.8.1 software. To ensure data consistency and reliability, we completed immunotyping on 21 mice aged 9–10 weeks in one day. The process, including animal sacrifice, tissue extraction, and flow cytometry data collection, was conducted within 12 hours, reducing variability due to time differences. In vitro activation and proliferation of T cells To induce activation of T cells, we employed in vitro treatment with anti-CD3 and anti-CD28 (BioLegend), followed by flow cytometry analysis 72 hours post-stimulation. Splenocytes were isolated from 9-13-week-old mice and labeled with the CFSE Cell Division Tracker Kit (BioLegend) according to the manufacturer's protocol. Next, 3×10 5 labeled splenocytes were seeded into each well of a 96-well plate and divided into control and anti-CD3/CD28 treatment groups (with a concentration of 5 µg/ml anti-CD3/CD28). The plate was then incubated at 37°C in a 5% CO 2 incubator for 72 hours. For cell staining, all cells were washed and incubated first with anti-mouse CD16/CD32 antibody, and then stained with a diluted staining solution (Supplementary Data 2) for 30 minutes at 4°C, following the Immunophenotyping procedure. Finally, the stained cells were acquired using a BD FACSLyric™ within 4 hours of staining and analyzed with FlowJo 10.8.1 software. ELISA measurement of cytokine Supernatants from cells treated with anti-CD3/CD28 were collected and stored at -20°C. Interferon-γ levels were measured using an ELISA kit (R&D Systems, McKinley Place NE, Minneapolis, USA). Hematological analysis Blood samples were obtained from 9-10-week-old mice via cardiac puncture, and approximately 250 µL of blood was collected into a 0.5 mL EDTA anticoagulant tube. Within 3 hours, the samples were sent to NTUCM-LAC (ISO17025 accredited) for analysis using the IDEXX ProCyte Dx* Hematology Analyzer. The CBC analysis included measurement of red blood cell count, hemoglobin level, hematocrit level, mean corpuscular volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration, reticulocyte count, platelet count, white blood cell count, neutrophils count, lymphocytes count, monocytes count, eosinophils count, and basophils count (detailed data see Table S4 ). Histological analysis Tissue samples were obtained from the brain, thymus, heart, lung, spleen, liver, kidney and intestine of 11-12-week-old mice and fixed in 4% paraformaldehyde for two days. The fixed tissues were subjected to standard tissue embedding, sectioning, and staining protocols at NTUCM-LAC, and the resulting tissue sections were examined for morphological changes under a Life EVOS microscope. Statistical Analysis In this study, sample sizes were determined based on prior experimental experience, not specific statistical methods. Details are in the figure legends and Supplementary Data-1. Additionally, all data points were included in the analysis without any exclusions. We performed statistical analysis using PRISM software ( https://www.graphpad.com/features ), as well as used one-way or two-way ANOVA with Tukey's multiple comparison test to compare the three groups of CD4 m/m (control group), CD4 m/h , and CD4 h/h (experiment groups) mice. The level of statistical significance was set as follows: * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001. To verify if the data met the basic assumptions of ANOVA, we utilized Levene's test. In cases where the assumptions were not met, we employed Brown-Forsythe and Welch ANOVA, complemented with Dunnett's T3 method for statistical analysis. Declarations Competing Interests The authors affirm that there are no conflicts of interest associated with this manuscript. Author contributions Ka-Man Kam, Ya-Hui Chuang, and Pei-Lung Chen were responsible for designing this study. Ka-Man Kam, Tsz-En Shiu, Chien-Ming Hsieh, Wen-Ting Lu, and Yu-Yun Pan assisted in collecting mouse tissues and samples. Ka-Man Kam conducted the statistical analysis. Ya-Hui Chuang, I-Shing Yu, and Pei-Lung Chen supervised and coordinated the entire research process. Ka-Man Kam, Ya-Hui Chuang, I-Shing Yu, and Pei-Lung Chen jointly wrote and revised the manuscript. Funding for this study was provided by Pei-Lung Chen. Acknowledgments We would like to express our gratitude to the following organizations for their support in conducting this study: Transgenic Mouse Models Core Facility at the National Core Facility for Biopharmaceuticals, National Science and Technology Council, Taiwan; Seventh and Third Core Labs of the Department of Medical Research at National Taiwan University Hospital; and the NTUCM-LAC. References Kervevan, J. & Chakrabarti, L.A. Role of CD4 + T Cells in the Control of Viral Infections: Recent Advances and Open Questions. Int J Mol Sci 22 (2021). Luckheeram, R.V., Zhou, R., Verma, A.D. & Xia, B. CD4(+)T cells: differentiation and functions. Clin Dev Immunol 2012, 925135 (2012). Swain, S.L., McKinstry, K.K. & Strutt, T.M. Expanding roles for CD4(+) T cells in immunity to viruses. Nat Rev Immunol 12, 136–148 (2012). Germain, R.N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol 2, 309–322 (2002). Morch, A.M., Balint, S., Santos, A.M., Davis, S.J. & Dustin, M.L. Coreceptors and TCR Signaling - the Strong and the Weak of It. Front Cell Dev Biol 8, 597627 (2020). Li, Y., Yin, Y. & Mariuzza, R.A. Structural and biophysical insights into the role of CD4 and CD8 in T cell activation. Front Immunol 4, 206 (2013). Janeway, C.A., Jr. The co-receptor function of CD4. Semin Immunol 3, 153–160 (1991). Lee, M.S. et al. Enhancing and inhibitory motifs regulate CD4 activity. Elife 11 (2022). Vignali, D.A., Doyle, C., Kinch, M.S., Shin, J. & Strominger, J.L. Interactions of CD4 with MHC class II molecules, T cell receptors and p56lck. Philos Trans R Soc Lond B Biol Sci 342, 13–24 (1993). Wang, J.H. et al. Crystal structure of the human CD4 N-terminal two-domain fragment complexed to a class II MHC molecule. Proc Natl Acad Sci U S A 98, 10799–10804 (2001). Vignali, D.A. & Vignali, K.M. Profound enhancement of T cell activation mediated by the interaction between the TCR and the D3 domain of CD4. J Immunol 162, 1431–1439 (1999). Li, L. et al. Role of human CD4 D1D2 domain in HIV-1 infection. Immunol Invest 42, 106–121 (2013). Moebius, U. et al. Human immunodeficiency virus gp120 binding C'C" ridge of CD4 domain 1 is also involved in interaction with class II major histocompatibility complex molecules. Proc Natl Acad Sci U S A 89, 12008–12012 (1992). Perez-Jimenez, R. et al. Probing the effect of force on HIV-1 receptor CD4. ACS Nano 8, 10313–10320 (2014). Yong, K.S.M., Her, Z. & Chen, Q. Humanized Mice as Unique Tools for Human-Specific Studies. Arch Immunol Ther Exp (Warsz) 66, 245–266 (2018). Yatsuda, J. et al. Establishment of HLA-DR4 transgenic mice for the identification of CD4 + T cell epitopes of tumor-associated antigens. PLoS One 8, e84908 (2013). Konig, R., Huang, L.Y. & Germain, R.N. MHC class II interaction with CD4 mediated by a region analogous to the MHC class I binding site for CD8. Nature 356, 796–798 (1992). Lores, P. et al. Expression of human CD4 in transgenic mice does not confer sensitivity to human immunodeficiency virus infection. AIDS Res Hum Retroviruses 8, 2063–2071 (1992). Seay, K. et al. Mice transgenic for CD4-specific human CD4, CCR5 and cyclin T1 expression: a new model for investigating HIV-1 transmission and treatment efficacy. PLoS One 8, e63537 (2013). Browning, J. et al. Mice transgenic for human CD4 and CCR5 are susceptible to HIV infection. Proc Natl Acad Sci U S A 94, 14637–14641 (1997). Haruyama, N., Cho, A. & Kulkarni, A.B. Overview: engineering transgenic constructs and mice. Curr Protoc Cell Biol Chap. 1 9, Unit 19 10 (2009). Chen, M., Kretzschmar, D., Verdile, G. & Lardelli, M. in Animal Models for the Study of Human Disease. (ed. P.M. Conn) 595–632 (Academic Press, Boston; 2013). Yoshimi, K. et al. ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nature communications 7, 10431 (2016). Laing, K.J. et al. Evolution of the CD4 family: teleost fish possess two divergent forms of CD4 in addition to lymphocyte activation gene-3. J Immunol 177, 3939–3951 (2006). Boscariol, R., Pleasance, J., Piedrafita, D.M., Raadsma, H.W. & Spithill, T.W. Identification of two allelic forms of ovine CD4 exhibiting a Ser183/Pro183 polymorphism in the coding sequence of domain 3. Vet Immunol Immunopathol 113, 305–312 (2006). Helling, B. et al. A specific CD4 epitope bound by tregalizumab mediates activation of regulatory T cells by a unique signaling pathway. Immunol Cell Biol 93, 396–405 (2015). Karimi, M.M. et al. The order and logic of CD4 versus CD8 lineage choice and differentiation in mouse thymus. Nat Commun 12, 99 (2021). Lewis, S.M., Williams, A. & Eisenbarth, S.C. Structure and function of the immune system in the spleen. Sci Immunol 4 (2019). Rahemtulla, A. et al. Normal development and function of CD8 + cells but markedly decreased helper cell activity in mice lacking CD4. Nature 353, 180–184 (1991). Kim, D.K., Tahara-Hanaoka, S., Shinohara, N. & Nakauchi, H. A human mutant CD4 molecule resistant to HIV-1 binding restores helper T-lymphocyte functions in murine CD4-deficient mice. Exp Mol Med 39, 1–7 (2007). Vignali, D.A., Carson, R.T., Chang, B., Mittler, R.S. & Strominger, J.L. The two membrane proximal domains of CD4 interact with the T cell receptor. J Exp Med 183, 2097–2107 (1996). Killeen, N., Sawada, S. & Littman, D.R. Regulated expression of human CD4 rescues helper T cell development in mice lacking expression of endogenous CD4. EMBO J 12, 1547–1553 (1993). Singer, A., Adoro, S. & Park, J.H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol 8, 788–801 (2008). Nish, S. & Medzhitov, R. Host defense pathways: role of redundancy and compensation in infectious disease phenotypes. Immunity 34, 629–636 (2011). Zhao, N., Zhang, T., Zhao, Y., Zhang, J. & Wang, K. CD3(+)T, CD4(+)T, CD8(+)T, and CD4(+)T/CD8(+)T Ratio and Quantity of gammadeltaT Cells in Peripheral Blood of HIV-Infected/AIDS Patients and Its Clinical Significance. Comput Math Methods Med 2021, 8746264 (2021). El-Brolosy, M.A. & Stainier, D.Y.R. Genetic compensation: A phenomenon in search of mechanisms. PLoS Genet 13, e1006780 (2017). Schwartz, M.A., Kolhatkar, N.S., Thouvenel, C., Khim, S. & Rawlings, D.J. CD4 + T cells and CD40 participate in selection and homeostasis of peripheral B cells. J Immunol 193, 3492–3502 (2014). Kalia, V., Sarkar, S., Gourley, T.S., Rouse, B.T. & Ahmed, R. Differentiation of memory B and T cells. Curr Opin Immunol 18, 255–264 (2006). Janeway, C. & Janeway, C. Immunobiology: the immune system in health and disease, Edn. 5th. (Garland Pub, New York; 2001). Law, Y.M. et al. Human CD4 restores normal T cell development and function in mice deficient in murine CD4. J Exp Med 179, 1233–1242 (1994). Moore, M.J. et al. Humanization of T cell-mediated immunity in mice. Sci Immunol 6, eabj4026 (2021). Additional Declarations There is NO Competing Interest. Supplementary Files AuthorChecklist.pdf Competinginterests.pdf Reportingsummary.pdf SupplementaryData1.docx SupplementaryData2.xlsx Supplementary Data-2 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4299701","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":305126806,"identity":"759fe066-2da0-496e-97a2-333b4b370bb1","order_by":0,"name":"Pei-Lung Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0UlEQVRIiWNgGAWjYHACxgNAQg7CZiNSD0iLMUQ1kOAhVktiA9FazNnPGBz4uKM2fbt8jwHDh7LDDPYSCfi1WPbkGByceeZ47s42HgPGGecOM/AQ0mJwIMfgMG/bsdwNx3gMmHnbgFqkCWk5/wasJd0ApOUvUVpugG2pSQBrYSRGi+WMZwUHZ7YdMNxwLK3gYM+5dB6e+w/wazHnT9744GNbnbzB4cMbH/wos5Zj7zlAwGEMHAZA6jCYA1JLOCYNGNhB7qgjqHAUjIJRMApGMAAA8TtGgrg4R5cAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-5640-3074","institution":"National Taiwan University College of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Pei-Lung","middleName":"","lastName":"Chen","suffix":""},{"id":305126807,"identity":"d44fff1d-7398-43be-a652-9b15235190c0","order_by":1,"name":"Ka-Man Kam","email":"","orcid":"https://orcid.org/0009-0001-5122-371X","institution":"National Taiwan University College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ka-Man","middleName":"","lastName":"Kam","suffix":""},{"id":305126808,"identity":"fe957c28-7193-466c-aae9-f62b727b531f","order_by":2,"name":"Tsz-En Shiu","email":"","orcid":"","institution":"National Taiwan University College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Tsz-En","middleName":"","lastName":"Shiu","suffix":""},{"id":305126809,"identity":"0d0e5be0-0062-490a-9ba1-22d0c42b5c07","order_by":3,"name":"Chien-Ming Hsieh","email":"","orcid":"","institution":"National Taiwan University College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Chien-Ming","middleName":"","lastName":"Hsieh","suffix":""},{"id":305126810,"identity":"5283365c-d2cf-4220-b2eb-f3afc180869a","order_by":4,"name":"Wen-Ting Lu","email":"","orcid":"","institution":"National Taiwan University College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Wen-Ting","middleName":"","lastName":"Lu","suffix":""},{"id":305126811,"identity":"aaee69d7-7561-4eec-bc8b-eb8a9a627ddb","order_by":5,"name":"Yu-Yun Pan","email":"","orcid":"","institution":"National Taiwan University College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yu-Yun","middleName":"","lastName":"Pan","suffix":""},{"id":305126812,"identity":"b941fa2d-c358-4603-8e32-b8530489050e","order_by":6,"name":"Ya-Hui Chuang","email":"","orcid":"","institution":"National Taiwan University College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ya-Hui","middleName":"","lastName":"Chuang","suffix":""},{"id":305126813,"identity":"8c55f61c-fdbf-4eb7-9c54-ef743d4af9cf","order_by":7,"name":"I-Shing Yu","email":"","orcid":"","institution":"National Taiwan University College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"I-Shing","middleName":"","lastName":"Yu","suffix":""}],"badges":[],"createdAt":"2024-04-21 07:00:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4299701/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4299701/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":56916450,"identity":"363a6380-73e6-460a-b546-44af221514cf","added_by":"auto","created_at":"2024-05-22 06:26:25","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":206108,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGeneration and evaluation of hCD4 KI mice for humanized expression. a,\u003c/strong\u003e Schematic representation of the first six exons of the \u003cem\u003eCD4\u003c/em\u003e gene (to scale) and the corresponding proteins (not to scale) in \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e mice (top), human (middle), and hCD4 KI mice (bottom), with mouse (black) and human (red) coding sequences (CDS), untranslated regions (UTR), and domains. Numbers indicate the number of base pairs (bp). \u003cstrong\u003eb, \u003c/strong\u003ePCR and RT-PCR primer design strategy for genotype identification: two primer sets for PCR genotyping targeting mouse/human exon 3 and exon 4 to 5 (left), and RT-PCR/RT-qPCR primer designs spanning exon 2 to 4 (right). \u003cstrong\u003ec,\u003c/strong\u003e PCR genotyping of\u003cem\u003e CD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m \u003c/em\u003e\u003c/sup\u003eand hCD4 KI mice (\u003cem\u003en\u003c/em\u003e=2/genotype). Toe-clipping DNA used with primers for mouse and human exon 3 (resulting in 347 bp, 347+294 bp, and 294 bp respectively) and exon 4-5 (914 bp, 914+782 bp, and 782 bp respectively). Mouse IDs are indicated as #1-6. \u003cstrong\u003ed,\u003c/strong\u003e (Top) Agarose gel electrophoresis RT-PCR analysis for mouse \u003cem\u003eCd4\u003c/em\u003e and human\u003cem\u003e CD4\u003c/em\u003e expression (233 bp and 351 bp products, respectively), with β2-microglobulin \u003cem\u003e(B2m)\u003c/em\u003e as a control (164 bp). (bottom) RT-qPCR quantification in 9-10-week-old mice splenocytes (\u003cem\u003en\u003c/em\u003e=4/genotype) shows human \u003cem\u003eCD4\u003c/em\u003e in \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003eand both mouse \u003cem\u003eCd4\u003c/em\u003e and human \u003cem\u003eCD4\u003c/em\u003e in \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice. \u003cstrong\u003ee,\u003c/strong\u003e Flow cytometry histograms (left) showing mCD4-D1 and hCD4-D1 expression on mCD3\u003csup\u003e+\u003c/sup\u003e gated splenocytes and PBMC (\u003cem\u003en\u003c/em\u003e=7/genotype) of 9-10-week-old mice. Mean fluorescence intensities (MFI) shown as bar graphs (right). Data represented as mean ± SD. Gating strategy for splenocytes is shown in Supplementary Fig. 2.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4299701/v1/b3420408a8a3ab60c0c50656.png"},{"id":56916446,"identity":"4c02fb5c-8012-4898-acb2-2006347cf813","added_by":"auto","created_at":"2024-05-22 06:26:25","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1145708,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNormal growth and histology in hCD4 KI mice. a, \u003c/strong\u003eComparison of physical features in 8-week-old \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e and hCD4 KI mice. \u003cstrong\u003eb,\u003c/strong\u003e Organ observations focusing on brain, lungs, heart, liver, and kidneys in 8-week-old mice. \u003cstrong\u003ec, \u003c/strong\u003eBody weight comparison among \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e,\u003cem\u003e CD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e, and \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e mice aged 4-12 weeks. Data analyzed using one-way ANOVA and Tukey's multiple comparisons test, indicating similar body weights across both male and female mice of each genotype during this period. \u003cstrong\u003ed, \u003c/strong\u003eH\u0026amp;E-stained tissue sections representing various organs, including the brain, thymus, heart, lung, spleen, liver, kidney, and intestine of 11-12-week-old \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e and hCD4 KI mice. Scale bars are provided for 1000 μm and 200 μm.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4299701/v1/cce0f54008ac12d4fde18d9e.png"},{"id":56917511,"identity":"fcaf0d75-3582-434a-ab7b-08f08d008ece","added_by":"auto","created_at":"2024-05-22 06:42:25","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":158113,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNormal hematological parameters in hCD4 KI mice.\u003c/strong\u003e CBC were performed on blood samples collected from \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e and hCD4 KI mice (\u003cem\u003en\u003c/em\u003e=8/genotype) at 9-10 weeks of age. Results show similar CBC parameters for all genotypes. Abbreviations: RBC, Red blood cell; HGB, Hemoglobin; HCT, Hematocrit; MCV, Mean Corpuscular Volume; MCH, Mean Corpuscular Hemoglobin; MCHC, Mean Corpuscular Hemoglobin Concentration; RET, Reticulocyte; PLT, Platelet; WBC, White blood cell; NEUT, Neutrophil; LYMPH, Lymphocyte; MONO, Monocyte; EO, Eosinophil; BASO, Basophil. Box plots show mean ± SD. Statistical analysis was performed using one-way ANOVA and Tukey's multiple comparison test.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4299701/v1/af68277bb1aa24812a64a55c.png"},{"id":56917512,"identity":"b5781e63-2e2a-4eca-8e04-698ab4ba2895","added_by":"auto","created_at":"2024-05-22 06:42:25","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":331621,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAltered thymic T cell development in hCD4 KI mice. \u003c/strong\u003eGender-based analysis of the \u003cstrong\u003ea, \u003c/strong\u003eappearance \u003cstrong\u003eb, \u003c/strong\u003elength and weight of the thymus in 8-week-old \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e and hCD4 KI mice. Male: \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003en\u003c/em\u003e=20; \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003en\u003c/em\u003e=20; \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003en\u003c/em\u003e=15. Female: \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003en\u003c/em\u003e=20; \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003en\u003c/em\u003e=20; \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003en\u003c/em\u003e=20. \u003cstrong\u003ec,\u003c/strong\u003e Total thymocytes count in mice (\u003cem\u003en\u003c/em\u003e=7/genotype) at 9-10 weeks of age. \u003cstrong\u003ed-e,\u003c/strong\u003e Flow cytometry analysis of thymocytes from 9-10-week-old \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e and hCD4 KI mice (\u003cem\u003en\u003c/em\u003e=7/genotype)\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003ed,\u003c/strong\u003e DN, DP, CD4 SP, and CD8 SP subsets proportions and representative plots. \u003cstrong\u003ee,\u003c/strong\u003e DN1-4 subsets proportions and representative plots. Gating strategy for thymocytes is shown in Supplementary Fig. 3. Data are presented as mean ± SD. Statistical analysis was performed using one-way ANOVA and Tukey's multiple comparison test (*\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 and **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4299701/v1/89e4dcd47be15b34d64d84a4.png"},{"id":56916454,"identity":"84f58b3e-6a52-4be7-97f0-eabc0c5f92c5","added_by":"auto","created_at":"2024-05-22 06:26:26","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":411243,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAltered immune cell composition in hCD4 KI mice spleen and PBMC.\u003c/strong\u003e Gender-based analysis of the \u003cstrong\u003ea,\u003c/strong\u003e appearance \u003cstrong\u003eb,\u003c/strong\u003e weight and length\u003cstrong\u003e \u003c/strong\u003eof the spleen in 8-week-old CD4m/m and hCD4 KI mice. Male: \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003en\u003c/em\u003e=20; \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003en\u003c/em\u003e=20; \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003en\u003c/em\u003e=15. Female: \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003en\u003c/em\u003e=20; \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003en\u003c/em\u003e=20; \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003en\u003c/em\u003e=20. \u003cstrong\u003ec,\u003c/strong\u003e Total splenocyte counts in mice (\u003cem\u003en\u003c/em\u003e=7/genotype) at 9-10 weeks of age. \u003cstrong\u003ed-h,\u003c/strong\u003e Flow cytometry analysis of splenocytes and PBMC from 9-10-week-old \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e and hCD4 KI mice (\u003cem\u003en\u003c/em\u003e=7/genotype), showing representative flow cytometry plots and proportions of various immune cell types. \u003cstrong\u003ed,\u003c/strong\u003e mCD3\u003csup\u003e+\u003c/sup\u003e T cells and mCD19\u003csup\u003e+\u003c/sup\u003e B cells. \u003cstrong\u003ee, \u003c/strong\u003eCombined percentages of mCD3\u003csup\u003e+\u003c/sup\u003emCD4-D1\u003csup\u003e+\u003c/sup\u003e, mCD3\u003csup\u003e+\u003c/sup\u003emCD4-D1\u003csup\u003e+\u003c/sup\u003ehCD4-D1\u003csup\u003e+\u003c/sup\u003e, and mCD3\u003csup\u003e+\u003c/sup\u003ehCD4-D1\u003csup\u003e+\u003c/sup\u003e cell populations.\u003cstrong\u003e f,\u003c/strong\u003e Percentages and ratios of mCD3\u003csup\u003e+\u003c/sup\u003emCD4-D3\u003csup\u003e+\u003c/sup\u003e and mCD3\u003csup\u003e+\u003c/sup\u003emCD8\u003csup\u003e+ \u003c/sup\u003eT cells. \u003cstrong\u003eg,\u003c/strong\u003e Naive (CD62L\u003csup\u003e+\u003c/sup\u003eCD44\u003csup\u003e-\u003c/sup\u003e), CM (CD62L\u003csup\u003e+\u003c/sup\u003eCD44\u003csup\u003e+\u003c/sup\u003e), and EM (CD62L\u003csup\u003e-\u003c/sup\u003eCD44\u003csup\u003e+\u003c/sup\u003e) T cells in mCD3\u003csup\u003e+\u003c/sup\u003emCD4-D3\u003csup\u003e+\u003c/sup\u003e T cell. \u003cstrong\u003eh,\u003c/strong\u003e Naive, CM, and EM T cells in mCD3\u003csup\u003e+\u003c/sup\u003emCD8\u003csup\u003e+\u003c/sup\u003e T cell. Gating strategy for splenocytes and PBMC are shown in Supplementary Fig. 3. Data are presented as mean ± SD. Statistical analysis was performed using \u003cstrong\u003eb-c\u003c/strong\u003e one-way ANOVA or \u003cstrong\u003ed-h\u003c/strong\u003e two-way ANOVA with Tukey’s multiple comparisons test (*\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, and ****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4299701/v1/afbf82db80294bd979aee5be.png"},{"id":56916453,"identity":"65397913-2d52-43f1-908e-823459667b2e","added_by":"auto","created_at":"2024-05-22 06:26:26","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":191792,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNormal T cell responses to anti-CD3/CD28 stimulation in vitro in hCD4 KI mice.\u003c/strong\u003e CFSE-labeled splenocytes from 9-13-week-old \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e and hCD4 KI mice (\u003cem\u003en\u003c/em\u003e=5/genotype), were cultured with anti-CD3/CD28 or no anti-CD3/CD28 (control) for 72 hours. The expression of \u003cstrong\u003ea, \u003c/strong\u003eCD44, CD25, and\u003cstrong\u003e b,\u003c/strong\u003e CFSE was determined by flow cytometry in mCD4-D3\u003csup\u003e+\u003c/sup\u003e and mCD8\u003csup\u003e+\u003c/sup\u003e T cells, including representative plots and expression percentage. \u003cstrong\u003ec,\u003c/strong\u003e Interferon-γ in anti-CD3/CD28 cultures measured via ELISA. Gating strategy for anti-CD3/CD28 stimulated splenocytes is shown in Supplementary Fig. 4. Bar graphs show mean ± SEM. Statistical analysis was performed using (\u003cstrong\u003ea-b)\u003c/strong\u003e two-way ANOVA or (\u003cstrong\u003ec)\u003c/strong\u003e one-way ANOVA with Tukey’s multiple comparisons test.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4299701/v1/791f06ed9543682f438b0ab3.png"},{"id":56917521,"identity":"4e1db5cb-c6e7-423e-afba-663de1f69637","added_by":"auto","created_at":"2024-05-22 06:42:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3071986,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4299701/v1/28f1bef1-7e28-4d3e-8ab5-345405151a6f.pdf"},{"id":56917052,"identity":"5f290964-ead0-495f-9c4a-7ed24c8b2a3f","added_by":"auto","created_at":"2024-05-22 06:34:25","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":126623,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"AuthorChecklist.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4299701/v1/3f00d77e8f1cad1750164b7b.pdf"},{"id":56916455,"identity":"42aa83ff-fa33-4481-8548-a279ae46c172","added_by":"auto","created_at":"2024-05-22 06:26:26","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":311042,"visible":true,"origin":"","legend":"","description":"","filename":"Competinginterests.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4299701/v1/7e5f877a64673f9c37b1cfca.pdf"},{"id":56916451,"identity":"221fca69-116c-4126-a057-7c33f86ea232","added_by":"auto","created_at":"2024-05-22 06:26:26","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1647814,"visible":true,"origin":"","legend":"","description":"","filename":"Reportingsummary.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4299701/v1/5d5dd6de34475521801ec596.pdf"},{"id":56916456,"identity":"2d7e62bb-fd3b-4433-b96d-aa8f802a8ff7","added_by":"auto","created_at":"2024-05-22 06:26:26","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":8693347,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryData1.docx","url":"https://assets-eu.researchsquare.com/files/rs-4299701/v1/e74427d3056049df403f0650.docx"},{"id":56917070,"identity":"c9d0dbc3-2221-4748-8dec-490e5ce3ce68","added_by":"auto","created_at":"2024-05-22 06:34:26","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":44481,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Data-2\u003c/p\u003e","description":"","filename":"SupplementaryData2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4299701/v1/827fab2e6100fe8afa468a61.xlsx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Generation and characterization of humanization CD4 knock-in mice expressing chimeric mouse/human CD4 protein","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCD4\u003csup\u003e+\u003c/sup\u003e T cells play a fundamental role in adaptive immunity, meticulously orchestrating and regulating the body's immune responses to combat infections effectively\u003csup\u003e\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. The development\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e, activation\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e, and regulation\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e of CD4\u003csup\u003e+\u003c/sup\u003e T cells are heavily dependent on the presence of surface CD4 glycoprotein receptors, which facilitate T cell receptor (TCR) recognition of antigen peptides presented by MHC class II molecules and enable crucial intercellular communication. Specifically, the extracellular domains 1 (D1) and 2 (D2) of the CD4 glycoprotein hold a pivotal position in this process, as they interact with the β2 domain of MHC class II, thereby stabilizing the MHC-TCR complex interaction and finely regulating the activation of CD4\u003csup\u003e+\u003c/sup\u003e T cells\u003csup\u003e\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Moreover, these extracellular domains of the CD4 glycoprotein serve as critical targets in human immunodeficiency virus (HIV) infection\u003csup\u003e\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Therefore, understanding the intricate molecular interactions between these domains and MHC class II molecules bears significant importance in the field of molecular immunology, as it holds the potential to inform the development of promising therapeutic strategies and elucidate the underlying pathological mechanisms of immune-related diseases.\u003c/p\u003e \u003cp\u003eHumanized mice are valuable tools for studying human gene function and replicating human physiological characteristics\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. While mouse \u003cem\u003eCd4\u003c/em\u003e shares an 80% homology with the human \u003cem\u003eCD4\u003c/em\u003e gene sequence\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e, the weak binding affinity between mouse CD4 and human MHC (i.e., the human leukocyte antigen (HLA)) class II molecules\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e has limited the use of mice in studying human CD4 or immunological phenotypes related to class II HLA. To address this challenge, researchers have often inserted full-length human \u003cem\u003eCD4\u003c/em\u003e into the mouse genome through transgenic approaches, which have provided many insights into the gene function of human CD4 and related pathological research\u003csup\u003e\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. However, these transgenic models have limitations, such as the risk of random mutations and ectopic expression\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e, the coexistence of endogenous mouse \u003cem\u003eCd4\u003c/em\u003e gene\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e, and the inability to study individual protein structural domains in vivo.\u003c/p\u003e \u003cp\u003eTo overcome these limitations, we utilized CRISPR/Cas9 precise gene editing technology\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e to develop hCD4 KI mice. Our optimized design strategy involved replacing the sequence encoding the D1 and D2 domains of mouse \u003cem\u003eCd4\u003c/em\u003e with the corresponding human \u003cem\u003eCD4\u003c/em\u003e sequence. The resulting hCD4 KI mice exhibited similar overall biological and immunological activity to \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e mice, albeit with altered thymocyte development.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eHumanization of mouse CD4 in hCD4 KI mice\u003c/h2\u003e \u003cp\u003eBoth mouse and human CD4 proteins' molecular structures and corresponding coding sequences (CDS) have been previously resolved, where their D1 and D2 domains were found to be encoded by exons 3, 4, and 5\u003csup\u003e24\u0026ndash;26\u003c/sup\u003e. Our goal was to investigate the interactions of D1 and D2 domains of human CD4 with other molecules while preserving the function of the rest parts of mouse CD4, thus we replaced only the CDS of these domains. To achieve precise and accurate humanization, we utilized the CRISPR/Cas9 technique to replace a portion (27\u0026ndash;168 bp) of mouse exon 3 with human exon 3 (27\u0026ndash;165 bp), completely replacing mouse exon 4 (162 bp) and exon 5 (237 bp) sequences with human exon 4 (159 bp) and exon 5 (234 bp), while retaining mouse extracellular domain 3 (D3) and domain 4 (D4), transmembrane and cytoplasmic domains (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea), as well as all the mouse intronic sequences. This resulted in the production of chimeric mouse/human CD4 protein. To optimize our targeting strategy and avoid negative effects on CRISPR-Cas9 editing efficiency, we constructed separate donor vectors for exon 3 and exons 4\u0026ndash;5, as there is a 6176 bp intron sequence between mouse exon 3 and exon 4. We successfully targeted and introduced exon 3 into the mouse first, followed by the introduction of exons 4\u0026ndash;5 (Supplementary Fig.\u0026nbsp;1).\u003c/p\u003e \u003cp\u003eGenotyping results showed that both alleles (exon 3 and exons 4\u0026ndash;5) were inherited on the same chromosome (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e mice were able to express both DNA and mRNA sequences encoding human and mouse D1 and D2, while \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e mice only expressed human D1 and D2 sequences, not mouse D1 and D2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec-d). Flow cytometry analysis of splenocytes demonstrated that \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e mice expressed both human CD4-D1 (hCD4-D1) and mouse CD4-D1 (mCD4-D1)\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e proteins on the cell surface, with the expression level of hCD4-D1 protein being approximately half that of \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e mice. \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e mice only expressed hCD4-D1 protein, not mCD4-D1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee), which was consistent with genotyping and quantitative PCR results.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eNormal growth, hematology and histology in hCD4 KI mice\u003c/h2\u003e \u003cp\u003eIn our study, we conducted detailed analyses of the appearance, size, cell count, and immunophenotyping of CD4-related immune organs\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e, specifically the spleen and thymus. For other essential physiological organs, we utilized basic visual comparison for evaluation. Our findings suggest that the overall appearance of hCD4 KI mice, including the condition of their hair, eyes, ears, nose, and other related areas, closely resembles that of \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea) In a comparative analysis of various organs, the size and shape of each organ in the hCD4 KI mice appeared similar to those in \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). To gain comprehensive insights into the health status of hCD4 KI mice, we performed extensive hematological and histological analyses. The complete blood cell count (CBC) reports revealed no significant variations in blood composition parameters between \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e mice and their \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e counterparts (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e and Table \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e). Moreover, there were no notable differences observed in body weight measurements (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec-d and Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e). Additionally, hematoxylin and eosin staining (H\u0026amp;E staining) of tissue sections showed no abnormalities or pathological changes, with similar tissue and cellular morphology observed among the groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee). Based on these comprehensive findings, we propose that partial humanization of CD4 in mice may not exert a substantial impact on their overall physiological function.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eAltered thymic development of T lymphocytes in hCD4 KI mice\u003c/h2\u003e \u003cp\u003eThe thymus of hCD4 KI mice displayed similar appearance, weight, length (Table S5), and total cell count to \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea-c). To evaluate the effect of humanized mouse CD4 on T lymphocyte development and lineage selection, we conducted a comprehensive analysis of thymocyte development. Specifically, we utilized the specific antibody against the domain 3 of mouse CD4 (mCD4-D3)\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e to detect the percentage of all CD4 proteins in mice. Our results revealed that both \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e mice displayed an increased percentage of double negative (DN) cells compared to \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). Furthermore, we examined the proportion of DN cell subsets based on CD25 and CD44 expression, and observed a reduction in DN3 cells in \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e mice, which subsequently recovered to levels similar to those in \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e mice at the DN4 stage (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). Moreover, during the single positive (SP) phase, a dosage-dependent decrease in CD4\u003csup\u003e+\u003c/sup\u003e SP cells was observed with the hCD4 KI, while CD8\u003csup\u003e+\u003c/sup\u003e SP cells exhibited a corresponding increase (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). These findings suggest that humanization of the D1 and D2 of mouse CD4 leads to altered T lymphocyte development.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eAbnormal immune cell composition in the peripheral lymphatic system of hCD4 KI mice\u003c/h2\u003e \u003cp\u003eThe spleen of hCD4 KI mice displayed similar appearance, weight, length (Supplementary Fig.\u0026nbsp;5), and total cell count to those of \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea-c). We then conducted a comprehensive analysis of the immunophenotype of spleen and peripheral blood mononuclear cells (PBMC) in \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e mice, with \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e mice as controls, to investigate the abnormal T lymphocyte development observed in the thymus. Consistent with the thymogenesis differences, we observed a dosage-dependent decrease in the percentage of mCD3\u003csup\u003e+\u003c/sup\u003emCD4\u003csup\u003e+\u003c/sup\u003e cells and a corresponding increase in the percentage of mCD3\u003csup\u003e+\u003c/sup\u003emCD8\u003csup\u003e+\u003c/sup\u003e T cells in the spleen and PBMC of \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e mice, resulting in a lower CD4/CD8 ratio (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef). The results from mCD4-D3\u003csup\u003e+\u003c/sup\u003e were confirmed by the summation of mCD4-D1\u003csup\u003e+\u003c/sup\u003e, mCD4-D1\u003csup\u003e+\u003c/sup\u003ehCD4-D1\u003csup\u003e+\u003c/sup\u003e, and hCD4-D1\u003csup\u003e+\u003c/sup\u003e percentages (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee).\u003c/p\u003e \u003cp\u003eWhile changes in T cell subsets were detected in the spleen and PBMC, the overall T cell count remained unchanged (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed), indicating compensation by CD8\u003csup\u003e+\u003c/sup\u003e T cells for the decreased amount of CD4\u003csup\u003e+\u003c/sup\u003e T cells. Additionally, the proportion of B cells was significantly reduced in the spleen of \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e mice, but there was no significant change in the proportion of B cells in PBMC (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed).\u003c/p\u003e \u003cp\u003eInterestingly, although normal naive, effector memory (EM), and central memory (CM) CD8\u003csup\u003e+\u003c/sup\u003e T cell subpopulations were detected in the spleen and PBMC of \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eh), the proportion of CM CD4\u003csup\u003e+\u003c/sup\u003e T cells in their spleens was significantly increased compared to \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e mice, while the proportion of EM CD4\u003csup\u003e+\u003c/sup\u003e T cells did not significantly differ (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg). These findings suggest active immune memory formation in hCD4 KI mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eNormal in vitro T cell responses in hCD4 KI mice\u003c/h2\u003e \u003cp\u003eTo assess the activation and proliferation potential of T cells in hCD4 KI mice, splenocytes were stimulated with anti-CD3/CD28 for 72 hours. The expression of activation markers CD44 and CD25, as well as the proliferation marker carboxyfluorescein diacetate succinimidyl ester (CFSE), were evaluated to determine the cellular biology and activity state. Our results showed that both mCD4-D3\u003csup\u003e+\u003c/sup\u003e and mCD8\u003csup\u003e+\u003c/sup\u003e T cells from \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e mice splenocytes were fully activated (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea), and secreted high levels of interferon-γ (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec). Additionally, proliferation analysis revealed that mCD4-D3\u003csup\u003e+\u003c/sup\u003e and mCD8\u003csup\u003e+\u003c/sup\u003e T cells from \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e mice splenocytes exhibited a robust proliferative response comparable to \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb). Thus, our findings suggest that T cells in hCD4 KI mice display a normal activation and proliferation response under stimulation conditions.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we employed CRISPR/Cas9 technology to generate hCD4 KI mice and performed a comprehensive physiological analysis. The results confirmed successful expression of chimeric mouse/human CD4 protein in mice. During our investigation, we observed altered T lymphocyte development in the thymus of hCD4 KI mice, characterized by an increase in DN cells and altered ratios of CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e SP cells. These findings align with observations made in mCD4-deficient mouse model\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e, suggesting that humanized CD4-D1 and D2 can influence CD4\u003csup\u003e+\u003c/sup\u003e T cell lineage selection. Previous research has indicated that hCD4 might exhibit greater affinity for certain mouse MHC class II molecules compared to mCD4\u003csup\u003e17\u003c/sup\u003e. However, replacing mCD4\u0026rsquo;s D3 and D4 with those from hCD4 resulted in reduced binding efficiency to TCR, presumably due to a decreased affinity of this chimeric CD4 for mouse MHC class II molecules\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Additionally, it has been shown that driving the expression of hCD4, driven by mouse \u003cem\u003eCd4\u003c/em\u003e gene enhancer, can compensate for mCD4-deficiency, restoring hCD4\u003csup\u003e+\u003c/sup\u003e SP cells in the thymus and hCD4\u003csup\u003e+\u003c/sup\u003e T cells in the peripheral blood\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. In our model, the hCD4 KI mice retained all native regulatory elements of mouse \u003cem\u003eCd4\u003c/em\u003e gene, yet exhibited thymic development similar to mCD4-deficient mice. Therefore, we hypothesize that the observed developmental discrepancies in the thymus are likely due to the differing affinities of mCD4 and the chimeric mouse/human CD4 for mouse MHC class II molecules. This difference in affinity may lead to variations in signal transduction intensity, influencing the differentiation of DP cells\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. Consequently, hCD4 KI mice tend to favor the production of mouse CD8\u003csup\u003e+\u003c/sup\u003e T cells rather than the chimeric mouse/human CD4\u003csup\u003e+\u003c/sup\u003e T cells during T cell lineage selection. As a result, the decrease in CD4\u003csup\u003e+\u003c/sup\u003e SP cells and the corresponding increase in CD8\u003csup\u003e+\u003c/sup\u003e SP cells are associated with the introduction of \u003cem\u003ehCD4\u003c/em\u003e. Our study provides a valuable foundation for further exploration of human CD4 application in mouse models. These insights into T cell development and lineage selection might have important implications for the use of hCD4 KI mice as a research tool in future studies.\u003c/p\u003e \u003cp\u003eThe abnormal T cell development observed in the thymus of hCD4 KI mice has subsequent impact on the peripheral lymphoid immune system. We found that this disruption led to a decrease in CD4\u003csup\u003e+\u003c/sup\u003e T cells and an increase in CD8\u003csup\u003e+\u003c/sup\u003e T cells in the spleen and PBMC of hCD4 KI mice, while the total number of T cells remained unchanged. These findings suggest that compensatory mechanisms may exist to maintain a balance in the number of T lymphocytes and to preserve normal immune function in vivo\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. However, we also observed an increase in the proportion of naive CD4\u003csup\u003e+\u003c/sup\u003e and CM CD4\u003csup\u003e+\u003c/sup\u003e cells in the spleen of hCD4 KI mice, indicating that they had been exposed to specific pathogens in the past. Despite the partial compensatory mechanisms, immunodeficiency may still increase susceptibility to pathogens and other health issues, as it is restricted by immune responses\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Therefore, these findings highlight the importance of understanding the impact of disrupted T cell development on the immune system and overall health of humanized mouse models. Further studies are needed to explore the potential long-term consequences of these compensatory mechanisms and their implications for translational research.\u003c/p\u003e \u003cp\u003eCD4\u003csup\u003e+\u003c/sup\u003e T cells are essential for normal B cell activation and function\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. In the absence of CD4\u003csup\u003e+\u003c/sup\u003e T cells, the stimulatory signals required for proper B cell activation are weakened, leading to abnormal B cell proliferation\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. Our study observed a reduction in the percentage of B cells in the spleen of hCD4 KI mice, which we attribute to the lower total number of CD4\u003csup\u003e+\u003c/sup\u003e T cells in these mice, resulting in weaker signal stimulation. We also hypothesize that the chimeric mouse/human CD4 may have reduced efficiency in interaction with MHC class II molecules of mouse B cells\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e, which requires further investigation to validate.\u003c/p\u003e \u003cp\u003eOur study shows that the chimeric mouse/human CD4 in hCD4 KI mice preserves most of the function of mouse CD4. The T cell function of hCD4 KI mice was evaluated and found to be comparable to \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e mice. The physiological analyses of hCD4 KI mice also showed no significant differences from \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e mice in terms of body weight, CBC reports, and tissue staining results. These results suggest that the chimeric mouse/human CD4 can play a similar role when mice partially or completely lack mouse CD4 protein, which is consistent with previous studies on humanized transgenic \u003cem\u003eCD4\u003c/em\u003e mice\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. In addition, our hCD4 KI mouse model not only offers an advantage by exclude potential disruptions from endogenous mouse \u003cem\u003eCd4\u003c/em\u003e genes, enhancing the accuracy and applicability of investigations of disease mechanisms and therapeutic approaches, but also provides a thorough characterization of hCD4 KI mice, establishing a foundation for their application in immunologically related research.\u003c/p\u003e \u003cp\u003ePrevious studies have shown normal T and B cell development in humanized mice expressing HLA class II, chimeric mouse/human CD4, T-cell receptor genes, chimeric mouse/human B2M and chimeric mouse/human CD8\u003csup\u003e41\u003c/sup\u003e. This suggests that hCD4 KI mice can be used with HLA class II KI mice, if available in the future, to improve abnormal thymocyte development and splenic B cell compartment. This approach can deepen our understanding of the affinity between chimeric mouse/human CD4 protein and HLA class II molecule, as well as its regulatory mechanism on T and B cells, thus advancing immune molecular biology. Combining these two models will also increase the reliability of hCD4 KI mice in studying immune-related diseases associated with MHC class II and CD4. According to this previous study, the physiological effect of multiple humanized mouse gene has revealed. However, our study uniquely focuses on the specific impact of a single humanized mouse gene on mouse physiology, which provides an important reference basis for future exploration of the role of other related genes.\u003c/p\u003e \u003cp\u003eIn summary, this study presents a sophisticated design strategy to develops hCD4 KI mice based on precise gene editing using CRISPR/Cas9 technology. The resulting hCD4 KI mice exhibited similar overall biological and immunological activity to \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e mice, albeit with altered thymocyte development manifested with changed proportion of lymphocyte subtypes in thymus, spleen and peripheral blood. Our study highlights the potential of hCD4 KI mice as a valuable research platform for investigating the dynamic interaction between CD4 and MHC class II molecules. Furthermore, a combined humanized CD4 and humanized MHC mice in the future might offer the opportunity to shed light on the pathogenic mechanisms of human immune-related diseases.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eAnimals were obtained from the National Taiwan University College of Medicine Laboratory Animal Center (NTUCM-LAC) (AAALAC accredited) and maintained in a specific pathogen-free (SPF) area with ad libitum access to food and water. Toes from neonatal mice within 1 week of birth were clipped for identification and genotyping, then housed by gender after weaning. Body weight was recorded weekly (detailed data see Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e) starting at 4 weeks of age. All animal experiments and care were conducted in accordance with the guidelines of the Institutional Animal Care and Use Committee (IACUC) at National Taiwan University College of Medicine. This study's animal use was approved by IACUC 20200108.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eGeneration of hCD4 KI mice\u003c/h2\u003e \u003cp\u003eWe used CRISPR/Cas9 technology to generate hCD4 KI mice on a C57BL/6J background that express the sequence of human CD4-D1 and CD4-D2 (NCBI gene ID: 12504). Cas9 RNA, sgRNA, and single-stranded DNA were designed or obtained using previously published methods\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. The targeting strategy and sgRNA design of CRISPR/Cas9 are presented in Supplementary Fig.\u0026nbsp;1. The sgRNA targeting sequences were as follows: sgRNA 1: 5'-TGTCACTCAAGGGAAGACGC-3', sgRNA 2: 5'-TGATTCCAAAAAAGGGGCAT-3', and sgRNA 3: 5'-AGAGTTGCTATCCAAGGTCA-3'. We repaired the mouse genome by inserting human \u003cem\u003eCD4\u003c/em\u003e exon 3 and exon 4\u0026ndash;5 sequences using single-stranded DNA. (human \u003cem\u003eCD4\u003c/em\u003e exon 3: 5\u0026rsquo;- GACAATAACGGTGCACGTGAGGACC ‐3\u0026rsquo; and 5\u0026rsquo;‐ GCTCTGGCTGTCACAGAACTCACTC ‐3\u0026rsquo;; human \u003cem\u003eCD4\u003c/em\u003e exon 4\u0026ndash;5: 5\u0026rsquo;‐ GTGTTCAGTTTGTAAGAGTGGTTGC ‐3\u0026rsquo; and 5\u0026rsquo;‐ GTCAGAGACCAGGACAATAGGTGTC ‐3\u0026rsquo;). Fertilized egg cells were injected with sgRNA and Cas9 nucleases, and founder mice were genotyped through PCR and Sanger DNA sequencing. The production of hCD4 KI mice was commissioned to the Transgenic Mouse Models Core Facility of the National Core Facility.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eGenotyping\u003c/h2\u003e \u003cp\u003eFor experimental grouping, we genotyped each founder mouse's offspring using the KAPA Mouse Genotyping Kit (R\u0026amp;D Systems), following the manufacturer's guidelines. To prepare the KAPA mix, an extraction mix was first created, consisting of 44 \u0026micro;L ddH\u003csub\u003e2\u003c/sub\u003eO, 5 \u0026micro;L 10x KAPA express Buffer, and 1 \u0026micro;L 1U/\u0026micro;L KAPA Express Extract Enzyme. Each mouse toes were then immersed in the KAPA mix and subjected to tissue lysis and DNA extraction by incubating at 75℃ for 30 minutes. The extracted DNA was diluted with ddH2O to 20 times its volume. Next, a PCR master mix was prepared by mixing 1 \u0026micro;L of diluted DNA (template DNA), 5 \u0026micro;L of 2X KAPA2G fast Hot Start Genotyping Mix (including dye), 3 \u0026micro;L of ddH2O, and 1 \u0026micro;L of primer. Two sets of primers were employed for genotyping (sequences see Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Finally, PCR amplification was performed under the following conditions: 3 mins at 95℃, 35 cycles of [15 sec at 95℃, 15 sec at 60℃, 30 sec at 72℃], 2 mins at 72℃ and hold at 16℃.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eIsolation of splenocytes and thymocytes\u003c/h2\u003e \u003cp\u003eTo isolate splenocytes and thymocytes, we first anesthetized 9-10-week-old mice and dislocated each cervical vertebrae to obtain spleen or thymus tissues form \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e, and \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e mice (the ratios of males to females were similar among the three groups). We then immersed the tissues in 5% fetal bovine serum (FBS) in 1\u0026times; PBS and gently ground them with a needle barrel before passing the suspension through a 70 \u0026micro;m cell strainer. Next, the single-cell suspension was subjected to red blood cell lysis using a solution containing 8.29g NH\u003csub\u003e4\u003c/sub\u003eCl, 1g KHCO\u003csub\u003e3\u003c/sub\u003e, and 0.02g EDTA. After washing the cells with 1\u0026times; PBS, the isolated splenocytes and thymocytes were collected for further experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eIsolation of PBMC\u003c/h2\u003e \u003cp\u003ePBMC were isolated from each 9-10-week-old \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e, and \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e mice (the ratios of males to females were similar among the three groups) using the following protocol. First, approximately 250 \u0026micro;l of blood was collected via cardiac puncture into a 0.5 ml EDTA anticoagulant tube. The blood was then mixed with 10 ml of red blood cell lysis solution and incubated for 10 minutes at room temperature. Next, the PBMC were isolated by washing the blood twice with 1\u0026times; PBS. The resulting PBMC were then collected and utilized for subsequent immunophenotyping analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was first isolated from splenocytes using TRIzol\u0026trade; Reagent (Life Technologies). Next, SuperScript\u0026trade; IV (Life Technologies) was used to reverse transcribe the RNA. Quantitative PCR was then performed on a BIO-RAD CFX Connect real-time PCR machine using the ORA\u0026trade; SEE qPCR Green ROX (highQu). Primer sequences are available in Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e. The PCR conditions included a 3 min initial denaturation at 95℃, followed by 40 cycles of denaturation at 95℃ for 10 sec, annealing and extension at 60℃ for 30 sec, and a final melting curve analysis. \u003cem\u003eB2m\u003c/em\u003e was used as an internal control for normalization. The 2-ΔΔCt formula was used for data analysis. All steps were carried out in accordance with the manufacturer's instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eImmunophenotyping\u003c/h2\u003e \u003cp\u003eA total of 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells (such as splenocytes, thymocytes or PBMC) were washed in flow staining buffer (2% FBS, 2mM EDTA). Next, the cells were suspended in 50 \u0026micro;l of flow staining buffer containing 1 \u0026micro;g of anti-mouse CD16/CD32 antibody (BioLegend) and incubated for 10 minutes at 4\u0026deg;C. After incubation, the diluted staining reagent (Supplementary Data 2) was added to achieve a final volume of 100 \u0026micro;l. The cells were then further incubated for 30 minutes at 4\u0026deg;C before being washed in flow staining buffer. Flow cytometry analysis was conducted using the Cytek\u0026trade; Aurora instrument, and the resulting data were analyzed using FlowJo 10.8.1 software. To ensure data consistency and reliability, we completed immunotyping on 21 mice aged 9\u0026ndash;10 weeks in one day. The process, including animal sacrifice, tissue extraction, and flow cytometry data collection, was conducted within 12 hours, reducing variability due to time differences.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eIn vitro activation and proliferation of T cells\u003c/h2\u003e \u003cp\u003eTo induce activation of T cells, we employed in vitro treatment with anti-CD3 and anti-CD28 (BioLegend), followed by flow cytometry analysis 72 hours post-stimulation. Splenocytes were isolated from 9-13-week-old mice and labeled with the CFSE Cell Division Tracker Kit (BioLegend) according to the manufacturer's protocol. Next, 3\u0026times;10\u003csup\u003e5\u003c/sup\u003e labeled splenocytes were seeded into each well of a 96-well plate and divided into control and anti-CD3/CD28 treatment groups (with a concentration of 5 \u0026micro;g/ml anti-CD3/CD28). The plate was then incubated at 37\u0026deg;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e incubator for 72 hours. For cell staining, all cells were washed and incubated first with anti-mouse CD16/CD32 antibody, and then stained with a diluted staining solution (Supplementary Data 2) for 30 minutes at 4\u0026deg;C, following the Immunophenotyping procedure. Finally, the stained cells were acquired using a BD FACSLyric\u0026trade; within 4 hours of staining and analyzed with FlowJo 10.8.1 software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eELISA measurement of cytokine\u003c/h2\u003e \u003cp\u003eSupernatants from cells treated with anti-CD3/CD28 were collected and stored at -20\u0026deg;C. Interferon-γ levels were measured using an ELISA kit (R\u0026amp;D Systems, McKinley Place NE, Minneapolis, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eHematological analysis\u003c/h2\u003e \u003cp\u003eBlood samples were obtained from 9-10-week-old mice via cardiac puncture, and approximately 250 \u0026micro;L of blood was collected into a 0.5 mL EDTA anticoagulant tube. Within 3 hours, the samples were sent to NTUCM-LAC (ISO17025 accredited) for analysis using the IDEXX ProCyte Dx* Hematology Analyzer. The CBC analysis included measurement of red blood cell count, hemoglobin level, hematocrit level, mean corpuscular volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration, reticulocyte count, platelet count, white blood cell count, neutrophils count, lymphocytes count, monocytes count, eosinophils count, and basophils count (detailed data see Table \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eHistological analysis\u003c/h2\u003e \u003cp\u003eTissue samples were obtained from the brain, thymus, heart, lung, spleen, liver, kidney and intestine of 11-12-week-old mice and fixed in 4% paraformaldehyde for two days. The fixed tissues were subjected to standard tissue embedding, sectioning, and staining protocols at NTUCM-LAC, and the resulting tissue sections were examined for morphological changes under a Life EVOS microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eIn this study, sample sizes were determined based on prior experimental experience, not specific statistical methods. Details are in the figure legends and Supplementary Data-1. Additionally, all data points were included in the analysis without any exclusions. We performed statistical analysis using PRISM software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.graphpad.com/features\u003c/span\u003e\u003cspan address=\"https://www.graphpad.com/features\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), as well as used one-way or two-way ANOVA with Tukey's multiple comparison test to compare the three groups of \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e (control group), \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e, and \u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e (experiment groups) mice. The level of statistical significance was set as follows: *\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, and ****\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001. To verify if the data met the basic assumptions of ANOVA, we utilized Levene's test. In cases where the assumptions were not met, we employed Brown-Forsythe and Welch ANOVA, complemented with Dunnett's T3 method for statistical analysis.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003eCompeting Interests\u003c/h2\u003e \u003cp\u003eThe authors affirm that there are no conflicts of interest associated with this manuscript.\u003c/p\u003e\u003ch2\u003eAuthor contributions\u003c/h2\u003e \u003cp\u003eKa-Man Kam, Ya-Hui Chuang, and Pei-Lung Chen were responsible for designing this study. Ka-Man Kam, Tsz-En Shiu, Chien-Ming Hsieh, Wen-Ting Lu, and Yu-Yun Pan assisted in collecting mouse tissues and samples. Ka-Man Kam conducted the statistical analysis. Ya-Hui Chuang, I-Shing Yu, and Pei-Lung Chen supervised and coordinated the entire research process. Ka-Man Kam, Ya-Hui Chuang, I-Shing Yu, and Pei-Lung Chen jointly wrote and revised the manuscript. Funding for this study was provided by Pei-Lung Chen.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eWe would like to express our gratitude to the following organizations for their support in conducting this study: Transgenic Mouse Models Core Facility at the National Core Facility for Biopharmaceuticals, National Science and Technology Council, Taiwan; Seventh and Third Core Labs of the Department of Medical Research at National Taiwan University Hospital; and the NTUCM-LAC.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKervevan, J. \u0026amp; Chakrabarti, L.A. Role of CD4\u0026thinsp;+\u0026thinsp;T Cells in the Control of Viral Infections: Recent Advances and Open Questions. Int J Mol Sci 22 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuckheeram, R.V., Zhou, R., Verma, A.D. \u0026amp; Xia, B. CD4(+)T cells: differentiation and functions. \u003cem\u003eClin Dev Immunol\u003c/em\u003e 2012, 925135 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSwain, S.L., McKinstry, K.K. \u0026amp; Strutt, T.M. Expanding roles for CD4(+) T cells in immunity to viruses. Nat Rev Immunol 12, 136\u0026ndash;148 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGermain, R.N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol 2, 309\u0026ndash;322 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorch, A.M., Balint, S., Santos, A.M., Davis, S.J. \u0026amp; Dustin, M.L. Coreceptors and TCR Signaling - the Strong and the Weak of It. Front Cell Dev Biol 8, 597627 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, Y., Yin, Y. \u0026amp; Mariuzza, R.A. Structural and biophysical insights into the role of CD4 and CD8 in T cell activation. Front Immunol 4, 206 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJaneway, C.A., Jr. The co-receptor function of CD4. Semin Immunol 3, 153\u0026ndash;160 (1991).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee, M.S. et al. Enhancing and inhibitory motifs regulate CD4 activity. Elife 11 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVignali, D.A., Doyle, C., Kinch, M.S., Shin, J. \u0026amp; Strominger, J.L. Interactions of CD4 with MHC class II molecules, T cell receptors and p56lck. Philos Trans R Soc Lond B Biol Sci 342, 13\u0026ndash;24 (1993).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, J.H. et al. Crystal structure of the human CD4 N-terminal two-domain fragment complexed to a class II MHC molecule. Proc Natl Acad Sci U S A 98, 10799\u0026ndash;10804 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVignali, D.A. \u0026amp; Vignali, K.M. Profound enhancement of T cell activation mediated by the interaction between the TCR and the D3 domain of CD4. J Immunol 162, 1431\u0026ndash;1439 (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, L. et al. Role of human CD4 D1D2 domain in HIV-1 infection. Immunol Invest 42, 106\u0026ndash;121 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoebius, U. et al. Human immunodeficiency virus gp120 binding C'C\" ridge of CD4 domain 1 is also involved in interaction with class II major histocompatibility complex molecules. Proc Natl Acad Sci U S A 89, 12008\u0026ndash;12012 (1992).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerez-Jimenez, R. et al. Probing the effect of force on HIV-1 receptor CD4. ACS Nano 8, 10313\u0026ndash;10320 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYong, K.S.M., Her, Z. \u0026amp; Chen, Q. Humanized Mice as Unique Tools for Human-Specific Studies. Arch Immunol Ther Exp (Warsz) 66, 245\u0026ndash;266 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYatsuda, J. et al. Establishment of HLA-DR4 transgenic mice for the identification of CD4\u0026thinsp;+\u0026thinsp;T cell epitopes of tumor-associated antigens. PLoS One 8, e84908 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKonig, R., Huang, L.Y. \u0026amp; Germain, R.N. MHC class II interaction with CD4 mediated by a region analogous to the MHC class I binding site for CD8. Nature 356, 796\u0026ndash;798 (1992).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLores, P. et al. Expression of human CD4 in transgenic mice does not confer sensitivity to human immunodeficiency virus infection. AIDS Res Hum Retroviruses 8, 2063\u0026ndash;2071 (1992).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeay, K. et al. Mice transgenic for CD4-specific human CD4, CCR5 and cyclin T1 expression: a new model for investigating HIV-1 transmission and treatment efficacy. PLoS One 8, e63537 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrowning, J. et al. Mice transgenic for human CD4 and CCR5 are susceptible to HIV infection. Proc Natl Acad Sci U S A 94, 14637\u0026ndash;14641 (1997).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaruyama, N., Cho, A. \u0026amp; Kulkarni, A.B. Overview: engineering transgenic constructs and mice. \u003cem\u003eCurr Protoc Cell Biol Chap. 1\u003c/em\u003e9, Unit 19 10 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, M., Kretzschmar, D., Verdile, G. \u0026amp; Lardelli, M. in Animal Models for the Study of Human Disease. (ed. P.M. Conn) 595\u0026ndash;632 (Academic Press, Boston; 2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoshimi, K. et al. ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nature communications 7, 10431 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaing, K.J. et al. Evolution of the CD4 family: teleost fish possess two divergent forms of CD4 in addition to lymphocyte activation gene-3. J Immunol 177, 3939\u0026ndash;3951 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoscariol, R., Pleasance, J., Piedrafita, D.M., Raadsma, H.W. \u0026amp; Spithill, T.W. Identification of two allelic forms of ovine CD4 exhibiting a Ser183/Pro183 polymorphism in the coding sequence of domain 3. Vet Immunol Immunopathol 113, 305\u0026ndash;312 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHelling, B. et al. A specific CD4 epitope bound by tregalizumab mediates activation of regulatory T cells by a unique signaling pathway. Immunol Cell Biol 93, 396\u0026ndash;405 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarimi, M.M. et al. The order and logic of CD4 versus CD8 lineage choice and differentiation in mouse thymus. Nat Commun 12, 99 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLewis, S.M., Williams, A. \u0026amp; Eisenbarth, S.C. Structure and function of the immune system in the spleen. Sci Immunol 4 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahemtulla, A. et al. Normal development and function of CD8\u0026thinsp;+\u0026thinsp;cells but markedly decreased helper cell activity in mice lacking CD4. Nature 353, 180\u0026ndash;184 (1991).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim, D.K., Tahara-Hanaoka, S., Shinohara, N. \u0026amp; Nakauchi, H. A human mutant CD4 molecule resistant to HIV-1 binding restores helper T-lymphocyte functions in murine CD4-deficient mice. Exp Mol Med 39, 1\u0026ndash;7 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVignali, D.A., Carson, R.T., Chang, B., Mittler, R.S. \u0026amp; Strominger, J.L. The two membrane proximal domains of CD4 interact with the T cell receptor. J Exp Med 183, 2097\u0026ndash;2107 (1996).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKilleen, N., Sawada, S. \u0026amp; Littman, D.R. Regulated expression of human CD4 rescues helper T cell development in mice lacking expression of endogenous CD4. EMBO J 12, 1547\u0026ndash;1553 (1993).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSinger, A., Adoro, S. \u0026amp; Park, J.H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol 8, 788\u0026ndash;801 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNish, S. \u0026amp; Medzhitov, R. Host defense pathways: role of redundancy and compensation in infectious disease phenotypes. Immunity 34, 629\u0026ndash;636 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao, N., Zhang, T., Zhao, Y., Zhang, J. \u0026amp; Wang, K. CD3(+)T, CD4(+)T, CD8(+)T, and CD4(+)T/CD8(+)T Ratio and Quantity of gammadeltaT Cells in Peripheral Blood of HIV-Infected/AIDS Patients and Its Clinical Significance. \u003cem\u003eComput Math Methods Med\u003c/em\u003e 2021, 8746264 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-Brolosy, M.A. \u0026amp; Stainier, D.Y.R. Genetic compensation: A phenomenon in search of mechanisms. PLoS Genet 13, e1006780 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchwartz, M.A., Kolhatkar, N.S., Thouvenel, C., Khim, S. \u0026amp; Rawlings, D.J. CD4\u0026thinsp;+\u0026thinsp;T cells and CD40 participate in selection and homeostasis of peripheral B cells. J Immunol 193, 3492\u0026ndash;3502 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalia, V., Sarkar, S., Gourley, T.S., Rouse, B.T. \u0026amp; Ahmed, R. Differentiation of memory B and T cells. Curr Opin Immunol 18, 255\u0026ndash;264 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJaneway, C. \u0026amp; Janeway, C. Immunobiology: the immune system in health and disease, Edn. 5th. (Garland Pub, New York; 2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaw, Y.M. et al. Human CD4 restores normal T cell development and function in mice deficient in murine CD4. J Exp Med 179, 1233\u0026ndash;1242 (1994).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoore, M.J. et al. Humanization of T cell-mediated immunity in mice. Sci Immunol 6, eabj4026 (2021).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":false,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4299701/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4299701/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHumanized mouse models have become indispensable tools for investigating human gene function and disease modeling. However, conventional transgenic approaches carry the risk of unforeseen biological consequences. To address this concern, we developed a novel human \u003cem\u003eCD4\u003c/em\u003e knock-in mouse model (hCD4 KI mice) using CRISPR/Cas9 gene editing technology. We replaced the region encoding the first two major extracellular domains of the mouse \u003cem\u003eCd4\u003c/em\u003e gene, which are critical for interaction with major histocompatibility complex (MHC) class II, with the corresponding human CD4 sequence. Subsequently, we conducted comprehensive physiological and immune system analyses on hCD4 KI mice, including both heterozygous (\u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/h\u003c/em\u003e\u003c/sup\u003e) and homozygous (\u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003eh/h\u003c/em\u003e\u003c/sup\u003e) genotypes. Our investigations revealed a dosage-dependent impact of the hCD4 KI, resulting in a decrease population of CD4\u003csup\u003e+\u003c/sup\u003e single positive (SP) cells, accompanied by a corresponding increase in CD8\u003csup\u003e+\u003c/sup\u003e SP cells within the thymus. These developmental alterations, evident in thymus, were also observed in the peripheral lymphatic system such as the spleen and in the peripheral blood, exhibiting an increased population of mature CD8\u003csup\u003e+\u003c/sup\u003e T cells and a decreased proportion of mature CD4\u003csup\u003e+\u003c/sup\u003e T cells. Despite these changes, hCD4 KI mice exhibited normal biological characteristics, including T cell activation and proliferation functions, blood composition, tissue structure, and body weight, closely resembling those of wild-type (\u003cem\u003eCD4\u003c/em\u003e\u003csup\u003e\u003cem\u003em/m\u003c/em\u003e\u003c/sup\u003e) mice. Our study underscores hCD4 KI mice as a valuable tool for exploring CD4 and MHC class II interactions, with potential for future integration with humanized MHC class II KI mice, offering insights into immune disease mechanisms.\u003c/p\u003e","manuscriptTitle":"Generation and characterization of humanization CD4 knock-in mice expressing chimeric mouse/human CD4 protein","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-22 06:26:21","doi":"10.21203/rs.3.rs-4299701/v1","editorialEvents":[],"status":"published","journal":{"display":false,"email":"[email protected]","identity":"lab-animal","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"laban","sideBox":"Learn more about [Lab Animal](http://www.nature.com/laban/)","snPcode":"","submissionUrl":"","title":"Lab Animal","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Research","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"5c53968d-8f3f-4225-a352-4b7e8a2e7efa","owner":[],"postedDate":"May 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":32216706,"name":"Biological sciences/Immunology/Translational immunology"},{"id":32216707,"name":"Biological sciences/Immunology/Lymphoid tissues/Spleen"},{"id":32216708,"name":"Biological sciences/Immunology/Lymphoid tissues/Thymus"},{"id":32216709,"name":"Biological sciences/Immunology/Haematopoiesis/Lymphopoiesis"},{"id":32216710,"name":"Biological sciences/Biological techniques/Biological models/Immunological models"}],"tags":[],"updatedAt":"2025-09-30T13:15:23+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-22 06:26:21","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4299701","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4299701","identity":"rs-4299701","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}