Uncovering functional insights into human pathogenic variants in CDK19 using Drosophila models

Uncovering functional insights into human pathogenic variants in CDK19 using Drosophila models | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Uncovering functional insights into human pathogenic variants in CDK19 using Drosophila models Karampal S. Grewal , Christopher Tam , Jenny Zhe Liao , View ORCID Profile Esther M. Verheyen doi: https://doi.org/10.1101/2025.09.10.675453 Karampal S. Grewal 1 Department of Molecular Biology and Biochemistry, Simon Fraser University , Burnaby, British Columbia, Canada V5A 1S6 2 Centre for Cell Biology, Development and Disease, Simon Fraser University , Burnaby, British Columbia, Canada V5A 1S6 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Christopher Tam 1 Department of Molecular Biology and Biochemistry, Simon Fraser University , Burnaby, British Columbia, Canada V5A 1S6 2 Centre for Cell Biology, Development and Disease, Simon Fraser University , Burnaby, British Columbia, Canada V5A 1S6 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jenny Zhe Liao 1 Department of Molecular Biology and Biochemistry, Simon Fraser University , Burnaby, British Columbia, Canada V5A 1S6 2 Centre for Cell Biology, Development and Disease, Simon Fraser University , Burnaby, British Columbia, Canada V5A 1S6 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Esther M. Verheyen 1 Department of Molecular Biology and Biochemistry, Simon Fraser University , Burnaby, British Columbia, Canada V5A 1S6 2 Centre for Cell Biology, Development and Disease, Simon Fraser University , Burnaby, British Columbia, Canada V5A 1S6 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Esther M. Verheyen For correspondence: everheye{at}sfu.ca Abstract Full Text Info/History Metrics Preview PDF Abstract Heterozygous missense variants in CDK19 have been found in patients diagnosed with Developmental and epileptic encephalopathy-87 (DEE87) who present with global developmental delay, intellectual disability and other muscular and neurological deficiencies. Two missense variants in CDK19, Y32H and T196A , were first proposed to be dominant negative in nature based on experiments in a Drosophila model. Subsequently, another group proposed that Y32H is a gain of function based on elevated kinase activity. We present a detailed evaluation of the activity and functionality of these dominant variants in several contexts in fly models of DEE-87 in which endogenous cdk8 , the fly ortholog of human CDK8 and CDK19 , is knocked down while we overexpressed the human genes. Depletion of Drosophila cdk8 causes thicker muscle myofibrils, fused mitochondria, and climbing defects. The expression of human CDK19 WT in a fly cdk8-RNAi background rescues these defects, highlighting functional conservation. To investigate functional differences between the variants, we compared effects of variants to expression of wildtype CDK19. Ubiquitous expression of Y32H can rescue the cdk8 knockdown phenotype through a gain of function compensatory effect, while T196A is unable to do so through a possible reduction in kinase activity. We found that supplementation of the antioxidant drug, N-acetylcysteine amide (NACA), rescues phenotypes of only the T196A adult flies, illustrating a divergence in variant functionality. Our studies in flies allowed us to assay these variants in numerous contexts to gain further insight into their mechanism and obtain translational knowledge to apply back to human health. Introduction Decades of research have established Drosophila as a powerful tool for investigating fundamental biological processes and in understanding human disease mechanisms and functions of rare disease gene variants ( 1 – 3 ). Elegant and diverse assays can be used in flies to probe functional differences between patient variants, which may provide insights into therapeutic interventions. Here we describe our work to understand two patient missense variants in the human CDK19 protein. Cyclin dependent kinase 19 (CDK19) and its paralog, Cyclin dependent kinase 8 (CDK8) are both classified as CDKs that regulate transcription ( 4 , 5 ). They can both bind to their partner cyclin, Cyclin C, and other mediator proteins to form a conserved kinase module that can interact with RNA polymerase II to modulate gene expression, as has been shown across genera ( 4 , 6 ). We recently showed that Cdk8 and CDK19 can regulate mitochondrial dynamics in fly tissues by promoting activity of the fission regulator Dynamin-related protein 1 (Drp1) ( 7 ). Furthermore, reduced Cdk8 function can result in build-up of Reactive Oxygen Species (ROS). Aberrant activity or enhanced gene expression of either CDK19 or CDK8 has been linked to diverse ailments in humans, including cancer and developmental syndromes ( 8 – 12 ). A syndrome that is linked to de novo heterozygous missense variants of CDK19 was termed Developmental Epilepsy and Encephalopathy-87 (DEE87) (OMIM 618916) ( 9 , 10 , 13 , 14 ). Patients harbouring variants of CDK19 present with global developmental delay, intellectual disability and other neuromuscular deficiencies including ataxia and hypotonia ( 10 ). Drosophila has one ortholog to human CDK19/CDK8 termed Cdk8. cdk8 mutant flies die at late larval stages ( 15 ). Depletion of cdk8 using RNAi in flies causes muscle defects, seizure susceptibility, and reduced locomotion ( 7 , 10 ). Depletion of cdk8 can be phenotypically rescued by expression of wild-type human CDK19 ( 7 , 10 ). This showcases the functional conservation of these orthologues and paves the way to further investigate effects of expressing patient variants in a cdk8 depleted background as has been done previously to show their pathogenicity ( 10 ). Two de novo missense variants of human CDK19 , Y32H and T196A , were the first variants of CDK19 to be characterized ( 10 ). The variant Y32H, in which a conserved tyrosine is replaced by a histidine, resides in the Gly-rich loop implicated in ATP binding. In the T196A variant, a threonine is replaced by an alanine at amino acid position 196 which is located within the predicted activation loop implicated in kinase activation and substrate phosphorylation ( 10 , 14 ). The clinical description of the variant expressing patients was accompanied by experiments in Drosophila to gain functional insight into the variants. Using an RNAi-based approach to severely deplete fly cdk8 , the patient variants Y32H and T196A were then expressed using the GAL4-UAS system, and various fly phenotypes were then assessed. The strategy of these experiments was to compare phenotypes found when expressing either Y32H or T196A in a cdk8 depleted background compared to effects of CDK19 WT (WT) in the same background. The authors tested numerous parameters including viability, lifespan, and sensitivity to mechanical stimulus ( 10 ). A theme emerged in their work that pointed towards a possible dominant negative nature of these variants. They proposed this based on their results showcasing that depleting cdk8 and then expressing either Y32H or T196A led to effects similar or worse than depletion of cdk8 alone, indicating that the variants are possibly interfering with the function of the residual Cdk8 in the adult flies. Another group of researchers aimed to dissect the nature of several de novo missense variants using a Zebrafish model ( 14 ). In their work, they looked at Y32H and assessed its kinase activity in vitro by determining the phospho-status of known targets of CDK19 ( 14 ). They observed that Y32H had elevated autophosphorylation and target phosphorylation compared to CDK19 WT , leading them to postulate that Y32H may be a gain of function missense variant. While they did not assess T196A directly, they suggested that it may be a loss of kinase function variant like another variant (G28R) they characterized ( 14 ). In Zebrafish assays they found that both variants caused dominant pathogenic phenotypes, despite having opposite effects on kinase activity. In this current study, we aimed to further investigate and reconcile the proposed natures of the variants Y32H and T196A by studying effects of these variants on viability, lifespan, muscle function and morphology. Our lab has previously described numerous defects due to depletion of Drosophila cdk8 in indirect flight muscles, which served as valuable readouts of variant function ( 7 ). In the current study we used a genetic background in which cdk8 was depleted and the patient variant or wildtype CDK19 genes were expressed. Under these experimental conditions, ubiquitous depletion of cdk8 yields reduced lifespan, climbing defects, and muscle and mitochondrial morphology defects that can be phenotypically rescued by expression of CDK19 WT . In addition, we show that expression of Y32H or T196A in this model is pathogenic at 29°C where the activity of GAL4 driving transgene expression is higher, but at 25°C Y32H shows no pathogenicity while T196A maintains its pathogenicity causing semi-lethality, suggesting that these experimental conditions would allow us to dissect functions in a less pathogenic context. We show that the cdk8 knockdown climbing defect and muscle mitochondrial morphology can be phenotypically rescued by CDK19 WT and Y32H but not T196A. It was previously shown that fly Cdk8 can phosphorylate Drp1 in vivo at S616 to induce mitochondrial fission ( 7 ). By extension of functional conservation, the same may be said for CDK19. We find evidence that Drp1 phosphorylation at S616 is elevated in the muscle tissue of Y32H flies and significantly reduced in T196A flies. This is supportive of gain of function and dominant negative hypotheses for the two variants, respectively. Further we show that T196A phenotypes can be phenotypically rescued by supplementation of the antioxidant drug NACA which also effectively reduces the ROS level in T196A fly adult muscle to control levels. The Y32H muscle mitochondrial morphology is unaffected compared to CDK19 WT control group and there is no notable effect to the ROS level upon NACA supplementation. In summary, we present our model to further dissect the nature of two de novo missense variants that may be applied to study other variants that may be linked to DEE87 or other syndromes in humans. We provide evidence that in numerous contexts Y32H acts as a gain of function variant while T196A acts as a dominant negative or inactive kinase. Notably, both of these effects are dominantly pathogenic and associated with similar clinical presentation. Our findings raise the possibility of assessing NACA supplementation in treating the symptoms of human patients and looking at a variant-specific treatment regime in the future. Our studies further highlight the need for diverse functional analyses to dissect variant function in human syndromes. Results CDK19 variants Y32H and T196A localize to unique regions in the CDK19 protein possibly in close spatial proximity The amino acid substitutions in CDK19 associated with DEE87 which we have characterized are found to localize to two distinct regions of the protein, namely the ATP binding domain and the activation domain ( Fig. 1A ). Numerous additional de novo missense CDK19 patient variants have been found in these domains ( 10 , 13 , 14 ). Upon predictive protein modelling and annotation, these residues may be in close proximity with one another in the three dimensional protein structure ( Fig. 1B ) ( 16 , 17 ), since the region binding ATP needs to contact the activation segment to phosphorylate substrates ( 18 ). Patients have one wild-type allele and one dominantly acting variant allele of CDK19 ( Fig. 1C ). We have leveraged the GAL4/UAS system in Drosophila to study Drosophila models for DEE87. In these models, an RNAi-based knockdown of endogenous fly cdk8 is combined with expression of either wild-type human CDK19 ( CDK19 WT ) or a de novo missense variant ( Fig. 1C ). These conditions have been used by other groups to induce varying phenotypic severities ( 7 , 10 ). A summary illustration highlights the patient genetic environment with respect to CDK 19 and the fly model that can be used to study these patient variants. We find that the exogenous CDK19 W T and the two variant proteins are expressed at comparable levels in adult tissues (Fig. S1A) and that these proteins are abundant in cytoplasmic and nuclear fractions, consistent with our previous work ( 7 ). Given that they are expressed at equivalent amounts, we can compare functional differences based on their phenotypes in fly tissues. Download figure Open in new tab Figure 1. CDK19 variant localization on protein sequence and model. ( A) Human CDK19 protein sequence cartoon highlighting the amino acid substitutions, p.Tyr32His and p.Thr196Ala, each resulting from a de novo missense mutation. Protein sequence alignments of the Y32 and T196 regions for each variant with respect to reference CDK19 using Benchling Molecular Biology Software. (B) AlphaFold2 protein model for human CDK19 WT (UniProt ID Q9BWU1) with an enlarged field of view of the two amino acid locations: p.Y32 shown in orange and p.T196 shown in yellow. (C) Graphical representation of the model used in the paper leveraging the Gal4/UAS system for both expression of a fly cdk8-RNAi construct and human CDK19 X cDNA construct ( x = WT, Y32H, T196A ) and the patient genetic environment for context. Modulating ectopic expression of Y32H and T196A in a cdk8 knockdown background causes variable effects on fly eclosion and lifespan It has previously been shown that cdk8 homozygous mutant flies die at early larval stages of development ( 15 ) and this effect can be phenotypically rescued upon ubiquitous expression of either fly cdk8 or human CDK19 using actin-Gal4 ( 10 ). In contrast, the patient variants Y32H and T196A are unable to rescue viability in this same background ( 10 ). We find that using daughterless-Gal4 ( da-Gal4 ) to perform RNAi-based ubiquitous knockdown of fly cdk8 at 29°C, yields a reduction in eclosion of viable adult flies ( Fig. 2A ). Expression of CDK19 WT in this background produces a rescue to control levels ( Fig. 2A ). Expression of either Y32H or T196A in this fly cdk8 depleted background is highly pathogenic and there is a significant reduction in the percent of progeny that eclose as adults compared to the CDK19 WT rescue group ( Fig. 2A ). We found that at 29°C the percent of pupae eclosed in the Y32H and T196A groups are roughly 3.2% and 0.5% respectively, significantly lower than cdk8 depletion alone (Fig. S2A). This further reduction in viability in the variant groups compared to the cdk8-RNAi group illustrates a dominant effect of these variants on the remaining endogenous fly Cdk8, though it is not clear what causes the pathogenicity. Download figure Open in new tab Figure 2. Expression of Y32H and T196A in a cdk8 knockdown background causes variable effects to fly eclosion and lifespan. (A) Percent of pupae eclosed as adults when ubiquitously expressing the variants in a ubiquitous fly cdk8 knockdown background at 29°C and (B) 25°C (n=3 biological replicates per genotype). Statistical analyses are ordinary one-way ANOVA followed by a Dunnett multiple comparisons test. Results are mean ± s.e.m. (***p < 0.001 ****p 45 flies per genotype, n=3 biological replicates). Statistical analyses are a log rank score for survival trends (χ 2 = 18.98, p = 8.0e-04). Results are average percent viable from n=3 biological replicates. GAL4 activity is temperature dependent ( 19 ), thus raising flies at 25°C instead of 29°C reduces the degree of the cdk8 knockdown and abrogates the eclosion defect in the cdk8 knockdown group, resulting in eclosion consistent with control flies ( Fig. 2B ). Under these experimental conditions cdk8 was significantly knocked down to roughly 30% of control fly cdk8 expression levels (Fig. S1B) and all test groups showed a residual cdk8 expression that is not significantly different from the cdk8-RNAi group (Fig. S1C). This less severe knockdown reduces the effect on viability but provides a sensitized background in which to investigate variant functions more fully. Strikingly, we found that expression of Y32H in the cdk8 knockdown background at 25°C did not cause a pathogenic effect on eclosion of adults as was seen at 29°C and there is no significant difference in the percent eclosion between the cdk8-RNAi and CDK19 Y32H groups (Fig. S2B). In contrast, expression of T196A was dominantly pathogenic in this sensitized background with only roughly 12% of pupae eclosing as adults, significantly lower than the CDK19 WT group ( Fig. 2B ) and cdk8 knockdown group (Fig. S2B) respectively. These findings demonstrate that the variants are functionally distinct, highlighting the need for further research. Thus, we selected the 25°C conditions for our further work to investigate the functional consequences of these two variants, compared to the CDK19 WT and cdk8 depletion genotypes. This provides two-fold insight, in that we can assess functional conservation or dominant effects of these variants with respect to the wild-type CDK19 and the endogenous fly Cdk8, respectively. Our initial characterizations mirror analyses performed by Chung et al., with the key difference being that in their assays depletion of cdk8 alone caused 95% lethality, with few escapers, while under our assay conditions, cdk8 depletion resulted in reduced viability at 29°C but no effect on viability at 25°C. In this context, we could more easily assess distinct effects of the variants. We next assessed adult fly lifespan at 25°C as a readout for overall fly health by determining how long flies of each genotype lived ( Fig. 2C ) and extrapolating the time at which 50% of flies had died and 50% still survived ( Fig. 2D ). Upon carrying out a Kaplan-Meier analysis (log-rank score) to obtain a chi-squared (χ 2 ) value for these lifespan data ( 20 ), the χ 2 was 18.98 and from this we obtained a p-value of 8e-04 indicating a significant difference in the lifespan of these groups ( Fig. 2C ). Under these assay conditions the respective days of 50% viability were 51 days for the white-RNAi control group and 29 days for the cdk8-RNAi group ( Fig. 2D ). Expression of CDK19 WT in the cdk8 depleted background rescues lifespan with 50% viability climbing to around Day 46, while the Y32H and T196A groups reached 50% viability around Day 27 and Day 12 respectively ( Fig. 2D ). The T196A group showed an early drop off in survival compared to all other groups while Y32H behaved like the cdk8 knockdown alone and the CDK19 WT group performed relatively in line with the control group ( Fig. 2C-D ). We also found that under these experimental conditions, Y32H expression while having no effect to eclosion at 25°C ( Fig. 2B ), does affect fly lifespan, though T196A affects lifespan to a greater severity. We note that there are less viable adult flies from the T196A group compared to the other groups and this severe reduction in the number of T196A progeny would imply that the viable flies that successfully eclose are escapers. For this lifespan assessment we had to compensate for this reduction in progenies by amplifying the number of replicate mating vials. To account for this going forward in our work, we selected flies in groups of n = 5 per experimental replicate for subsequent experiments. We observed distinct lethality phenotypes from these T196A progenies that were unable to fully develop or eclose. These included elongated L3, a deformed L3-pre-pupa in a pupal case, and some pharate progenies (Fig. S2C). Y32H can rescue fly cdk8 depletion climbing defects like wild-type CDK19 while T196A does not In the lifespan assessment, we noted that the T196A group is affected earliest and significantly compared to all other groups, notably the Y32H or wild-type CDK19 groups when comparing the day of 50% viability ( Fig. 2C-D ). We also noted that there are less viable adult flies from the T196A group compared to the other groups. Taking these factors into consideration, we wanted to choose an adult lifecycle timepoint that would allow us to consistently assess phenotypes without running into lethality issues. Therefore, we selected flies at the three-day old stage for further assessments which is a well-used stage across Drosophila literature and also consistent with staging used to assess adult phenotypes caused by cdk8 depletion ( 7 ). These adjustments allowed us to obtain a sustainable number of flies per genotype and perform a greater number of experimental replicates to compensate for the reduced number of T196A adults. By controlling for this as the limiting group and normalizing the group assessment size to the T196A fly group, our experimental comparisons are more robust as well. With these insights in mind, we recalled that patients harbouring these dominant de novo missense variants of CDK19 present with neuromuscular defects ( 10 ) and that these phenotypes are conserved in flies with severely depleted cdk8 ( 7 , 10 ) we therefore set out to assess adult fly climbing ability as illustrated ( Fig. 3A ) as a readout for neuromuscular function. Download figure Open in new tab Figure 3. Y32H rescues cdk8 knockdown climbing defects like wild-type CDK19, while T196A does not. (A) Graphical representation of fly climbing assessment for the listed genotypes. (B) Average percent of flies that reach ≥ 5 cm (target line) for the indicated genotypes. Each experiment was individually repeated six times (n = 6 biological replicates and n = 30 adult males per genotype). Statistical analyses are ordinary one-way ANOVA followed by a Dunnett multiple comparisons test. Results are shown as bar plots with mean height reached ± s.e.m. (****p < 0.0001, ns no significance). (C) Violin plots showcasing climbing distribution as an entire group by plotting the per trial height climbed by each fly for five replicate climbing trials for all independent experimental replicates. We measured the percentage of flies of a given genotype which could climb to or above the 5 cm line as an endpoint assessment and the height climbed for all tested flies in each individual trial as a group assessment in the set time limit of 15 seconds. Under these experimental conditions, flies with depleted cdk8 present with significant climbing defects compared to control flies (Fig. S3B) and this is significantly rescued upon expression of CDK19 WT ( Fig. 3B ). Interestingly, expression of Y32H significantly rescued climbing ability compared to the cdk8-RNAi group (Fig. S3B) and the climbing ability in the Y32H group is not significantly different from the CDK19 WT group ( Fig. 3B ). This illustrates that both expression of CDK19 WT and CDK19 Y32H can rescue the cdk8-RNAi climbing defect to an equivalent degree, indicating an ability of Y32H to compensate for reduction in Cdk8 under these conditions. One way this result might be rationalized is that this variant has a gain of function as has been proposed previously based on in vitro data ( 14 ). We showed that expression of T196A in a cdk8 depleted background significantly reduced the number of viable adults indicative of a possible dominant negative effect as previously shown ( 10 ) with the number of surviving flies being a fraction of that of the cdk8-RNAi or CDK19 WT groups . Here we see that the escaper flies from the T196A group have a climbing ability that is not significantly different from the cdk8 depleted flies (Fig. S3B). It is to be noted that we are dealing with a severely reduced population size in the T196A group. Together, these findings illustrate a possible dominant negative effect of T196A on Cdk8 in the flies that were unable to eclose and an inability for T196A to compensate for reduced Cdk8 as CDK19 Y32H and WT can in viable adults. Y32H and T196A flies show similar muscle myofibril thickness and variable muscle mitochondrial phenotypes that correlate to pDrp1 S616 levels We see that expression of Y32H can phenotypically compensate for reduced endogenous cdk8 while T196A cannot. These findings led us to consider whether there may be a muscular defect underlying both the climbing rescue in the Y32H group and impairment in the T196A group. We investigated muscle fiber and mitochondria morphologies in the flies expressing the variants. Our rationale was that depletion of endogenous fly cdk8 has already been shown to lead to muscle fiber thickening and mitochondrial fusion/elongation ( 7 ) but no such observations have yet been made for these de novo missense patient variants of CDK19 . We used Drosophila indirect flight muscles (IFMs) to assess both myofibril thickness, sarcomere length, and mitochondrial morphology to assess variant function. Adult IFMs are a well-studied and suitable muscle group to assess these characteristics, they have remarkable similarity to vertebrate cardiac muscle in terms of structure and mode of power output ( 21 , 22 ). IFMs are also known for their use in assessing effects of protein variants on muscle cell function and morphology ( 21 , 22 ). Under these conditions, ubiquitous cdk8 depletion yields significantly thicker muscle myofibrils compared to control flies (Fig. S4A) which can be rescued upon expression of wild-type CDK19 to a myofibril thickness that is not significantly different from the white-RNAi control group ( Fig. 4A-B , Fig. S4A), as was also shown with muscle-specific knockdown of cdk8 ( 7 ). Both Y32H and T196A fail to rescue this phenotype with myofibrils significantly thicker than the CDK19 WT group ( Fig. 4B ) and not significantly different than the cdk8 knockdown group (Fig. S4A), indicative of a muscle defect upon expression of either variant in the cdk8 depleted background. We next assessed the sarcomere unit length and observed all groups had consistent sarcomere unit length when using the CDK19 WT group as reference ( Fig. 4C ). We use the myofibril thickness and sarcomere unit length as proxies for muscle dimensions, a change in myofibril thickness but not sarcomere unit length indicates a net change to fiber thickness. Download figure Open in new tab Figure 4. Y32H and T196A flies show similar muscle myofibril thickness and variable mitochondrial phenotypes that correlate to pDrp1 S616 levels. (A) Rhodamine-phalloidin staining (F-actin, red) to visualize adult indirect flight muscle for the listed genotypes and ATP5α staining (mitochondria, green) to visualize mitochondrial morphology in the indicated genotypes. Scale bar: 5 µm. (B) Quantification of adult fly indirect flight muscle myofibril width. (C) Quantification of adult fly indirect flight muscle sarcomere unit length. (D) Quantification of adult fly indirect flight muscle mitochondrial length. Quantification of muscle and mitochondria shown as box and whisper plots with solid line at the mean and whiskers for range with 15 muscle regions assessed per genotype. (E) Western blot showing the total level of phospho-Drp1 S616 and Drp1 to assess pDrp1 S616 /Drp1 ratio in the listed genotypes from adult thorax tissue. Densitometry done in Fiji (ImageJ) to show (F) total Drp1 protein level and (G) phospho-status of Drp1 at position S616 both normalized to alpha-tubulin loading control. Results are presented as bar plots mean intensity ± s.e.m. All muscle tissue is from 3-day old adult males, raised at 25°C, with n = 5 unique muscle tissue per genotype repeated in n=3 biological replicate gels. Statistical analyses are ordinary one-way ANOVA followed by a Dunnett multiple comparisons test. (*p < 0.05, ****p < 0.0001, ns no significance). We used mitochondrial length as a proxy for morphology as has been done previously when looking at adult IFM mitochondria since mitochondrial shapes are constrained between muscle fibers ( 7 ). Under these experimental conditions the cdk8 depleted group has significantly longer mitochondria than white-RNAi control (Fig. S4B) representative of a more fused/elongated phenotype, which can be phenotypically and significantly rescued by wild-type CDK19 ( Fig. 4A,D ). Expression of Y32H also reduces mitochondrial length compared to the cdk8 depletion group (Fig. S4B) illustrating a rescue of the cdk8 depletion mitochondrial morphology defect to a similar degree as CDK19 WT ( Fig. 4D ). Conversely, T196A was unable to do so, and T196A mitochondrial lengths were not significantly different from the cdk8 knockdown group (Fig. S4B) and significantly higher compared to the CDK19 WT group ( Fig. 4D ). While assessing mitochondrial morphology of the variant expressing groups, we also observed that the Y32H group consistently showed more individual mitochondria per assessed area of muscle (Fig. S4C) indicative of a more punctate morphology. Mean mitochondrial length for the Y32H group is comparable to the CDK19 WT group and white-RNAi control group but there are more individual mitochondria per assessed area on average. We do not see this for the T196A group, and this group more resembled the cdk8 knockdown group (Fig. S4C). These findings showcase that escaper T196A flies have phenotypes comparable to the cdk8 depletion group and T196A is unable to rescue mitochondrial morphology defects caused by cdk8 depletion while Y32H and CDK19 WT can. These T196A escaper flies showcase a possible loss of function nature of this variant and indicate a functional Y32H nature. The kinase activity of Cdk8 is required for regulation of mitochondrial morphology through phosphorylation of Drp1 at position S616 ( 7 ), and given the effects on mitochondria by wildtype CDK19 we propose this function is conserved ( 7 ). We assessed the phospho-status of Drp1 (pDrp1 S616 ) with respect to total Drp1. This assay provides a two-fold benefit. We can assess the phospho-status of Drp1 to correlate to the mitochondrial morphologies we see in the variant groups, but we can also use this as a functional readout for these two variant kinases by leveraging the conservation between Cdk8/CDK19. For this assay, the adult thorax was chosen for its high muscle to non-muscle tissue ratio. We find that total levels of Drp1 protein relative to tubulin are consistent across all genotypes ( Fig. 4E-F , Fig S4D). Under these less severe experimental conditions, cdk8 knockdown does not cause reduced phospho-Drp1 as the pDrp1:Drp1 ratio is not significantly different from control (Fig. S4E). The pDrp1:Drp1 ratio in the Y32H group trends higher, though not significantly. In contrast, the pDrp1:Drp1 ratio is significantly lower in the T196A group with respect to the cdk8 knockdown group (Fig. S4E) and CDK19 WT group ( Fig. 4G ). Applying the established relationship between the phospho-status of Drp1 and mitochondrial morphology ( 7 ) to this result, our data are consistent with the model that Y32H is a gain of function with elevated kinase activity in that the trend in the phospho-Drp1 is higher in this group than the CDK19 WT group, and that T196A is having a dominant negative effect on the remaining endogenous Cdk8 possibly through a loss of kinase activity due to the nature of the variant. T196A flies have elevated muscular ROS We previously showed that cdk8 depletion correlates with elevated reactive oxygen species (ROS) in neuronal and muscle tissue ( 7 ). Given our functional insights and investigations thus far we hypothesise, consistent with previous literature, that Y32H is a gain of function and T196A is acting as a dominant negative. We wanted to assess the effects of expressing these variants in a cdk8 depleted background on the level of ROS in adult muscle. Our rationale for this assessment is that a gain of function compensation by Y32H in a fly Cdk8 depleted background would likely result in similar or reduced ROS and for T196A we would likely observe an elevation in ROS if this variant were acting on endogenous fly Cdk8 in a dominant negative manner. This assessment can be done using dihydroethidium (DHE) which reacts with superoxide radicals to produce a fluorescent signal that can be detected and subsequently quantified ( 23 ). We observe under our experimental conditions, cdk8 knockdown flies do not have elevated ROS compared to control white-RNAi flies (Fig. S5A), compared to the effects previously shown for targeted muscle-specific knockdown of cdk8 ( 7 ). We observe a trend lower and tightening, though not significant, of the mean fluorescent intensity in the Y32H group when comparing both to cdk8 knockdown (Fig. S5A) and CDK19 WT ( Fig. 5A-B ). There is a significant increase in the mean DHE fluorescent intensity for the escaper T196A flies compared to cdk8 knockdown (Fig. S5A) and CDK19 WT ( Fig. 5A-B ). This finding confirmed our hypothesis that the expression of T196A leads to elevated ROS in adult muscle and this would be consistent with T196A having a dominant negative effect on the endogenous fly Cdk8. Download figure Open in new tab Figure 5. T196A adult muscle shows elevated ROS that can be significantly reduced through NACA antioxidant supplementation. (A) DHE staining to visualize adult indirect flight muscle (IFM) for the listed genotypes raised on standard food media and NACA supplemented food media. Scale bar: 100 µm. (B) Quantification of mean DHE intensity from adult fly IFM from standard food progenies. (C) Comparison of standard food and NACA food adult fly IFM DHE intensity. Quantifications shown as box and whisper plots with solid line at the mean and whiskers for range with n = 9 muscle regions assessed per genotype. All muscle tissue is from 3-day old adult males, raised at 25°C, with n=9 muscle across three biological replicates. Statistical analyses are ordinary one-way ANOVA followed by a Dunnett multiple comparisons test. (**p < 0.01, ***p < 0.001, ns no significance). Supplementation of the antioxidant NACA can reduce elevated ROS in T196A flies Given our finding of elevated ROS in T196A escaper adult muscle, we wanted to assess if this elevated ROS could be sequestered by supplementation of an antioxidant. Our rationale for this assessment is that antioxidant compounds have previously been used to suppress elevated ROS in flies expressing patient variants of other genes ( 24 ). One such antioxidant compound is called NACA, which is a derivatized form of the more than half century old FDA approved drug, N-acetylcysteine (NAC) ( 25 ). NACA has a more suitable half-life, improved tissue permeability, and has been shown to be converted into L-cysteine to eventually be integrated into reduced glutathione (GSH) production among other possible routes ( 25 – 28 ). GSH is a chief antioxidant in biological organisms across genera, and we aimed to leverage this NACA/GSH relationship to assess the effect of NACA supplementation on all groups, particularly the escaper T196A flies. We supplemented NACA into the fly medium at a concentration of 80 µg/ml, based on a previously determined effective concentration in fly studies ( 29 ) and observed that while there was no significant effect to other groups, the escaper T196A adult muscle had significantly lower ROS compared to their standard food medium raised counterparts ( Fig. 5A,C ). The ROS levels in these escaper T196A flies raised on NACA is significantly reduced compared to T196A flies raised on standard food media to a level that is not significantly different from the other genotype groups (Fig. S5B). Thus, we show that expression of T196A is contributing to elevated muscular ROS that NACA can suppress. Supplementation of the antioxidant NACA induces a robust shift to punctate mitochondria in adult muscle tissue and climbing ability is improved in T196A flies It has been well established that mitochondria are the majority contributors to cellular ROS, up to almost 90% ( 30 ). We have demonstrated the ability of dietary NACA to suppress elevated ROS in the T196A group and further wanted to assess the state of muscle and mitochondria to determine if there is any association with ROS levels and muscle morphology. Our rationale for this assessment is that our lab has previously done a preliminary test on white-RNAi and cdk8-RNAi IFMs from flies raised with or without NACA supplementation. That experiment showed that NACA supplementation could induce a robust punctate mitochondrial morphology in adult muscle tissue, rescuing the mitochondrial fusion/elongation phenotype resulting from cdk8 depletion (Fig. S6A-B). We next investigated the effects of NACA supplementation on the genotypes that we have characterized so far in this study. There is no significant difference in the adult IFM myofibril width from adults raised with or without NACA supplementation ( Fig. 6A-B ). There is a slight reduction in the escaper T196A myofibril width, though not significant. We do find a robust and significant induction of mitochondrial fission resulting in a punctate mitochondrial morphology across all genotype groups ( Fig. 6A,C ). Most notably, this finding demonstrates that NACA supplementation aids in overcoming the escaper T196A mitochondrial fusion/elongation phenotype. Download figure Open in new tab Figure 6. Dietary supplementation of the antioxidant drug, NACA, induces robust mitochondrial fission in adult muscle coupled with climbing improvement in T196A flies. (A) Rhodamine-phalloidin staining (F-actin, red) to visualize adult indirect flight muscle for the listed genotypes and ATP5α staining (mitochondria, green) to visualize mitochondrial morphology in the indicated genotypes raised on NACA supplemented food. Scale bar: 5 µm. (B) Quantification of adult fly indirect flight muscle myofibril width comparing flies raised with or without NACA supplementation. (C) Quantification of adult fly indirect flight muscle mitochondrial length comparing flies with or without NACA supplementation. All muscle tissue is from 3-day old adults, raised at 25°C, with n = 5 muscle per genotype repeated in three biological replicates for a total of 15 unique muscle regions assessed. Data presented as box and whisper plots with solid line at the mean and whiskers for range. (D) Average percent of flies that reach ≥ 5 cm (target line) for the indicated genotypes comparing flies raised with or without NACA supplementation. (E) Violin plots showcasing climbing distribution as an entire group by plotting the per trial height climbed by each fly for five replicate climbing trials for all independent experimental replicates of flies raised with or without NACA supplementation. Each experiment was individually repeated six times (n = 6 biological replicates and n = 30 adult males per genotype). Statistical analyses are one-way ANOVA followed by a Dunnett multiple comparisons test. (****p < 0.0001, ns no significance). Following this robust effect of NACA on the mitochondrial phenotypes in adult muscle, we wanted to assess overall neuromuscular health of these flies. We used climbing assessment to compare flies that were raised on standard food vs. NACA food media. Our rationale for this assessment is that the poorest performing adult flies in the climbing assessments harbour elongated/fused mitochondria that are rescued by NACA supplementation. Using the adult IFMs as a readout for muscular health we propose that muscle defects brought on by cdk8 depletion previously shown ( 7 ) or sustained muscle defects upon T196A expression in this cdk8 depleted background are one of the factors creating the locomotion defect we observe in these adult flies. The climbing abilities of these flies were assessed and the white-RNAi , CDK19 WT , and CDK19 Y32H groups performed comparably between the NACA groups and standard food groups ( Fig. 6D-E ), showcasing no effect of NACA supplementation on Y32H climbing ability. The cdk8-RNAi and T196A groups show a trend higher when assessing endpoint height reached with tighter data distribution from the NACA groups notably for T196A ( Fig. 6D ), though not significant. On a per trial basis, however, the cdk8-RNAi and T196A genotypes both show overall improvement in climbing ability as a group when observing the violin plot distribution for height climbed ( Fig. 6E ). Interestingly, the T196A group performs better than the cdk8 knockdown group. This indicates that NACA is having a therapeutic effect on the T196A flies that may potentially suppress some harmful effects caused by expression of this variant under these experimental conditions. The demonstrated reduction in ROS for the T196A group correlates with a more punctate mitochondrial morphology and improved climbing ability as a readout for neuromuscular health and general health of the adult flies. Discussion With the identification of many novel missense variants, including ones of unknown significance, it is important to have robust and diverse assays to study their impacts on protein function. Initial tests of pathogenicity are very powerful to highlight dominant effects of variant proteins, however these do not always reveal underlying activities, depending on experimental conditions. So, while pathogenicity can be established by certain assays, a more in-depth investigation is often needed to identify potential therapeutic measures to avoid ineffective treatments. Upon initial discovery and characterization of the dominant patient variants of CDK19 Y32H (Y32H) and CDK19 T196A (T196A), a set of Drosophila experiments were carried out to establish pathogenicity ( 10 ). These findings showed that these variants were unable to rescue viability when expressed in a cdk8 deficient background compared to CDK19 WT (WT), highlighting their distinct nature ( 10 ). Further, when expressing these variants in a severely depleted cdk8 background, the phenotypes were largely similar to, or more severe than, cdk8 depletion on its own ( 10 ). The prevailing hypothesis based on these results was that these de novo patient variants are loss of function variants presenting as dominant negative. Following this work, another group independently assessed Y32H and other variants using Zebrafish as a model system and they proposed that Y32H may be a gain of function variant with elevated kinase activity while T196A may be a lost/reduced kinase function variant ( 14 ). Both assessments used different conditions and model systems. In this study, we aimed to further our understanding of these patient variants by adapting the Drosophila model system previously used to further assess viable adult progeny to investigate various phenotypes and gain functional insight on the nature of these variants. Understanding the biochemical and cellular function of different variants can reveal insights into their clinical features. Of note, our studies confirm the pathogenicity of such variants and reveal that both gain and loss of function can result in similar clinical features. Here we show under less severe cdk8 depletion, the de novo CDK19 patient variant Y32H can compensate for reduced fly cdk8 across numerous phenotypic measures like the reference CDK19 WT can, while T196A cannot. We show that under a less severe fly cdk8 depletion, Y32H expression is not pathogenic to the fly host, but T196A expression is and there is a significant reduction in the number of viable T196A progeny. These limited viable adult progenies are escapers of this genotype, likely representing variability that allows them to complete development and eclose as adults. Further, we reinforce that both variants when expressed under these conditions show pathogenic effects on lifespan compared to control flies; however, upon further dissection we can tease apart subtleties in the effects of these two variants on overall Drosophila health and function. When we look at adult indirect flight muscle (IFM) to assess effects of the patient variants on muscle cell function relative to the cdk8-RNAi and CDK19 WT rescue groups, we show that both variant expressing flies present with thick muscle myofibrils that are not significantly different than cdk8 depletion alone, highlighting that myofibril thickness is not sensitive to the dominant effects of the variants. In contrast, when we examined mitochondrial morphology in IFM, we observed distinct effects of the variants, namely the Y32H group muscle contains more punctate mitochondria overall and the escaper T196A group has more fused/elongated mitochondria overall consistent with the cdk8 depletion mitochondrial morphology ( 7 ). Concomitant to these mitochondrial phenotypes, we provide evidence for elevated pDrp1 levels in the Y32H group with respect to the CDK19 WT group and show significantly reduced pDrp1 levels in the T196A group compared to both the cdk8 depletion and CDK19 WT groups. Given the established relationship between Cdk8/CDK19, Drp1 phospho-status, and mitochondrial morphology, we provide evidence from a functional standpoint that Y32H may be phosphorylating Drp1 at position S616 to a greater extent consistent with a gain of function (hypermorphic) kinase nature. Conversely, we show evidence for a significant reduction to Drp1 phosphorylation in the T196A group relative to what we see with cdk8 knockdown alone, providing further evidence for a dominant negative effect. Further, we demonstrate that expression of T196A is leading to significantly elevated ROS in the adult IFMs. The supplementation of an antioxidant drug, NACA, into the fly food media is sufficient to suppress the elevated ROS in the T196A group while having no significant effect on all other genotypes. NACA can be taken up into the cell and utilized for production of GSH (reduced glutathione) ( 25 – 28 ), the chief antioxidant in biological organisms across genera ( 31 , 32 ). NACA has previously been used in Drosophila studies as a therapeutic agent to treat severe neurological phenotypes induced upon expression of patient variants of ACOX1 linked to elevated glial ROS ( 24 ). The supplementation of NACA is also sufficient to induce robust muscle mitochondrial fission in all groups, notably the T196A group. These findings coincide with a climbing improvement in T196A adult flies and demonstrate that NACA has no significant beneficial or detrimental effect to the Y32H variant group. Our Drosophila model allows us to reduce the severity of the cdk8 depletion to create a viable yet sensitized background to assay the effects of these variants by assessing various phenotypic readouts. It builds on the work that has been done previously and brings further functional insights and investigations into the nature of these variants. This Drosophila model may also, in the future, be adapted to test effects of other patient variants of CDK19 or its paralog CDK8 . In summary, our work reveals further evidence for a gain of function nature for Y32H and dominant negative nature for T196A. Our work also reinforces that both gain of function and loss of function missense variants can lead to human syndromes such as DEE87. Further, we find that there is great potential in assessing the nature of these and other patient variants using fly models and that therapeutic treatments may be prescribed on a variant-specific basis to human patients. We see that NACA supplementation was able to alleviate the severe phenotypes of the T196A group while having no detrimental effect to the Y32H group, illustrating that the nature of these variants can contribute to unique backgrounds that may be targeted. This allows for the use of a compound such as NACA to target distinct effects caused by T196A expression such as abnormally elongated/fused mitochondria and elevated ROS in muscle tissue. These methods may be applied to research into personalized medicinal approaches for DEE87 patients harbouring variants of CDK19 or other genes linked to various syndromes through a variant specific targeting regime. Materials and Methods Protein Sequence Alignment and Modelling FASTA protein sequence of CDK19 WT (UniProt ID: Q9BWU1) was aligned to CDK19 Y32H and CDK19 T196A separately to showcase the amino acid substitutions that arise from single base de novo missense mutations ( 10 ). To do this the wild-type sequence was manually edited to create separate protein sequences for each variant, Y32H and T196A. The alignment was done in Benchling Molecular Biology Software. To produce a predictive protein model for CDK19, AlphaFold Protein Structure database was used ( 16 , 17 ). The PDB file for this model was input to PyMOL ( 33 ) and the protein model was annotated at position 32 and position 196 corresponding to Y and T respectively on the wild-type CDK19 protein. Drosophila culture Drosophila melanogaster flies were raised and maintained on a standard cornmeal-molasses medium in accordance with the recipe outlined by BDRC ( 34 ) or in standard medium supplemented with 80 µg/ml of N-acetylcysteine amide. Fly stock lines were maintained at 25°C, and crosses were carried out at 25°C and 29°C as indicated. This allowed us to leverage Gal4 temperature sensitivity ( 19 ) and modulate degree of expression. The 25°C conditions were suitable to proceed with both variants. The following fly strains were used: ;;da-Gal4 (derived from BL #55850), ;;UAS-Cdk8-RNAi (BL #35324), ;;UAS-white-RNAi (BL #33762). The stocks with a BL number are sourced from Bloomington Drosophila Stock Centre (Bloomington, IN, USA). The following stock lines: ;UAS-CDK19 WT ; UAS-Cdk8-RNAi ;UAS-CDK19 Y32H ; UAS-Cdk8-RNAi ;UAS-CDK19 T196A ; UAS-Cdk8-RNAi were generated in a previous study ( 10 ) and generously provided by Dr. Hyunglok Chung (Houston Methodist, Texas, USA). Adult Fly Collection Adult flies were anesthetized using CO 2 (g) and collected in styrene vials for use when and where appropriate. Eclosion Assessment Progenies raised at 25°C and 29°C were counted in the pupal stage and following that the number of eclosed adults were counted. The cross for each genotype was carried through three replicate vials and repeated for a total of three biological replicates totalling nine vials per genotype. These data were then quantified and expressed as percent eclosed. This was to assess a readout for viability. Lifespan Assessment Adult flies were maintained at 25°C to assess lifespan. These flies were transferred to fresh food every third day and viability was scored daily on a weekly basis and quantified. This was repeated for a total of three biological replicates and all groups were scored until death. These data were expressed as percent viable per day for each group and a log-rank test was carried out on these data to assess statistical significance of survival trends and to retrieve a χ 2 value corresponding to a p-value for significance. Climbing Assessment Flies raised at 25°C were subjected to negative geotaxis assays at multiple timepoints: 3-days, 6-days, 10-days and 13-days. The 3-day old assessment was taken as the young-adult timepoint and used for all subsequent assessments. To assess climbing, three-day old adult flies were moved in batches of n = 5 to empty polystyrene vials with another empty vial taped to the top to form a closed cylinder. The bottom vial was marked with dashes at 1 cm increments ranging from 0 cm to 5 cm. The vials containing the flies were gently and simultaneously tapped down and a timer was set for 15 seconds. This trial was repeated for a total of five times These assays were recorded with a Pro 12 MP Digital Camera and the height distribution of each test group was documented and quantified. This test was repeated for a total of five trials per biological replicate. qRT-PCR Drosophila progenies were cleaned in ice-cold 1X PBS and put through an RNA extraction protocol using RNeasy Mini Kits (Qiagen 74134). cDNA for transcript level quantification was produced using OneScript Plus cDNA Synthesis Kit (ABM G236). qRT-PCR was performed using PowerTrack SYBR Master Mix (Applied Biosystems – ThermoFisher – Lot # 29999-452) on a StepOne Real-time PCR System (Applied Biosystems). Primers used: rp49 F AGCATACAGGCCCAAGATCG rp49 R TGTTGTCGATACCCTTGGGC 18S F CTGAGAAACGGCTACCACATC 18S R ACCAGACTTGCCCTCCAAT cdk8 F CATCCGGGTGTTTCTGTCG cdk8 R CAGCCCGATGGAACTTAATGAT To quantify expression level of the target genes of interest, the 2 -ΔΔCt method was used ( 35 ). The calculations were done manually using rp49 as the internal reference gene to quantify relative expression level. Immunofluorescence staining Adult thoraces were separated in 1X PBS and fixed in 4% paraformaldehyde (PFA) for 15 minutes at room temperature with rocking. Samples were washed twice for 10 minutes in PBST (0.1% Triton X-100). Tissues were blocked in 5% BSA in PBST for 1 hour at room temperature and then placed in primary antibodies overnight at 4°C. The following primary antibodies were used: mouse anti-ATP5α (1:500, Abcam ab14748). Following primary antibody incubation, tissues were washed with PBST and incubated with the appropriate secondary antibodies: FITC conjugated anti-mouse (1:500, Jackson ImmunoResearch Laboratories) in combination with Rhodamine-Phalloidin prepared in methanol (1:500, ThermoFisher R415) for two hours at room temperature. Samples were mounted on 1 mm spaced glass bridge slides in VectaShield Antifade Mounting Medium (Vector Laboratories, BioLynx) and imaged using a Zeiss LSM880 Airyscan Confocal microscope and processed using Fiji (ImageJ). Quantification of mitochondrial morphology Adult indirect flight muscle images were input to ImageJ and a box of a fixed size was placed to encompass a region of mitochondria. A minimum of 3-5 unique thorax samples were imaged for each genotype repeated for a total of three biological replicates. Lengths of mitochondria were determined manually, and data collected from adult muscle were pooled for box and whisper plot generation and relevant statistics using GraphPad (Prism 10). Quantification of muscle fiber width and sarcomere unit length Adult indirect flight muscle images were input to ImageJ and a box of a fixed size was placed to encompass a region of muscle myofibrils. A minimum of 3-5 thorax samples were imaged for each genotype repeated for a total of three biological replicates. Myofibril widths and sarcomere lengths were determined manually, and data collected from adult muscle were pooled for box and whisper plot generation and relevant statistics using GraphPad (Prism 10). ROS Staining and Quantification Briefly, adult thoraces were isolated in ice-cold PBS and incubated in 30 mM DHE (Cayman Chemical - #12013) for 30 minutes in the dark at room temperature with gentle shaking. Following DHE incubation, tissues were incubated in 8% PFA and washed twice for 5 minutes before mounting on 1 mm spaced glass bridge slides in VectaShield Antifade Mounting Medium (Vector Laboratories, BioLynx). Images were taken within two days using a Zeiss LSM880 Airyscan Confocal microscope. Fluorescent intensity was measured using Fiji (ImageJ). Data collected from adult muscle were pooled for box and whisper plot generation and relevant statistics using GraphPad (Prism 10). Statistical analyses We used GraphPad Prism for statistical analysis and generation of figures. Statistical analysis was done with the default settings of the software (∗ indicates p < 0.05, ∗∗ indicates p < 0.01, ∗∗∗ indicates p < 0.001, ∗∗∗∗ indicates p < 0.0001). Violin plots, bar graphs, and box and whisker plots were made using GraphPad Prism 10. Web Resources Benchling Molecular Biology Software Clustal Omega Alignment Software: https://www.ebi.ac.uk/jdispatcher/msa/clustalo Conflict of Interest Statement Authors declare no competing financial interests. Abbreviations ANOVA Analysis of variation ATP Adenosine triphosphate ATP5α Adenosine triphosphate synthase subunit 5α BDRC Bloomington Drosophila Research Center BSA Bovine serum albumin CDK19 Human Cyclin-dependent kinase 19 CDK8 Human Cyclin-dependent kinase 8 Cdk8 Drosophila Cdk8 cDNA Complimentary DNA da-Gal4 Daughterless-Gal4 DEE-87 Human Developmental and Epileptic Encephalopathy Syndrome 87 DHE Dihydroethidium Drp1 Dynamin-related protein 1 FITC Fluorescein isothiocyanate G28R Human Cyclin-dependent kinase 19 patient variant G28R GSH Glutathione (reduced) IFM Drosophila Indirect Flight Muscle MP Megapixel NAC N-acetylcysteine NACA N-acetylcysteine amide OMIM Online Mendelian inheritance in man PBS Phosphate buffered saline PBST Phosphate buffered saline – Tween-20 solution PCR Polymerase chain reaction pDrp1 Phosphorylated Dynamin-related protein 1 PFA Paraformaldehyde RNA Ribonucleic acid ROS Reactive oxygen species s.e.m. Standard error margin S616 Amino acid position Serine-616 on Drp1 T196A Human Cyclin-dependent kinase 19 patient variant T196A TBST Tris base – Tween-20 solution WT Human Cyclin-dependent kinase 19 wildtype Y32H Human Cyclin-dependent kinase 19 patient variant Y32H Download figure Open in new tab Figure S1. CDK19 proteins have similar levels and localization when expressed ubiquitously in flies and cdk8 depletion is robust and significant compared to control. (A) Western blot of whole-body thorax lysate fractionation from six whole adult flies using daughterless-Gal4 to express HA-tagged CDK19 protein constructs at 25°C. CDK19 protein was detected via a 3xHA tag using rat anti-HA-HRP antibody, loading controls were β-tubulin (cytoplasmic) and Histone H3 (nuclear) probed with mouse anti-β-tubulin (abm, G098) and rabbit anti-Histone H3 (CST, #9715) respectively. (B) Quantification of expression of cdk8 (knockdown efficiency) with respect to rp49 in the listed genotypes compared to control and (C) with respect to cdk8-RNAi group. Download figure Open in new tab Figure S2. Expression of Y32H is pathogenic at 29°C but not at 25°C while T196A is pathogenic at both temperatures compared to cdk8 knockdown alone (A) Percent of pupae eclosed as adults when ubiquitously expressing the variants in a ubiquitous fly cdk8 knockdown background at 29°C and (B) 25°C (n=3 biological replicates per genotype). (C) Pupae of the listed genotypes compared to various progeny obtained from the T196A mating vial including elongated L3, undeveloped pupae, and pharate progenies. Statistical analyses are ordinary one-way ANOVA followed by a Dunnett multiple comparisons test. Results are mean ± s.e.m. (**p < 0.01 ***p < 0.001 ****p < 0.0001). Download figure Open in new tab Figure S3. Expression of CDK19 WT , CDK19 Y32H both significantly rescue cdk8 while T196A escaper flies are not significantly different in their climbing ability (A) Graphical representation of fly climbing assessment for the listed genotypes. (B) Average percent of flies that reach ≥ 5 cm (target line) for the indicated genotypes. Each experiment was individually repeated six times (n = 6 biological replicates and n = 30 adult males per genotype). Statistical analyses are ordinary one-way ANOVA followed by a Dunnett multiple comparisons test. Results are shown as bar plots with mean height reached ± s.e.m. (****p < 0.0001, ns no significance). Download figure Open in new tab Figure S4. Patient variants of CDK19, Y32H and T196A, show various effects to muscle, mitochondria, and Drp1 phospho-status compared to cdk8 knockdown alone. Quantification of (A) adult fly indirect flight muscle myofibril width, (B) mitochondrial length, with respect to cdk8-RNAI and (C) mitochondrial counts per 15 assessed regions of muscle. Muscle phenotype data shown as box and whisper plots with solid line at the mean and whiskers for range with 15 muscle regions assessed per genotype. Mitochondrial counts shown as bar plots. (D) Relative Drp1/tubulin loading control and (E) relative pDrp1/Drp1 from adult thorax lysate samples. Results are presented as bar plots of mean intensity ± s.e.m. All muscle tissue is from 3-day old adult males, raised at 25°C, with n = 5 unique muscle tissue per genotype repeated in n=3 biological replicate immunofluorescent staining or lysate preparations respectively. Statistical analyses are ordinary one-way ANOVA followed by a Dunnett multiple comparisons test. (**p < 0.01 ***p < 0.001, ****p < 0.0001, ns no significance). Download figure Open in new tab Figure S5. T196A adult muscle ROS is significantly elevated compared to the cdk8 knockdown group while the Y32H group is unaffected. (A) Quantification of mean DHE intensity from adult fly IFM from standard food raised progenies compared to cdk8-RNAi . (B) Quantification of mean DHE intensity from adult fly IFM from standard food raised progenies compared to T196A group raised on NACA food. Quantifications shown as box and whisper plots with solid line at the mean and whiskers for range with n = 9 muscle regions assessed per genotype. All muscle tissue is from 3-day old adult males, raised at 25°C, with n=9 muscle across three biological replicates. Statistical analyses are ordinary one-way ANOVA followed by a Dunnett multiple comparisons test. (*p < 0.05, ns for no significance). Download figure Open in new tab Figure S6. Preliminary assessment of the effects of NACA supplementation on cdk8-RNAi adult indirect flight muscle mitochondria compared to white-RNAi. Rhodamine-phalloidin staining (F-actin, red), ATP5α staining (mitochondria, green), and DAPI staining (DNA, blue) to visualize adult indirect flight muscle mitochondrial morphology in the indicated genotypes. Scale bar: 5 µm. (A) Adult indirect flight muscle of adult flies raised on standard food medium compared to (B) NACA food medium. Acknowledgements We thank Dr. Hyunglok Chung (Houston Methodist, Texas, USA) and Dr. Hugo J. Bellen (Baylor College of Medicine, Texas, USA) for the generation of the variant lines used in this study and many productive and engaging discussions. This work was funded by the Canadian Institutes of Health Research to E.M.V. [PJT-495269 (Bridge grant), PJT-189990]. Funder Information Declared Canadian Institutes of Health Research, https://ror.org/01gavpb45 , PJT-495269 , PJT-189990 References 1. ↵ Wangler , M.F. , Yamamoto , S. , Chao , H.-T. , Posey , J.E. , Westerfield , M. , Postlethwait , J. , Hieter , P. , Boycott , K.M. , Campeau , P.M. , Bellen , H.J. , et al. ( 2017 ) Model Organisms Facilitate Rare Disease Diagnosis and Therapeutic Research . Genetics , 207 , 9 – 27 . OpenUrl CrossRef PubMed 2. Verheyen , E.M . ( 2022 ) The power of Drosophila in modeling human disease mechanisms . Disease models & mechanisms , 15 . 3. ↵ Bellen , H.J. , Wangler , M.F. and Yamamoto , S . ( 2019 ) The fruit fly at the interface of diagnosis and pathogenic mechanisms of rare and common human diseases . Human Molecular Genetics , 28 , R207 – R214 . OpenUrl CrossRef PubMed 4. ↵ Conaway , R.C. , Sato , S. , Tomomori-Sato , C. , Yao , T. and Conaway , J.W . ( 2005 ) The mammalian Mediator complex and its role in transcriptional regulation . Trends in Biochemical Sciences , 30 , 250 – 255 . OpenUrl CrossRef PubMed Web of Science 5. ↵ Fant , C.B. and and Taatjes , D.J. ( 2019 ) Regulatory functions of the Mediator kinases CDK8 and CDK19 . Transcription , 10 , 76 – 90 . OpenUrl CrossRef PubMed 6. ↵ Bourbon , H.-M . ( 2008 ) Comparative genomics supports a deep evolutionary origin for the large, four-module transcriptional mediator complex . Nucleic Acids Research , 36 , 3993 – 4008 . OpenUrl CrossRef PubMed Web of Science 7. ↵ Liao , J.Z. , Chung , H. , Shih , C. , Wong , K.K.L. , Dutta , D. , Nil , Z. , Burns , C.G. , Kanca , O. , Park , Y.-J. , Zuo , Z. , et al. ( 2024 ) Cdk8/CDK19 promotes mitochondrial fission through Drp1 phosphorylation and can phenotypically suppress pink1 deficiency in Drosophila . Nat Commun , 15 , 3326 . OpenUrl CrossRef PubMed 8. ↵ Broude , E.V. , Gyorffy , B. , Chumanevich , A.A. , Chen , M. , McDermott , M.S.J. , Shtutman , M. , Catroppo , J.F. and Roninson , I.B . Expression of CDK8 and CDK8-interacting Genes as Potential Biomarkers in Breast Cancer . Current Cancer Drug Targets , 15 , 739 – 749 . 9. ↵ Calpena , E. , Hervieu , A. , Kaserer , T. , Swagemakers , S.M.A. , Goos , J.A.C. , Popoola , O. , Ortiz-Ruiz , M.J. , Barbaro-Dieber , T. , Bownass , L. , Brilstra , E.H. , et al. ( 2019 ) De Novo Missense Substitutions in the Gene Encoding CDK8, a Regulator of the Mediator Complex, Cause a Syndromic Developmental Disorder . American journal of human genetics , 104 , 709 – 720 . OpenUrl CrossRef PubMed 10. ↵ Chung , H. , Mao , X. , Wang , H. , Park , Y.J. , Marcogliese , P.C. , Rosenfeld , J.A. , Burrage , L.C. , Liu , P. , Murdock , D.R. , Yamamoto , S. , et al. ( 2020 ) De Novo Variants in CDK19 Are Associated with a Syndrome Involving Intellectual Disability and Epileptic Encephalopathy . American Journal of Human Genetics , 106 , 717 – 725 . OpenUrl CrossRef PubMed 11. Firestein , R. , Bass , A.J. , Kim , S.Y. , Dunn , I.F. , Silver , S.J. , Guney , I. , Freed , E. , Ligon , A.H. , Vena , N. , Ogino , S. , et al. ( 2008 ) CDK8 is a colorectal cancer oncogene that regulates β-catenin activity . Nature , 455 , 547 – 551 . OpenUrl CrossRef PubMed Web of Science 12. ↵ Uehara , T. , Abe , K. , Oginuma , M. , Ishitani , S. , Yoshihashi , H. , Okamoto , N. , Takenouchi , T. , Kosaki , K. and Ishitani , T . ( 2020 ) Pathogenesis of CDK8-associated disorder: two patients with novel CDK8 variants and in vitro and in vivo functional analyses of the variants . Scientific Reports , 10 , 17575 . OpenUrl PubMed 13. ↵ Yang , S. , Yu , W. , Chen , Q. and Wang , X . ( 2021 ) A novel variant of CDK19 causes a severe neurodevelopmental disorder with infantile spasms . Cold Spring Harb Mol Case Stud , 7 , a006082 . OpenUrl Abstract / FREE Full Text 14. ↵ Zarate , Y.A. , Uehara , T. , Abe , K. , Oginuma , M. , Harako , S. , Ishitani , S. , Lehesjoki , A.-E. , Bierhals , T. , Kloth , K. , Ehmke , N. , et al. ( 2021 ) CDK19-related disorder results from both loss-of-function and gain-of-function de novo missense variants . Genetics in Medicine , 23 , 1050 – 1057 . OpenUrl PubMed 15. ↵ Loncle , N. , Boube , M. , Joulia , L. , Boschiero , C. , Werner , M. , Cribbs , D.L. and Bourbon , H.M . ( 2007 ) Distinct roles for Mediator Cdk8 module subunits in Drosophila development . EMBO Journal , 26 , 1045 – 1054 . OpenUrl CrossRef PubMed Web of Science 16. ↵ Jumper , J. , Evans , R. , Pritzel , A. , Green , T. , Figurnov , M. , Ronneberger , O. , Tunyasuvunakool , K. , Bates , R. , Žídek , A ., Potapenko , A. , et al. ( 2021 ) Highly accurate protein structure prediction with AlphaFold . Nature , 596 , 583 – 589 . OpenUrl CrossRef PubMed 17. ↵ Varadi , M. , Bertoni , D. , Magana , P. , Paramval , U. , Pidruchna , I. , Radhakrishnan , M. , Tsenkov , M. , Nair , S. , Mirdita , M. , Yeo , J. , et al. ( 2024 ) AlphaFold Protein Structure Database in 2024: providing structure coverage for over 214 million protein sequences . Nucleic Acids Research , 52 , D368 – D375 . OpenUrl CrossRef PubMed 18. ↵ Williams , R.T. , Wu , L. , Carbonaro-Hall , D.A. , Tolo , V.T. and Hall , F.L . ( 1993 ) Identification of a novel cyclin-like protein in human tumor cells . J Biol Chem , 268 , 8871 – 8880 . OpenUrl Abstract / FREE Full Text 19. ↵ Duffy , J.B . ( 2002 ) GAL4 system in Drosophila: A fly geneticist’s Swiss army knife . Genesis , 34 , 1 – 15 . OpenUrl CrossRef PubMed Web of Science 20. ↵ Kaplan , E.L. and Meier , P . ( 1958 ) Nonparametric Estimation from Incomplete Observations . Journal of the American Statistical Association , 53 , 457 – 481 . OpenUrl CrossRef Web of Science 21. ↵ Swank , D.M . ( 2012 ) Mechanical analysis of Drosophila indirect flight and jump muscles . Methods , 56 , 69 – 77 . OpenUrl CrossRef PubMed Web of Science 22. ↵ Zhao , C. and Swank , D.M . ( 2017 ) The Drosophila indirect flight muscle myosin heavy chain isoform is insufficient to transform the jump muscle into a highly stretch-activated muscle type . Am J Physiol Cell Physiol , 312 , C111 – C118 . OpenUrl CrossRef PubMed 23. ↵ Bartosz , G . ( 2006 ) Use of spectroscopic probes for detection of reactive oxygen species . Clinica Chimica Acta , 368 , 53 – 76 . OpenUrl CrossRef PubMed Web of Science 24. ↵ Chung , H. , Wangler , M.F. , Marcogliese , P.C. , Jo , J. , Ravenscroft , T.A. , Zuo , Z. , Duraine , L. , Sadeghzadeh , S. , Li-Kroeger , D. , Schmidt , R.E. , et al. ( 2020 ) Loss- or Gain-of-Function Mutations in ACOX1 Cause Axonal Loss via Different Mechanisms . Neuron , 106 , 589 – 606.e6 . OpenUrl CrossRef PubMed 25. ↵ Kwapiszewski , W. , Iliaszenko , J. and Sokołowska-Muszyńska , M . ( 1981 ) Synthesis of L-cysteine derivatives of immunotropic activity . Arch Immunol Ther Exp (Warsz ) , 29 , 823 – 826 . OpenUrl PubMed 26. Mokhtari , V. , Afsharian , P. , Shahhoseini , M. , Kalantar , S.M. and Moini , A . ( 2017 ) A Review on Various Uses of N-Acetyl Cysteine . Cell Journal (Yakhteh ) , 19 , 11 – 17 . OpenUrl 27. Poladian , N. , Navasardyan , I. , Narinyan , W. , Orujyan , D. and Venketaraman , V . ( 2023 ) Potential Role of Glutathione Antioxidant Pathways in the Pathophysiology and Adjunct Treatment of Psychiatric Disorders . Clinics and Practice , 13 , 768 – 779 . OpenUrl 28. ↵ Rushworth , G.F. and Megson , I.L . ( 2014 ) Existing and potential therapeutic uses for N-acetylcysteine: The need for conversion to intracellular glutathione for antioxidant benefits . Pharmacology & Therapeutics , 141 , 150 – 159 . OpenUrl PubMed 29. ↵ Chung , H. , Wangler , M.F. , Marcogliese , P.C. , Jo , J. , Ravenscroft , T.A. , Zuo , Z. , Duraine , L. , Sadeghzadeh , S. , Li-Kroeger , D. , Schmidt , R.E. , et al. ( 2020 ) Loss- or Gain-of-Function Mutations in ACOX1 Cause Axonal Loss via Different Mechanisms . Neuron , 106 , 589 – 606.e6 . OpenUrl CrossRef PubMed 30. ↵ Balaban , R.S. , Nemoto , S. and Finkel , T . ( 2005 ) Mitochondria, Oxidants, and Aging . Cell , 120 , 483 – 495 . OpenUrl CrossRef PubMed Web of Science 31. ↵ GLUTATHIONE . 32. ↵ Cassier-Chauvat , C. , Marceau , F. , Farci , S. , Ouchane , S. and Chauvat , F . ( 2023 ) The Glutathione System: A Journey from Cyanobacteria to Higher Eukaryotes . Antioxidants , 12 , 1199 . OpenUrl PubMed 33. ↵ The PyMOL Molecular Graphics System, Version 3.0 Schrödinger, LLC . 34. ↵ Bloomington Drosophila Stock Center https://bdsc.indiana.edu/information/recipes/bloomfood.html (accessed May 16, 2025). 35. ↵ Livak , K.J. and Schmittgen , T.D . ( 2001 ) Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method . Methods , 25 , 402 – 408 . OpenUrl CrossRef PubMed Web of Science View the discussion thread. Back to top Previous Next Posted September 12, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Uncovering functional insights into human pathogenic variants in CDK19 using Drosophila models Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Uncovering functional insights into human pathogenic variants in CDK19 using Drosophila models Karampal S. Grewal , Christopher Tam , Jenny Zhe Liao , Esther M. Verheyen bioRxiv 2025.09.10.675453; doi: https://doi.org/10.1101/2025.09.10.675453 Share This Article: Copy Citation Tools Uncovering functional insights into human pathogenic variants in CDK19 using Drosophila models Karampal S. Grewal , Christopher Tam , Jenny Zhe Liao , Esther M. Verheyen bioRxiv 2025.09.10.675453; doi: https://doi.org/10.1101/2025.09.10.675453 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Genetics Subject Areas All Articles Animal Behavior and Cognition (7618) Biochemistry (17636) Bioengineering (13860) Bioinformatics (41847) Biophysics (21401) Cancer Biology (18536) Cell Biology (25424) Clinical Trials (138) Developmental Biology (13353) Ecology (19860) Epidemiology (2067) Evolutionary Biology (24287) Genetics (15583) Genomics (22463) Immunology (17701) Microbiology (40300) Molecular Biology (17141) Neuroscience (88434) Paleontology (666) Pathology (2825) Pharmacology and Toxicology (4813) Physiology (7633) Plant Biology (15107) Scientific Communication and Education (2042) Synthetic Biology (4285) Systems Biology (9808) Zoology (2268)