Human antigen R suppresses replication and promotes cap independent translation of Dengue viral RNA

Human antigen R suppresses replication and promotes cap independent translation of Dengue viral RNA | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Human antigen R suppresses replication and promotes cap independent translation of Dengue viral RNA Ashish Aneja, Risabh Sahu, Srishti Rajkumar Mishra, Santu Paul, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9090268/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Host RNA-binding proteins (RBPs) play a pivotal role in regulating dengue virus (DENV) translation and replication through interactions with untranslated regions (UTRs) of viral RNA. We investigated host proteins associated with detergent-resistant membranes (DRMs) of the DENV replication complex and identified Human antigen R (HuR) as a key RBP enriched in the DRM. HuR was found to negatively regulate DENV replication by binding the DENV-3′UTR and impeding the association of polypyrimidine tract-binding protein (PTB), a known RNA stabilizer. Additionally, infection-induced modulation of HuR stabilized host mRNAs involved in innate immunity. Interestingly, preliminary in vivo validation in the AG129 mouse model reveals an inverse correlation between HuR expression and viral load, implicating HuR in cytokine dysregulation. Notably, HuR promoted cap-independent translation of viral RNA during later stages of infection, when cap-dependent translation is suppressed. These findings reveal a dual role for HuR: restricting viral RNA replication while enhancing translation, highlighting its critical, phase-specific function in the DENV life cycle. Biological sciences/Immunology Biological sciences/Microbiology Biological sciences/Molecular biology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Dengue virus (DENV) is a mosquito-borne flavivirus belonging to the family Flaviviridae . DENV severe infection leads to dengue shock syndrome (DSS) in humans 1 , causing 20,000 to 40,000 deaths per year globally, as per the World Health Organization 2 . Four antigenically different dengue virus (DENV) serotypes exist (DENV-1, 2, 3, and 4) with varying pathogenesis 3,4 . The virus enters the host cells via receptor-mediated endocytosis and interacts with the endoplasmic reticulum (ER) membrane, forming replication complexes known as detergent-resistant membranes (DRMs) 5,6 . These replication complexes have been shown to comprise both host and viral proteins, which interact with the viral RNA and affect its life cycle. Viral proteins such as NS4A (Non-structural protein 4A) and NS4B (Non-structural protein 4B) have been shown to remodel the ER membrane complex and aid in forming a virus replication complex. Although total RNA-binding proteins (RBPs) interacting with the viral untranslated regions (UTRs) have been reported earlier, no studies have been done to identify all the host proteins present in the viral replication complex The viral 5’UTR has also been shown to translate via a cap-independent mechanism, even upon inhibition of eIF4E (Eukaryotic Initiation Factor 4E), a critical factor in cap-dependent translation 7 . However, it is not yet understood when or how this cap-independent mechanism operates during DENV infection, or which host factors are involved. RBPs such as Lupus La autoantigen (La), polypyrimidine tract-binding protein (PTB), and Heterogeneous nuclear ribonucleoprotein C (HnRNP C1/C2) have previously been shown to interact with the viral RNA and play a role in virus translation and/or replication 8–11 . RBPs binding may impact the interaction of viral UTR with other viral or host cellular factors, including proteins and miRNAs 12,13 . It may also impact the circularization of the viral RNA, which is essential for virus replication. RBPs, such as Human antigen R (HuR) and La, have often been found to be associated with the viral replication complex as they aid in the regulation of host immune response genes 14,15 . Utilization of these proteins by the virus during its life cycle also serves as a mechanism for suppressing the host's immune response upon virus infection. HuR is a vital RBP that has previously been shown to shuttle from the nucleus to the cytoplasm in the context of virus infection and has been shown to interact and stabilize many innate immune-responsive genes, such as Interleukins ( IL-8, IL-6 ,) and Tumour necrosis factor ( TNF-α) 16 , which have been shown to affect the cytokine pathway, which is central to DENV pathogenesis 17,18 . HuR is also differentially regulated by many viruses, such as Hepatitis C virus (HCV), Zika virus (ZIKV) and Chikungunya virus (CHIKV), and its modulation is known to directly affect virus-induced pathogenesis. However, the role of HuR protein in the DENV life cycle and pathogenesis has not been investigated. Given that HuR affects the replication of various viruses (HCV, ZIKV, and Coxsackievirus B3(CVB3)) through interaction with UTRs, we examined the interaction of HuR with DENV UTR 12,19,20 . Here, we report that HuR interacts with the 3’UTR of DENV and negatively regulates the viral life cycle by affecting the binding of PTB, which is known to positively influence viral replication 9 . Moreover, HuR was found to play an important role in cap-independent translation during the later stages of infection. Additionally, DENV–mediated regulation of HuR protein levels directly influences virus-induced pathogenesis by stabilizing host immunomodulatory genes. Overall, our work highlights the role of an important host factor, HuR, in viral replication, cap-independent translation, and pathogenesis. Results 1) HuR protein is associated with the viral replication complex, and its levels are downregulated upon infection - Understanding the composition of the Detergent Resistant Membranes (DRMs), which comprise the viral replication complex, is crucial in dissecting the regulation of viral replication inside the host. Therefore, DRMs were isolated from virus-infected Huh7 cells at 48 h post-infection by treating the cell lysate with and without detergent, followed by ultracentrifugation (Supplementary Figure. 1a). The results showed a significant shift in the position of some known RBPs, such as HuR and PTB, toward lower fractions, along with the enrichment of the viral NS5 protein, which served as a positive control, suggesting their presence in the DRM fractions. Mass spectrometry data of fractions 3rd, 4th, and 5th identified a lot of RBPs such as HuR and PTB, along with heat shock proteins and chaperons, all of which were found to be associated with the viral replication complex and could play a critical role in the viral life cycle (Supplementary Table 2). The viral NS5 protein is predominantly nuclear, and the cytoplasmic localization is within the viral replication complex (Supplementary Figure. 1 (a, b, and c)). Therefore, the NS5 protein was used as a marker to determine the site of virus replication. Its cytoplasmic localization was visualized using a cytoplasmic-specific permeabilization agent, digitonin. To check whether the RNA-binding protein HuR co-localizes with the viral NS5 protein in the DRM, confocal microscopy was performed at 48 h post-infection using digitonin-mediated permeabilization. PTB was used as a positive control, which was previously shown to aid in the viral life cycle. The data analyses showed that HuR and PTB significantly colocalized with the viral NS5 protein with a colocalization coefficient of > 0.5 (Figure. 1a). To assess the interaction of HuR protein with the viral RNA, confocal microscopy was performed with dsRNA antibody (J2) and anti-HuR antibody in the background of virus infection. The results indicated the association of viral RNA with HuR protein upon infection with a Mander’s colocalization coefficient of > 0.5 (Figure. 1b). To further assess the effect of virus infection on the overall levels of HuR and PTB, infection was carried out at Multiplicity of Infection 1(MOI = 1) in Huh7 cells, followed by reverse transcription polymerase chain reaction (RT-PCR) to check for viral RNA levels (Supplementary Figure. (1d and e)). The levels of PTB and HuR were checked using western blotting from 6 hours to 72 hours post-infection (Fig. 1 c). Interestingly, a significant decrease in the levels of HuR protein was observed at 48 hr post-infection, whereas PTB levels remain high, which coincides with the decrease in host translational machinery as observed in DENV infection 21 . 2) HuR negatively regulates DENV replication – Next, to determine further whether this change in protein level regulation is due to the shuttling of these proteins from the nucleus to the cytoplasm post-infection, we checked their abundance post nuclear-cytoplasmic fractionation upon infection in Huh 7 cells. (Supplementary Fig. 2b). We found no significant difference in the abundance of HuR in the cytoplasm upon virus infection, indicating no relocalization of the protein to the cytoplasm post-infection. The same was visible qualitatively using different permeabilization agents, i.e., Triton X-100 and digitonin (Supplementary Fig. 2a). To evaluate the role of HuR in the viral life cycle, HuR was silenced using HuR-targeting siRNA in Huh7 cells, followed by virus infection (Fig. 2 a and b). Upon partial silencing of HuR, a significant upregulation of the viral RNA was observed at 48 h and 72h post-infection. In contrast, overexpression of HuR led to a significant downregulation of viral RNA levels, post-infection (Fig. 2 c and d). Furthermore, to determine whether HuR influences the viral RNA translation or replication, we used a DENV sub-genomic replicon construct containing a luciferase reporter gene in place of the structural proteins (Fig. 2 e). The luciferase values did not show significant changes upon silencing of the HuR gene (Fig. 2 f and g), suggesting that HuR predominantly affects the viral RNA replication via interacting with the viral 3’UTR, as shown earlier. However, the replicon construct does not mimic real virus infection, and its transfection does not result in global shutdown of cap-dependent translation. To further evaluate the impact of total knockout (KO) of HuR and PTB on the viral life cycle, CRISPR-mediated KO of both HuR and PTB was performed in HEK-293T cells (Fig. 2 j). As anticipated, viral replication was significantly upregulated (by approximately 100%) in HuR KO cells, whereas the PTB KO resulted in significant downregulation (by approximately 80%) of viral replication (Fig. 2 h and i). We also repeated the infection in HuR KO cells with DENV serotype 1 and observed a similar result (Supplementary Fig. 2g). The KO of HuR and PTB also resulted in significant variation in the virus titre in the supernatant of the infected cells post 72 hr of infection, where the KO of HuR caused an increased virus titre by 50% in the supernatant whereas the KO of PTB resulted in a decrease of around 70% virus titre in the supernatant as compared to normal Hek 293T cells (Fig. 2 k). The specificity of the KO cells was also confirmed by a rescue experiment with HuR and PTB overexpression in the background of KO cells (Supplementary Fig. 2 (c-f)). Overall, these results suggest that HuR acts as a negative regulator of viral RNA replication, in contrast to PTB, which has been reported as a positive regulator of viral RNA replication 9 . 3) HuR protein interacts with the viral 3’UTR – To determine whether HuR protein interacts with viral RNA, a direct Ultraviolet crosslinking (UV) experiment was performed using recombinant HuR protein and radiolabelled viral 5’ and 3’ UTR RNA, followed by RNase treatment and autoradiography. The results showed a significant interaction of HuR protein with the viral 3′UTR that increased with increasing protein concentration (Fig. 3 a). To further confirm the specificity of this interaction, a competitive UV-crosslinking experiment was conducted in the presence of self and non-self-cold RNAs. The results indicated a specific interaction between HuR and the viral 3’UTR, but not the viral 5’UTR (Fig. 3 b and c). Further crosslinking assay with different domains of 3’UTR showed interaction with the 3’Stem loop (SL) region, in close proximity to the PTB binding site (Supplementary Fig. 3a). Additionally, to validate the specificity of the interaction, a competitive UV-crosslinking experiment was performed using S10 lysates from Huh7-infected cells. A specific decrease in the intensity of a band corresponding to the molecular weight of HuR was observed, which was further confirmed by immunoprecipitation with an anti-HuR antibody after UV-crosslinking (Fig. 3 d and e). Further, to examine HuR protein interaction with viral RNA following DENV-2 infection, RT-PCR was performed post-immunoprecipitation with an anti-HuR antibody. Results showed that HuR protein interacts with viral RNA post-infection (Fig. 3 f and g), and its binding is specific for the viral RNA 3'UTR. 4) PTB displaces HuR from the 3’UTR of the viral RNA, leading to an increase in viral RNA levels upon infection – To understand the mechanism by which HuR regulates the viral life cycle, the binding site of HuR protein at the 3’UTR of the viral RNA was investigated using CatRapid tool and sequence-specific interaction (Supplementary Fig. 4a). Interestingly, the binding site for PTB was found to overlap with the binding site for HuR protein (Supplementary Fig. 4a-b). To assess the interplay between these two proteins, immunoprecipitation was performed using anti-HuR and anti-PTB antibodies, and the associated viral RNA was quantified by RT-PCR at different time intervals post-infection. HuR was more strongly associated with viral RNA at 24 h, whereas PTB association was greater at 48hr (Fig. 4 a-d). Additionally, PTB was found to displace HuR protein from the 3’UTR of the viral RNA, whereas HuR protein could not displace PTB in the in vitro UV-crosslinking assay (Fig. 4 e). Overexpression of PTB displaced HuR from the viral RNA in IP-RT (immunoprecipitation followed by reverse transcriptase polymerase chain reaction), whereas HuR overexpression failed to displace PTB (Fig. 4 f- i). To further assess HuR displacement by PTB, the putative binding sites of HuR and PTB were mutated in the 5′Luc3′ reporter construct (Fig. 4 j). The wild-type and mutant 5’Luc3’ reporter DNAs were transfected into Huh7 cells, and luciferase activity was measured at 48 h. The HuR binding mutant showed higher luciferase activity compared to the PTB binding mutant (Fig. 4 k). The overall affinity of HuR and PTB with DENV 3’UTR was calculated using a Biolayer interferometry (BLI) assay, where PTB was found to be associated with a 100-fold higher affinity (Kd ~ 10 -6 M) as compared to HuR (Kd ~ 10 -8 M) (Fig. 4 l-m). To confirm the impact of these mutations on protein binding, IP-RT was performed after transfection with wild-type and mutant constructs (Supplementary Fig. 3b-f). The HuR binding mutant showed greater PTB interaction, while the PTB binding mutant exhibited greater HuR interaction with the reporter construct, reconfirming the interplay between HuR and PTB at the viral 3′UTR. 5) HuR positively regulates cap-independent translation at later time points post-infection – To understand the role of HuR in cap-independent translation of DENV, reporter constructs 5’UTR Firefly luciferase (Fluc) and 5’UTR-FLuc-3’UTR were transfected into Huh7 cells in the background of virus infection at MOI-1. Renilla luciferase (Rluc) was used as an internal control for cap-dependent translation. An increase in Fluc/Rluc ratio was observed at 24 h and 48 h post-infection in cells transfected with 5’UTR-Luc-3’UTR but not in 5’UTR-Luc (Fig. 5 a- b). Results clearly show cap-independent translation at a later time point post-infection, and the specific role of 3’UTR in its regulation 7 , along with a significant decrease in cap-dependent translation, which is further evidenced by polysome analysis at 48hr post-infection, which shows an increase in the monosomal peak, and subsequent decrease in the polysomal peak at 48hr in infected cells (Fig. 5 c). However, the viral RNA translation was still upregulated at later time points i.e 48 hr (Fig. 1 c) and (Supplementary Fig. 4e). Further, to specifically assess the role of HuR binding to the 3’UTR in cap-independent translation at later time points, 5’UTR-Luc-3’UTR and 5’UTR-Luc-3’UTR (delta HuR) reporter constructs were transfected into HEK293T cells. As expected, the HuR binding mutant showed a significant decrease in Fluc/Rluc ratio in the background of virus infection, even at 48 hr hours post-infection when the HuR levels were found to be significantly downregulated (Fig. 5 d) and (Fig. 1 a). To reconfirm the role of HuR in cap-independent translation of DENV RNA, the reporter constructs were transfected in the presence of LY294002 (40uM), a known inhibitor of cap-dependent translation (Supplementary Fig. 4 (a,b)), HuR KO cells showed a significant decrease in cap-independent translation activity of DENV at 48 hr post-transfection (Fig. 5 e-f) but not at early time points where cap dependent translation is prominent mode of viral translation (Supplementary Fig. 4 (c, b)). To check the effect of viral loading on the polysomes upon infection in WT and KO cells. DENV infection was given in HEK 293T and HuR KO cells, and 48 hr post-infection, viral RNA was quantified from monosomes and polysomes. There was a substantial reduction in viral RNA load in the polysomal fractions in HuR KO cells, further highlighting HuR's role in cap-independent translation at later time points post-infection (Fig. 5 g-h). 6) HuR protein levels inversely correlate with viral RNA levels and its potential mRNA targets - To assess HuR protein levels upon infection and its role in virus-induced pathogenesis, we did pilot studies upon DENV 2 infection in AG129 mice and checked the levels of HuR in the brain and liver tissues at day 3 and day 6 post-DENV infection. HuR protein levels were downregulated at day 3 post-infection and upregulated at day 6 post-infection in mouse liver tissues (Fig. 6 b-e). The levels of HuR protein were further found to inversely correlate with viral RNA levels in liver tissues at Day 3 and Day 6 post-infection (Fig. 6 f), indicating a negative regulation of HuR by DENV, as observed in our earlier cell culture studies. The mRNA levels of the genes involved in important immunoregulatory pathways, such as IL-8, IL-6 , and TNF-α , which are known to be stabilized or destabilized by HuR protein 22 , were also checked to assess the impact of HuR protein in cellular pathogenesis (Fig. 6 g), the levels of IL-8 (Chemokine(C-X-C motif) ligand 15 (CXCL-15) in the context of mice infection) and TNF-α were found to be upregulated in both mouse liver tissue samples and HuR KO cells upon DENV infection (Fig. 6 h-i) and (Supplementary Fig. 5). Also, the association of TNF-α and CXCL-15 mRNA with HuR protein was further found to be downregulated upon virus infection at day 3 post-infection as shown by IP-RT assay (Fig. 6 j-m), thereby showing that HuR protein may play as an important player in pathogenesis via the negative regulation of TNF-α and IL-8 mRNAs upon DENV infection. Discussion DENV replication in the human host begins with the Langerhans cell beneath the skin, followed by infection in the liver, the predominant site of virus replication and pathogenesis 23–25 . Virus replication inside the host cells is affected by various host factors, including RBPs and miRNAs that bind to the viral UTRs and may act as proviral or antiviral factors. An abundance of these factors ultimately decides the virus's tissue specificity in the human host cells 13,26 or mosquito cells 27 . Upon entry into the cells, the virus forms replication complexes with the ER membrane, which is known to contain many host and viral proteins. The replication complexes of other flaviviruses such as HCV and ZIKV, have been characterized previously, showing many RBPs such as La and PTB, and chaperons such as HSPs (Heat Shock proteins). Our mass spectrometry data of the DENV replication complexes also showed a similar profile with many hnRNPs, HSPs, and RBPs present in the virus replication complex 28–30 . We also observed the enrichment of an important RBP, HuR, in our DRM fraction using western blotting. However, our mass spectrometry data did not detect the specific presence of HuR protein in the spectra, which may be due to the presence of HuR protein in small amounts in the entire cytoplasmic fractions, as evidenced by western blotting. HuR is a known RBP and an essential immunomodulatory protein that interacts with and stabilizes many genes that regulate host immune responses, including chemokines and cytokines. HuR is also known to shuttle from the nucleus to the cytoplasm via post-translational modifications, predominantly phosphorylation, under certain stress conditions such as oxidative stress and virus infection 16 . Upon DENV infection, the relocalization of HuR protein was not detected, which is consistent with the previous observations of no relocalization for other vital factors, such as PTB and DEAD-box helicase 6 (DDX6), upon DENV infection in Huh 7 cells 31–33 . This may be due to the protein's cytoplasmic level being sufficient to regulate the viral life cycle, as shown by HuR co-localization with the viral NS5 protein using digitonin, a cytoplasmic-specific permeabilization agent, as well as silencing and overexpression results. The interaction of HuR protein with the 5’UTR has predominantly been reported to play a role in viral RNA translation, as seen in the HCV virus 34 . In contrast, its interaction with the 3’UTR plays a predominant role in replication, as seen with CVB3 20 . The 3’UTR-specific interaction of HuR and the lack of any effect on the viral translation using the replicon system show that, in the context of DENV, HuR has a predominant role in viral RNA replication compared to cap-dependent translation. Interestingly, the predicted HuR binding site overlaps with another known RBP, PTB, which has been previously shown to positively regulate viral RNA replication. This is evident in our study using gene-specific CRISPR KO cell lines for HuR and PTB. The overlapping interaction of HuR and PTB, along with the in vitro and ex vivo experiments, demonstrated that during infection i.e., from 24 h to 48 h when the viral RNA starts replicating, the displacement of HuR protein by PTB from the 3’UTR of the viral RNA due to higher affinity of PTB act as a molecular switch that helps the viral RNA peak post 24 h of infection. DENV has previously been shown to exhibit both cap-dependent and cap-independent mechanisms of translation 7,35,36 . Recent reports also suggest that transacting factors, such as PTB, may affect the Internal ribosome entry site (IRES) activity of DENV upon infection 11 . However, it has not been shown at which phase of the viral life cycle the viral RNA undergoes a transition from cap-dependent to cap-independent translation, and whether other host factors are required in this process. Using reporter constructs, we were able to show that the cap-independent mode of translation may be prominent at a later phase of the viral life cycle, i.e., 48 h post-infection, which can be attributed to a reduction in the levels of canonical translation factors 21 due to an overall reduction in global translation upon virus infection, as shown by polysome analysis. The results indicated a specific role for the 3’UTR in cap-independent translation, corroborating previous observations 7,37 . Luciferase assays performed in the presence of virus infection and the cap inhibitor LY294002 in HuR KO cells show the role of HuR protein in regulating cap-independent translation, which may be due to the 3′UTR-binding activity of HuR protein that inhibits replication, thereby allowing more viral RNA to be available for translation, or possibly due to the dysregulation of host factors that are themselves regulated by HuR protein 38 . Hence, it may be possible that both PTB and HuR play a role in cap-independent translation at a later phase of the virus life cycle, when we observe a global reduction in cap-dependent translation upon infection. Preliminary studies in the immunocompromised AG129 mouse model also corroborated our cell culture data, showing higher HuR protein levels at low virus titers. In contrast, high virus titers led to downregulation of HuR protein levels, facilitating greater viral RNA replication. The mRNA targets of HuR protein, which have previously been shown to play important roles in the cytokine pathway 22 , were also found to be dysregulated upon virus infection, inversely correlating with changes in HuR protein levels in both cell culture and mouse models. This suggests a destabilizing role for HuR in regulating TNF-α and IL-8 ( CXCL-15 in the context of mice infection) mRNA levels during DENV infection. The protein levels of TNF-α have already been shown to be upregulated in infected mice and patients with severe Dengue 39 . However, this study needs to be further validated in an immunocompetent DENV mouse model with more time points and greater statistical power to strengthen the finding that cytokine levels are regulated by HuR upon DENV infection. Overall, this study uncovers how the virus cleverly uses host cell machinery at different stages of infection, demonstrating for the first time all the host factors present in the viral replication complex and elucidating the double role of an important RBP, HuR, in the DENV life cycle and pathogenesis, highlighting its potential as a target for antiviral therapies. Methods Isolation and Characterization of DRMs – To characterize the DRMs, a membrane flotation assay was performed. Briefly, the cells were lysed in a hypotonic buffer by passing them through a 25-gauge needle 20 times. Centrifugation was performed for 5 minutes at 1,000 × g to remove cell debris and nuclei. Cell lysates (3mg/ml) were mixed with 1.5 ml of 72% sucrose in low-salt buffer (LSB). The mixture was overlaid with 55% sucrose in LSB followed by 0.75 ml of 10% sucrose in LSB. The sucrose gradients were centrifuged at 38,000 rpm for 14 h at 4°C using a Beckman SW55 Ti rotor. Fractions of 500 µl were collected, and 100 µl from each fraction was resolved by SDS-PAGE followed by Western blotting. To analyze the proportion of proteins in the detergent-resistant membrane (DRM) fractions, cell lysates were treated with 1% NP40 or 0.5% Triton X 100 for 30 min on ice before ultracentrifugation. LC-MS/MS analysis – Protein extraction and trypsin digestion. A total of 100 µg protein was reconstituted in 50 mM ammonium bicarbonate buffer, reduced with 10 mM dithiothreitol for 1 hour at 65°C followed by alkylation with 40 mM iodoacetamide for 30 minutes at 37°C in dark. The proteome was hydrolysed overnight with MS-grade trypsin with final protease to protein ratio of 1:50 at 37°C. Further the digested peptides were cleaned by solid phase extraction by using Sep-Pak Vac 1cc (50mg) C18 Cartridges (Waters Corporation). The peptide concentration was determined by BCA assay before being loaded onto analytical column. LC-MS/MS acquisition and database search – The proteomic dataset was acquired by using Ultimate3000 RSLC nano system online coupled to a QExactive Plus Orbitrap MS with an EASY nano-Spray interface (Thermo Fisher Scientific). The peptides were resolved on a C18 analytical column (2 µm, 100 Å particles, 75 µm × 50 cm), mobile phases for peptide separation (A, 0.1% FA in 5% acetonitrile; B, 0.1% FA in 100% acetonitrile) delivered by the RSLC nano system with flow rate 0.3 µL/min. The gradient time was 117 min, reaching 38% of B. The peptides were ionized in positive mode and acquired in full scan using top 15 method for precursor selection with a resolution 140,000, custom AGC target followed by 15 MS/MS scans with a resolution of 17,500, custom AGC target, mass isolation window of 1.4 m/z, and normalized collision energy at 29 eV. The proteomic data set was processed and analysed by using SEQUEST HT search algorithm in Proteome Discoverer v2.4 (Thermo Fisher Scientific) with a UniProt human database for protein identification and quantification across all samples. The search parameters included were oxidation of methionine (15.99 Dalton), and fixed modification of cysteine carbamidomethylation (57.021464 Dalton). Peptide identification was performed using a 10-ppm precursor ion tolerance and 0.02 Da for-product ions, peptide spectrum matches were adjusted to 1% false discovery rate. Proteins with at least 1 unique peptide were considered for further analysis. Cell lines and transfections – Huh7 cells were provided by the laboratory of Charles M. Rice, Rockefeller University, and Apath, LLC (New York, NY, USA) and maintained in Dulbecco's modified Eagle's medium (DMEM; Sigma) with 10% Fetal bovine serum (FBS) (Gibco, Invitrogen). Transfection was carried out using Lipofectamine 2000 (Invitrogen) in accordance with the manufacturer's protocol. CRISPR KO cell lines generation – The guide RNA targeting HuR and PTB sequence were designed using IDT Crispr design tool. These gRNA were cloned in the pSpCas9(BB)-2A-GFP (PX458) vector as per the described protocol. The clones were transfected in HEK-293T cells and 48h post transfection, the cells expressing GFP were sorted as one cell per well in a 96-well plate. These cells were grown and analysed for HuR and PTB knockout using western blotting and confirmed though sequencing. gRNA HuR: ACCACATGGCCGAAGACTGC gRNA PTB: GCTCCCCATCGACGTCACGG Nuclear - Cytoplasmic fractionation – Nuclear and cytoplasmic extracts were prepared using the SIGMA CelLytic NuCLEAR Extraction Kit as per manufacturer’s protocol. Briefly, cells were lysed in hypotonic lysis buffer and treated with 1% IGEPAL as per the manufacturer’s recommendations (NXTRACT, SIGMA) to obtain the cytoplasmic extract. The nuclear pellet was then washed thoroughly with lysis buffer and lysed in the extraction buffer. The protein concentration of each extract was determined by Bradford assay. Equal amounts of protein were resolved on a SDS-10% PAGE followed by western blot using the desired antibodies. Preparation of virus stock – Dengue virus serotype 2 (DENV-2) (IND/P23085/1960 strain, Gene Bank accession no. JQ922552.1) was provided by Dr. Sankar Bhattacharyya, and Dengue virus serotype 1 (DENV-1) (NR-3787) was procured from BEI resources. First, 2.2×10 6 (2.2 million) C6/36 cells were seeded in a T‐175 flask. Cells were infected with MOI‐1 of DENV serotype 1 or 2 in serum‐depleted L‐15 media 16 h after seeding. The cells were incubated with the virus for 4 h. After 4 h, the complete L‐15 medium was added. Seven days postinfection, the supernatant was collected and concentrated to 1/10 of the original volume using a 100 kDa centricon tube (Sartorious). The virus stock was further aliquoted and stored at − 80°C. The virus titer was calculated by determining the Foci forming units (FFUs) assay upon infection in Vero cells using confocal microscopy at different virus stock dilutions. The total Foci-forming units (FFUs) were counted, followed by multiplication by the dilution factor to obtain the virus titre, which was used to determine the seeding cell density. DENV infection in Huh7 cells – Huh7 cells (70% confluent monolayer) (7×10 4 cells) were infected with MOI-1 of the Dengue virus serotype 2 (DENV-2) (IND/P23085/1960 strain, Gene Bank accession no. JQ922552.1) and Dengue virus serotype 1 (DENV-1) (BC89/94 (NR-3787, BEI Resources) in serum-depleted DMEM two hours after infection, DMEM supplemented with 10% fetal bovine serum was added. Cells were harvested after 24 h, 48 h, and 72 h using TRI reagent (Sigma) for total RNA isolation and qRT-PCR. Quantitative real-time polymerase chain reaction (qRT-PCR) – Total RNA was isolated using TRI Reagent (Sigma). Briefly, the cells and mouse tissues (post-homogenisation using a pestle) were incubated with TRI reagent, followed by the addition of 1/5th volume of chloroform, which was mixed thoroughly. The supernatant was collected after centrifugation at 10,000 RPM for 10min at 4°C. An Equal volume of Isopropanol was added to the supernatant, followed by overnight precipitation at -80°C. The next day, the RNA was precipitated at 12,000 RPM for 30min at 4°C, then dissolved in RNase-free water, followed by DNase (Thermo Fisher) treatment to remove any DNA contamination. The RNA was immunoprecipitated with an equal volume of isopropanol at 12,000 RPM at 4°C, followed by which cDNA preparation and Real Time PCR were carried out. SYBR Green mRNA Assay System was used for Real Time PCR. The RT reaction was carried out in three stages. The first phase included 600 ng of total RNA, 0.5 µl of RNase Inhibitor, 2 µl of mRNA-specific reverse primer (10 mM), and 2 µl of GAPDH reverse primer (10 mM). 75°C, and 5 minutes, and snap cooling were the reaction conditions. This reaction mixture was then supplemented with 0.1 µl of reverse transcriptase enzyme, 2 µl of 10× RT buffer, and 2 µl of 10 mM dNTPs mix. Five minutes at 25°C, one hour at 42°C, and ten minutes at 75°C were the final reaction conditions. After that, RT-PCR was carried out in a total reaction volume of 10 µl containing 5 µl of 2× Master Mix, 1 µl of mRNA-specific forward primer (10 mM), 1 µl of mRNA-specific reverse primer (10 mM), 0.2 µl of Rox, and 2 µl of RT product. The reaction conditions were 95°C for 10 min, followed by 40 cycles of 95°C for 30 s, 61°C for 30 s, and 72°C for 30 s. The primers used in the study have separately been provided in Supplementary Table 1. siRNA transfection – Briefly, 14 h after seeding of cells, 150 nM siRNA targeting HuR, and a nontargeting siRNA (Dharmacon) was transfected using Lipofectamine 2000 transfection reagent in Opti-MEM (Invitrogen). At 96 h post transfection the cells were harvested, and the extracts were used for Western blot analysis as described below. In the case of transient transfections, siRNA was transfected first, and DENV was infected 16 h later. Cells were harvested at the time points after DENV infection as indicated on the figures. Immunofluorescence staining – For immunofluorescence staining, ∼0.06 × 10 6 Huh 7 cells were seeded in a 24-well plate on coverslips for 14 h, followed by infection with DENV (MOI = 1). At 48 h post-infection, cells were washed twice with 1× phosphate-buffered saline (PBS) and fixed using 4% Paraformaldehyde (PFA)at room temperature (RT) for 10min. Permeabilization was done with 0.1% Triton X-100 or 10ug/ml digitonin for 10 min at room temperature, after one hour of incubation with 3% bovine serum albumin (BSA) at 37°C, the cells were treated with the antibodies shown in the figure for two hours at 4°C. Alexa-488-conjugated anti-mouse or Alexa-647 conjugated anti-rabbit secondary antibodies were then used for 30 minutes (Invitrogen) to identify the cells. Andor dragonfly 200 (spinning disc confocal). The overlap coefficient was used to measure colocalization in ImageJ; a value of 0 indicates no colocalization, while 1 indicates full colocalization. For Fig. 1 , b Mander’s co-localization was used for the overlap of the green channel over the red channel. For each experiment, over 60 cells were examined. Western blot analysis – Proteins were isolated from the cell culture samples and the mouse liver tissues using RIPA reagent-mediated cell lysis. Briefly, cells and mouse tissues were incubated with 1X RIPA reagent (50mM Tris-HCl, pH = 8, 1mM EDTA, 0.5mM EGTA, 1% Triton X-100, 0.5% Sodium deoxycholate, 0.1% SDS, 50mM NaCl, 1mM PMSF), followed by mechanical lysis and vortexing to isolate the protein. The protein concentration was estimated using the Bradford test (Bio-Rad), and equal volumes of cell extracts were separated using SDS–12% PAGE and then put onto a nitrocellulose membrane (Pall Corporation). Using the appropriate secondary antibody (horseradish peroxidase-conjugated anti-mouse or anti-rabbit IgG [Sigma]), the samples were analyzed by Western blotting using the desired antibodies, which included anti-HuR antibody (3A2; Santa Cruz), anti-NS5 antibody (GTX103350; Genetex), anti-La antibody (ab75927; Abcam), or anti-PTB antibody (Calbiochem). To ensure that entire cell extracts loaded equally, a mouse monoclonal anti-β-actin peroxidase-conjugated antibody (A3854; Sigma) was employed as a control. An Immobilon Western system (Millipore) was used to detect antibody complexes. In vitro transcription – Runoff transcription processes were used to in vitro transcribe RNAs from various linearized plasmid constructs using T7 promoters. Xba1 was used to linearize pcDNA3 vectors carrying the DV 5′ UTR, DV 3′ UTR, and PGMT vector. After being electrophoresed on agarose gels and extracted using a Qiagen gel elution kit, the linear DNA samples were used as templates for the production of unlabeled or 32P-labeled RNA with [32P]UTP (BRIT) and T7 RNA polymerase (Thermo Fisher). 2.5 µg of linear template DNA was used in the transcription reaction, which was conducted for 1.5 hours at 37°C using normal conditions (Thermo Fisher protocol). The RNA was resuspended in 20 µl of nuclease-free water following alcohol precipitation. One microliter of the radiolabeled RNA sample was spotted onto DE81 filter paper, washed with phosphate buffer, and dried, and the incorporated radioactivity was measured using a liquid scintillation counter. Protein purification. In Escherichia coli BL21(DE3) cells that had been transformed using the proper pET28a vectors, recombinant HuR, PTB, and La proteins were produced. At an optical density of 0.6 at 660 nm, 0.5 mM isopropyl-1-thio-β-d-galactopyranoside (IPTG) was used to induce the expression of recombinant HuR, PTB, and La. The cells were then allowed to proliferate for an additional five hours. Sonication was used to break up the cells on ice after they had been pelleted and resuspended in lysis buffer (50 mM Tris, pH 7.5, 300 mM NaCl, 0.1 mM phenylmethylsulfonyl fluoride [PMSF]). Every step that followed was done at 4°C. After centrifuging the lysates for 30 minutes at 10,000 rpm, they were incubated for 6 hours in cyclomixer with a Ni-nitrilotriacetic acid (NTA)-agarose slurry (Qiagen). The flowthrough was disposed of, and the protein bound slurry was put onto a column. 20 ml of wash buffer (50 mM Tris, pH 7.5, 300 mM NaCl, and 40 mM imidazole) was used to wash the column. 500 µl of an elution solution containing 500 mM imidazole was used to elute the bound protein. Following a 4- to 6-hour dialyzation in ten times the volume of dialysis buffer (50 mM Tris, pH 7.4, 100 mM KCl, 7 mM β-mercaptoethanol [β-ME], 20% glycerol), the eluted proteins were aliquoted and kept in a freezer at -70°C. Preparation of S10 extracts – The preparation of S10 extracts followed as described by Ray et al (16). In summary, 10% FBS (Gibco, Invitrogen) was added to DMEM (Sigma) to support the growth of Huh7 or replicon cells. Following three rounds of washing with cold isotonic buffer (35 mM HEPES, pH 7.4, 146 mM NaCl, and 11 mM glucose), a monolayer of cells was harvested, pelleted down, and resuspended in 1.5× packed cell volume of hypotonic buffer (10 mM HEPES, pH 7.4, 15 mM KCl, 1.5 mM Mg-acetate, and 6 mM β-ME). The cells were then allowed to swell for 10 minutes on ice. After that, the cells were sent to a Down's homogenizer and given 50 ice strokes to break them up. 20 mM HEPES, 1.2 M KCl, 50 mM Mg-acetate, and 60 mM β-mercaptoethanol comprised the 1× incubation buffer in which the lysate was incubated for 10 minutes. To obtain the cytoplasmic extract (S10 supernatant), the lysate was centrifuged at 10,000 × g for 30 minutes at 4°C. 1 L of dialysis buffer (10 mM HEPES, 90 mM KCl, 1.5 mM Mg-acetate, 7 mM β-ME, and 20% glycerol) was dialyzed against the supernatant for 2 to 4 hours. UV-induced cross-linking of proteins with RNA and immunoprecipitation (IP) assays – The procedure outlined by Ray and Das (16) for UV-induced cross-linking was used. Briefly, in 1× RNA binding buffer (5 mM HEPES, pH 7.6, 25 mM KCl, 2 mM MgCl2, 3.8% glycerol, 2 mM dithiothreitol [DTT], and 0.1 mM EDTA), α-32P-labeled RNA probes were allowed to form complexes with S10 extracts or with recombinant proteins before being exposed to UV light for 20 minutes. The mixture was separated on an SDS–10% polyacrylamide gel (SDS-PAGE), post treatment with 30 µg of RNase A (Sigma), and then subjected to phosphor imaging analysis. For competition crosslinking assays, the cold RNA specific to the probe and the Nsp RNA (Non-specific RNA control), i.e., the Multiple cloning site region of the PGMT vector, were used based on RNA molecular weight estimates. RNase A-treated reaction mixtures (30 µg of total protein) were prepared for immunoprecipitation (IP) using polysome lysis buffer (100 mM KCl, 5 mM MgCl2, 10 mM HEPES, pH 7.0, 0.5% NP-40, 1 mM DTT, and 100 U/ml RNasin) up to 500 µl. and precleared with protein G-Sepharose beads for 1 h at 4°C. To pellet the beads, the samples were spun at 1,000 × g for two minutes, and the supernatant was then discarded. Protein G-Sepharose beads were added to the precleared lysates and incubated for three hours at 4°C with continuous mixing using a cyclomixer. They were incubated with 2 µg of anti-HuR antibody (Santa Cruz) overnight at 4°C in a total volume of 200 µl of polysome lysis buffer. Polysome lysis buffer was used to wash the beads four times. After the immunoprecipitated protein was released from the beads by boiling them in SDS sample buffer, the supernatant was electrophoresed on an SDS–10% PAGE gel. Autoradiography was used to create, expose, and dry the gel. Biolayer Interferometry (BLI) – Binding interactions between HuR or PTB and the DENV 3′ UTR RNA were measured by biolayer interferometry (BLI) using an Octet RED96 system. All experiments were performed at 25°C with constant agitation (1,000 rpm). Measurements were carried out in kinetic buffer consisting of phosphate-buffered saline supplemented with 0.01% Tween-20 and 0.1% bovine serum albumin to minimize nonspecific interactions. Ni–NTA biosensors were hydrated in kinetic buffer for at least 10 min before use. His-tagged HuR or PTB was immobilized onto the sensors at a concentration of 20 µg/ml until a stable loading signal was obtained. Following protein immobilization, sensors were equilibrated in kinetic buffer to establish a baseline. For association measurements, protein-loaded sensors were transferred to wells containing DENV 3′ UTR RNA at final concentrations of 2 µM and 3 µM. Dissociation was monitored by subsequently transferring the sensors back into kinetic buffer. Reference sensors lacking RNA were included in parallel and used for background subtraction. Sensorgrams were processed by reference subtraction and analysed using Octet Data Analysis software. Binding data were evaluated using a 1:1 Langmuir binding model. Apparent association (k on ) and dissociation (k off ) rate constants were obtained where fitting was supported by the data, and equilibrium dissociation constants (K d ) were calculated from the ratio k off /k on . IP-RT assay – An experiment known as ribonucleoprotein complex immunoprecipitation (RNP IP) was used to evaluate the relationship between HuR, PTB, and DENV RNA. In short, IP was performed using 2 µg of either anti-HuR or anti-PTB antibody or a Human IgG isotype control antibody (Imgenex) after whole-cell lysates were prepared in polysome lysis buffer. Before being treated with the corresponding antibodies in polysome lysis buffer for 16 hours at 4°C, Protein G beads (Sigma) were preblocked with 0.4% BSA for 30 minutes at room temperature. For each reaction volume, 1mg of cell lysate was employed. After lysates were precleared with protein G beads for 1 hour at 4°C, they were then incubated with the target antibody for 4 hours at 4°C. After four rounds of washing with polysome lysis buffer, the beads were treated with 0.1% SDS and 30 µg of proteinase K at 50°C for 30 min, followed by RNA isolation with TRI reagent and RT-PCR to detect DENV RNA NS5 region. The ct values of the input RNA from each condition was taken as a normalization control. Sucrose gradient preparation – 10% and 50% sucrose solution is prepared in 1X gradient buffer. 10x gradient buffer (200Mm Tris HCL, 1.5M KCL, and 50Mm MgCl2) is diluted to 1x buffer sucrose solution, and cycloheximide (100µg/ml) was added. Equal volume (1:1 ratio) of 10% sucrose buffer and 50% sucrose buffer was sequentially poured into an ultracentrifuge tube (Beckman Coulter). Ultracentrifuge tubes were further spun at 21RPM for 1 minutes 50 seconds at 80 o in Bio Comp gradient maker to prepare continuous sucrose gradient. 500 µg of samples were poured from the top. Polysome characterization – To identify the association of viral RNA in polysomal fraction and effect of virus infection on global translation, sucrose gradient polysome fractionation was performed. After 48h post infection, cells were treated with 100 µg/ml cycloheximide for 15min at 37°C. Followed by that cells were washed with PBS and thereafter wash with 1x hypotonic buffer (5 mM MgCl2, 5 mM Tris-HCl pH-7.5, and 1.5 mM KCl). 100 µg/ml cycloheximide was added for all buffers used for sample processing. Cells were scraped in lysis buffer (5 mM Tris-HCl pH-7.5, 5 mM MgCl2, 1.5 mM KCl, 100 µg/ml cycloheximide, 1mM DTT, 200 U/ml RNase inhibitor from Promega, 0.5% Sodium-deoxycholate, 0.5% Triton X -100, 200µg t- RNA and 1X protease inhibitor cocktail) and incubated at ice for 20mins. After completion of lysis, the KCL was added to the lysate to adjust the KCl concentration to 150mM, and then the supernatant was collected after spinning the lysate for 8min at 3000 g at 4°C. 10–50% w/v sucrose gradient was prepared and supernatant was added from the top and samples were ultracentrifuged for 2h at 36000rpm at 4°C in sw41 rotor (Backman). Density gradient fractionation system was further used to fractionate the gradients at a flow rate of 0.3mm/sec in different microfuge tubes. UV detector at 254nm generates polysome profiles, which further used to distinguish the tubes containing 40s,60s, monosomes and polysomes (Biocomp polysome profiler). RNA isolation by Hot phenol method – To isolate RNA from Monosome and polysome fractions, RNA grade phenol (pH: 4.8–5.2) was pre heated at 60 o and equal volume of heated phenol was added in each fraction. Samples were further mixed and kept in 60 o dry bath for 10 minutes (Intermittent mixing was performed) and followed by that equal volume of chloroform was added and samples were vortexed and spun at 13000 RPM for 15 minutes. Aqueous layer was collected and 1/10th volume sodium acetate and 2x volume absolute ethanol added and kept for RNA precipitation. Luciferase assays – Transfected cells were isolated and lysed with Promega's 1× passive lysis buffer. The cell lysates were centrifuged for 10 minutes at 10,000 rpm at 4°C. After collecting the supernatant, the Dual Luciferase kit (Promega) was used to measure the luciferase reading in accordance with the manufacturer's instructions. The measurements were adjusted for total protein for the sub-genomic reporter and by the R luc (pRL-TK) values for the 5’Luc and 5’Luc3’ reporter constructs; the ratios of Fluc/Rluc were further normalized to the mock condition for the experiment. AG129 mice infection – All animal experiments were approved by BRIC-Rajiv Gandhi Centre for Biotechnology (BRIC-RGCB) Institutional Animal Ethics Committee (IAEC) (Approval No. (IAEC/911/ SREE/2022). AG129 mice (IFN-α/β and IFN-γ receptor knockouts) were procured from B&K Universal (UK), bred and maintained under specific-pathogen-free conditions. Three- to four-week-old AG129 mice were infected subcutaneously with 1 × 10⁴ plaque-forming units (PFU) of DENV-2 (strain RGCB880 35P) in a total volume of 500 µl. Mock-infected control animals were administered an equivalent volume of heat-inactivated virus as described 40 . Post-infection, mice were daily monitored for clinical symptoms including ruffled fur, hunched back, lethargy, edema with closed eyes and weight loss. Whole blood was collected by cardiac puncture under isoflurane anesthesia, on day 3 post-infection (early symptomatic phase) and day 6 post-infection (peak symptomatic phase) from both infected and mock-infected control animals. Blood samples were further processed for serum isolation. Immediately following blood collection, mice were sacrificed, and tissues including liver, spleen, and brain were harvested and preserved in RNA later for subsequent molecular analysis. All experiments were performed in at least three independent biological replicates. Statistical analyses were conducted using GraphPad Prism version 9.0 (or as applicable). Data are presented as mean, and error bars represent standard deviation Declarations Code availability No code was generated or applied in the present study. Author information Affiliations Indian Institute of Science, Bengaluru, India Ashish Aneja, Risabh Sahu, Santu Paul, SN Gagan Gaurav, and Saumitra Das Rajiv Gandhi Centre for Biotechnology, Thiruvananthapuram, India Srishti Rajkumar Mishra, Sreekumar E Institute of Advanced Virology Sreekumar E National Institute of Biomedical Genomics Arvind M. Korwar Author Contributions Conceptualization, A.A. and S.D.; Methodology, A.A., R.S, S.M., G.G., A.K., and S.P.; Investigation, A.A and S.D.; Resources, S.D.; Writing-Original, A.A. and S.D.; Writing-Review and editing, A.A., R.S., SM., S.E., A.K., and S.D.; Visualization, A.A. and S.D.; Supervision, S.D., S.E.; Funding acquisition, S.D. Corresponding author- Saumitra Das Email id – [email protected] Competing interests The authors declare no competing interests. Data availability The datasets used in the current study are available within the manuscript and the Supplementary files. Any additional data supporting the findings of this study are available from the corresponding author upon request. Acknowledgments We would like to acknowledge Prof. Ralf Bartenschlager for sharing with us DENV Sub-genomic replicon (pFK SgDV-R2A). We would also like to acknowledge the IISc DBT partnership and the mass spectrometry facility at NIBMG, Kalyani. We acknowledge the confocal facility at the MCB department and the divisional confocal facility at the Biological Science Division, IISc. We also want to acknowledge the divisional facility for BLI. No specific funding was received for this work. References Rathore, A. P. S. et al. Serum chymase levels correlate with severe dengue warning signs and clinical fluid accumulation in hospitalized pediatric patients. Scientific Reports 10 , 11856, doi:10.1038/s41598-020-68844-z (2020). Haider, N., Hasan, M. N., Onyango, J. & Asaduzzaman, M. Global landmark: 2023 marks the worst year for dengue cases with millions infected and thousands of deaths reported. IJID Regions 13 , 100459, doi:https://doi.org/10.1016/j.ijregi.2024.100459 (2024). Leitmeyer Katrin, C. et al. Dengue Virus Structural Differences That Correlate with Pathogenesis. Journal of virology 73 , 4738-4747, doi:10.1128/jvi.73.6.4738-4747.1999 (1999). Rathore, A. P. S. et al. Immunological and Pathological Landscape of Dengue Serotypes 1-4 Infections in Immune-Competent Mice. Volume 12 - 2021 , doi:10.3389/fimmu.2021.681950 (2021). Lescar, J. et al. in Dengue and Zika: Control and Antiviral Treatment Strategies (eds Rolf Hilgenfeld & Subhash G. Vasudevan) 115-129 (Springer Singapore, 2018). Rodenhuis-Zybert, I. A., Wilschut, J. & Smit, J. M. Dengue virus life cycle: viral and host factors modulating infectivity. Cellular and Molecular Life Sciences 67 , 2773-2786, doi:10.1007/s00018-010-0357-z (2010). Edgil, D., Polacek, C. & Harris, E. Dengue virus utilizes a novel strategy for translation initiation when cap-dependent translation is inhibited. Journal of virology 80 , 2976-2986, doi:10.1128/jvi.80.6.2976-2986.2006 (2006). García-Montalvo, B. M., Medina, F. & del Angel, R. M. La protein binds to NS5 and NS3 and to the 5' and 3' ends of Dengue 4 virus RNA. Virus research 102 , 141-150, doi:10.1016/j.virusres.2004.01.024 (2004). Anwar, A., Leong, K. M., Ng, M. L., Chu, J. J. H. & Garcia-Blanco, M. A. The polypyrimidine tract-binding protein is required for efficient dengue virus propagation and associates with the viral replication machinery. The Journal of biological chemistry 284 , 17021-17029, doi:10.1074/jbc.M109.006239 (2009). Dechtawewat, T. et al. Role of human heterogeneous nuclear ribonucleoprotein C1/C2 in dengue virus replication. Virology journal 12 , 14, doi:10.1186/s12985-014-0219-7 (2015). Fernández-García, L., Angulo, J. & López-Lastra, M. The Polypyrimidine Tract-Binding Protein Is a Transacting Factor for the Dengue Virus Internal Ribosome Entry Site. Viruses 16 , doi:10.3390/v16111757 (2024). Shwetha, S. et al. HuR Displaces Polypyrimidine Tract Binding Protein To Facilitate La Binding to the 3' Untranslated Region and Enhances Hepatitis C Virus Replication. Journal of virology 89 , 11356-11371, doi:10.1128/jvi.01714-15 (2015). Rani, P. et al. MicroRNA-22-3p displaces critical host factors from the 5' UTR and inhibits the translation of Coxsackievirus B3 RNA. Journal of virology 98 , e0150423, doi:10.1128/jvi.01504-23 (2024). Huang, X., Zhu, J., Li, Y., Yu, Y. & Tang, J. La protein regulates protein expression by binding with the mRNAs of target genes and participates the pathological process of ovarian cancer. Frontiers in oncology 12 , 763480, doi:10.3389/fonc.2022.763480 (2022). Majumder, M. et al. RNA-binding protein HuR reprograms immune T cells and promotes oral squamous cell carcinoma. Oral Oncology Reports 10 , 100296, doi:https://doi.org/10.1016/j.oor.2024.100296 (2024). Raheja, H. et al. Hepatitis C virus non-structural proteins modulate cellular kinases for increased cytoplasmic abundance of host factor HuR and facilitate viral replication. PLoS pathogens 19 , e1011552, doi:10.1371/journal.ppat.1011552 (2023). Apoorva, Kumar, A. & Singh, S. K. Dengue virus NS1 hits hard at the barrier integrity of human cerebral microvascular endothelial cells via cellular microRNA dysregulations. Tissue Barriers , 2424628, doi:10.1080/21688370.2024.2424628. Singh, B. et al. Defective Mitochondrial Quality Control during Dengue Infection Contributes to Disease Pathogenesis. Journal of virology 96 , e0082822, doi:10.1128/jvi.00828-22 (2022). Bonenfant, G. et al. Zika Virus Subverts Stress Granules To Promote and Restrict Viral Gene Expression. Journal of virology 93 , doi:10.1128/jvi.00520-19 (2019). George, B., Dave, P., Rani, P., Behera, P. & Das, S. Cellular Protein HuR Regulates the Switching of Genomic RNA Templates for Differential Functions during the Coxsackievirus B3 Life Cycle. Journal of virology 95 , e0091521, doi:10.1128/jvi.00915-21 (2021). Roth, H. et al. Flavivirus Infection Uncouples Translation Suppression from Cellular Stress Responses. mBio 8 , 10.1128/mbio.02150-02116, doi:10.1128/mbio.02150-16 (2017). Karginov, F. V. HuR controls apoptosis and activation response without effects on cytokine 3' UTRs. RNA biology 16 , 686-695, doi:10.1080/15476286.2019.1582954 (2019). Helgers, L. C., Keijzer, N. C. H., van Hamme, J. L., Sprokholt, J. K. & Geijtenbeek, T. B. H. Dengue Virus Infects Human Skin Langerhans Cells through Langerin for Dissemination to Dendritic Cells. The Journal of investigative dermatology 144 , 1099-1111.e1093, doi:10.1016/j.jid.2023.09.287 (2024). Swamy, A. M., Mahesh, P. Y. & Rajashekar, S. T. Liver function in dengue and its correlation with disease severity: a retrospective cross-sectional observational study in a tertiary care center in Coastal India. The Pan African medical journal 40 , 261, doi:10.11604/pamj.2021.40.261.29795 (2021). Campana, V. et al. Liver involvement in dengue: A systematic review. 34 , e2564, doi:https://doi.org/10.1002/rmv.2564 (2024). Trobaugh, D. W. & Klimstra, W. B. MicroRNA Regulation of RNA Virus Replication and Pathogenesis. Trends in Molecular Medicine 23 , 80-93, doi:10.1016/j.molmed.2016.11.003 (2017). Yocupicio-Monroy, M., Padmanabhan, R., Medina, F. & del Angel, R. M. Mosquito La protein binds to the 3′ untranslated region of the positive and negative polarity dengue virus RNAs and relocates to the cytoplasm of infected cells. Virology 357 , 29-40, doi:https://doi.org/10.1016/j.virol.2006.07.042 (2007). Viktorovskaya, O. V., Greco, T. M., Cristea, I. M. & Thompson, S. R. Identification of RNA Binding Proteins Associated with Dengue Virus RNA in Infected Cells Reveals Temporally Distinct Host Factor Requirements. PLOS Neglected Tropical Diseases 10 , e0004921, doi:10.1371/journal.pntd.0004921 (2016). Reyes-Del Valle, J., Chávez-Salinas, S., Medina, F. & Del Angel, R. M. Heat shock protein 90 and heat shock protein 70 are components of dengue virus receptor complex in human cells. Journal of virology 79 , 4557-4567, doi:10.1128/jvi.79.8.4557-4567.2005 (2005). Yeh, S. C. et al. Characterization of dengue virus 3'UTR RNA binding proteins in mosquitoes reveals that AeStaufen reduces subgenomic flaviviral RNA in saliva. PLoS pathogens 18 , e1010427, doi:10.1371/journal.ppat.1010427 (2022). Choksupmanee, O. et al. Specific Interaction of DDX6 with an RNA Hairpin in the 3' UTR of the Dengue Virus Genome Mediates G(1) Phase Arrest. Journal of virology 95 , e0051021, doi:10.1128/jvi.00510-21 (2021). Kumar, A. et al. Nuclear localization of dengue virus nonstructural protein 5 does not strictly correlate with efficient viral RNA replication and inhibition of type I interferon signaling. Journal of virology 87 , 4545-4557, doi:10.1128/jvi.03083-12 (2013). Jiang, L., Yao, H., Duan, X., Lu, X. & Liu, Y. Polypyrimidine tract-binding protein influences negative strand RNA synthesis of dengue virus. Biochemical and biophysical research communications 385 , 187-192, doi:10.1016/j.bbrc.2009.05.036 (2009). Rivas-Aravena, A. et al. The Elav-like protein HuR exerts translational control of viral internal ribosome entry sites. Virology 392 , 178-185, doi:https://doi.org/10.1016/j.virol.2009.06.050 (2009). Fernández-García, L. et al. The internal ribosome entry site of the Dengue virus mRNA is active when cap-dependent translation initiation is inhibited. Journal of virology 95 , doi:10.1128/jvi.01998-20 (2021). Song, Y., Mugavero, J., Stauft, C. B. & Wimmer, E. Dengue and Zika Virus 5′ Untranslated Regions Harbor Internal Ribosomal Entry Site Functions. 10 , 10.1128/mbio.00459-00419, doi:doi:10.1128/mbio.00459-19 (2019). Manzano, M. et al. Identification of Cis-Acting Elements in the 3′-Untranslated Region of the Dengue Virus Type 2 RNA That Modulate Translation and Replication *. Journal of Biological Chemistry 286 , 22521-22534, doi:10.1074/jbc.M111.234302 (2011). Wu, M., Tong, C. W. S., Yan, W., To, K. K. W. & Cho, W. C. S. The RNA Binding Protein HuR: A Promising Drug Target for Anticancer Therapy. Current cancer drug targets 19 , 382-399, doi:10.2174/1568009618666181031145953 (2019). Chen, H. C., Hofman, F. M., Kung, J. T., Lin, Y. D. & Wu-Hsieh, B. A. Both virus and tumor necrosis factor alpha are critical for endothelium damage in a mouse model of dengue virus-induced hemorrhage. Journal of virology 81 , 5518-5526, doi:10.1128/jvi.02575-06 (2007). Modak, A. et al. Higher-temperature-adapted dengue virus serotype 2 strain exhibits enhanced virulence in AG129 mouse model. 37 , e23062, doi:https://doi.org/10.1096/fj.202300098R (2023). Additional Declarations No competing interests reported. Supplementary Files SupplementaryData.pdf SupplementaryFiguresLegends.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9090268","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":607593070,"identity":"28817a9e-1dc8-4577-8669-93fc96c27833","order_by":0,"name":"Ashish Aneja","email":"","orcid":"","institution":"Indian Institute of Science","correspondingAuthor":false,"prefix":"","firstName":"Ashish","middleName":"","lastName":"Aneja","suffix":""},{"id":607593072,"identity":"35884326-3bde-4698-963a-fc4ef290b745","order_by":1,"name":"Risabh Sahu","email":"","orcid":"","institution":"Indian Institute of Science","correspondingAuthor":false,"prefix":"","firstName":"Risabh","middleName":"","lastName":"Sahu","suffix":""},{"id":607593074,"identity":"c8e1c68d-6c3f-46b8-8b08-91fdc40be308","order_by":2,"name":"Srishti Rajkumar Mishra","email":"","orcid":"","institution":"Rajiv Gandhi Centre for Biotechnology","correspondingAuthor":false,"prefix":"","firstName":"Srishti","middleName":"Rajkumar","lastName":"Mishra","suffix":""},{"id":607593075,"identity":"7c5d44f8-9138-4374-b0b8-0c1de4bfd79f","order_by":3,"name":"Santu Paul","email":"","orcid":"","institution":"Indian Institute of Science","correspondingAuthor":false,"prefix":"","firstName":"Santu","middleName":"","lastName":"Paul","suffix":""},{"id":607593076,"identity":"3166ba45-defa-473a-b056-630f7d1cc0a1","order_by":4,"name":"SN Gagan Gaurav","email":"","orcid":"","institution":"Indian Institute of Science","correspondingAuthor":false,"prefix":"","firstName":"SN","middleName":"Gagan","lastName":"Gaurav","suffix":""},{"id":607593077,"identity":"990ddb90-1122-4c8d-bb95-6fc1d8f14926","order_by":5,"name":"Arvind M. Korwar","email":"","orcid":"","institution":"National Institute of Biomedical Genomics","correspondingAuthor":false,"prefix":"","firstName":"Arvind","middleName":"M.","lastName":"Korwar","suffix":""},{"id":607593078,"identity":"ba5387af-609d-4b79-8816-f91b206589b6","order_by":6,"name":"E Sreekumar","email":"","orcid":"","institution":"Rajiv Gandhi Centre for Biotechnology","correspondingAuthor":false,"prefix":"","firstName":"E","middleName":"","lastName":"Sreekumar","suffix":""},{"id":607593081,"identity":"69bae740-fe1d-4315-a3c4-618cf93aa608","order_by":7,"name":"Saumitra Das","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAq0lEQVRIiWNgGAWjYFCCBAaGDwYSUI4BkVoYZ5CshZmHJGfJtyc//mxTYGHP38D88ANDwR3CWgzOPDOTzjGQSJxxgM1YgsHgGRFaJBLMmIFaEoC+MANyDxPhsBnpnz9bGEjYGzCwfyNOC8ONHANpoF2MGxh4iLTF4MybMskekF8O8xQDnUeMw9rTN3/48afOnr+9feOHD3+IcRgcMDOAU8IoGAWjYBSMAmoAAK4xMHHEtDUcAAAAAElFTkSuQmCC","orcid":"","institution":"Indian Institute of Science","correspondingAuthor":true,"prefix":"","firstName":"Saumitra","middleName":"","lastName":"Das","suffix":""}],"badges":[],"createdAt":"2026-03-11 05:39:46","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9090268/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9090268/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105035807,"identity":"112cf195-80e3-489d-90d9-1c42d29dd1ea","added_by":"auto","created_at":"2026-03-20 07:26:39","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":502502,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHuR protein is associated with the viral replication complex, and its levels are downregulated upon virus infection.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Co-localization of HuR (Alexa 488) with NS5 (Alexa 647) and co-localization of PTB (Alexa 488) with NS5 (Alexa 647) proteins checked in the cytoplasm. Virus was infected with MOI=1 in Huh 7 cells, followed by detergent-mediated cytoplasm permeabilization was performed with digitonin. DAPI staining was not performed as nucleus was not permeabilized. The Pearson co-localization analysis was done using ImageJ software (n=70).\u003c/p\u003e\n\u003cp\u003e(b) Co-localization of HuR (Alexa 647) with dsRNA (Alexa 488) checked upon infection. The virus was infected with MOI=1 in Huh 7 cells. The Manders co-localization analysis was done using ImageJ software (n=70).\u003c/p\u003e\n\u003cp\u003e(c) HuR and PTB protein levels checked during different timepoints upon infection in Huh 7 cells. 6h,12h, 24h, 48h and 72h post-virus infection, proteins were isolated, and Western blotting was done to check the levels of the proteins with actin as an internal control.\u003c/p\u003e\n\u003cp\u003eAll bar graphs are indicative of N=3, n=3, error bars represent standard deviation (SD), and statistical analysis by Student’s t Test. P\u0026lt;0.05 = *, P\u0026lt;0.01 = **\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-9090268/v1/5bf0d28c9a22a5c9e39f202a.png"},{"id":105002490,"identity":"f8a12d64-18d4-4ae0-8323-a2064d4285dc","added_by":"auto","created_at":"2026-03-19 17:21:14","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":118565,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHuR negatively regulates Dengue replication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) RT-PCR of viral RNA (positive strand) post virus infection upon silencing of HuR protein using 150nM siHuR. (b) Representative image of western blot upon partial silencing of HuR protein.\u003c/p\u003e\n\u003cp\u003e(c) RT-PCR of viral RNA (positive strand) post virus infection upon overexpression of HuR protein (200ng of pcD-HuR). (d) Representative image of western blot upon overexpression of HuR protein.\u003c/p\u003e\n\u003cp\u003e(e) Schematics of sub-genomic replicon of Dengue virus (DENV SgDV-R2A).\u003c/p\u003e\n\u003cp\u003e(f) Normalized luciferase values of DENV SgDV-R2A RNA upon partial silencing of HuR protein. The Luc values were normalized with the total protein concentration. (g) Representative image of western blot upon partial silencing of HuR protein.\u003c/p\u003e\n\u003cp\u003e(h) RT-PCR of viral RNA (positive strand) 24h post virus infection in HuR KO and PTB KO HEK-293T cells. (I) RT-PCR of viral RNA (positive strand) 48h post virus infection in HuR KO and PTB KO HEK-293T cells.\u003c/p\u003e\n\u003cp\u003e(j) Representative image of western blot for validation of HuR and PTB KO cells.\u003c/p\u003e\n\u003cp\u003e(k) Viral titre (viral RNA copy number) post-infection was measured in supernatant of HuR KO and PTB KO cells separately.\u003c/p\u003e\n\u003cp\u003eAll bar graphs are indicative of N=3, n=3, error bars represent standard deviation (SD), and statistical analysis by Student’s t Test. P\u0026lt;0.05 = *, P\u0026lt;0.01 = **\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-9090268/v1/d0d0eadea2ffd8e766b7108d.png"},{"id":105002492,"identity":"79b648da-f8c4-49ba-a2c1-170d20905a68","added_by":"auto","created_at":"2026-03-19 17:21:14","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":286084,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHuR protein interacts with Dengue virus 3’UTR.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Ultraviolet (UV) cross-linking assay showing the interaction of HuR and PTB with Dengue virus 3’UTR. Radiolabelled viral 3’UTR was incubated with recombinant proteins, followed by RNaseA treatment and autoradiography was performed\u003cstrong\u003e.\u003c/strong\u003e La protein was used as a positive control in the assay.\u003c/p\u003e\n\u003cp\u003e(b) Competition UV crosslinking assay was performed using increasing concentration of non-radiolabelled DENV 3’UTR RNA (50X, 100X, 200X, 300X) along with radiolabelled DV 3’UTR and HuR. Non-specific RNA (Nsp RNA) was used as negative control in the assay.\u003c/p\u003e\n\u003cp\u003e(c) Competition UV crosslinking assay was performed using increasing concentration of non-radiolabelled DENV 5’UTR (200X, 300X) along with radiolabelled DENV 5’UTR and HuR.\u003c/p\u003e\n\u003cp\u003e(d) Competition UV crosslinking assay was performed using increasing concentration of DENV3’UTR RNA (50X and 100X) along with radiolabelled DENV 3’UTR and S10 extract.\u003c/p\u003e\n\u003cp\u003e(e) UV crosslinking followed by immunoprecipitation (UV-IP) was performed to confirm the identity of the band as HuR protein. Radiolabelled viral 3’UTR was incubated with S10 lysate, and then Immunoprecipitation was performed with anti-HuR antibody, followed by RNase A treatment, and autoradiography was performed.\u003c/p\u003e\n\u003cp\u003e(f) Immunoprecipitation of HuR protein was performed using an anti-HuR antibody. IgG is the negative control for pulldown experiment.\u003c/p\u003e\n\u003cp\u003e(g)Enrichment of virus RNA (NS5 RNA amplified) from immunoprecipitated HuR was measured by semi-quantitative PCR followed by visualized using 2% agarose gel electrophoresis.\u003c/p\u003e\n\u003cp\u003eAll bar graphs are indicative of N=3, n=3, error bars represent standard deviation (SD), and statistical analysis by Student’s t Test. P\u0026lt;0.05 = *, P\u0026lt;0.01 = **\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-9090268/v1/19d8c879b7e6e980f9b8c57a.png"},{"id":105002495,"identity":"9f192ef0-c38f-4f3f-ac4d-3395f9fd8562","added_by":"auto","created_at":"2026-03-19 17:21:14","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":125030,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePTB displaces HuR from the 3’UTR of the viral RNA leading to an increase in viral RNA levels upon infection.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Immunoprecipitation of HuR and PTB was performed using anti-HuR and anti-PTB antibodies 24h post virus infection and representative image suggested specific pulldown of HuR and PTB protein. IgG was used as negative control for pulldown experiment.\u003c/p\u003e\n\u003cp\u003e(b) Immunoprecipitation of HuR and PTB was performed using anti-HuR and anti-PTB antibodies 48h post virus infection and representative image suggested specific pulldown of HuR and PTB protein. IgG was used as negative control for pulldown experiment.\u003c/p\u003e\n\u003cp\u003e(c)Association of Virus RNA was checked using real-time PCR from the immunoprecipitated fraction of HuR and PTB protein harvested at 24h post virus infection. Normalization was done with the Ct values of the input RNA.\u003c/p\u003e\n\u003cp\u003e(d) Association of Virus RNA was checked using real-time PCR from the immunoprecipitated fraction of HuR and PTB protein harvested at 48h post virus infection. Normalization was done with the Ct values of the input RNA.\u003c/p\u003e\n\u003cp\u003e(e) Competition UV crosslinking was performed using increasing concentration of HuR along PTB and radiolabelled DENV 3’UTR to observe competitive binding between HuR and PTB with DENV 3’UTR. Similar experiments were performed using increasing concentration of PTB along with HuR and radiolabelled DENV 3’UTR.\u003c/p\u003e\n\u003cp\u003e(f) Competitive binding of HuR and PTB with DENV 3’UTR was checked upon infection in Huh7 cells. In the background of HuR overexpression, immunoprecipitation of PTB was performed using anti-PTB antibody. Representative western blot suggested the same.\u003c/p\u003e\n\u003cp\u003e(g) In the background of PTB overexpression, immunoprecipitation of HuR was performed using anti HuR antibody. Representative western blot suggested the same.\u003c/p\u003e\n\u003cp\u003e(h, i) Association of viral RNA with PTB protein upon HuR overexpression condition was checked by real-time PCR. Normalization was done with the Ct values of input RNA. Similarly, viral RNA association with HuR protein upon PTB overexpression was checked.\u003c/p\u003e\n\u003cp\u003e(j)Schematic representation of luciferase reporter construct of Dengue virus (5’UTR-Fluc-3’UTR)\u003c/p\u003e\n\u003cp\u003e(k) Luciferase activity was measured upon transfection of wild-type (5’UTR-Fluc-3’UTR) and mutant reporter constructs (5’UTR-Fluc-3’UTR \u003cstrong\u003eΔHuR\u003c/strong\u003e and 5’UTR-Fluc-3’UTR \u003cstrong\u003eΔPTB\u003c/strong\u003e ). The predicted binding sites of HuR and PTB were mutated, as shown in supplementary figure 4, and were given the nomenclature \u003cstrong\u003eΔHuR and ΔPTB\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e(l, m) Biolayer Interferometry was performed using HuR and PTB immobilized on Ni-NTA sensor tips to measure binding affinity with 3’UTR DENV RNA. K\u003csub\u003eon\u003c/sub\u003e and K\u003csub\u003eoff\u003c/sub\u003e was measured and Kd value was calculated using formula, Kd = K\u003csub\u003eoff\u003c/sub\u003e/K\u003csub\u003eon\u003c/sub\u003e.\u003c/p\u003e\n\u003cp\u003eAll bar graphs are indicative of N=3, n=3, error bars represent standard deviation (SD), and statistical analysis by Student’s t Test.\u0026nbsp; P\u0026lt;0.05 = *, P\u0026lt;0.01 = **\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-9090268/v1/787761a04b08f670f43c96af.png"},{"id":105002496,"identity":"e57dd8d5-c077-4db4-8469-82244978d52d","added_by":"auto","created_at":"2026-03-19 17:21:14","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":193091,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHuR positively regulates cap-independent translation at 48hr post-infection.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Fluc activity of 5’UTR-Fluc at different time points (6h, 12h, 24hand 48h) post virus infection was measured. Rluc is the internal control of the experiment. Ratio of Fluc/Rluc was represented in the graph.\u003c/p\u003e\n\u003cp\u003e(b) Fluc activity of 5’UTR-Fluc-3’UTR at different time points (6h, 12h, 24hand 48h) post virus infection was measured. Rluc is the internal control of the experiment. Ratio of Fluc/Rluc was represented in the graph.\u003c/p\u003e\n\u003cp\u003e(c) Polysome profiling was performed at 48h post-infection in Huh 7 cells. Represented graph suggested comparative polysome profile of mock cells (green colour) vs infected cells (red colour) upon DENV infection at MOI=1. 40S, 60S, Monosome and polysome fractions were marked in the graph.\u003c/p\u003e\n\u003cp\u003e(d) Fluc/Rluc activity of 5’UTR-Fluc-3’UTR and 5’UTR-Fluc-3’ΔHuR UTR was measured in the background of Dengue virus infection. Rluc is the internal control of the experiment.\u003c/p\u003e\n\u003cp\u003e(e) Fluc/Rluc activity of 5’UTR-Fluc-3’UTR and 5’UTR-Fluc-3’ΔHuR constructs were measured at 48 hr post-transfection in the presence of cap inhibitor LY294002 (40uM). DMSO (mock) was used as control. Rluc is the internal control of the experiment.\u003c/p\u003e\n\u003cp\u003e(f) Fluc/Rluc activity of 5’UTR-Fluc-3’UTR and 5’UTR-Fluc-3’ΔHuR constructs were measuredat 48 hr post-transfection in HEK 293T and HEK 293T HuR KO cells. Rluc is the internal control of the experiment.\u003c/p\u003e\n\u003cp\u003e(g) Polysome profiling was performed at 48h post-infection in HEK (Wild type) and HEK-HuR-KO cells. Represented graph suggested comparative polysome profile of infected HEK cells (blue colour) vs infected HEK-HuR-KO cells (orange colour) upon DENV infection at MOI 1. 40S, 60S, Monosome and polysome fractions were marked in the graph.\u003c/p\u003e\n\u003cp\u003e(h) Viral RNA levels were checked in monosomes and polysomes isolated from HEK and HEK HuR KO cells 48h post-infection.\u003c/p\u003e\n\u003cp\u003eAll bar graphs are indicative of N=3, n=3, error bars represent standard deviation (SD), and statistical analysis by Student’s t Test. P\u0026lt;0.05 = *, P\u0026lt;0.01 = **\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-9090268/v1/46ce30ce263bbb8e1d64bab6.png"},{"id":105035083,"identity":"d2c34dd9-e186-403e-a863-a1997c2979da","added_by":"auto","created_at":"2026-03-20 07:25:26","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":111219,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHuR protein levels inversely correlate with viral RNA levels and its mRNA targets during infection.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Schematic of Virus infection in mice. AG129 mice were infected at 1× 10\u003csup\u003e4\u003c/sup\u003e PFU in total volume of 500µl with Dengue virus, and infected mice were euthanized post day 3 and day 6. 500 µl of PBS was injected into mice, which were used as control.\u003c/p\u003e\n\u003cp\u003e(b, c) HuR levels were measured in mouse brain and liver tissues at Day 3 post-infection.\u003c/p\u003e\n\u003cp\u003e(d, e) HuR levels were measured in mouse brain and liver tissue at Day 6 post-infection.\u003c/p\u003e\n\u003cp\u003e(f) Viral RNA copy number in liver tissue at Days 3 and 6 post-infections.\u003c/p\u003e\n\u003cp\u003e(g) HuR-binding mRNA proteins.\u0026nbsp; The schematic represents top five important mRNA targets known to regulate immune pathways\u003c/p\u003e\n\u003cp\u003e(h) IL8 (CXCL-15 in mice) and TNF-α levels were checked in the liver tissues of mice euthanized on day 3 and day 6.\u003c/p\u003e\n\u003cp\u003e(i) IL8 (CXCL-15 in mice) and TNF-α levels were checked in HEK (Wild type) and HEK-HuR-KO cells at 48h post-infection.\u003c/p\u003e\n\u003cp\u003e(j, k) HuR was immunoprecipitated from mouse liver tissues (mock and infected) at Day 3 post-infection using anti-HuR antibody. IgG was kept as a negative control in the experiment.\u003c/p\u003e\n\u003cp\u003e(l, m) RT-PCR of IL-8 (CXCL-15 in mouse) and TNF-α was performed from the HuR immunoprecipitated fraction at Day 3 post-infection. Real-time PCR was performed on the immunoprecipitated fraction, and normalization was based on the Ct values of input RNA in each mouse tissue.\u003c/p\u003e\n\u003cp\u003eAll bar graphs are indicative of N=3 (mice), error bars represent standard deviation (SD), and statistical analysis by Student’s t Test.\u0026nbsp; P\u0026lt;0.05 = *, P\u0026lt;0.01 = **\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-9090268/v1/daa7ad68f39592288b50e073.png"},{"id":108978005,"identity":"d9a6a8c3-d46b-4a04-9375-9b241f68592c","added_by":"auto","created_at":"2026-05-11 11:33:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1580690,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9090268/v1/f524a78e-7bf1-461b-bdba-373561e3426f.pdf"},{"id":105002494,"identity":"d9ac6e2a-b70e-4c11-b98a-a7cf59808d50","added_by":"auto","created_at":"2026-03-19 17:21:14","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":819206,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"SupplementaryData.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9090268/v1/87cc32b2dc938f158b9e1804.pdf"},{"id":105002497,"identity":"3e9a4183-0005-426f-bf32-4d4a0993ccad","added_by":"auto","created_at":"2026-03-19 17:21:14","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":15681,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFiguresLegends.docx","url":"https://assets-eu.researchsquare.com/files/rs-9090268/v1/820fe175fc3be164ef110028.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Human antigen R suppresses replication and promotes cap independent translation of Dengue viral RNA","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDengue virus (DENV) is a mosquito-borne flavivirus belonging to the family \u003cem\u003eFlaviviridae\u003c/em\u003e. DENV severe infection leads to dengue shock syndrome (DSS) in humans\u003csup\u003e1\u003c/sup\u003e, causing 20,000 to 40,000 deaths per year globally, as per the World Health Organization \u003csup\u003e2\u003c/sup\u003e. Four antigenically different dengue virus (DENV) serotypes exist (DENV-1, 2, 3, and 4) with varying pathogenesis \u003csup\u003e3,4\u003c/sup\u003e. The virus enters the host cells via receptor-mediated endocytosis and interacts with the endoplasmic reticulum (ER) membrane, forming replication complexes known as detergent-resistant membranes (DRMs) \u003csup\u003e5,6\u003c/sup\u003e. These replication complexes have been shown to comprise both host and viral proteins, which interact with the viral RNA and affect its life cycle. Viral proteins such as NS4A (Non-structural protein 4A) and NS4B (Non-structural protein 4B) have been shown to remodel the ER membrane complex and aid in forming a virus replication complex. Although total RNA-binding proteins (RBPs) interacting with the viral untranslated regions (UTRs) have been reported earlier, no studies have been done to identify all the host proteins present in the viral replication complex\u003c/p\u003e \u003cp\u003eThe viral 5\u0026rsquo;UTR has also been shown to translate via a cap-independent mechanism, even upon inhibition of eIF4E (Eukaryotic Initiation Factor 4E), a critical factor in cap-dependent translation\u003csup\u003e7\u003c/sup\u003e. However, it is not yet understood when or how this cap-independent mechanism operates during DENV infection, or which host factors are involved. RBPs such as Lupus La autoantigen (La), polypyrimidine tract-binding protein (PTB), and Heterogeneous nuclear ribonucleoprotein C (HnRNP C1/C2) have previously been shown to interact with the viral RNA and play a role in virus translation and/or replication \u003csup\u003e8\u0026ndash;11\u003c/sup\u003e. RBPs binding may impact the interaction of viral UTR with other viral or host cellular factors, including proteins and miRNAs \u003csup\u003e12,13\u003c/sup\u003e. It may also impact the circularization of the viral RNA, which is essential for virus replication. RBPs, such as Human antigen R (HuR) and La, have often been found to be associated with the viral replication complex as they aid in the regulation of host immune response genes \u003csup\u003e14,15\u003c/sup\u003e. Utilization of these proteins by the virus during its life cycle also serves as a mechanism for suppressing the host's immune response upon virus infection.\u003c/p\u003e \u003cp\u003eHuR is a vital RBP that has previously been shown to shuttle from the nucleus to the cytoplasm in the context of virus infection and has been shown to interact and stabilize many innate immune-responsive genes, such as Interleukins (\u003cem\u003eIL-8, IL-6\u003c/em\u003e,) and Tumour necrosis factor (\u003cem\u003eTNF-α)\u003c/em\u003e \u003csup\u003e16\u003c/sup\u003e, which have been shown to affect the cytokine pathway, which is central to DENV pathogenesis\u003csup\u003e17,18\u003c/sup\u003e. HuR is also differentially regulated by many viruses, such as Hepatitis C virus (HCV), Zika virus (ZIKV) and Chikungunya virus (CHIKV), and its modulation is known to directly affect virus-induced pathogenesis. However, the role of HuR protein in the DENV life cycle and pathogenesis has not been investigated. Given that HuR affects the replication of various viruses (HCV, ZIKV, and Coxsackievirus B3(CVB3)) through interaction with UTRs, we examined the interaction of HuR with DENV UTR \u003csup\u003e12,19,20\u003c/sup\u003e. Here, we report that HuR interacts with the 3\u0026rsquo;UTR of DENV and negatively regulates the viral life cycle by affecting the binding of PTB, which is known to positively influence viral replication \u003csup\u003e9\u003c/sup\u003e. Moreover, HuR was found to play an important role in cap-independent translation during the later stages of infection. Additionally, DENV\u0026ndash;mediated regulation of HuR protein levels directly influences virus-induced pathogenesis by stabilizing host immunomodulatory genes. Overall, our work highlights the role of an important host factor, HuR, in viral replication, cap-independent translation, and pathogenesis.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003e1) HuR protein is associated with the viral replication complex, and its levels are downregulated upon infection -\u003c/b\u003e Understanding the composition of the Detergent Resistant Membranes (DRMs), which comprise the viral replication complex, is crucial in dissecting the regulation of viral replication inside the host. Therefore, DRMs were isolated from virus-infected Huh7 cells at 48 h post-infection by treating the cell lysate with and without detergent, followed by ultracentrifugation (Supplementary Figure. 1a). The results showed a significant shift in the position of some known RBPs, such as HuR and PTB, toward lower fractions, along with the enrichment of the viral NS5 protein, which served as a positive control, suggesting their presence in the DRM fractions. Mass spectrometry data of fractions 3rd, 4th, and 5th identified a lot of RBPs such as HuR and PTB, along with heat shock proteins and chaperons, all of which were found to be associated with the viral replication complex and could play a critical role in the viral life cycle (Supplementary Table\u0026nbsp;2). The viral NS5 protein is predominantly nuclear, and the cytoplasmic localization is within the viral replication complex (Supplementary Figure. 1 (a, b, and c)). Therefore, the NS5 protein was used as a marker to determine the site of virus replication. Its cytoplasmic localization was visualized using a cytoplasmic-specific permeabilization agent, digitonin. To check whether the RNA-binding protein HuR co-localizes with the viral NS5 protein in the DRM, confocal microscopy was performed at 48 h post-infection using digitonin-mediated permeabilization. PTB was used as a positive control, which was previously shown to aid in the viral life cycle. The data analyses showed that HuR and PTB significantly colocalized with the viral NS5 protein with a colocalization coefficient of \u0026gt;\u0026thinsp;0.5\u003c/p\u003e \u003cp\u003e(Figure. 1a). To assess the interaction of HuR protein with the viral RNA, confocal microscopy was performed with dsRNA antibody (J2) and anti-HuR antibody in the background of virus infection. The results indicated the association of viral RNA with HuR protein upon infection with a Mander\u0026rsquo;s colocalization coefficient of \u0026gt;\u0026thinsp;0.5 (Figure. 1b). To further assess the effect of virus infection on the overall levels of HuR and PTB, infection was carried out at Multiplicity of Infection 1(MOI\u0026thinsp;=\u0026thinsp;1) in Huh7 cells, followed by reverse transcription polymerase chain reaction (RT-PCR) to check for viral RNA levels (Supplementary Figure. (1d and e)). The levels of PTB and HuR were checked using western blotting from 6 hours to 72 hours post-infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). Interestingly, a significant decrease in the levels of HuR protein was observed at 48 hr post-infection, whereas PTB levels remain high, which coincides with the decrease in host translational machinery as observed in DENV infection\u003csup\u003e21\u003c/sup\u003e.\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003e \u003cb\u003e2) HuR negatively regulates DENV replication\u003c/b\u003e \u0026ndash; Next, to determine further whether this change in protein level regulation is due to the shuttling of these proteins from the nucleus to the cytoplasm post-infection, we checked their abundance post nuclear-cytoplasmic fractionation upon infection in Huh 7 cells. (Supplementary Fig.\u0026nbsp;2b). We found no significant difference in the abundance of HuR in the cytoplasm upon virus infection, indicating no relocalization of the protein to the cytoplasm post-infection. The same was visible qualitatively using different permeabilization agents, i.e., Triton X-100 and digitonin (Supplementary Fig.\u0026nbsp;2a).\u003c/p\u003e\u003cp\u003eTo evaluate the role of HuR in the viral life cycle, HuR was silenced using HuR-targeting siRNA in Huh7 cells, followed by virus infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea and b). Upon partial silencing of HuR, a significant upregulation of the viral RNA was observed at 48 h and 72h post-infection. In contrast, overexpression of HuR led to a significant downregulation of viral RNA levels, post-infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec and d). Furthermore, to determine whether HuR influences the viral RNA translation or replication, we used a DENV sub-genomic replicon construct containing a luciferase reporter gene in place of the structural proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee). The luciferase values did not show significant changes upon silencing of the \u003cem\u003eHuR\u003c/em\u003e gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef and g), suggesting that HuR predominantly affects the viral RNA replication via interacting with the viral 3\u0026rsquo;UTR, as shown earlier. However, the replicon construct does not mimic real virus infection, and its transfection does not result in global shutdown of cap-dependent translation. To further evaluate the impact of total knockout (KO) of HuR and PTB on the viral life cycle, CRISPR-mediated KO of both HuR and PTB was performed in HEK-293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ej). As anticipated, viral replication was significantly upregulated (by approximately 100%) in HuR KO cells, whereas the PTB KO resulted in significant downregulation (by approximately 80%) of viral replication (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eh and i). We also repeated the infection in HuR KO cells with DENV serotype 1 and observed a similar result (Supplementary Fig.\u0026nbsp;2g). The KO of HuR and PTB also resulted in significant variation in the virus titre in the supernatant of the infected cells post 72 hr of infection, where the KO of HuR caused an increased virus titre by 50% in the supernatant whereas the KO of PTB resulted in a decrease of around 70% virus titre in the supernatant as compared to normal Hek 293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ek). The specificity of the KO cells was also confirmed by a rescue experiment with HuR and PTB overexpression in the background of KO cells (Supplementary Fig.\u0026nbsp;2 (c-f)). Overall, these results suggest that HuR acts as a negative regulator of viral RNA replication, in contrast to PTB, which has been reported as a positive regulator of viral RNA replication\u003csup\u003e9\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003e \u003cb\u003e3) HuR protein interacts with the viral 3\u0026rsquo;UTR \u0026ndash;\u003c/b\u003e To determine whether HuR protein interacts with viral RNA, a direct Ultraviolet crosslinking (UV) experiment was performed using recombinant HuR protein and radiolabelled viral 5\u0026rsquo; and 3\u0026rsquo; UTR RNA, followed by RNase treatment and autoradiography. The results showed a significant interaction of HuR protein with the viral 3\u0026prime;UTR that increased with increasing protein concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). To further confirm the specificity of this interaction, a competitive UV-crosslinking experiment was conducted in the presence of self and non-self-cold RNAs. The results indicated a specific interaction between HuR and the viral 3\u0026rsquo;UTR, but not the viral 5\u0026rsquo;UTR (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb and c). Further crosslinking assay with different domains of 3\u0026rsquo;UTR showed interaction with the 3\u0026rsquo;Stem loop (SL) region, in close proximity to the PTB binding site (Supplementary Fig.\u0026nbsp;3a). Additionally, to validate the specificity of the interaction, a competitive UV-crosslinking experiment was performed using S10 lysates from Huh7-infected cells. A specific decrease in the intensity of a band corresponding to the molecular weight of HuR was observed, which was further confirmed by immunoprecipitation with an anti-HuR antibody after UV-crosslinking (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed and e). Further, to examine HuR protein interaction with viral RNA following DENV-2 infection, RT-PCR was performed post-immunoprecipitation with an anti-HuR antibody. Results showed that HuR protein interacts with viral RNA post-infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef and g), and its binding is specific for the viral RNA 3'UTR.\u003c/p\u003e\u003cp\u003e \u003cb\u003e4) PTB displaces HuR from the 3\u0026rsquo;UTR of the viral RNA, leading to an increase in viral RNA levels upon infection \u0026ndash;\u003c/b\u003e To understand the mechanism by which HuR regulates the viral life cycle, the binding site of HuR protein at the 3\u0026rsquo;UTR of the viral RNA was investigated using CatRapid tool and sequence-specific interaction (Supplementary Fig.\u0026nbsp;4a). Interestingly, the binding site for PTB was found to overlap with the binding site for HuR protein (Supplementary Fig.\u0026nbsp;4a-b). To assess the interplay between these two proteins, immunoprecipitation was performed using anti-HuR and anti-PTB antibodies, and the associated viral RNA was quantified by RT-PCR at different time intervals post-infection. HuR was more strongly associated with viral RNA at 24 h, whereas PTB association was greater at 48hr (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea-d). Additionally, PTB was found to displace HuR protein from the 3\u0026rsquo;UTR of the viral RNA, whereas HuR protein could not displace PTB in the in vitro UV-crosslinking assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). Overexpression of PTB displaced HuR from the viral RNA in IP-RT (immunoprecipitation followed by reverse transcriptase polymerase chain reaction), whereas HuR overexpression failed to displace PTB (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef- i). To further assess HuR displacement by PTB, the putative binding sites of HuR and PTB were mutated in the 5\u0026prime;Luc3\u0026prime; reporter construct (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ej). The wild-type and mutant 5\u0026rsquo;Luc3\u0026rsquo; reporter DNAs were transfected into Huh7 cells, and luciferase activity was measured at 48 h. The HuR binding mutant showed higher luciferase activity compared to the PTB binding mutant (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ek). The overall affinity of HuR and PTB with DENV 3\u0026rsquo;UTR was calculated using a Biolayer interferometry (BLI) assay, where PTB was found to be associated with a 100-fold higher affinity (Kd\u0026thinsp;~\u0026thinsp;10 \u003csup\u003e-6\u003c/sup\u003eM) as compared to HuR (Kd\u0026thinsp;~\u0026thinsp;10 \u003csup\u003e-8\u003c/sup\u003eM) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003el-m). To confirm the impact of these mutations on protein binding, IP-RT was performed after transfection with wild-type and mutant constructs (Supplementary Fig.\u0026nbsp;3b-f). The HuR binding mutant showed greater PTB interaction, while the PTB binding mutant exhibited greater HuR interaction with the reporter construct, reconfirming the interplay between HuR and PTB at the viral 3\u0026prime;UTR.\u003c/p\u003e\u003cp\u003e \u003cb\u003e5) HuR positively regulates cap-independent translation at later time points post-infection \u0026ndash;\u003c/b\u003e To understand the role of HuR in cap-independent translation of DENV, reporter constructs 5\u0026rsquo;UTR Firefly luciferase (Fluc) and 5\u0026rsquo;UTR-FLuc-3\u0026rsquo;UTR were transfected into Huh7 cells in the background of virus infection at MOI-1. Renilla luciferase (Rluc) was used as an internal control for cap-dependent translation. An increase in Fluc/Rluc ratio was observed at 24 h and 48 h post-infection in cells transfected with 5\u0026rsquo;UTR-Luc-3\u0026rsquo;UTR but not in 5\u0026rsquo;UTR-Luc (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003ea- b). Results clearly show cap-independent translation at a later time point post-infection, and the specific role of 3\u0026rsquo;UTR in its regulation\u003csup\u003e7\u003c/sup\u003e, along with a significant decrease in cap-dependent translation, which is further evidenced by polysome analysis at 48hr post-infection, which shows an increase in the monosomal peak, and subsequent decrease in the polysomal peak at 48hr in infected cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). However, the viral RNA translation was still upregulated at later time points i.e 48 hr (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec) and (Supplementary Fig.\u0026nbsp;4e). Further, to specifically assess the role of HuR binding to the 3\u0026rsquo;UTR in cap-independent translation at later time points, 5\u0026rsquo;UTR-Luc-3\u0026rsquo;UTR and 5\u0026rsquo;UTR-Luc-3\u0026rsquo;UTR (delta HuR) reporter constructs were transfected into HEK293T cells. As expected, the HuR binding mutant showed a significant decrease in Fluc/Rluc ratio in the background of virus infection, even at 48 hr hours post-infection when the HuR levels were found to be significantly downregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003ed) and (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). To reconfirm the role of HuR in cap-independent translation of DENV RNA, the reporter constructs were transfected in the presence of LY294002 (40uM), a known inhibitor of cap-dependent translation (Supplementary Fig.\u0026nbsp;4 (a,b)), HuR KO cells showed a significant decrease in cap-independent translation activity of DENV at 48 hr post-transfection (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003ee-f) but not at early time points where cap dependent translation is prominent mode of viral translation (Supplementary Fig.\u0026nbsp;4 (c, b)). To check the effect of viral loading on the polysomes upon infection in WT and KO cells. DENV infection was given in HEK 293T and HuR KO cells, and 48 hr post-infection, viral RNA was quantified from monosomes and polysomes. There was a substantial reduction in viral RNA load in the polysomal fractions in HuR KO cells, further highlighting HuR's role in cap-independent translation at later time points post-infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eg-h).\u003c/p\u003e\u003cp\u003e \u003cb\u003e6) HuR protein levels inversely correlate with viral RNA levels and its potential mRNA targets -\u003c/b\u003e To assess HuR protein levels upon infection and its role in virus-induced pathogenesis, we did pilot studies upon DENV 2 infection in AG129 mice and checked the levels of HuR in the brain and liver tissues at day 3 and day 6 post-DENV infection. HuR protein levels were downregulated at day 3 post-infection and upregulated at day 6 post-infection in mouse liver tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb-e). The levels of HuR protein were further found to inversely correlate with viral RNA levels in liver tissues at Day 3 and Day 6 post-infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ef), indicating a negative regulation of HuR by DENV, as observed in our earlier cell culture studies. The mRNA levels of the genes involved in important immunoregulatory pathways, such as \u003cem\u003eIL-8, IL-6\u003c/em\u003e, and \u003cem\u003eTNF-α\u003c/em\u003e, which are known to be stabilized or destabilized by HuR protein\u003csup\u003e22\u003c/sup\u003e, were also checked to assess the impact of HuR protein in cellular pathogenesis (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eg), the levels of \u003cem\u003eIL-8\u003c/em\u003e (Chemokine(C-X-C motif) ligand 15 \u003cem\u003e(CXCL-15)\u003c/em\u003e in the context of mice infection) and \u003cem\u003eTNF-α\u003c/em\u003e were found to be upregulated in both mouse liver tissue samples and HuR KO cells upon DENV infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eh-i) and (Supplementary Fig.\u0026nbsp;5). Also, the association of \u003cem\u003eTNF-α\u003c/em\u003e and \u003cem\u003eCXCL-15\u003c/em\u003e mRNA with HuR protein was further found to be downregulated upon virus infection at day 3 post-infection as shown by IP-RT assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ej-m), thereby showing that HuR protein may play as an important player in pathogenesis via the negative regulation of \u003cem\u003eTNF-α\u003c/em\u003e and \u003cem\u003eIL-8\u003c/em\u003e mRNAs upon DENV infection.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eDENV replication in the human host begins with the Langerhans cell beneath the skin, followed by infection in the liver, the predominant site of virus replication and pathogenesis \u003csup\u003e23\u0026ndash;25\u003c/sup\u003e. Virus replication inside the host cells is affected by various host factors, including RBPs and miRNAs that bind to the viral UTRs and may act as proviral or antiviral factors. An abundance of these factors ultimately decides the virus's tissue specificity in the human host cells \u003csup\u003e13,26\u003c/sup\u003e or mosquito cells \u003csup\u003e27\u003c/sup\u003e. Upon entry into the cells, the virus forms replication complexes with the ER membrane, which is known to contain many host and viral proteins. The replication complexes of other flaviviruses such as HCV and ZIKV, have been characterized previously, showing many RBPs such as La and PTB, and chaperons such as HSPs (Heat Shock proteins). Our mass spectrometry data of the DENV replication complexes also showed a similar profile with many hnRNPs, HSPs, and RBPs present in the virus replication complex \u003csup\u003e28\u0026ndash;30\u003c/sup\u003e. We also observed the enrichment of an important RBP, HuR, in our DRM fraction using western blotting. However, our mass spectrometry data did not detect the specific presence of HuR protein in the spectra, which may be due to the presence of HuR protein in small amounts in the entire cytoplasmic fractions, as evidenced by western blotting.\u003c/p\u003e \u003cp\u003eHuR is a known RBP and an essential immunomodulatory protein that interacts with and stabilizes many genes that regulate host immune responses, including chemokines and cytokines. HuR is also known to shuttle from the nucleus to the cytoplasm via post-translational modifications, predominantly phosphorylation, under certain stress conditions such as oxidative stress and virus infection \u003csup\u003e16\u003c/sup\u003e. Upon DENV infection, the relocalization of HuR protein was not detected, which is consistent with the previous observations of no relocalization for other vital factors, such as PTB and DEAD-box helicase 6 (DDX6), upon DENV infection in Huh 7 cells \u003csup\u003e31\u0026ndash;33\u003c/sup\u003e. This may be due to the protein's cytoplasmic level being sufficient to regulate the viral life cycle, as shown by HuR co-localization with the viral NS5 protein using digitonin, a cytoplasmic-specific permeabilization agent, as well as silencing and overexpression results.\u003c/p\u003e \u003cp\u003eThe interaction of HuR protein with the 5\u0026rsquo;UTR has predominantly been reported to play a role in viral RNA translation, as seen in the HCV virus \u003csup\u003e34\u003c/sup\u003e. In contrast, its interaction with the 3\u0026rsquo;UTR plays a predominant role in replication, as seen with CVB3 \u003csup\u003e20\u003c/sup\u003e. The 3\u0026rsquo;UTR-specific interaction of HuR and the lack of any effect on the viral translation using the replicon system show that, in the context of DENV, HuR has a predominant role in viral RNA replication compared to cap-dependent translation. Interestingly, the predicted HuR binding site overlaps with another known RBP, PTB, which has been previously shown to positively regulate viral RNA replication. This is evident in our study using gene-specific CRISPR KO cell lines for HuR and PTB. The overlapping interaction of HuR and PTB, along with the in vitro and ex vivo experiments, demonstrated that during infection i.e., from 24 h to 48 h when the viral RNA starts replicating, the displacement of HuR protein by PTB from the 3\u0026rsquo;UTR of the viral RNA due to higher affinity of PTB act as a molecular switch that helps the viral RNA peak post 24 h of infection.\u003c/p\u003e \u003cp\u003eDENV has previously been shown to exhibit both cap-dependent and cap-independent mechanisms of translation \u003csup\u003e7,35,36\u003c/sup\u003e. Recent reports also suggest that transacting factors, such as PTB, may affect the Internal ribosome entry site (IRES) activity of DENV upon infection\u003csup\u003e11\u003c/sup\u003e. However, it has not been shown at which phase of the viral life cycle the viral RNA undergoes a transition from cap-dependent to cap-independent translation, and whether other host factors are required in this process. Using reporter constructs, we were able to show that the cap-independent mode of translation may be prominent at a later phase of the viral life cycle, i.e., 48 h post-infection, which can be attributed to a reduction in the levels of canonical translation factors\u003csup\u003e21\u003c/sup\u003e due to an overall reduction in global translation upon virus infection, as shown by polysome analysis. The results indicated a specific role for the 3\u0026rsquo;UTR in cap-independent translation, corroborating previous observations \u003csup\u003e7,37\u003c/sup\u003e. Luciferase assays performed in the presence of virus infection and the cap inhibitor LY294002 in HuR KO cells show the role of HuR protein in regulating cap-independent translation, which may be due to the 3\u0026prime;UTR-binding activity of HuR protein that inhibits replication, thereby allowing more viral RNA to be available for translation, or possibly due to the dysregulation of host factors that are themselves regulated by HuR protein\u003csup\u003e38\u003c/sup\u003e. Hence, it may be possible that both PTB and HuR play a role in cap-independent translation at a later phase of the virus life cycle, when we observe a global reduction in cap-dependent translation upon infection.\u003c/p\u003e \u003cp\u003ePreliminary studies in the immunocompromised AG129 mouse model also corroborated our cell culture data, showing higher HuR protein levels at low virus titers. In contrast, high virus titers led to downregulation of HuR protein levels, facilitating greater viral RNA replication. The mRNA targets of HuR protein, which have previously been shown to play important roles in the cytokine pathway \u003csup\u003e22\u003c/sup\u003e, were also found to be dysregulated upon virus infection, inversely correlating with changes in HuR protein levels in both cell culture and mouse models. This suggests a destabilizing role for HuR in regulating \u003cem\u003eTNF-α\u003c/em\u003e and \u003cem\u003eIL-8\u003c/em\u003e (\u003cem\u003eCXCL-15\u003c/em\u003e in the context of mice infection) mRNA levels during DENV infection. The protein levels of \u003cem\u003eTNF-α\u003c/em\u003e have already been shown to be upregulated in infected mice and patients with severe Dengue\u003csup\u003e39\u003c/sup\u003e. However, this study needs to be further validated in an immunocompetent DENV mouse model with more time points and greater statistical power to strengthen the finding that cytokine levels are regulated by HuR upon DENV infection. Overall, this study uncovers how the virus cleverly uses host cell machinery at different stages of infection, demonstrating for the first time all the host factors present in the viral replication complex and elucidating the double role of an important RBP, HuR, in the DENV life cycle and pathogenesis, highlighting its potential as a target for antiviral therapies.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eIsolation and Characterization of DRMs \u0026ndash;\u003c/h2\u003e \u003cp\u003eTo characterize the DRMs, a membrane flotation assay was performed. Briefly, the cells were lysed in a hypotonic buffer by passing them through a 25-gauge needle 20 times. Centrifugation was performed for 5 minutes at 1,000 \u0026times; g to remove cell debris and nuclei. Cell lysates (3mg/ml) were mixed with 1.5 ml of 72% sucrose in low-salt buffer (LSB). The mixture was overlaid with 55% sucrose in LSB followed by 0.75 ml of 10% sucrose in LSB. The sucrose gradients were centrifuged at 38,000 rpm for 14 h at 4\u0026deg;C using a Beckman SW55 Ti rotor. Fractions of 500 \u0026micro;l were collected, and 100 \u0026micro;l from each fraction was resolved by SDS-PAGE followed by Western blotting. To analyze the proportion of proteins in the detergent-resistant membrane (DRM) fractions, cell lysates were treated with 1% NP40 or 0.5% Triton X 100 for 30 min on ice before ultracentrifugation.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eLC-MS/MS analysis –\u003c/h3\u003e\n\u003cp\u003eProtein extraction and trypsin digestion. A total of 100 \u0026micro;g protein was reconstituted in 50 mM ammonium bicarbonate buffer, reduced with 10 mM dithiothreitol for 1 hour at 65\u0026deg;C followed by alkylation with 40 mM iodoacetamide for 30 minutes at 37\u0026deg;C in dark. The proteome was hydrolysed overnight with MS-grade trypsin with final protease to protein ratio of 1:50 at 37\u0026deg;C. Further the digested peptides were cleaned by solid phase extraction by using Sep-Pak Vac 1cc (50mg) C18 Cartridges (Waters Corporation). The peptide concentration was determined by BCA assay before being loaded onto analytical column.\u003c/p\u003e\n\u003ch3\u003eLC-MS/MS acquisition and database search –\u003c/h3\u003e\n\u003cp\u003eThe proteomic dataset was acquired by using Ultimate3000 RSLC nano system online coupled to a QExactive Plus Orbitrap MS with an EASY nano-Spray interface (Thermo Fisher Scientific). The peptides were resolved on a C18 analytical column (2 \u0026micro;m, 100 \u0026Aring; particles, 75 \u0026micro;m \u0026times; 50 cm), mobile phases for peptide separation (A, 0.1% FA in 5% acetonitrile; B, 0.1% FA in 100% acetonitrile) delivered by the RSLC nano system with flow rate 0.3 \u0026micro;L/min. The gradient time was 117 min, reaching 38% of B. The peptides were ionized in positive mode and acquired in full scan using top 15 method for precursor selection with a resolution 140,000, custom AGC target followed by 15 MS/MS scans with a resolution of 17,500, custom AGC target, mass isolation window of 1.4 m/z, and normalized collision energy at 29 eV. The proteomic data set was processed and analysed by using SEQUEST HT search algorithm in Proteome Discoverer v2.4 (Thermo Fisher Scientific) with a UniProt human database for protein identification and quantification across all samples. The search parameters included were oxidation of methionine (15.99 Dalton), and fixed modification of cysteine carbamidomethylation (57.021464 Dalton). Peptide identification was performed using a 10-ppm precursor ion tolerance and 0.02 Da for-product ions, peptide spectrum matches were adjusted to 1% false discovery rate. Proteins with at least 1 unique peptide were considered for further analysis.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell lines and transfections \u0026ndash;\u003c/h2\u003e \u003cp\u003eHuh7 cells were provided by the laboratory of Charles M. Rice, Rockefeller University, and Apath, LLC (New York, NY, USA) and maintained in Dulbecco's modified Eagle's medium (DMEM; Sigma) with 10% Fetal bovine serum (FBS) (Gibco, Invitrogen). Transfection was carried out using Lipofectamine 2000 (Invitrogen) in accordance with the manufacturer's protocol.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCRISPR KO cell lines generation –\u003c/h3\u003e\n\u003cp\u003eThe guide RNA targeting HuR and PTB sequence were designed using IDT Crispr design tool. These gRNA were cloned in the pSpCas9(BB)-2A-GFP (PX458) vector as per the described protocol. The clones were transfected in HEK-293T cells and 48h post transfection, the cells expressing GFP were sorted as one cell per well in a 96-well plate. These cells were grown and analysed for HuR and PTB knockout using western blotting and confirmed though sequencing. gRNA HuR: ACCACATGGCCGAAGACTGC\u003c/p\u003e \u003cp\u003egRNA PTB: GCTCCCCATCGACGTCACGG\u003c/p\u003e\n\u003ch3\u003eNuclear - Cytoplasmic fractionation –\u003c/h3\u003e\n\u003cp\u003eNuclear and cytoplasmic extracts were prepared using the SIGMA CelLytic NuCLEAR Extraction Kit as per manufacturer\u0026rsquo;s protocol. Briefly, cells were lysed in hypotonic lysis buffer and treated with 1% IGEPAL as per the manufacturer\u0026rsquo;s recommendations (NXTRACT, SIGMA) to obtain the cytoplasmic extract. The nuclear pellet was then washed thoroughly with lysis buffer and lysed in the extraction buffer. The protein concentration of each extract was determined by Bradford assay. Equal amounts of protein were resolved on a SDS-10% PAGE followed by western blot using the desired antibodies.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of virus stock \u0026ndash;\u003c/h2\u003e \u003cp\u003eDengue virus serotype 2 (DENV-2) (IND/P23085/1960 strain, Gene Bank accession no. JQ922552.1) was provided by Dr. Sankar Bhattacharyya, and Dengue virus serotype 1 (DENV-1) (NR-3787) was procured from BEI resources. First, 2.2\u0026times;10\u003csup\u003e\u003cb\u003e6\u003c/b\u003e\u003c/sup\u003e (2.2\u0026nbsp;million) C6/36 cells were seeded in a T‐175 flask. Cells were infected with MOI‐1 of DENV serotype 1 or 2 in serum‐depleted L‐15 media 16 h after seeding. The cells were incubated with the virus for 4 h. After 4 h, the complete L‐15 medium was added. Seven days postinfection, the supernatant was collected and concentrated to 1/10 of the original volume using a 100 kDa centricon tube (Sartorious). The virus stock was further aliquoted and stored at \u0026minus;\u0026thinsp;80\u0026deg;C. The virus titer was calculated by determining the Foci forming units (FFUs) assay upon infection in Vero cells using confocal microscopy at different virus stock dilutions. The total Foci-forming units (FFUs) were counted, followed by multiplication by the dilution factor to obtain the virus titre, which was used to determine the seeding cell density.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eDENV infection in Huh7 cells \u0026ndash;\u003c/h2\u003e \u003cp\u003eHuh7 cells (70% confluent monolayer) (7\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells) were infected with MOI-1 of the Dengue virus serotype 2 (DENV-2) (IND/P23085/1960 strain, Gene Bank accession no. JQ922552.1) and Dengue virus serotype 1 (DENV-1) (BC89/94 (NR-3787, BEI Resources) in serum-depleted DMEM two hours after infection, DMEM supplemented with 10% fetal bovine serum was added. Cells were harvested after 24 h, 48 h, and 72 h using TRI reagent (Sigma) for total RNA isolation and qRT-PCR.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time polymerase chain reaction (qRT-PCR) \u0026ndash;\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated using TRI Reagent (Sigma). Briefly, the cells and mouse tissues (post-homogenisation using a pestle) were incubated with TRI reagent, followed by the addition of 1/5th volume of chloroform, which was mixed thoroughly. The supernatant was collected after centrifugation at 10,000 RPM for 10min at 4\u0026deg;C. An Equal volume of Isopropanol was added to the supernatant, followed by overnight precipitation at -80\u0026deg;C. The next day, the RNA was precipitated at 12,000 RPM for 30min at 4\u0026deg;C, then dissolved in RNase-free water, followed by DNase (Thermo Fisher) treatment to remove any DNA contamination. The RNA was immunoprecipitated with an equal volume of isopropanol at 12,000 RPM at 4\u0026deg;C, followed by which cDNA preparation and Real Time PCR were carried out.\u003c/p\u003e \u003cp\u003eSYBR Green mRNA Assay System was used for Real Time PCR. The RT reaction was carried out in three stages. The first phase included 600 ng of total RNA, 0.5 \u0026micro;l of RNase Inhibitor, 2 \u0026micro;l of mRNA-specific reverse primer (10 mM), and 2 \u0026micro;l of GAPDH reverse primer (10 mM). 75\u0026deg;C, and 5 minutes, and snap cooling were the reaction conditions. This reaction mixture was then supplemented with 0.1 \u0026micro;l of reverse transcriptase enzyme, 2 \u0026micro;l of 10\u0026times; RT buffer, and 2 \u0026micro;l of 10 mM dNTPs mix. Five minutes at 25\u0026deg;C, one hour at 42\u0026deg;C, and ten minutes at 75\u0026deg;C were the final reaction conditions. After that, RT-PCR was carried out in a total reaction volume of 10 \u0026micro;l containing 5 \u0026micro;l of 2\u0026times; Master Mix, 1 \u0026micro;l of mRNA-specific forward primer (10 mM), 1 \u0026micro;l of mRNA-specific reverse primer (10 mM), 0.2 \u0026micro;l of Rox, and 2 \u0026micro;l of RT product. The reaction conditions were 95\u0026deg;C for 10 min, followed by 40 cycles of 95\u0026deg;C for 30 s, 61\u0026deg;C for 30 s, and 72\u0026deg;C for 30 s. The primers used in the study have separately been provided in Supplementary Table\u0026nbsp;1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003esiRNA transfection \u0026ndash;\u003c/h2\u003e \u003cp\u003eBriefly, 14 h after seeding of cells, 150 nM siRNA targeting HuR, and a nontargeting siRNA (Dharmacon) was transfected using Lipofectamine 2000 transfection reagent in Opti-MEM (Invitrogen). At 96 h post transfection the cells were harvested, and the extracts were used for Western blot analysis as described below. In the case of transient transfections, siRNA was transfected first, and DENV was infected 16 h later. Cells were harvested at the time points after DENV infection as indicated on the figures.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence staining \u0026ndash;\u003c/h2\u003e \u003cp\u003eFor immunofluorescence staining, \u0026sim;0.06 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e Huh 7 cells were seeded in a 24-well plate on coverslips for 14 h, followed by infection with DENV (MOI\u0026thinsp;=\u0026thinsp;1). At 48 h post-infection, cells were washed twice with 1\u0026times; phosphate-buffered saline (PBS) and fixed using 4% Paraformaldehyde (PFA)at room temperature (RT) for 10min. Permeabilization was done with 0.1% Triton X-100 or 10ug/ml digitonin for 10 min at room temperature, after one hour of incubation with 3% bovine serum albumin (BSA) at 37\u0026deg;C, the cells were treated with the antibodies shown in the figure for two hours at 4\u0026deg;C. Alexa-488-conjugated anti-mouse or Alexa-647 conjugated anti-rabbit secondary antibodies were then used for 30 minutes (Invitrogen) to identify the cells. Andor dragonfly 200 (spinning disc confocal). The overlap coefficient was used to measure colocalization in ImageJ; a value of 0 indicates no colocalization, while 1 indicates full colocalization. For Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, b Mander\u0026rsquo;s co-localization was used for the overlap of the green channel over the red channel. For each experiment, over 60 cells were examined.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot analysis \u0026ndash;\u003c/h2\u003e \u003cp\u003eProteins were isolated from the cell culture samples and the mouse liver tissues using RIPA reagent-mediated cell lysis. Briefly, cells and mouse tissues were incubated with 1X RIPA reagent (50mM Tris-HCl, pH\u0026thinsp;=\u0026thinsp;8, 1mM EDTA, 0.5mM EGTA, 1% Triton X-100, 0.5% Sodium deoxycholate, 0.1% SDS, 50mM NaCl, 1mM PMSF), followed by mechanical lysis and vortexing to isolate the protein. The protein concentration was estimated using the Bradford test (Bio-Rad), and equal volumes of cell extracts were separated using SDS\u0026ndash;12% PAGE and then put onto a nitrocellulose membrane (Pall Corporation). Using the appropriate secondary antibody (horseradish peroxidase-conjugated anti-mouse or anti-rabbit IgG [Sigma]), the samples were analyzed by Western blotting using the desired antibodies, which included anti-HuR antibody (3A2; Santa Cruz), anti-NS5 antibody (GTX103350; Genetex), anti-La antibody (ab75927; Abcam), or anti-PTB antibody (Calbiochem). To ensure that entire cell extracts loaded equally, a mouse monoclonal anti-β-actin peroxidase-conjugated antibody (A3854; Sigma) was employed as a control. An Immobilon Western system (Millipore) was used to detect antibody complexes.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003etranscription \u0026ndash;\u003c/b\u003e\u003c/p\u003e \u003cp\u003eRunoff transcription processes were used to in vitro transcribe RNAs from various linearized plasmid constructs using T7 promoters. Xba1 was used to linearize pcDNA3 vectors carrying the DV 5\u0026prime; UTR, DV 3\u0026prime; UTR, and PGMT vector. After being electrophoresed on agarose gels and extracted using a Qiagen gel elution kit, the linear DNA samples were used as templates for the production of unlabeled or 32P-labeled RNA with [32P]UTP (BRIT) and T7 RNA polymerase (Thermo Fisher). 2.5 \u0026micro;g of linear template DNA was used in the transcription reaction, which was conducted for 1.5 hours at 37\u0026deg;C using normal conditions (Thermo Fisher protocol). The RNA was resuspended in 20 \u0026micro;l of nuclease-free water following alcohol precipitation. One microliter of the radiolabeled RNA sample was spotted onto DE81 filter paper, washed with phosphate buffer, and dried, and the incorporated radioactivity was measured using a liquid scintillation counter.\u003c/p\u003e \u003cp\u003e \u003cb\u003eProtein purification.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn Escherichia coli BL21(DE3) cells that had been transformed using the proper pET28a vectors, recombinant HuR, PTB, and La proteins were produced. At an optical density of 0.6 at 660 nm, 0.5 mM isopropyl-1-thio-β-d-galactopyranoside (IPTG) was used to induce the expression of recombinant HuR, PTB, and La. The cells were then allowed to proliferate for an additional five hours. Sonication was used to break up the cells on ice after they had been pelleted and resuspended in lysis buffer (50 mM Tris, pH 7.5, 300 mM NaCl, 0.1 mM phenylmethylsulfonyl fluoride [PMSF]). Every step that followed was done at 4\u0026deg;C. After centrifuging the lysates for 30 minutes at 10,000 rpm, they were incubated for 6 hours in cyclomixer with a Ni-nitrilotriacetic acid (NTA)-agarose slurry (Qiagen). The flowthrough was disposed of, and the protein bound slurry was put onto a column. 20 ml of wash buffer (50 mM Tris, pH 7.5, 300 mM NaCl, and 40 mM imidazole) was used to wash the column. 500 \u0026micro;l of an elution solution containing 500 mM imidazole was used to elute the bound protein. Following a 4- to 6-hour dialyzation in ten times the volume of dialysis buffer (50 mM Tris, pH 7.4, 100 mM KCl, 7 mM β-mercaptoethanol [β-ME], 20% glycerol), the eluted proteins were aliquoted and kept in a freezer at -70\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of S10 extracts \u0026ndash;\u003c/h2\u003e \u003cp\u003eThe preparation of S10 extracts followed as described by Ray et al (16). In summary, 10% FBS (Gibco, Invitrogen) was added to DMEM (Sigma) to support the growth of Huh7 or replicon cells. Following three rounds of washing with cold isotonic buffer (35 mM HEPES, pH 7.4, 146 mM NaCl, and 11 mM glucose), a monolayer of cells was harvested, pelleted down, and resuspended in 1.5\u0026times; packed cell volume of hypotonic buffer (10 mM HEPES, pH 7.4, 15 mM KCl, 1.5 mM Mg-acetate, and 6 mM β-ME). The cells were then allowed to swell for 10 minutes on ice. After that, the cells were sent to a Down's homogenizer and given 50 ice strokes to break them up. 20 mM HEPES, 1.2 M KCl, 50 mM Mg-acetate, and 60 mM β-mercaptoethanol comprised the 1\u0026times; incubation buffer in which the lysate was incubated for 10 minutes. To obtain the cytoplasmic extract (S10 supernatant), the lysate was centrifuged at 10,000 \u0026times; g for 30 minutes at 4\u0026deg;C. 1 L of dialysis buffer (10 mM HEPES, 90 mM KCl, 1.5 mM Mg-acetate, 7 mM β-ME, and 20% glycerol) was dialyzed against the supernatant for 2 to 4 hours.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eUV-induced cross-linking of proteins with RNA and immunoprecipitation (IP) assays \u0026ndash;\u003c/h2\u003e \u003cp\u003eThe procedure outlined by Ray and Das (16) for UV-induced cross-linking was used. Briefly, in 1\u0026times; RNA binding buffer (5 mM HEPES, pH 7.6, 25 mM KCl, 2 mM MgCl2, 3.8% glycerol, 2 mM dithiothreitol [DTT], and 0.1 mM EDTA), α-32P-labeled RNA probes were allowed to form complexes with S10 extracts or with recombinant proteins before being exposed to UV light for 20 minutes. The mixture was separated on an SDS\u0026ndash;10% polyacrylamide gel (SDS-PAGE), post treatment with 30 \u0026micro;g of RNase A (Sigma), and then subjected to phosphor imaging analysis. For competition crosslinking assays, the cold RNA specific to the probe and the Nsp RNA (Non-specific RNA control), i.e., the Multiple cloning site region of the PGMT vector, were used based on RNA molecular weight estimates. RNase A-treated reaction mixtures (30 \u0026micro;g of total protein) were prepared for immunoprecipitation (IP) using polysome lysis buffer (100 mM KCl, 5 mM MgCl2, 10 mM HEPES, pH 7.0, 0.5% NP-40, 1 mM DTT, and 100 U/ml RNasin) up to 500 \u0026micro;l. and precleared with protein G-Sepharose beads for 1 h at 4\u0026deg;C. To pellet the beads, the samples were spun at 1,000 \u0026times; g for two minutes, and the supernatant was then discarded. Protein G-Sepharose beads were added to the precleared lysates and incubated for three hours at 4\u0026deg;C with continuous mixing using a cyclomixer. They were incubated with 2 \u0026micro;g of anti-HuR antibody (Santa Cruz) overnight at 4\u0026deg;C in a total volume of 200 \u0026micro;l of polysome lysis buffer. Polysome lysis buffer was used to wash the beads four times. After the immunoprecipitated protein was released from the beads by boiling them in SDS sample buffer, the supernatant was electrophoresed on an SDS\u0026ndash;10% PAGE gel. Autoradiography was used to create, expose, and dry the gel.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eBiolayer Interferometry (BLI) \u0026ndash;\u003c/h2\u003e \u003cp\u003eBinding interactions between HuR or PTB and the DENV 3\u0026prime; UTR RNA were measured by biolayer interferometry (BLI) using an Octet RED96 system. All experiments were performed at 25\u0026deg;C with constant agitation (1,000 rpm). Measurements were carried out in kinetic buffer consisting of phosphate-buffered saline supplemented with 0.01% Tween-20 and 0.1% bovine serum albumin to minimize nonspecific interactions. Ni\u0026ndash;NTA biosensors were hydrated in kinetic buffer for at least 10 min before use. His-tagged HuR or PTB was immobilized onto the sensors at a concentration of 20 \u0026micro;g/ml until a stable loading signal was obtained. Following protein immobilization, sensors were equilibrated in kinetic buffer to establish a baseline. For association measurements, protein-loaded sensors were transferred to wells containing DENV 3\u0026prime; UTR RNA at final concentrations of 2 \u0026micro;M and 3 \u0026micro;M. Dissociation was monitored by subsequently transferring the sensors back into kinetic buffer. Reference sensors lacking RNA were included in parallel and used for background subtraction. Sensorgrams were processed by reference subtraction and analysed using Octet Data Analysis software. Binding data were evaluated using a 1:1 Langmuir binding model. Apparent association (k\u003csub\u003eon\u003c/sub\u003e) and dissociation (k\u003csub\u003eoff\u003c/sub\u003e) rate constants were obtained where fitting was supported by the data, and equilibrium dissociation constants (K\u003csub\u003ed\u003c/sub\u003e) were calculated from the ratio k\u003csub\u003eoff\u003c/sub\u003e/k\u003csub\u003eon\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eIP-RT assay \u0026ndash;\u003c/h2\u003e \u003cp\u003eAn experiment known as ribonucleoprotein complex immunoprecipitation (RNP IP) was used to evaluate the relationship between HuR, PTB, and DENV RNA. In short, IP was performed using 2 \u0026micro;g of either anti-HuR or anti-PTB antibody or a Human IgG isotype control antibody (Imgenex) after whole-cell lysates were prepared in polysome lysis buffer. Before being treated with the corresponding antibodies in polysome lysis buffer for 16 hours at 4\u0026deg;C, Protein G beads (Sigma) were preblocked with 0.4% BSA for 30 minutes at room temperature. For each reaction volume, 1mg of cell lysate was employed. After lysates were precleared with protein G beads for 1 hour at 4\u0026deg;C, they were then incubated with the target antibody for 4 hours at 4\u0026deg;C. After four rounds of washing with polysome lysis buffer, the beads were treated with 0.1% SDS and 30 \u0026micro;g of proteinase K at 50\u0026deg;C for 30 min, followed by RNA isolation with TRI reagent and RT-PCR to detect DENV RNA NS5 region. The ct values of the input RNA from each condition was taken as a normalization control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eSucrose gradient preparation \u0026ndash;\u003c/h2\u003e \u003cp\u003e10% and 50% sucrose solution is prepared in 1X gradient buffer. 10x gradient buffer (200Mm Tris HCL, 1.5M KCL, and 50Mm MgCl2) is diluted to 1x buffer sucrose solution, and cycloheximide (100\u0026micro;g/ml) was added. Equal volume (1:1 ratio) of 10% sucrose buffer and 50% sucrose buffer was sequentially poured into an ultracentrifuge tube (Beckman Coulter). Ultracentrifuge tubes were further spun at 21RPM for 1 minutes 50 seconds at 80\u003csup\u003eo\u003c/sup\u003e in Bio Comp gradient maker to prepare continuous sucrose gradient. 500 \u0026micro;g of samples were poured from the top.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003ePolysome characterization \u0026ndash;\u003c/h2\u003e \u003cp\u003eTo identify the association of viral RNA in polysomal fraction and effect of virus infection on global translation, sucrose gradient polysome fractionation was performed. After 48h post infection, cells were treated with 100 \u0026micro;g/ml cycloheximide for 15min at 37\u0026deg;C. Followed by that cells were washed with PBS and thereafter wash with 1x hypotonic buffer (5 mM MgCl2, 5 mM Tris-HCl pH-7.5, and 1.5 mM KCl). 100 \u0026micro;g/ml cycloheximide was added for all buffers used for sample processing. Cells were scraped in lysis buffer (5 mM Tris-HCl pH-7.5, 5 mM MgCl2, 1.5 mM KCl, 100 \u0026micro;g/ml cycloheximide, 1mM DTT, 200 U/ml RNase inhibitor from Promega, 0.5% Sodium-deoxycholate, 0.5% Triton X -100, 200\u0026micro;g t- RNA and 1X protease inhibitor cocktail) and incubated at ice for 20mins. After completion of lysis, the KCL was added to the lysate to adjust the KCl concentration to 150mM, and then the supernatant was collected after spinning the lysate for 8min at 3000 g at 4\u0026deg;C. 10\u0026ndash;50% w/v sucrose gradient was prepared and supernatant was added from the top and samples were ultracentrifuged for 2h at 36000rpm at 4\u0026deg;C in sw41 rotor (Backman). Density gradient fractionation system was further used to fractionate the gradients at a flow rate of 0.3mm/sec in different microfuge tubes. UV detector at 254nm generates polysome profiles, which further used to distinguish the tubes containing 40s,60s, monosomes and polysomes (Biocomp polysome profiler).\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eRNA isolation by Hot phenol method \u0026ndash;\u003c/h2\u003e \u003cp\u003eTo isolate RNA from Monosome and polysome fractions, RNA grade phenol (pH: 4.8\u0026ndash;5.2) was pre heated at 60\u003csup\u003eo\u003c/sup\u003e and equal volume of heated phenol was added in each fraction. Samples were further mixed and kept in 60\u003csup\u003eo\u003c/sup\u003e dry bath for 10 minutes (Intermittent mixing was performed) and followed by that equal volume of chloroform was added and samples were vortexed and spun at 13000 RPM for 15 minutes. Aqueous layer was collected and 1/10th volume sodium acetate and 2x volume absolute ethanol added and kept for RNA precipitation.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eLuciferase assays \u0026ndash;\u003c/h2\u003e \u003cp\u003eTransfected cells were isolated and lysed with Promega's 1\u0026times; passive lysis buffer. The cell lysates were centrifuged for 10 minutes at 10,000 rpm at 4\u0026deg;C. After collecting the supernatant, the Dual Luciferase kit (Promega) was used to measure the luciferase reading in accordance with the manufacturer's instructions. The measurements were adjusted for total protein for the sub-genomic reporter and by the R luc (pRL-TK) values for the 5\u0026rsquo;Luc and 5\u0026rsquo;Luc3\u0026rsquo; reporter constructs; the ratios of Fluc/Rluc were further normalized to the mock condition for the experiment.\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eAG129 mice infection \u0026ndash;\u003c/h2\u003e \u003cp\u003e All animal experiments were approved by BRIC-Rajiv Gandhi Centre for Biotechnology (BRIC-RGCB) Institutional Animal Ethics Committee (IAEC) (Approval No. (IAEC/911/ SREE/2022). AG129 mice (IFN-α/β and IFN-γ receptor knockouts) were procured from B\u0026amp;K Universal (UK), bred and maintained under specific-pathogen-free conditions. Three- to four-week-old AG129 mice were infected subcutaneously with 1 \u0026times; 10⁴ plaque-forming units (PFU) of DENV-2 (strain RGCB880 35P) in a total volume of 500 \u0026micro;l. Mock-infected control animals were administered an equivalent volume of heat-inactivated virus as described \u003csup\u003e40\u003c/sup\u003e. Post-infection, mice were daily monitored for clinical symptoms including ruffled fur, hunched back, lethargy, edema with closed eyes and weight loss. Whole blood was collected by cardiac puncture under isoflurane anesthesia, on day 3 post-infection (early symptomatic phase) and day 6 post-infection (peak symptomatic phase) from both infected and mock-infected control animals. Blood samples were further processed for serum isolation. Immediately following blood collection, mice were sacrificed, and tissues including liver, spleen, and brain were harvested and preserved in RNA later for subsequent molecular analysis.\u003c/p\u003e \u003cp\u003eAll experiments were performed in at least three independent biological replicates. Statistical analyses were conducted using GraphPad Prism version 9.0 (or as applicable). Data are presented as mean, and error bars represent standard deviation\u003c/p\u003e \u003c/div\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCode availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo code was generated or applied in the present study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAffiliations\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIndian Institute of Science, Bengaluru, India\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAshish Aneja, Risabh Sahu, Santu Paul, SN Gagan Gaurav, and Saumitra Das\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRajiv Gandhi Centre for Biotechnology, Thiruvananthapuram, India\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSrishti Rajkumar Mishra, Sreekumar E\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInstitute of Advanced Virology\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSreekumar E\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;National Institute of Biomedical Genomics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eArvind M. Korwar\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, A.A. and S.D.; Methodology, A.A., R.S, S.M., G.G., A.K., and S.P.; Investigation, A.A and S.D.; Resources, S.D.; Writing-Original, A.A. and S.D.; Writing-Review and editing, A.A., R.S., SM., S.E., A.K., and S.D.; Visualization, A.A. and S.D.; Supervision, S.D., S.E.; Funding acquisition, S.D.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding author- Saumitra Das\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEmail id \u0026ndash;\u0026nbsp;\u003c/strong\u003e\u003cstrong\[email protected]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used in the current study are available within the manuscript and the Supplementary files. Any additional data supporting the findings of this study are available from the corresponding author upon request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to acknowledge Prof. Ralf Bartenschlager for sharing with us DENV Sub-genomic replicon (pFK SgDV-R2A). We would also like to acknowledge the IISc DBT partnership and the mass spectrometry facility at NIBMG, Kalyani. We acknowledge the confocal facility at the MCB department and the divisional confocal facility at the Biological Science Division, IISc. We also want to acknowledge the divisional facility for BLI. No specific funding was received for this work.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eRathore, A. P. S.\u003cem\u003e et al.\u003c/em\u003e Serum chymase levels correlate with severe dengue warning signs and clinical fluid accumulation in hospitalized pediatric patients. \u003cem\u003eScientific Reports\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 11856, doi:10.1038/s41598-020-68844-z (2020).\u003c/li\u003e\n\u003cli\u003eHaider, N., Hasan, M. N., Onyango, J. \u0026amp; Asaduzzaman, M. Global landmark: 2023 marks the worst year for dengue cases with millions infected and thousands of deaths reported. \u003cem\u003eIJID Regions\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 100459, doi:https://doi.org/10.1016/j.ijregi.2024.100459 (2024).\u003c/li\u003e\n\u003cli\u003eLeitmeyer Katrin, C.\u003cem\u003e et al.\u003c/em\u003e Dengue Virus Structural Differences That Correlate with Pathogenesis. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e73\u003c/strong\u003e, 4738-4747, doi:10.1128/jvi.73.6.4738-4747.1999 (1999).\u003c/li\u003e\n\u003cli\u003eRathore, A. P. S.\u003cem\u003e et al.\u003c/em\u003e Immunological and Pathological Landscape of Dengue Serotypes 1-4 Infections in Immune-Competent Mice. \u003cstrong\u003eVolume 12 - 2021\u003c/strong\u003e, doi:10.3389/fimmu.2021.681950 (2021).\u003c/li\u003e\n\u003cli\u003eLescar, J.\u003cem\u003e et al.\u003c/em\u003e in \u003cem\u003eDengue and Zika: Control and Antiviral Treatment Strategies\u003c/em\u003e (eds Rolf Hilgenfeld \u0026amp; Subhash G. Vasudevan) 115-129 (Springer Singapore, 2018).\u003c/li\u003e\n\u003cli\u003eRodenhuis-Zybert, I. A., Wilschut, J. \u0026amp; Smit, J. M. Dengue virus life cycle: viral and host factors modulating infectivity. \u003cem\u003eCellular and Molecular Life Sciences\u003c/em\u003e \u003cstrong\u003e67\u003c/strong\u003e, 2773-2786, doi:10.1007/s00018-010-0357-z (2010).\u003c/li\u003e\n\u003cli\u003eEdgil, D., Polacek, C. \u0026amp; Harris, E. Dengue virus utilizes a novel strategy for translation initiation when cap-dependent translation is inhibited. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e80\u003c/strong\u003e, 2976-2986, doi:10.1128/jvi.80.6.2976-2986.2006 (2006).\u003c/li\u003e\n\u003cli\u003eGarc\u0026iacute;a-Montalvo, B. M., Medina, F. \u0026amp; del Angel, R. M. La protein binds to NS5 and NS3 and to the 5\u0026apos; and 3\u0026apos; ends of Dengue 4 virus RNA. \u003cem\u003eVirus research\u003c/em\u003e \u003cstrong\u003e102\u003c/strong\u003e, 141-150, doi:10.1016/j.virusres.2004.01.024 (2004).\u003c/li\u003e\n\u003cli\u003eAnwar, A., Leong, K. M., Ng, M. L., Chu, J. J. H. \u0026amp; Garcia-Blanco, M. A. The polypyrimidine tract-binding protein is required for efficient dengue virus propagation and associates with the viral replication machinery. \u003cem\u003eThe Journal of biological chemistry\u003c/em\u003e \u003cstrong\u003e284\u003c/strong\u003e, 17021-17029, doi:10.1074/jbc.M109.006239 (2009).\u003c/li\u003e\n\u003cli\u003eDechtawewat, T.\u003cem\u003e et al.\u003c/em\u003e Role of human heterogeneous nuclear ribonucleoprotein C1/C2 in dengue virus replication. \u003cem\u003eVirology journal\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 14, doi:10.1186/s12985-014-0219-7 (2015).\u003c/li\u003e\n\u003cli\u003eFern\u0026aacute;ndez-Garc\u0026iacute;a, L., Angulo, J. \u0026amp; L\u0026oacute;pez-Lastra, M. The Polypyrimidine Tract-Binding Protein Is a Transacting Factor for the Dengue Virus Internal Ribosome Entry Site. \u003cem\u003eViruses\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, doi:10.3390/v16111757 (2024).\u003c/li\u003e\n\u003cli\u003eShwetha, S.\u003cem\u003e et al.\u003c/em\u003e HuR Displaces Polypyrimidine Tract Binding Protein To Facilitate La Binding to the 3\u0026apos; Untranslated Region and Enhances Hepatitis C Virus Replication. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e89\u003c/strong\u003e, 11356-11371, doi:10.1128/jvi.01714-15 (2015).\u003c/li\u003e\n\u003cli\u003eRani, P.\u003cem\u003e et al.\u003c/em\u003e MicroRNA-22-3p displaces critical host factors from the 5\u0026apos; UTR and inhibits the translation of Coxsackievirus B3 RNA. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, e0150423, doi:10.1128/jvi.01504-23 (2024).\u003c/li\u003e\n\u003cli\u003eHuang, X., Zhu, J., Li, Y., Yu, Y. \u0026amp; Tang, J. La protein regulates protein expression by binding with the mRNAs of target genes and participates the pathological process of ovarian cancer. \u003cem\u003eFrontiers in oncology\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 763480, doi:10.3389/fonc.2022.763480 (2022).\u003c/li\u003e\n\u003cli\u003eMajumder, M.\u003cem\u003e et al.\u003c/em\u003e RNA-binding protein HuR reprograms immune T cells and promotes oral squamous cell carcinoma. \u003cem\u003eOral Oncology Reports\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 100296, doi:https://doi.org/10.1016/j.oor.2024.100296 (2024).\u003c/li\u003e\n\u003cli\u003eRaheja, H.\u003cem\u003e et al.\u003c/em\u003e Hepatitis C virus non-structural proteins modulate cellular kinases for increased cytoplasmic abundance of host factor HuR and facilitate viral replication. \u003cem\u003ePLoS pathogens\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, e1011552, doi:10.1371/journal.ppat.1011552 (2023).\u003c/li\u003e\n\u003cli\u003eApoorva, Kumar, A. \u0026amp; Singh, S. K. Dengue virus NS1 hits hard at the barrier integrity of human cerebral microvascular endothelial cells via cellular microRNA dysregulations. \u003cem\u003eTissue Barriers\u003c/em\u003e, 2424628, doi:10.1080/21688370.2024.2424628.\u003c/li\u003e\n\u003cli\u003eSingh, B.\u003cem\u003e et al.\u003c/em\u003e Defective Mitochondrial Quality Control during Dengue Infection Contributes to Disease Pathogenesis. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e96\u003c/strong\u003e, e0082822, doi:10.1128/jvi.00828-22 (2022).\u003c/li\u003e\n\u003cli\u003eBonenfant, G.\u003cem\u003e et al.\u003c/em\u003e Zika Virus Subverts Stress Granules To Promote and Restrict Viral Gene Expression. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e93\u003c/strong\u003e, doi:10.1128/jvi.00520-19 (2019).\u003c/li\u003e\n\u003cli\u003eGeorge, B., Dave, P., Rani, P., Behera, P. \u0026amp; Das, S. Cellular Protein HuR Regulates the Switching of Genomic RNA Templates for Differential Functions during the Coxsackievirus B3 Life Cycle. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e95\u003c/strong\u003e, e0091521, doi:10.1128/jvi.00915-21 (2021).\u003c/li\u003e\n\u003cli\u003eRoth, H.\u003cem\u003e et al.\u003c/em\u003e Flavivirus Infection Uncouples Translation Suppression from Cellular Stress Responses. \u003cem\u003emBio\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 10.1128/mbio.02150-02116, doi:10.1128/mbio.02150-16 (2017).\u003c/li\u003e\n\u003cli\u003eKarginov, F. V. HuR controls apoptosis and activation response without effects on cytokine 3\u0026apos; UTRs. \u003cem\u003eRNA biology\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 686-695, doi:10.1080/15476286.2019.1582954 (2019).\u003c/li\u003e\n\u003cli\u003eHelgers, L. C., Keijzer, N. C. H., van Hamme, J. L., Sprokholt, J. K. \u0026amp; Geijtenbeek, T. B. H. Dengue Virus Infects Human Skin Langerhans Cells through Langerin for Dissemination to Dendritic Cells. \u003cem\u003eThe Journal of investigative dermatology\u003c/em\u003e \u003cstrong\u003e144\u003c/strong\u003e, 1099-1111.e1093, doi:10.1016/j.jid.2023.09.287 (2024).\u003c/li\u003e\n\u003cli\u003eSwamy, A. M., Mahesh, P. Y. \u0026amp; Rajashekar, S. T. Liver function in dengue and its correlation with disease severity: a retrospective cross-sectional observational study in a tertiary care center in Coastal India. \u003cem\u003eThe Pan African medical journal\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 261, doi:10.11604/pamj.2021.40.261.29795 (2021).\u003c/li\u003e\n\u003cli\u003eCampana, V.\u003cem\u003e et al.\u003c/em\u003e Liver involvement in dengue: A systematic review. \u003cstrong\u003e34\u003c/strong\u003e, e2564, doi:https://doi.org/10.1002/rmv.2564 (2024).\u003c/li\u003e\n\u003cli\u003eTrobaugh, D. W. \u0026amp; Klimstra, W. B. MicroRNA Regulation of RNA Virus Replication and Pathogenesis. \u003cem\u003eTrends in Molecular Medicine\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 80-93, doi:10.1016/j.molmed.2016.11.003 (2017).\u003c/li\u003e\n\u003cli\u003eYocupicio-Monroy, M., Padmanabhan, R., Medina, F. \u0026amp; del Angel, R. M. Mosquito La protein binds to the 3\u0026prime; untranslated region of the positive and negative polarity dengue virus RNAs and relocates to the cytoplasm of infected cells. \u003cem\u003eVirology\u003c/em\u003e \u003cstrong\u003e357\u003c/strong\u003e, 29-40, doi:https://doi.org/10.1016/j.virol.2006.07.042 (2007).\u003c/li\u003e\n\u003cli\u003eViktorovskaya, O. V., Greco, T. M., Cristea, I. M. \u0026amp; Thompson, S. R. Identification of RNA Binding Proteins Associated with Dengue Virus RNA in Infected Cells Reveals Temporally Distinct Host Factor Requirements. \u003cem\u003ePLOS Neglected Tropical Diseases\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, e0004921, doi:10.1371/journal.pntd.0004921 (2016).\u003c/li\u003e\n\u003cli\u003eReyes-Del Valle, J., Ch\u0026aacute;vez-Salinas, S., Medina, F. \u0026amp; Del Angel, R. M. Heat shock protein 90 and heat shock protein 70 are components of dengue virus receptor complex in human cells. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e79\u003c/strong\u003e, 4557-4567, doi:10.1128/jvi.79.8.4557-4567.2005 (2005).\u003c/li\u003e\n\u003cli\u003eYeh, S. C.\u003cem\u003e et al.\u003c/em\u003e Characterization of dengue virus 3\u0026apos;UTR RNA binding proteins in mosquitoes reveals that AeStaufen reduces subgenomic flaviviral RNA in saliva. \u003cem\u003ePLoS pathogens\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, e1010427, doi:10.1371/journal.ppat.1010427 (2022).\u003c/li\u003e\n\u003cli\u003eChoksupmanee, O.\u003cem\u003e et al.\u003c/em\u003e Specific Interaction of DDX6 with an RNA Hairpin in the 3\u0026apos;\u0026thinsp;UTR of the Dengue Virus Genome Mediates G(1) Phase Arrest. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e95\u003c/strong\u003e, e0051021, doi:10.1128/jvi.00510-21 (2021).\u003c/li\u003e\n\u003cli\u003eKumar, A.\u003cem\u003e et al.\u003c/em\u003e Nuclear localization of dengue virus nonstructural protein 5 does not strictly correlate with efficient viral RNA replication and inhibition of type I interferon signaling. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e87\u003c/strong\u003e, 4545-4557, doi:10.1128/jvi.03083-12 (2013).\u003c/li\u003e\n\u003cli\u003eJiang, L., Yao, H., Duan, X., Lu, X. \u0026amp; Liu, Y. Polypyrimidine tract-binding protein influences negative strand RNA synthesis of dengue virus. \u003cem\u003eBiochemical and biophysical research communications\u003c/em\u003e \u003cstrong\u003e385\u003c/strong\u003e, 187-192, doi:10.1016/j.bbrc.2009.05.036 (2009).\u003c/li\u003e\n\u003cli\u003eRivas-Aravena, A.\u003cem\u003e et al.\u003c/em\u003e The Elav-like protein HuR exerts translational control of viral internal ribosome entry sites. \u003cem\u003eVirology\u003c/em\u003e \u003cstrong\u003e392\u003c/strong\u003e, 178-185, doi:https://doi.org/10.1016/j.virol.2009.06.050 (2009).\u003c/li\u003e\n\u003cli\u003eFern\u0026aacute;ndez-Garc\u0026iacute;a, L.\u003cem\u003e et al.\u003c/em\u003e The internal ribosome entry site of the Dengue virus mRNA is active when cap-dependent translation initiation is inhibited. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e95\u003c/strong\u003e, doi:10.1128/jvi.01998-20 (2021).\u003c/li\u003e\n\u003cli\u003eSong, Y., Mugavero, J., Stauft, C. B. \u0026amp; Wimmer, E. Dengue and Zika Virus 5\u0026prime; Untranslated Regions Harbor Internal Ribosomal Entry Site Functions. \u003cstrong\u003e10\u003c/strong\u003e, 10.1128/mbio.00459-00419, doi:doi:10.1128/mbio.00459-19 (2019).\u003c/li\u003e\n\u003cli\u003eManzano, M.\u003cem\u003e et al.\u003c/em\u003e Identification of \u0026lt;em\u0026gt;Cis\u0026lt;/em\u0026gt;-Acting Elements in the 3\u0026amp;#x2032;-Untranslated Region of the Dengue Virus Type 2 RNA That Modulate Translation and Replication *\u0026lt;sup\u0026gt;\u0026lt;/sup\u0026gt;. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e \u003cstrong\u003e286\u003c/strong\u003e, 22521-22534, doi:10.1074/jbc.M111.234302 (2011).\u003c/li\u003e\n\u003cli\u003eWu, M., Tong, C. W. S., Yan, W., To, K. K. W. \u0026amp; Cho, W. C. S. The RNA Binding Protein HuR: A Promising Drug Target for Anticancer Therapy. \u003cem\u003eCurrent cancer drug targets\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 382-399, doi:10.2174/1568009618666181031145953 (2019).\u003c/li\u003e\n\u003cli\u003eChen, H. C., Hofman, F. M., Kung, J. T., Lin, Y. D. \u0026amp; Wu-Hsieh, B. A. Both virus and tumor necrosis factor alpha are critical for endothelium damage in a mouse model of dengue virus-induced hemorrhage. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e81\u003c/strong\u003e, 5518-5526, doi:10.1128/jvi.02575-06 (2007).\u003c/li\u003e\n\u003cli\u003eModak, A.\u003cem\u003e et al.\u003c/em\u003e Higher-temperature-adapted dengue virus serotype 2 strain exhibits enhanced virulence in AG129 mouse model. \u003cstrong\u003e37\u003c/strong\u003e, e23062, doi:https://doi.org/10.1096/fj.202300098R (2023).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-9090268/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9090268/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHost RNA-binding proteins (RBPs) play a pivotal role in regulating dengue virus (DENV) translation and replication through interactions with untranslated regions (UTRs) of viral RNA. We investigated host proteins associated with detergent-resistant membranes (DRMs) of the DENV replication complex and identified Human antigen R (HuR) as a key RBP enriched in the DRM. HuR was found to negatively regulate DENV replication by binding the DENV-3\u0026prime;UTR and impeding the association of polypyrimidine tract-binding protein (PTB), a known RNA stabilizer. Additionally, infection-induced modulation of HuR stabilized host mRNAs involved in innate immunity. Interestingly, preliminary \u003cem\u003ein vivo\u003c/em\u003e validation in the AG129 mouse model reveals an inverse correlation between HuR expression and viral load, implicating HuR in cytokine dysregulation. Notably, HuR promoted cap-independent translation of viral RNA during later stages of infection, when cap-dependent translation is suppressed. These findings reveal a dual role for HuR: restricting viral RNA replication while enhancing translation, highlighting its critical, phase-specific function in the DENV life cycle.\u003c/p\u003e","manuscriptTitle":"Human antigen R suppresses replication and promotes cap independent translation of Dengue viral RNA","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-19 17:21:09","doi":"10.21203/rs.3.rs-9090268/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"83817b75-88d1-4b25-bbec-d4550a139c6f","owner":[],"postedDate":"March 19th, 2026","published":true,"recentEditorialEvents":[{"type":"decision","content":"Rejected","date":"2026-05-10T10:01:43+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-30T16:37:52+00:00","index":35,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":64652670,"name":"Biological sciences/Immunology"},{"id":64652671,"name":"Biological sciences/Microbiology"},{"id":64652672,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2026-05-10T10:10:10+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-19 17:21:09","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9090268","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9090268","identity":"rs-9090268","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}