CH02 peptide-stimulated periodontal ligament stem cells enhance periodontal regeneration

CH02 peptide-stimulated periodontal ligament stem cells enhance periodontal regeneration | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article CH02 peptide-stimulated periodontal ligament stem cells enhance periodontal regeneration Huijuan Wang, Huiying He, Xin Cheng, Qi Feng, Xuesong Yang, Xiaojia Chen, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5382618/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Jul, 2025 Read the published version in BMC Oral Health → Version 1 posted 4 You are reading this latest preprint version Abstract Objectives Periodontal ligament stem cells (PDLSCs) are considered ideal seed cells for periodontal tissue engineering and regeneration, and optimizing their efficacy is a pressing challenge. Although basic fibroblast growth factor (bFGF) has been extensively studied for promoting periodontal regeneration, its instability limits its application. This study introduces a smaller, less degradable peptide, CH02, to address this issue. Therefore, this study aims to explore the promoting effect of the CH02 peptide on the osteogenic differentiation of PDLSCs, providing new support for periodontal regeneration. Methods Extracted PDLSCs from human premolars; used bFGF as a positive control to analyze the effects of CH02 on the proliferation, toxicity, migration, osteogenic differentiation, and calcification ability of PDLSCs; RT-qPCR analysis of osteogenesis-related gene expression; constructed a rat model of periodontal bone defect, delivered PDLSCs encapsulated in Matrigel to the defect site, and intervened with CH02 and bFGF for 2W and 4W respectively, then analyzed bone regeneration through Micro-CT, HE staining, Masson staining, and immunohistochemistry. Results The extracted PDLSCs meet the international standards for mesenchymal stem cells. CH02 at 25 µg/mL promotes the proliferation, migration, and osteogenic differentiation of PDLSCs, with effects comparable to those of 25 ng/mL bFGF. CH02 enhances the expression of osteogenic-related genes RUNX2, OCN, and COL-1 in PDLSCs. In vivo, CH02 promotes the repair of periodontal bone defects in rats by PDLSCs. Conclusions PDLSCs have the potential for osteogenic differentiation; CH02 is more efficient than bFGF in promoting osteogenic differentiation of PDLSCs and the repair of periodontal bone defects in rats. PDLSCs CH02 peptide osteogenesis periodontal regeneration Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Periodontal disease is a prevalent chronic inflammatory disorder of the oral cavity, which can destroy the alveolar bone, periodontal ligament (PDL), and cementum, resulting in periodontal bone defects and ultimately leading to tooth loss, seriously affecting the function and appearance of patients 1–3 . Stem cell transplantation therapy is one of the most promising approaches for reconstructing periodontal tissue 4–6 . Since their initial discovery, periodontal ligament stem cells (PDLSCs) have been regarded as the most optimal seed cells for periodontal regeneration 7–9 . PDLSCs possess the self-renewal, pluripotency, and immunomodulatory properties of mesenchymal stem cells (MSCs) and have the distinctive potential to fabricate 3D PDL tissue 10–12 . Meanwhile, PDLSCs have the advantages of easy accessibility, low immunogenicity, and few ethical concerns 13 . PDLSCs also demonstrated their capacity to differentiate into cementoblasts, as manifested by morphological alterations, enhanced alkaline phosphatase activity, increased matrix mineralization, and upregulation of minerality-related genes 14 . However, at present, PDLSCs transplantation in the treatment of bone defects is confronted with issues such as unsatisfactory bone formation and survival difficulties 15 , and it is still necessary to further explore the strategies to enhance their osteogenic differentiation. Fibroblast growth factor receptor (FGFR) signaling plays a crucial role in bone remodeling 16 . Studies have identified four FGFRs with distinctive spatiotemporal expression patterns 17, 18 . FGFR2, predominantly expressed in bone progenitor cells, is implicated in intramembrane osteogenesis, and site mutations in its receptors can also cause cranial dysplasia and lead periodontal regeneration by stimulating PDLSC proliferation and facilitating healing, offering significant benefits to patients regarding natural tooth structure and tissue regeneration 19, 20 . Nevertheless, due to its instability, its biological properties are difficult to be utilized effectively 21 . Additionally, the quantity of bFGF is limited, and its separation from cells is challenging, failing to meet the therapeutic requirements 22 . Its target specificity is low, and its residence time in local tissues is short, resulting in an easy loss at the periodontal surgical site and thereby limiting the activity of bFGF 23, 24 . As a mimic peptide targeting FGFR2, CH02 is more accessible through chemical synthesis, more separable in terms of impurities or byproducts, has a lower production cost, and a higher purity than bFGF. Furthermore, CH02 has a small molecular weight, which is more easily accumulated in the lesion, is not prone to degradation, and has low immunogenicity. Regarding molecular mechanisms, we found that CH02 promotes tissue regeneration, e.g., nerve 25 , mainly through FGFR downstream AKT and ERK signaling, which also play a crucial role in bone regeneration. In this study, PDLSCs were extracted from human subjects through enzyme digestion, manifesting their potential for multi-directional differentiation, particularly in osteogenesis. Subsequently, PDLSCs were cultivated with CH02 and observed that CH02 could enhance the osteogenic capacity of PDLSCs, facilitate the expression of related genes and proteins, and ultimately expedite the regeneration and repair process of alveolar bone. Therefore, this study concentrated on the role of CH02 in osteogenic differentiation and periodontal regeneration, providing a novel scheme for periodontal bone regeneration. Materials and methods Materials CH02 and bFGF from the Institute of Life Sciences, Jinan University. Isolation and Culture of PDLSCs This study received approval from the Ethics Committee of Jinan University (JNUKY-2023-0110) with patient or guardian consent. We used premolars without cavities or periodontal disease from orthodontic patients aged 12–20. We extracted one-third of the root periodontal membrane, digested it with 3 mg/mL type I collagenase, and cultured it in DMEM with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (PS) at 37°C and 5% CO2, with medium changes every three days. We used cells from passages 3 to 5 (P3-P5) for the experiments. Identification of PDLSCs Detection of MSC Surface Markers by Flow Cytometry The cells were divided into three groups, each containing 1 × 10 6 cells. The positive group was treated with CD73, CD90, and CD105 antibodies, while the opposing group was treated with CD45, CD34, and HLA-DR antibodies. The control group was treated with PBS. After a 30-minute dark incubation at room temperature, the cells were washed, resuspended in 100 µl of PBS, transferred to 96-well plates, and analyzed by flow cytometry using FlowJo V10 software . Lipogenic and Osteogenic Differentiation Experiments PDLSCs' differentiation was assessed using the Human Associated Stem Cell Adipogenic and Osteogenic Differentiation Kit . P3 PDLSCs were seeded at 2×10⁴/cm² in 6-well plates, and the induction solution was changed upon 90% confluence. Lipogenesis was induced with liquid A for three days, followed by liquid B for one day. Osteogenic induction fluid was changed every three days. After 14 days, oil red O and alizarin red staining were performed, and images were captured under the microscope. Cell viability analysis Cell proliferation assay P3-P5 PDLSCs were seeded into 96-well plates at a density of 3×10³ cells per well. After 24 hours, different concentrations of CH02 (0, 3.125, 6.25, 12.5, 25, 50, and 100 µg/mL) and bFGF (0, 3.125, 6.25, 12.5, 25, 50, and 100 ng/mL) were added for 12, 24, 48, and 72 hours. Then, serum-free DMEM medium containing 10% CCK8 was added and incubated at 37℃ for 2.5 hours. Using an enzyme-labeler, cell viability was assessed by measuring the OD value at 450 nm. Cloning experiment The experiment involved three groups: control, CH02, and bFGF. CH02 and bFGF were diluted in modified DMEM with 10% FBS and 1% PS. P3 PDLSCs (400 PCS/well) were cultured in 6-well plates and the medium was changed every three days. After two weeks, the cells were fixed using 4% paraformaldehyde (PFA) and then stained with crystal violet . The cloning rate of PDLSCs was calculated from the cloning photos. Fluorescent staining of live and dead cells P3-P5 PDLSCs were seeded in 96-well plates at a density of 6×10³ cells per well and treated with interventions for 24 hours based on predefined groups. Each well received 100 uL of Calcein AM /PI working solution, followed by a 37℃ incubation for 30 minutes in the dark. Staining effects were then observed microscopically and analyzed statistically. Scratch test A horizontal line was marked at the center of each well on the plate's back. P3-P5 PDLSCs were seeded in 6-well plates at 20×10⁴ cells per well and cultured until a monolayer was formed. Using a 200 µL pipette tip, a 0.5 cm gap was created, dividing the cells into groups as per 2.4.2. Each well received 2 mL of DMEM with 0.5% FBS, and cultures were maintained for 0, 12, and 24 hours. Microscopic images were captured, and the migration rate was calculated. Cell osteoblastic differentiation experiment Alizarin red staining and alkaline phosphatase (ALP) determination The experiment included the control, OI (osteogenic induction), CH02, and bFGF groups. CH02 and bFGF were diluted to the specified concentrations using the osteogenic induction differentiation medium, with medium changes every three days. After 14 days, ALP staining and quantitative analysis were employed. At 21 days, alizarin red staining and calcium quantification were conducted, measuring the OD value at 562 nm for statistical analysis. RT-PCR The experiment included the control, OI, and CH02 groups, induced for 3 and 7 days, respectively. RNA extraction was done using the FastPure Cell/Tissue Total RNA Isolation Kit V2 , followed by cDNA synthesis using the HiScript ⅢAll-in-one RT SuperMix Perfect for qPCR R333 . PCR was conducted with ChamQ Universal SYBR qPCR Master Mix , considering the GAPDH parameter. The relevant gene sequences are presented in Table 1 . Table 1 Primer sequences for related genes Gene Forward primer (5’-3’) Reverse primer (5’-3’) human GAPDH CTTTGGTATCGTGGAAGGACTC GTAGAGGCAGGGATGATGTTCT human OCN CCCAGGCGCTACCTGTATCAA GGTCAGCCAACTCGTCACAGTC human RUNX2 ACCAGATGGGACTGTGGTTAC GGATTAAAAGGACTTGGTGCAG human COL-1 GCTGATGATGCCAATGTGGT CCAGTCAGAGTGGCACATCTG Periodontal Bone Defect Animal Experiment This study was approved by the Animal Research Committee of Jinan University with the approval number IACUC-20230927-04. The study involved 32 6-week-old SPF male SD rats with an average body weight of 220 ± 20g. The rats were divided into three groups: the PDLSCs group, the PDLSCs + CH02 group, and the PDLSCs + bFGF group, with 8 rats in each group. The intervention treatment lasted for 2 weeks (W) and 4 weeks. The concentrations of CH02 and bFGF were determined using in vitro CCK8 screening. Anesthesia was administered by intraperitoneal injection of 25 mg/kg of pentobarbital sodium. A 1-cm incision was made in the mesial region of the maxillary first molar, and the flap was reversed. Bone tissue was removed at a low speed, and the defect was standardized to 1.5×1.5×2 mm³. PDLSCs were transported using Matrigel matrix gel (BD Biosciences, USA) as the carrier. In the PDLSCs group, matrix gel containing 20×10⁴ PDLSCs was employed, and the corresponding concentration of CH02 and 20×10⁴ PDLSCs were utilized in the PDLSCs + CH02 group. The PDLSCs + bFGF group was treated with the corresponding concentration of bFGF and matrix glue containing 20×10⁴ PDLSCs. The wound was sutured with a 5.0 Angle needle, and the corresponding concentrations of CH02 and bFGF were injected daily. The rats were sacrificed at two weeks and four weeks, respectively, and the maxilla of the rats was obtained and fixed with 4% PFA for 24 hours. Micro-CT Analysis The maxillary sample was scanned by Micro-CT (n = 3) at a resolution of 12.2 um. The three-dimensional reconstruction of the rat maxillary bone was carried out using a high-resolution digital small animal X-ray machine (KUBTEC, USA) and Multiskan FC . Statistical analysis of bone volume fraction (BV/TV), trabecular number (Tb.N), and trabecular thickness (Tb.Th) were conducted in the new bone area. HE and Masson Staining The rat maxillae were decalcified using EDTA , dehydrated in a series of ethanol gradients, and embedded in paraffin wax. Sections (5µm thick) were then prepared from the paraffin-embedded maxillary tissues. Staining was performed using hematoxylin and eosin and the Masson staining kit . Immunohistochemical Staining The sections were treated with 0.1% pancreatin for 30 minutes and blocked with 3% rabbit serum at room temperature for 30 minutes. The primary antibody (goat antibody COL-1) XIX above was applied overnight at 4℃. After PBS washing, the secondary antibody (Goat anti-mouse IgG) XIX was added and incubated at 37°C for 50 minutes. The immune response was visualized using a DAB Chromogenic solution . Nuclei were counterstained, and the slide was sealed with hematoxylin. Statistical Analysis SPSS 26.0 was used for statistical analysis, and GraphPad Prism 9.0 was employed for plotting. Data were expressed as mean ± standard deviation and analyzed using One-Way ANOVA. For homogeneous variance, pairwise comparisons were conducted using the Bonferroni method. In cases of heterogeneous variance, comparisons were made using Tamhane's T2 method. A significance level of P < 0.05 was considered statistically significant. This study adhered to the FAIR and CARE data management principles. Results Isolation and identification of PDLSCs were successfully achieved. Utilizing a mixed-method approach, PDLSCs were successfully isolated (Fig. 1 A). Microscopic examination revealed elongated, spindle-shaped cells with a characteristic fibroblast-like morphology, migrating along the periphery of human periodontal tissues. Flow cytometry analysis (Fig. 1 B) demonstrated that PDLSCs exhibited high expression levels of mesenchymal stem cell (MSC) markers CD73 and CD90. In contrast, they were negative for the pan-leukocyte marker CD45, hematopoietic stem cell marker CD34, and lymphocyte marker HLA-DR. These marker profiles confirm that PDLSCs fulfill the established criteria for stem cells. Multi-lineage differentiation assays (Fig. 1 C) indicated that following osteogenic induction, alkaline phosphatase expression was detectable via ALP staining, and substantial calcium salt deposition was observed with alizarin red staining. Post adipogenic induction, oil red O staining revealed prominent, round lipid droplets. CH02 is capable of facilitating the proliferation and migration of PDLSCs. To investigate the impacts of CH02 and bFGF on the viability of PDLSCs, subsequent experiments were carried out. CCK8 results revealed that different concentrations of CH02 enhanced cell viability after 12 hours. At 24 h, the peak activity of 25 µg/mL CH02 was significant (p < 0.0001). After 72 hours, 100 µg/mL CH02 activity decreased but was not statistically significant (Fig. 2 A). After 12 hours of bFGF, the peak of cell viability at 25 ng/mL concentration was significant (p < 0.0001) (Fig. 2 B). 25 µg/mL CH02 and 25 ng/mL bFGF were selected for subsequent experiments. The colony formation experiment (Fig. 2 C )demonstrated that the cell colonies in both the CH02 and bFGF groups were more prominent and more significant than those in the control group (P 0.05)(Fig. 2 C1). The results of live and dead staining(Fig. 2 D) manifested that almost all the PDLSCs treated with CH02 and bFGF were live cells, and the proportion of dead cells was approximately 0.3%, which was not significantly different from the control group(Fig. 2 D1-D2). The scratch test (Fig. 2 E) indicated that the CH02 group significantly facilitated the migration of PDLSCs within 12 hours (Fig. 2 E1) (P 0.05) (Fig. 2 E2). In conclusion, CH02 and bFGF can increase the proliferation and migration capacity of PDLSCs without toxicity to cells, and CH02 is superior to bFGF in proliferation and early migration. CH02 can enhance the osteogenic differentiation potential of PDLSCs To elucidate the impact of CH02 on the osteogenic differentiation of PDLSCs, we initially evaluated ALP activity, assessed calcium deposition via alizarin red staining, and quantified gene expression levels using RT-qPCR. Following 14 days of osteogenic induction, the CH02 group exhibited the most intense ALP staining and significantly elevated activity compared to other groups (P < 0.001) (Fig. 3 A, A1). By day 21, the CH02 group demonstrated the most pronounced alizarin red staining, indicating a substantial increase in calcium deposition relative to the control and bFGF groups (P < 0.05) (Fig. 3 A, A2). RT-qPCR analysis revealed that after three days of induction, the expression levels of RUNX2, OCN, and COL-1 genes were elevated in the CH02 group, with RUNX2 showing a statistically significant increase (P < 0.05) (Fig. 3 B). After seven days, the expression of RUNX2, OCN, and COL-1 in the CH02 group was markedly higher than in the control and OI groups (P < 0.0001) (Fig. 3 C). Effects of PDLSCs + CH02 on bone regeneration in rats with Periodontal Bone Defect Under microscopic examination, PDLSCs encapsulated in Matrigel exhibited robust growth after 2 and 4 weeks (Fig. 4 B). A standardized periodontal bone defect was successfully induced on the mesial aspect of the right first molar in rats (Fig. 4 C). Daily monitoring of body weight post-modeling showed no significant weight loss across any rat group (Fig. 4 D). Micro-CT three-dimensional reconstructions of the periodontal defect sites were conducted at 2 and 4 weeks post-surgery. At the 2-week mark, substantial new bone formation was evident in both the PDLSC and PDLSCs + CH02 groups, whereas the PDLSCs + bFGF group demonstrated comparatively less regeneration. By 4 weeks, the PDLSC and PDLSCs + CH02 groups had nearly achieved complete healing, in contrast to the PDLSCs + bFGF group, which exhibited reduced regeneration (Fig. 4 E). Quantitative analysis indicated that at 2 weeks, the BV/TV, Tb.N, and Tb.Th metrics of the PDLSCs + CH02 group surpassed those of the other groups, with the Tb.Th of the PDLSCs + CH02 group being significantly greater than that of the PDLSCs + bFGF group (P < 0.05) (Fig. 4 E1). At 4 weeks, the BV/TV and Tb.N metrics for the PDLSCs + CH02 group remained superior to those of the PDLSCs + bFGF group, while the Tb.Th metric of the PDLSC group was notably lower than that of the other two groups (Fig. 4 E2). HE staining (Fig. 5 A) revealed that at two weeks, the PDLSC and PDLSCs + CH02 groups exhibited reduced infiltration of inflammatory cells and edema in the adjacent connective tissue compared to other groups, with the PDLSCs + CH02 group demonstrating the least edema. At four weeks, the CH02 group showed significantly enhanced healing, whereas the gingival soft tissue in other groups appeared more recessed. The regeneration of collagen fibers in rat periodontal tissue was assessed using Masson staining and immunohistochemistry (Fig. 5 A). The PDLSCs + CH02 group exhibited a more pronounced blue collagen network at both 2 and 4 weeks, indicating the presence of more mature collagen fibers in the newly formed bone. COL-1 immunohistochemistry showed a higher density of brown-yellow positive areas in the PDLSCs + CH02 group at four weeks, signifying increased COL-1 expression in the new bone and surrounding connective tissue. These findings illustrate that PDLSCs + CH02 are more effective in promoting bone regeneration compared to the PDLSCs + bFGF and PDLSC groups. Furthermore, PDLSCs + CH02 can ameliorate the inflammatory environment of periodontal bone defects, reduce cellular infiltration and edema, and facilitate the regeneration of new bone and surrounding connective tissue. Discussion In this study, the osteogenic impact of CH02 on PDLSCs was verified via in vitro experiments, and the function of PDLSCs in facilitating periodontal regeneration under the intervention of CH02 was investigated through in vivo experiments. Bone formation is a complex process entailing the commitment of mesenchymal cells that gradually differentiate into osteoblast precursor cells and subsequently mature bone-forming cells under the regulation of transcription factors, systemic hormones, and local growth factors, as well as cell-to-cell and cell-to-matrix interactions 26 . It is generally held that FGF/FGFR signaling plays a significant role in osteoblast generation, and thus far, 22 FGFS and 4 FGFR (FGFR1-4) have been cloned 16 . As a low-molecular-weight peptide, CH02 has a high affinity for FGFR2 and has also manifested affinity for other FGFR receptors (FGFR1, FGFR3, and FGFR4) 25 . Since CH02 binds to FGFR and effectively promotes its activation, we contend it is an FGFR agonist facilitating osteogenic differentiation. bFGF is the first prototypical member of the FGF family to be discovered and plays a pleiotropic role in cellular and metabolic homeostasis 27 . bFGF is frequently utilized to promptly alleviate tissue inflammation and boost endogenous stromal cell recruitment, proliferation, and angiogenesis for bone repair 9 . Studies have indicated that bFGF can promote osteogenic differentiation and periodontal regeneration of periodontal stem cells 28 . Hence, in this study, bFGF was employed as a positive control to investigate the effects of CH02 on PDLSC proliferation, toxicity, migration, and osteogenesis. The design of this study is analogous to that of Ying Zhao et al. 20. This study demonstrates that CH02 and bFGF have comparable effects in terms of proliferation and might activate the same signaling pathway, but CH02 exhibits superior performance in promoting PDLSC migration and osteogenesis, potentially due to its facile diffusion and more robust targeting. The molecular mechanisms of bone formation encompass three principal stages: 1) proliferation, 2) extracellular matrix maturation, and 3) mineralization, which are orchestrated by diverse vital molecules that regulate this transfer stage 29 . Runx2 has been demonstrated to be the most significant transcription factor during osteogenesis and is accountable for activating the osteoblast differentiation marker gene. Runx2 augments the proliferation of Ob progenitor cells by directly modulating FGFR2 30 . During MSC differentiation, RUNX2 governs the expression of various osteogenic genes implicated in Ob differentiation, including OCN and COL-1 31 . OCN is a marker of mature osteoblasts and, by binding to hydroxyapatite crystals and facilitating their growth, participates in bone mineralization in the later phases of osteogenic differentiation, an essential step in forming functional bone tissue 32 . In this study, the up-regulation of RUNX2 expression indicates that CH02 can efficaciously promote the differentiation of PDLSCs into Ob, and the increase of OCN expression indicates that Ob differentiated by CH02-mediated PDLSCS is maturing and actively engaged in the mineralization of the extracellular matrix. Periodontal bone regeneration constitutes a significant challenge in tissue engineering due to the complexity of the periodontal structure 33 . The direct application of PDLSC in periodontal bone defects confronts the difficulties of easy loss, short cell survival time, and low viability. In this study, PDLSCs proliferated well in three-dimensional space after 2W and 4W of culture using Matrigel matrix glue as a scaffold. Studies have verified that the "sandwich structure" formed by stem cell sheets, dentin matrix, and matrix glue can successfully induce tissue regeneration 34 . Matrix gel mimics the extracellular matrix, provides physiological conditions, enhances MSC activity and function, and can prolong the biological activity of CH02 and bFGF 35–37 . This study found that CH02 intervention mitigated inflammatory cell infiltration and edema and facilitated collagen fiber regeneration and COL-1 expression in new bone and surrounding connective tissue. This is analogous to bFGF promoting collagen deposition and extracellular matrix remodeling in another study 38 . The in vivo results of this study follow the outcomes of five other clinical trials on the utilization of MSC in periodontal bone defects 39–43 . In these studies, periodontal bone regeneration was enhanced in the experimental group compared with the control group. However, except for Hernandez-Mondaraz 41 et al., the disparity in results was not statistically significant in all studies. The primary reason might be that the study's sample size is limited, the variations among individual animals are substantial, and no statistically significant difference between the control and experimental groups can be observed, which further affects the universality of the results. Conclusions This study unequivocally establishes that CH02 effectively stimulates the proliferation, migration, and osteogenic differentiation of PDLSCs, surpassing bFGF in terms of migration and osteogenic potential. Notably, animal experiments demonstrated the capacity of CH02 to facilitate the repair of periodontal bone defects in rats, fostering both bone and collagen regeneration. These significant findings underscore the promise of CH02 as a leading contender for advancing periodontal tissue regeneration. The outcomes strongly indicate that CH02 could offer a valuable therapeutic avenue for promoting periodontal regeneration while tackling the intricate challenges within periodontal tissue engineering. Further exploration through research and clinical trials is imperative to fully harness the therapeutic potential of CH02 in the realm of periodontal regeneration therapy. Abbreviations PDLSCs Periodontal ligament stem cells bFGF basic fibroblast growth factor RT-qPCR Reverse Transcription Quantitative Polymerase Chain Reaction Micro-CT Micro-computed Tomography HE Hematoxylin and Eosin staining RUNX2 Runt-related transcription factor 2 OCN Osteocalcin COL-1 Type I collagen PDL periodontal ligament MSCs mesenchymal stem cells FGFR Fibroblast growth factor receptor FGFR2 Fibroblast growth factor receptor 2 AKT Protein Kinase B ERK Extracellular signal-regulated kinase DMEM Dulbecco's Modified Eagle's Medium FBS fetal bovine serum PS penicillin/streptomycin P3 Passage3 P5 Passage5 CD73 Cluster of Differentiation 73 CD90 Cluster of Differentiation 90 CD105 Cluster of Differentiation 105 CD45 Cluster of Differentiation 45 CD34 Cluster of Differentiation 34 HLA-DR Human Leukocyte Antigen-DR PBS Phosphate-buffered saline CCK8 Cell Counting Kit-8 PFA Paraformaldehyde ALP alkaline phosphatase OI osteogenic induction GAPDH Glyceraldehyde 3-phosphate dehydrogenase BV/TV bone volume fraction Tb. N trabecular number Tb.Th trabecular thickness EDTA Ethylenediaminetetraacetic acid Declarations Acknowledgement We express our gratitude to BioRender for supplying the illustrative materials. Funding source The work was supported by the National Natural Science Foundation(82370995). Author contributions Huiying He, Xiaojia Cheng, and Yue Huang conceived and designed the experiment together. Huiying He and Huijuan Wang were responsible for the experiment execution, data analysis, and the drafting and revision of the paper. Xin Cheng participated in the experiment, Qi Feng and Xuesong Yang supervised the writing of the paper, and Yue Huang provided the research funding. All authors jointly discussed the findings and reviewed the manuscripts. Ethics declarations Ethics approval and consent to participate We affirm that the work involving human subjects in this study complies with the Declaration of Helsinki and was approved by the Ethics Committee of Jinan University on January 10, 2023, with approval number: JNUKY-2023-0110. All animal experiments adhered to the ARRIVE guidelines and were approved by the Animal Research Committee of Jinan University on September 27, 2023, with approval number: IACUC-20230927-04. Consent for publication All authors are aware and agree to the publication. Conflict of interests The authors declare that there is no conflict of interests. Data availability All data supporting the findings of this study are available within the paper and its supplementary information. References R. Teles, K. Moss, J. S. Preisser, R. Genco, W. V. Giannobile, P. Corby, N. Garcia, H. Jared, G. Torresyap, E. Salazar, J. Moya, C. Howard, R. Schifferle, K. L. Falkner, J. Gillespie, D. Dixon and M. Cugini, J Clin Periodontol , 2018, 45 , 15-25. T. D. Nguyen-Thi, B. H. Nguyen-Huynh, T. T. Vo-Hoang and T. Nguyen-Thanh, J Oral Biol Craniofac Res , 2023, 13 , 589-597. Y. Zhao, Y. Gong, X. Liu, J. He, B. Zheng and Y. Liu, Pharmaceutics , 2022, 14 . X. Wei, S. Guo, Q. Liu, L. Liu, F. Huo, Y. Wu and W. Tian, Int J Mol Sci , 2023, 24 . P. Wang, W. Wang, T. Geng, Y. Liu, S. Zhu, Z. Liu and C. Yuan, J Tissue Eng , 2019, 10 , 2041731419894361. G. Li, N. Han, H. Yang, X. Zhang, Y. Cao, Y. Cao, R. Shi, S. Wang and Z. Fan, J Oral Rehabil , 2020, 47 Suppl 1 , 12-18. B. M. Seo, M. Miura, S. Gronthos, P. M. Bartold, S. Batouli, J. Brahim, M. Young, P. G. Robey, C. Y. Wang and S. Shi, Lancet , 2004, 364 , 149-155. W. Qiu, B. L. Wu and F. C. Fang, World J Stem Cells , 2020, 12 , 251-265. T. Ding, W. Kang, J. Li, L. Yu and S. Ge, J Nanobiotechnology , 2021, 19 , 247. F. M. Chen and Y. Jin, Tissue Eng Part B Rev , 2010, 16 , 219-255. J. Li, Z. Wang, X. Huang, Z. Wang, Z. Chen, R. Wang, Z. Chen, W. Liu, B. Wu, F. Fang and W. Qiu, Stem Cell Res Ther , 2021, 12 , 98. F. M. Chen, H. H. Sun, H. Lu and Q. Yu, Biomaterials , 2012, 33 , 6320-6344. K. Mrozik, S. Gronthos, S. Shi and P. M. Bartold, Methods Mol Biol , 2017, 1537 , 413-427. J. Nuñez, F. Vignoletti, R. G. Caffesse and M. Sanz, Periodontol 2000 , 2019, 79 , 107-116. L. Tan, Z. Cao, H. Chen, Y. Xie, L. Yu, C. Fu, W. Zhao and Y. Wang, Life Sci , 2021, 270 , 119125. X. Du, Y. Xie, C. J. Xian and L. Chen, J Cell Physiol , 2012, 227 , 3731-3743. L. Chen and C. X. Deng, Front Biosci , 2005, 10 , 1961-1976. D. M. Ornitz and P. J. Marie, Genes Dev , 2002, 16 , 1446-1465. F. W. Hu, J. Hosomichi, Z. Kanno and K. Soma, J Med Dent Sci , 2008, 55 , 129-135. S. Sugimoto, M. Ota, Y. Shibukawa and S. Yamada, Biomedical Research-tokyo , 2004, 25 , 179-187. M. Shen, L. Wang, L. Feng, Y. Gao, S. Li, Y. Wu, C. Xu and G. Pei, Int J Nanomedicine , 2022, 17 , 2593-2608. Q. Huang, B. Liu and W. Wu, Oxid Med Cell Longev , 2023, 2023 , 8003821. Y. Li, F. Yu, Y. Liu, Q. Liang, Y. Huang, Q. Xiang, Q. Zhang, Z. Su, Y. Yang and Y. Zhao, J Periodontol , 2020, 91 , 975-985. S. Nakamura, T. Ito, K. Okamoto, T. Mima, K. Uchida, Y. D. Siddiqui, M. Ito, M. Tai, K. Okubo, K. Yamashiro, K. Omori, T. Yamamoto, O. Matsushita and S. Takashiba, J Periodontol , 2019, 90 , 1043-1052. Y. Zhao, Q. Wang, C. Xie, Y. Cai, X. Chen, Y. Hou, L. He, J. Li, M. Yao, S. Chen, W. Wu, X. Chen and A. Hong, Theranostics , 2021, 11 , 10125-10147. D. M. Ornitz and P. J. Marie, Genes Dev , 2015, 29 , 1463-1486. X. Li, Front Med , 2019, 13 , 511-530. S. Murakami, Periodontol 2000 , 2011, 56 , 188-208. D. H. Zheng, X. X. Wang, D. Ma, L. N. Zhang, Q. F. Qiao and J. Zhang, Drug Des Devel Ther , 2019, 13 , 2543-2552. T. Komori, Int J Mol Sci , 2019, 20 . T. Komori, Mol Cells , 2020, 43 , 168-175. J. Zhang, W. Zhang, J. Dai, X. Wang and S. G. Shen, Int J Oral Sci , 2019, 11 , 12. W. Wang, A. Wang, G. Hu, M. Bian, L. Chen, Q. Zhao, W. Sun and Y. Wu, ACS Biomater Sci Eng , 2023, 9 , 1961-1975. H. Meng, L. Hu, Y. Zhou, Z. Ge, H. Wang, C. T. Wu and J. Jin, Stem Cells Dev , 2020, 29 , 521-532. Z. Gan, X. Qin, H. Liu, J. Liu and J. Qin, Bioact Mater , 2023, 28 , 386-401. X. T. He, X. Li, Y. Xia, Y. Yin, R. X. Wu, H. H. Sun and F. M. Chen, Acta Biomater , 2019, 88 , 162-180. C. Liang, Q. Liang, X. Xu, X. Liu, X. Gao, M. Li, J. Yang, X. Xing, H. Huang, Q. Tang, L. Liao and W. Tian, Int J Oral Sci , 2022, 14 , 38. Y. Yang, T. Xia, W. Zhi, L. Wei, J. Weng, C. Zhang and X. Li, Biomaterials , 2011, 32 , 4243-4254. D. A. Apatzidou, A. A. Bakopoulou, K. Kouzi-Koliakou, V. Karagiannis and A. Konstantinidis, J Clin Periodontol , 2021, 48 , 1111-1125. F. M. Chen, L. N. Gao, B. M. Tian, X. Y. Zhang, Y. J. Zhang, G. Y. Dong, H. Lu, Q. Chu, J. Xu, Y. Yu, R. X. Wu, Y. Yin, S. Shi and Y. Jin, Stem Cell Res Ther , 2016, 7 , 33. B. Hernández-Monjaraz, E. Santiago-Osorio, E. Ledesma-Martínez, I. Aguiñiga-Sánchez, N. A. Sosa-Hernández and V. M. Mendoza-Núñez, Stem Cells Int , 2020, 2020 , 8890873. N. Sánchez, L. Fierravanti, J. Núñez, F. Vignoletti, M. González-Zamora, S. Santamaría, S. Suárez-Sancho, M. E. Fernández-Santos, E. Figuero, D. Herrera, J. A. García-Sanz and M. Sanz, J Clin Periodontol , 2020, 47 , 1391-1402. M. Takedachi, K. Sawada, K. Sakura, C. Morimoto, A. Hirai, T. Iwayama, J. Shimomura, K. Kawasaki, C. Fujihara, Y. Kashiwagi, A. Miyake, T. Yamada, H. Okura, A. Matsuyama, M. Saito, M. Kitamura and S. Murakami, Sci Rep , 2022, 12 , 8126. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 03 Jul, 2025 Read the published version in BMC Oral Health → Version 1 posted Editorial decision: Revision requested 12 Nov, 2024 Editor assigned by journal 04 Nov, 2024 Submission checks completed at journal 04 Nov, 2024 First submitted to journal 03 Nov, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5382618","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":377279652,"identity":"d5155a56-e79c-4c5c-882c-a96bffc804b7","order_by":0,"name":"Huijuan Wang","email":"","orcid":"","institution":"Jinan University","correspondingAuthor":false,"prefix":"","firstName":"Huijuan","middleName":"","lastName":"Wang","suffix":""},{"id":377279654,"identity":"5db5ac40-511d-4129-80c2-25b39e639909","order_by":1,"name":"Huiying He","email":"","orcid":"","institution":"Yuebei People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Huiying","middleName":"","lastName":"He","suffix":""},{"id":377279656,"identity":"0b777b59-e9b8-409a-b0c4-a6d36b87c4c1","order_by":2,"name":"Xin Cheng","email":"","orcid":"","institution":"Jinan University","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Cheng","suffix":""},{"id":377279657,"identity":"04892520-f348-43ee-a36b-8a8b93253a96","order_by":3,"name":"Qi Feng","email":"","orcid":"","institution":"Jinan University","correspondingAuthor":false,"prefix":"","firstName":"Qi","middleName":"","lastName":"Feng","suffix":""},{"id":377279658,"identity":"313d2db0-fd12-4a6a-961d-56c953427301","order_by":4,"name":"Xuesong Yang","email":"","orcid":"","institution":"Jinan University","correspondingAuthor":false,"prefix":"","firstName":"Xuesong","middleName":"","lastName":"Yang","suffix":""},{"id":377279659,"identity":"be4c4d2d-4a11-46a8-bd6e-d7768d7a6f31","order_by":5,"name":"Xiaojia Chen","email":"","orcid":"","institution":"Jinan University","correspondingAuthor":false,"prefix":"","firstName":"Xiaojia","middleName":"","lastName":"Chen","suffix":""},{"id":377279660,"identity":"d329dd3f-a970-4e23-b37e-6c4b96a3e53f","order_by":6,"name":"Yue Huang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYJACZjDJ3gOmePiI18JzhoHhAJBiI16LRA5YCwNBLQY3kg8wF7bZ5clHvj34+GOOnQwbA/PDRzfwaklLYJ7ZllxseDsv2eDgtmSgw9iMjXPwaskx/83bxpy4cXaOmcTBbcxALTxs0vi15H9g5m2rT9w48wxISz0xWnIYgFoOJ86X4AFpOUxYi+SZZwbMPOeOJ27gyTE2OLvtOA8bMwG/8B1PfsDMU1adOL/9jOGDym3V9vzszQ8f49OicADmQhgDGk24gXwDOmMUjIJRMApGAToAAKDmRkbc8iycAAAAAElFTkSuQmCC","orcid":"","institution":"Jinan University","correspondingAuthor":true,"prefix":"","firstName":"Yue","middleName":"","lastName":"Huang","suffix":""}],"badges":[],"createdAt":"2024-11-03 15:08:02","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5382618/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5382618/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12903-025-06393-5","type":"published","date":"2025-07-03T15:57:20+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":69268802,"identity":"caa2d9bb-5413-4351-9045-5a625d731a68","added_by":"auto","created_at":"2024-11-18 14:56:50","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":5305953,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eIsolation, Cultivation, and Characterization of PDLSCs.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e(A) PDLSCs Extraction Flowchart, scale: 50um; (B) Flow cytometry was employed to assess the expression levels of surface markers CD45, CD34, HLA-DR, CD73, and CD90 on PDLSCs.(C) Alkaline phosphatase staining after osteogenic induction of PDLSCs, scale: 100um; Alizarin red staining after osteogenic induction differentiation of PDLSCs, scale: 200um; Oil red O staining after lipid-induced differentiation of PDLSCs, scale: 25um; ALP: Alkaline phosphatase.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5382618/v1/180853935cd47e74f2a0304f.png"},{"id":69267389,"identity":"548239e3-d970-4b1f-8ffa-19c0aa334163","added_by":"auto","created_at":"2024-11-18 14:48:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":4110062,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eEffects of CH02 and bFGF on the Value-Added and Migration of PDLSCs.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e(A-B) The cell proliferation capacity of PDLSCs cultured with CH02 (A) and bFGF (B) at various concentrations for 12h, 24h, 48h, and 72h was detected by CCK8. The mean value was ±SD. *P \u0026lt; 0.05; **P \u0026lt; 0.01; ***P \u0026lt; 0.001; ****P \u0026lt; 0.0001.(C) The influence of CH02 and bFGF on the proliferation ability of PDLSCs was analyzed through a cloning experiment. The scale was 100um.(C1) Compared with the control group, the colony formation efficiency of the CH02 and bFGF groups was significantly higher, with the mean ±SD. *P \u0026lt; 0.01; **P \u0026lt; 0.001. (D) calcein AM/PI staining image, scale: 200um. Calcein AM stains live cells green. PI stains dead cells red. (D1-D2) There was no significant difference in the proportion of living cells (D1) and dead cells (D2) among the Control, CH02, and bFGF groups, with the mean ±SD and a non-significant result being P\u0026gt;0.05. (E) Microscopic examination of scratch assays of PDLSC treated with Control, CH02, and bFGF, scale: 100um. (E1-E2) The 12-hour (E1) and 24-hour (E2) mobility of PDLSC treated with Control, CH02, and bFGF was ±SD. nsP \u0026gt; 0.05, **P \u0026lt; 0.01, and ***P \u0026lt; 0.001. calcein AM: Calcein acetoxymethyl ester, PI: Propidium Iodide .\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5382618/v1/bffa9168b1bd739f797a4d66.png"},{"id":69267392,"identity":"a57fa27b-bd02-42c1-b23a-eccdf9ae81a9","added_by":"auto","created_at":"2024-11-18 14:48:50","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":5022964,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eThe Impact of CH02 on the Osteogenic Differentiation of PDLSCs.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e(A) Alkaline phosphatase (ALP) and alizarin red staining (ARS) of PDLSCs in Control, OI, and CH02 groups, scale: 100um. (A1) Statistical analysis of ALP activity of PDLSCs in the Control, OI, CH02, and bFGF groups, presented as mean ±SD, **P \u0026lt; 0.01, ****P \u0026lt; 0.0001. (A2) Statistical analysis of the OD value of PDLSCs calcium salt in the Control, OI, CH02, and bFGF groups, presented as mean ±SD. *P \u0026lt; 0.05, ***P \u0026lt; 0.001, ****P \u0026lt; 0.0001.(B) The expression levels of RUNX2, OCN, and COL-1 at three days of osteogenic induction were determined by RT-qPCR and presented as the mean ±SD. nsP \u0026gt; 0.05, *P \u0026lt; 0.05, ****P \u0026lt; 0.0001. (C) The expression levels of RUNX2, OCN, and COL-1 at seven days of osteogenic induction were determined by RT-qPCR, with the mean ±SD. **P \u0026lt; 0.01, ***P \u0026lt; 0.001, ****P \u0026lt; 0.0001. OI: Osteogenic induction. GAPDH: Glyceraldehyde 3-phosphate dehydrogenase. RUNX2: RUNt-associated transcription factor 2. COL-1: Type I collagen. OCN: Osteocalcin.\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5382618/v1/46fd6444ffa08cea43714b7a.png"},{"id":69267391,"identity":"0369b26a-1e96-49ba-8049-4778d5bac786","added_by":"auto","created_at":"2024-11-18 14:48:50","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3673411,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eModeling of periodontal bone defects in rats and micro-CT evaluation of periodontal regeneration effects\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e(A) Flowchart of the animal experiment design(Created by biorender.com). (B) Images of PDLSCs in Matrigel at 2 weeks and 4 weeks, scale: 200um. (C) Flowchart of Rat Periodontal Bone Defect Modeling Process. (D) Line chart of body weight for each group of rats after 2 and 4 weeks of intervention. (E) 3D reconstruction images of a periodontal defect in the Micro-CT 2W and 4W groups, scale: 1.0mm. (E1)Micro-CT data analysis for 2W. (E2)Micro-CT data analysis for 4W. *P \u0026lt; 0.05; **P \u0026lt; 0.01; ***P \u0026lt; 0.001. BV/TV: bone volume fraction(bone volume/total volume, n = 3). Tb.N: Number of bone trabeculae(n = 3). Tb.Th: bone trabecular thickness(n = 3).\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5382618/v1/ae15596e0dcff14b92f5a6d9.png"},{"id":69268801,"identity":"ace66ba9-1d7a-4ec8-b99b-4d9f1bb6f0b2","added_by":"auto","created_at":"2024-11-18 14:56:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3682240,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eHistological examination of periodontal defects in rats\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e(A) HE, Masson, and immunofluorescence staining at 2 and 4 weeks. Black dashed line, tooth root. White dotted line, alveolar bone.G, gingiva. a, alveolar bone.r,root.50X possesses a black border, scale: 200um. 200X without border, scale: 50um. COL-1: Type I collagen.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5382618/v1/354db271d80955b522420126.png"},{"id":86178963,"identity":"baf0d45b-c020-4d4e-9a96-80fc1f5ff1a4","added_by":"auto","created_at":"2025-07-07 16:13:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":26706613,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5382618/v1/b0d4c67c-fdf7-4f6b-a702-cf3372d17aac.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"CH02 peptide-stimulated periodontal ligament stem cells enhance periodontal regeneration","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePeriodontal disease is a prevalent chronic inflammatory disorder of the oral cavity, which can destroy the alveolar bone, periodontal ligament (PDL), and cementum, resulting in periodontal bone defects and ultimately leading to tooth loss, seriously affecting the function and appearance of patients \u003csup\u003e1\u0026ndash;3\u003c/sup\u003e. Stem cell transplantation therapy is one of the most promising approaches for reconstructing periodontal tissue \u003csup\u003e4\u0026ndash;6\u003c/sup\u003e. Since their initial discovery, periodontal ligament stem cells (PDLSCs) have been regarded as the most optimal seed cells for periodontal regeneration \u003csup\u003e7\u0026ndash;9\u003c/sup\u003e. PDLSCs possess the self-renewal, pluripotency, and immunomodulatory properties of mesenchymal stem cells (MSCs) and have the distinctive potential to fabricate 3D PDL tissue\u003csup\u003e10\u0026ndash;12\u003c/sup\u003e. Meanwhile, PDLSCs have the advantages of easy accessibility, low immunogenicity, and few ethical concerns\u003csup\u003e13\u003c/sup\u003e. PDLSCs also demonstrated their capacity to differentiate into cementoblasts, as manifested by morphological alterations, enhanced alkaline phosphatase activity, increased matrix mineralization, and upregulation of minerality-related genes \u003csup\u003e14\u003c/sup\u003e. However, at present, PDLSCs transplantation in the treatment of bone defects is confronted with issues such as unsatisfactory bone formation and survival difficulties \u003csup\u003e15\u003c/sup\u003e, and it is still necessary to further explore the strategies to enhance their osteogenic differentiation.\u003c/p\u003e \u003cp\u003eFibroblast growth factor receptor (FGFR) signaling plays a crucial role in bone remodeling\u003csup\u003e16\u003c/sup\u003e. Studies have identified four FGFRs with distinctive spatiotemporal expression patterns \u003csup\u003e17, 18\u003c/sup\u003e. FGFR2, predominantly expressed in bone progenitor cells, is implicated in intramembrane osteogenesis, and site mutations in its receptors can also cause cranial dysplasia and lead periodontal regeneration by stimulating PDLSC proliferation and facilitating healing, offering significant benefits to patients regarding natural tooth structure and tissue regeneration\u003csup\u003e19, 20\u003c/sup\u003e. Nevertheless, due to its instability, its biological properties are difficult to be utilized effectively\u003csup\u003e21\u003c/sup\u003e. Additionally, the quantity of bFGF is limited, and its separation from cells is challenging, failing to meet the therapeutic requirements\u003csup\u003e22\u003c/sup\u003e. Its target specificity is low, and its residence time in local tissues is short, resulting in an easy loss at the periodontal surgical site and thereby limiting the activity of bFGF \u003csup\u003e23, 24\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAs a mimic peptide targeting FGFR2, CH02 is more accessible through chemical synthesis, more separable in terms of impurities or byproducts, has a lower production cost, and a higher purity than bFGF. Furthermore, CH02 has a small molecular weight, which is more easily accumulated in the lesion, is not prone to degradation, and has low immunogenicity. Regarding molecular mechanisms, we found that CH02 promotes tissue regeneration, e.g., nerve\u003csup\u003e25\u003c/sup\u003e, mainly through FGFR downstream AKT and ERK signaling, which also play a crucial role in bone regeneration.\u003c/p\u003e \u003cp\u003eIn this study, PDLSCs were extracted from human subjects through enzyme digestion, manifesting their potential for multi-directional differentiation, particularly in osteogenesis. Subsequently, PDLSCs were cultivated with CH02 and observed that CH02 could enhance the osteogenic capacity of PDLSCs, facilitate the expression of related genes and proteins, and ultimately expedite the regeneration and repair process of alveolar bone. Therefore, this study concentrated on the role of CH02 in osteogenic differentiation and periodontal regeneration, providing a novel scheme for periodontal bone regeneration.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMaterials\u003c/h2\u003e \u003cp\u003eCH02 and bFGF from the Institute of Life Sciences, Jinan University.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eIsolation and Culture of PDLSCs\u003c/h3\u003e\n\u003cp\u003e This study received approval from the Ethics Committee of Jinan University (JNUKY-2023-0110) with patient or guardian consent. We used premolars without cavities or periodontal disease from orthodontic patients aged 12\u0026ndash;20. We extracted one-third of the root periodontal membrane, digested it with 3 mg/mL type I collagenase, and cultured it in DMEM with 10% fetal bovine serum (FBS)\u003ca class=\"FNLink\" href=\"#Fn1\" id=\"#FNLinkFn1\"\u003e\u003c/a\u003e and 1% penicillin/streptomycin (PS)\u003ca class=\"FNLink\" href=\"#Fn2\" id=\"#FNLinkFn2\"\u003e\u003c/a\u003e at 37\u0026deg;C and 5% CO2, with medium changes every three days. We used cells from passages 3 to 5 (P3-P5) for the experiments.\u003c/p\u003e\n\u003ch3\u003eIdentification of PDLSCs\u003c/h3\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eDetection of MSC Surface Markers by Flow Cytometry\u003c/h2\u003e \u003cp\u003eThe cells were divided into three groups, each containing 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells. The positive group was treated with CD73, CD90, and CD105 antibodies, while the opposing group was treated with CD45, CD34, and HLA-DR antibodies. The control group was treated with PBS. After a 30-minute dark incubation at room temperature, the cells were washed, resuspended in 100 \u0026micro;l of PBS, transferred to 96-well plates, and analyzed by flow cytometry using FlowJo V10 software\u003ca class=\"FNLink\" href=\"#Fn3\" id=\"#FNLinkFn3\"\u003e\u003c/a\u003e.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eLipogenic and Osteogenic Differentiation Experiments\u003c/h3\u003e\n\u003cp\u003ePDLSCs' differentiation was assessed using the Human Associated Stem Cell Adipogenic \u003ca class=\"FNLink\" href=\"#Fn4\" id=\"#FNLinkFn4\"\u003e\u003c/a\u003eand Osteogenic Differentiation Kit\u003ca class=\"FNLink\" href=\"#Fn5\" id=\"#FNLinkFn5\"\u003e\u003c/a\u003e. P3 PDLSCs were seeded at 2\u0026times;10⁴/cm\u0026sup2; in 6-well plates, and the induction solution was changed upon 90% confluence. Lipogenesis was induced with liquid A for three days, followed by liquid B for one day. Osteogenic induction fluid was changed every three days. After 14 days, oil red O and alizarin red staining were performed, and images were captured under the microscope.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell viability analysis\u003c/h2\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003eCell proliferation assay\u003c/h2\u003e \u003cp\u003eP3-P5 PDLSCs were seeded into 96-well plates at a density of 3\u0026times;10\u0026sup3; cells per well. After 24 hours, different concentrations of CH02 (0, 3.125, 6.25, 12.5, 25, 50, and 100 \u0026micro;g/mL) and bFGF (0, 3.125, 6.25, 12.5, 25, 50, and 100 ng/mL) were added for 12, 24, 48, and 72 hours. Then, serum-free DMEM medium containing 10% CCK8 was added and incubated at 37℃ for 2.5 hours. Using an enzyme-labeler, cell viability was assessed by measuring the OD value at 450 nm.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e\n\u003ch3\u003eCloning experiment\u003c/h3\u003e\n\u003cp\u003eThe experiment involved three groups: control, CH02, and bFGF. CH02 and bFGF were diluted in modified DMEM with 10% FBS and 1% PS. P3 PDLSCs (400 PCS/well) were cultured in 6-well plates and the medium was changed every three days. After two weeks, the cells were fixed using 4% paraformaldehyde (PFA)\u003ca class=\"FNLink\" href=\"#Fn6\" id=\"#FNLinkFn6\"\u003e\u003c/a\u003e and then stained with crystal violet\u003ca class=\"FNLink\" href=\"#Fn7\" id=\"#FNLinkFn7\"\u003e\u003c/a\u003e. The cloning rate of PDLSCs was calculated from the cloning photos.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eFluorescent staining of live and dead cells\u003c/h2\u003e \u003cp\u003eP3-P5 PDLSCs were seeded in 96-well plates at a density of 6\u0026times;10\u0026sup3; cells per well and treated with interventions for 24 hours based on predefined groups. Each well received 100 uL of Calcein AM\u003ca class=\"FNLink\" href=\"#Fn8\" id=\"#FNLinkFn8\"\u003e\u003c/a\u003e/PI \u003ca class=\"FNLink\" href=\"#Fn9\" id=\"#FNLinkFn9\"\u003e\u003c/a\u003eworking solution, followed by a 37℃ incubation for 30 minutes in the dark. Staining effects were then observed microscopically and analyzed statistically.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eScratch test\u003c/h2\u003e \u003cp\u003eA horizontal line was marked at the center of each well on the plate's back. P3-P5 PDLSCs were seeded in 6-well plates at 20\u0026times;10⁴ cells per well and cultured until a monolayer was formed. Using a 200 \u0026micro;L pipette tip, a 0.5 cm gap was created, dividing the cells into groups as per 2.4.2. Each well received 2 mL of DMEM with 0.5% FBS, and cultures were maintained for 0, 12, and 24 hours. Microscopic images were captured, and the migration rate was calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eCell osteoblastic differentiation experiment\u003c/h2\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003eAlizarin red staining and alkaline phosphatase (ALP) determination\u003c/h2\u003e \u003cp\u003eThe experiment included the control, OI (osteogenic induction), CH02, and bFGF groups. CH02 and bFGF were diluted to the specified concentrations using the osteogenic induction differentiation medium, with medium changes every three days. After 14 days, ALP staining\u003ca class=\"FNLink\" href=\"#Fn10\" id=\"#FNLinkFn10\"\u003e\u003c/a\u003e and quantitative analysis\u003ca class=\"FNLink\" href=\"#Fn11\" id=\"#FNLinkFn11\"\u003e\u003c/a\u003e were employed. At 21 days, alizarin red staining and calcium quantification were conducted, measuring the OD value at 562 nm for statistical analysis.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eRT-PCR\u003c/h2\u003e \u003cp\u003eThe experiment included the control, OI, and CH02 groups, induced for 3 and 7 days, respectively. RNA extraction was done using the FastPure Cell/Tissue Total RNA Isolation Kit V2\u003ca class=\"FNLink\" href=\"#Fn12\" id=\"#FNLinkFn12\"\u003e\u003c/a\u003e, followed by cDNA synthesis using the HiScript ⅢAll-in-one RT SuperMix Perfect for qPCR R333\u003ca class=\"FNLink\" href=\"#Fn13\" id=\"#FNLinkFn13\"\u003e\u003c/a\u003e. PCR was conducted with ChamQ Universal SYBR qPCR Master Mix\u003ca class=\"FNLink\" href=\"#Fn14\" id=\"#FNLinkFn14\"\u003e\u003c/a\u003e, considering the GAPDH parameter. The relevant gene sequences are presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for related genes\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ehuman GAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTTGGTATCGTGGAAGGACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTAGAGGCAGGGATGATGTTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ehuman OCN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCAGGCGCTACCTGTATCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTCAGCCAACTCGTCACAGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ehuman RUNX2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCAGATGGGACTGTGGTTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGATTAAAAGGACTTGGTGCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ehuman COL-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTGATGATGCCAATGTGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAGTCAGAGTGGCACATCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003ePeriodontal Bone Defect Animal Experiment\u003c/h2\u003e \u003cp\u003e This study was approved by the Animal Research Committee of Jinan University with the approval number IACUC-20230927-04. The study involved 32 6-week-old SPF male SD rats with an average body weight of 220\u0026thinsp;\u0026plusmn;\u0026thinsp;20g. The rats were divided into three groups: the PDLSCs group, the PDLSCs\u0026thinsp;+\u0026thinsp;CH02 group, and the PDLSCs\u0026thinsp;+\u0026thinsp;bFGF group, with 8 rats in each group. The intervention treatment lasted for 2 weeks (W) and 4 weeks. The concentrations of CH02 and bFGF were determined using in vitro CCK8 screening. Anesthesia was administered by intraperitoneal injection of 25 mg/kg of pentobarbital sodium. A 1-cm incision was made in the mesial region of the maxillary first molar, and the flap was reversed. Bone tissue was removed at a low speed, and the defect was standardized to 1.5\u0026times;1.5\u0026times;2 mm\u0026sup3;. PDLSCs were transported using Matrigel matrix gel (BD Biosciences, USA) as the carrier. In the PDLSCs group, matrix gel containing 20\u0026times;10⁴ PDLSCs was employed, and the corresponding concentration of CH02 and 20\u0026times;10⁴ PDLSCs were utilized in the PDLSCs\u0026thinsp;+\u0026thinsp;CH02 group. The PDLSCs\u0026thinsp;+\u0026thinsp;bFGF group was treated with the corresponding concentration of bFGF and matrix glue containing 20\u0026times;10⁴ PDLSCs. The wound was sutured with a 5.0 Angle needle, and the corresponding concentrations of CH02 and bFGF were injected daily. The rats were sacrificed at two weeks and four weeks, respectively, and the maxilla of the rats was obtained and fixed with 4% PFA for 24 hours.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eMicro-CT Analysis\u003c/h2\u003e \u003cp\u003eThe maxillary sample was scanned by Micro-CT \u003ca class=\"FNLink\" href=\"#Fn15\" id=\"#FNLinkFn15\"\u003e\u003c/a\u003e(n\u0026thinsp;=\u0026thinsp;3) at a resolution of 12.2 um. The three-dimensional reconstruction of the rat maxillary bone was carried out using a high-resolution digital small animal X-ray machine (KUBTEC, USA) and Multiskan FC\u003ca class=\"FNLink\" href=\"#Fn16\" id=\"#FNLinkFn16\"\u003e\u003c/a\u003e. Statistical analysis of bone volume fraction (BV/TV), trabecular number (Tb.N), and trabecular thickness (Tb.Th) were conducted in the new bone area.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eHE and Masson Staining\u003c/h2\u003e \u003cp\u003eThe rat maxillae were decalcified using EDTA\u003ca class=\"FNLink\" href=\"#Fn17\" id=\"#FNLinkFn17\"\u003e\u003c/a\u003e, dehydrated in a series of ethanol gradients, and embedded in paraffin wax. Sections (5\u0026micro;m thick) were then prepared from the paraffin-embedded maxillary tissues. Staining was performed using hematoxylin and eosin\u003ca class=\"FNLink\" href=\"#Fn18\" id=\"#FNLinkFn18\"\u003e\u003c/a\u003e and the Masson staining kit\u003ca class=\"FNLink\" href=\"#Fn19\" id=\"#FNLinkFn19\"\u003e\u003c/a\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemical Staining\u003c/h2\u003e \u003cp\u003eThe sections were treated with 0.1% pancreatin for 30 minutes and blocked with 3% rabbit serum at room temperature for 30 minutes. The primary antibody (goat antibody COL-1)\u003csup\u003eXIX\u003c/sup\u003e above was applied overnight at 4℃. After PBS washing, the secondary antibody (Goat anti-mouse IgG)\u003csup\u003eXIX\u003c/sup\u003e was added and incubated at 37\u0026deg;C for 50 minutes. The immune response was visualized using a DAB Chromogenic solution\u003ca class=\"FNLink\" href=\"#Fn20\" id=\"#FNLinkFn20\"\u003e\u003c/a\u003e. Nuclei were counterstained, and the slide was sealed with hematoxylin.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eSPSS 26.0 was used for statistical analysis, and GraphPad Prism 9.0 was employed for plotting. Data were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation and analyzed using One-Way ANOVA. For homogeneous variance, pairwise comparisons were conducted using the Bonferroni method. In cases of heterogeneous variance, comparisons were made using Tamhane's T2 method. A significance level of P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. This study adhered to the FAIR and CARE data management principles.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eIsolation and identification of PDLSCs were successfully achieved.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eUtilizing a mixed-method approach, PDLSCs were successfully isolated (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Microscopic examination revealed elongated, spindle-shaped cells with a characteristic fibroblast-like morphology, migrating along the periphery of human periodontal tissues. Flow cytometry analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) demonstrated that PDLSCs exhibited high expression levels of mesenchymal stem cell (MSC) markers CD73 and CD90. In contrast, they were negative for the pan-leukocyte marker CD45, hematopoietic stem cell marker CD34, and lymphocyte marker HLA-DR. These marker profiles confirm that PDLSCs fulfill the established criteria for stem cells. Multi-lineage differentiation assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC) indicated that following osteogenic induction, alkaline phosphatase expression was detectable via ALP staining, and substantial calcium salt deposition was observed with alizarin red staining. Post adipogenic induction, oil red O staining revealed prominent, round lipid droplets.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eCH02 is capable of facilitating the proliferation and migration of PDLSCs.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo investigate the impacts of CH02 and bFGF on the viability of PDLSCs, subsequent experiments were carried out. CCK8 results revealed that different concentrations of CH02 enhanced cell viability after 12 hours. At 24 h, the peak activity of 25 \u0026micro;g/mL CH02 was significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). After 72 hours, 100 \u0026micro;g/mL CH02 activity decreased but was not statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). After 12 hours of bFGF, the peak of cell viability at 25 ng/mL concentration was significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). 25 \u0026micro;g/mL CH02 and 25 ng/mL bFGF were selected for subsequent experiments. The colony formation experiment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC )demonstrated that the cell colonies in both the CH02 and bFGF groups were more prominent and more significant than those in the control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). However, there was no statistically significant difference between the two groups (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05)(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC1). The results of live and dead staining(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD) manifested that almost all the PDLSCs treated with CH02 and bFGF were live cells, and the proportion of dead cells was approximately 0.3%, which was not significantly different from the control group(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD1-D2). The scratch test (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE) indicated that the CH02 group significantly facilitated the migration of PDLSCs within 12 hours (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE1) (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and there was no significant difference in migration between the two groups after 24 hours (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE2). In conclusion, CH02 and bFGF can increase the proliferation and migration capacity of PDLSCs without toxicity to cells, and CH02 is superior to bFGF in proliferation and early migration.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eCH02 can enhance the osteogenic differentiation potential of PDLSCs\u003c/h2\u003e \u003cp\u003eTo elucidate the impact of CH02 on the osteogenic differentiation of PDLSCs, we initially evaluated ALP activity, assessed calcium deposition via alizarin red staining, and quantified gene expression levels using RT-qPCR. Following 14 days of osteogenic induction, the CH02 group exhibited the most intense ALP staining and significantly elevated activity compared to other groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, A1). By day 21, the CH02 group demonstrated the most pronounced alizarin red staining, indicating a substantial increase in calcium deposition relative to the control and bFGF groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, A2). RT-qPCR analysis revealed that after three days of induction, the expression levels of RUNX2, OCN, and COL-1 genes were elevated in the CH02 group, with RUNX2 showing a statistically significant increase (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). After seven days, the expression of RUNX2, OCN, and COL-1 in the CH02 group was markedly higher than in the control and OI groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eEffects of PDLSCs\u0026thinsp;+\u0026thinsp;CH02 on bone regeneration in rats with Periodontal Bone Defect\u003c/h2\u003e \u003cp\u003eUnder microscopic examination, PDLSCs encapsulated in Matrigel exhibited robust growth after 2 and 4 weeks (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). A standardized periodontal bone defect was successfully induced on the mesial aspect of the right first molar in rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Daily monitoring of body weight post-modeling showed no significant weight loss across any rat group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Micro-CT three-dimensional reconstructions of the periodontal defect sites were conducted at 2 and 4 weeks post-surgery. At the 2-week mark, substantial new bone formation was evident in both the PDLSC and PDLSCs\u0026thinsp;+\u0026thinsp;CH02 groups, whereas the PDLSCs\u0026thinsp;+\u0026thinsp;bFGF group demonstrated comparatively less regeneration. By 4 weeks, the PDLSC and PDLSCs\u0026thinsp;+\u0026thinsp;CH02 groups had nearly achieved complete healing, in contrast to the PDLSCs\u0026thinsp;+\u0026thinsp;bFGF group, which exhibited reduced regeneration (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Quantitative analysis indicated that at 2 weeks, the BV/TV, Tb.N, and Tb.Th metrics of the PDLSCs\u0026thinsp;+\u0026thinsp;CH02 group surpassed those of the other groups, with the Tb.Th of the PDLSCs\u0026thinsp;+\u0026thinsp;CH02 group being significantly greater than that of the PDLSCs\u0026thinsp;+\u0026thinsp;bFGF group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE1). At 4 weeks, the BV/TV and Tb.N metrics for the PDLSCs\u0026thinsp;+\u0026thinsp;CH02 group remained superior to those of the PDLSCs\u0026thinsp;+\u0026thinsp;bFGF group, while the Tb.Th metric of the PDLSC group was notably lower than that of the other two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE2). HE staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA) revealed that at two weeks, the PDLSC and PDLSCs\u0026thinsp;+\u0026thinsp;CH02 groups exhibited reduced infiltration of inflammatory cells and edema in the adjacent connective tissue compared to other groups, with the PDLSCs\u0026thinsp;+\u0026thinsp;CH02 group demonstrating the least edema. At four weeks, the CH02 group showed significantly enhanced healing, whereas the gingival soft tissue in other groups appeared more recessed. The regeneration of collagen fibers in rat periodontal tissue was assessed using Masson staining and immunohistochemistry (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). The PDLSCs\u0026thinsp;+\u0026thinsp;CH02 group exhibited a more pronounced blue collagen network at both 2 and 4 weeks, indicating the presence of more mature collagen fibers in the newly formed bone. COL-1 immunohistochemistry showed a higher density of brown-yellow positive areas in the PDLSCs\u0026thinsp;+\u0026thinsp;CH02 group at four weeks, signifying increased COL-1 expression in the new bone and surrounding connective tissue. These findings illustrate that PDLSCs\u0026thinsp;+\u0026thinsp;CH02 are more effective in promoting bone regeneration compared to the PDLSCs\u0026thinsp;+\u0026thinsp;bFGF and PDLSC groups. Furthermore, PDLSCs\u0026thinsp;+\u0026thinsp;CH02 can ameliorate the inflammatory environment of periodontal bone defects, reduce cellular infiltration and edema, and facilitate the regeneration of new bone and surrounding connective tissue.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, the osteogenic impact of CH02 on PDLSCs was verified via in vitro experiments, and the function of PDLSCs in facilitating periodontal regeneration under the intervention of CH02 was investigated through in vivo experiments. \u003cem\u003eBone formation\u003c/em\u003e is a complex process entailing the commitment of mesenchymal cells that gradually differentiate into osteoblast precursor cells and subsequently mature bone-forming cells under the regulation of transcription factors, systemic hormones, and local growth factors, as well as cell-to-cell and cell-to-matrix interactions\u003csup\u003e26\u003c/sup\u003e. It is generally held that FGF/FGFR signaling plays a significant role in osteoblast generation, and thus far, 22 FGFS and 4 FGFR (FGFR1-4) have been cloned\u003csup\u003e16\u003c/sup\u003e. As a low-molecular-weight peptide, CH02 has a high affinity for FGFR2 and has also manifested affinity for other FGFR receptors (FGFR1, FGFR3, and FGFR4) \u003csup\u003e25\u003c/sup\u003e. Since CH02 binds to FGFR and effectively promotes its activation, we contend it is an FGFR agonist facilitating osteogenic differentiation. bFGF is the first prototypical member of the FGF family to be discovered and plays a pleiotropic role in cellular and metabolic homeostasis \u003csup\u003e27\u003c/sup\u003e. bFGF is frequently utilized to promptly alleviate tissue inflammation and boost endogenous stromal cell recruitment, proliferation, and angiogenesis for bone repair\u003csup\u003e9\u003c/sup\u003e. Studies have indicated that bFGF can promote osteogenic differentiation and periodontal regeneration of periodontal stem cells\u003csup\u003e28\u003c/sup\u003e. Hence, in this study, bFGF was employed as a positive control to investigate the effects of CH02 on PDLSC proliferation, toxicity, migration, and osteogenesis. The design of this study is analogous to that of Ying Zhao et al. 20. This study demonstrates that CH02 and bFGF have comparable effects in terms of proliferation and might activate the same signaling pathway, but CH02 exhibits superior performance in promoting PDLSC migration and osteogenesis, potentially due to its facile diffusion and more robust targeting.\u003c/p\u003e \u003cp\u003eThe molecular mechanisms of bone formation encompass three principal stages: 1) proliferation, 2) extracellular matrix maturation, and 3) mineralization, which are orchestrated by diverse vital molecules that regulate this transfer stage\u003csup\u003e29\u003c/sup\u003e. Runx2 has been demonstrated to be the most significant transcription factor during osteogenesis and is accountable for activating the osteoblast differentiation marker gene. Runx2 augments the proliferation of Ob progenitor cells by directly modulating FGFR2\u003csup\u003e30\u003c/sup\u003e. During MSC differentiation, RUNX2 governs the expression of various osteogenic genes implicated in Ob differentiation, including OCN and COL-1\u003csup\u003e31\u003c/sup\u003e. OCN is a marker of mature osteoblasts and, by binding to hydroxyapatite crystals and facilitating their growth, participates in bone mineralization in the later phases of osteogenic differentiation, an essential step in forming functional bone tissue\u003csup\u003e32\u003c/sup\u003e. In this study, the up-regulation of RUNX2 expression indicates that CH02 can efficaciously promote the differentiation of PDLSCs into Ob, and the increase of OCN expression indicates that Ob differentiated by CH02-mediated PDLSCS is maturing and actively engaged in the mineralization of the extracellular matrix.\u003c/p\u003e \u003cp\u003ePeriodontal bone regeneration constitutes a significant challenge in tissue engineering due to the complexity of the periodontal structure\u003csup\u003e33\u003c/sup\u003e. The direct application of PDLSC in periodontal bone defects confronts the difficulties of easy loss, short cell survival time, and low viability. In this study, PDLSCs proliferated well in three-dimensional space after 2W and 4W of culture using Matrigel matrix glue as a scaffold. Studies have verified that the \"sandwich structure\" formed by stem cell sheets, dentin matrix, and matrix glue can successfully induce tissue regeneration \u003csup\u003e34\u003c/sup\u003e. Matrix gel mimics the extracellular matrix, provides physiological conditions, enhances MSC activity and function, and can prolong the biological activity of CH02 and bFGF\u003csup\u003e35\u0026ndash;37\u003c/sup\u003e. This study found that CH02 intervention mitigated inflammatory cell infiltration and edema and facilitated collagen fiber regeneration and COL-1 expression in new bone and surrounding connective tissue. This is analogous to bFGF promoting collagen deposition and extracellular matrix remodeling in another study \u003csup\u003e38\u003c/sup\u003e. The in vivo results of this study follow the outcomes of five other clinical trials on the utilization of MSC in periodontal bone defects \u003csup\u003e39\u0026ndash;43\u003c/sup\u003e. In these studies, periodontal bone regeneration was enhanced in the experimental group compared with the control group. However, except for Hernandez-Mondaraz\u003csup\u003e41\u003c/sup\u003e et al., the disparity in results was not statistically significant in all studies. The primary reason might be that the study's sample size is limited, the variations among individual animals are substantial, and no statistically significant difference between the control and experimental groups can be observed, which further affects the universality of the results.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThis study unequivocally establishes that CH02 effectively stimulates the proliferation, migration, and osteogenic differentiation of PDLSCs, surpassing bFGF in terms of migration and osteogenic potential. Notably, animal experiments demonstrated the capacity of CH02 to facilitate the repair of periodontal bone defects in rats, fostering both bone and collagen regeneration. These significant findings underscore the promise of CH02 as a leading contender for advancing periodontal tissue regeneration. The outcomes strongly indicate that CH02 could offer a valuable therapeutic avenue for promoting periodontal regeneration while tackling the intricate challenges within periodontal tissue engineering. Further exploration through research and clinical trials is imperative to fully harness the therapeutic potential of CH02 in the realm of periodontal regeneration therapy.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePDLSCs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePeriodontal ligament stem cells\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ebFGF\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ebasic fibroblast growth factor\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eRT-qPCR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eReverse Transcription Quantitative Polymerase Chain Reaction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMicro-CT\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMicro-computed Tomography\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHE\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHematoxylin and Eosin staining\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eRUNX2\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRunt-related transcription factor 2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eOCN\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eOsteocalcin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCOL-1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eType I collagen\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePDL\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eperiodontal ligament\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMSCs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emesenchymal stem cells\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFGFR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eFibroblast growth factor receptor\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFGFR2\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eFibroblast growth factor receptor 2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAKT\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eProtein Kinase B\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eERK\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eExtracellular signal-regulated kinase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDMEM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDulbecco's Modified Eagle's Medium\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFBS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003efetal bovine serum\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003epenicillin/streptomycin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eP3\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePassage3\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eP5\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePassage5\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCD73\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCluster of Differentiation 73\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCD90\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCluster of Differentiation 90\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCD105\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCluster of Differentiation 105\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCD45\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCluster of Differentiation 45\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCD34\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCluster of Differentiation 34\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHLA-DR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHuman Leukocyte Antigen-DR\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePBS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePhosphate-buffered saline\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCCK8\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCell Counting Kit-8\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePFA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eParaformaldehyde\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eALP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ealkaline phosphatase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eOI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eosteogenic induction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGAPDH\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGlyceraldehyde 3-phosphate dehydrogenase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBV/TV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ebone volume fraction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTb. N\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etrabecular number\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTb.Th\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etrabecular thickness\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eEDTA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eEthylenediaminetetraacetic acid\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe express our gratitude to BioRender for supplying the illustrative materials.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding source\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe work was supported by the National Natural Science Foundation(82370995).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuiying He, Xiaojia Cheng, and Yue Huang conceived and designed the experiment together. Huiying He and Huijuan Wang were responsible for the experiment execution, data analysis, and the drafting and revision of the paper. Xin Cheng participated in the experiment, Qi Feng and\u0026nbsp;Xuesong Yang supervised the writing of the paper, and Yue Huang provided the research funding. All authors jointly discussed the findings and reviewed the manuscripts.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEthics approval and consent to participate\u003c/p\u003e\n\u003cp\u003eWe affirm that the work involving human subjects in this study complies with the Declaration of Helsinki and was approved by the Ethics Committee of Jinan University on January 10, 2023, with approval number: JNUKY-2023-0110. All animal experiments adhered to the ARRIVE guidelines and were approved by the Animal Research Committee of Jinan University on September 27, 2023, with approval number: IACUC-20230927-04.\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eAll authors are aware\u0026nbsp;and agree to the publication.\u003c/p\u003e\n\u003cp\u003eConflict of interests\u003c/p\u003e\n\u003cp\u003eThe authors declare that there is no conflict of interests.\u003c/p\u003e\n\u003cp\u003eData availability\u003c/p\u003e\n\u003cp\u003eAll data supporting the findings of this study are available within the paper and its supplementary information.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eR. Teles, K. Moss, J. S. Preisser, R. Genco, W. V. Giannobile, P. Corby, N. Garcia, H. Jared, G. Torresyap, E. Salazar, J. Moya, C. Howard, R. Schifferle, K. L. Falkner, J. Gillespie, D. Dixon and M. Cugini, \u003cem\u003eJ Clin Periodontol\u003c/em\u003e, 2018, \u003cstrong\u003e45\u003c/strong\u003e, 15-25.\u003c/li\u003e\n\u003cli\u003eT. D. Nguyen-Thi, B. H. Nguyen-Huynh, T. T. Vo-Hoang and T. Nguyen-Thanh, \u003cem\u003eJ Oral Biol Craniofac Res\u003c/em\u003e, 2023, \u003cstrong\u003e13\u003c/strong\u003e, 589-597.\u003c/li\u003e\n\u003cli\u003eY. Zhao, Y. Gong, X. Liu, J. He, B. Zheng and Y. Liu, \u003cem\u003ePharmaceutics\u003c/em\u003e, 2022, \u003cstrong\u003e14\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eX. Wei, S. Guo, Q. Liu, L. Liu, F. Huo, Y. Wu and W. Tian, \u003cem\u003eInt J Mol Sci\u003c/em\u003e, 2023, \u003cstrong\u003e24\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eP. Wang, W. Wang, T. Geng, Y. Liu, S. Zhu, Z. Liu and C. Yuan, \u003cem\u003eJ Tissue Eng\u003c/em\u003e, 2019, \u003cstrong\u003e10\u003c/strong\u003e, 2041731419894361.\u003c/li\u003e\n\u003cli\u003eG. Li, N. Han, H. Yang, X. Zhang, Y. Cao, Y. Cao, R. Shi, S. Wang and Z. Fan, \u003cem\u003eJ Oral Rehabil\u003c/em\u003e, 2020, \u003cstrong\u003e47 Suppl 1\u003c/strong\u003e, 12-18.\u003c/li\u003e\n\u003cli\u003eB. M. Seo, M. Miura, S. Gronthos, P. M. Bartold, S. Batouli, J. Brahim, M. Young, P. G. Robey, C. Y. Wang and S. Shi, \u003cem\u003eLancet\u003c/em\u003e, 2004, \u003cstrong\u003e364\u003c/strong\u003e, 149-155.\u003c/li\u003e\n\u003cli\u003eW. Qiu, B. L. Wu and F. C. Fang, \u003cem\u003eWorld J Stem Cells\u003c/em\u003e, 2020, \u003cstrong\u003e12\u003c/strong\u003e, 251-265.\u003c/li\u003e\n\u003cli\u003eT. Ding, W. Kang, J. Li, L. Yu and S. Ge, \u003cem\u003eJ Nanobiotechnology\u003c/em\u003e, 2021, \u003cstrong\u003e19\u003c/strong\u003e, 247.\u003c/li\u003e\n\u003cli\u003eF. M. Chen and Y. Jin, \u003cem\u003eTissue Eng Part B Rev\u003c/em\u003e, 2010, \u003cstrong\u003e16\u003c/strong\u003e, 219-255.\u003c/li\u003e\n\u003cli\u003eJ. Li, Z. Wang, X. Huang, Z. Wang, Z. Chen, R. Wang, Z. Chen, W. Liu, B. Wu, F. Fang and W. Qiu, \u003cem\u003eStem Cell Res Ther\u003c/em\u003e, 2021, \u003cstrong\u003e12\u003c/strong\u003e, 98.\u003c/li\u003e\n\u003cli\u003eF. M. Chen, H. H. Sun, H. Lu and Q. Yu, \u003cem\u003eBiomaterials\u003c/em\u003e, 2012, \u003cstrong\u003e33\u003c/strong\u003e, 6320-6344.\u003c/li\u003e\n\u003cli\u003eK. Mrozik, S. Gronthos, S. Shi and P. M. Bartold, \u003cem\u003eMethods Mol Biol\u003c/em\u003e, 2017, \u003cstrong\u003e1537\u003c/strong\u003e, 413-427.\u003c/li\u003e\n\u003cli\u003eJ. Nu\u0026ntilde;ez, F. Vignoletti, R. G. Caffesse and M. Sanz, \u003cem\u003ePeriodontol 2000\u003c/em\u003e, 2019, \u003cstrong\u003e79\u003c/strong\u003e, 107-116.\u003c/li\u003e\n\u003cli\u003eL. Tan, Z. Cao, H. Chen, Y. Xie, L. Yu, C. Fu, W. Zhao and Y. Wang, \u003cem\u003eLife Sci\u003c/em\u003e, 2021, \u003cstrong\u003e270\u003c/strong\u003e, 119125.\u003c/li\u003e\n\u003cli\u003eX. Du, Y. Xie, C. J. Xian and L. Chen, \u003cem\u003eJ Cell Physiol\u003c/em\u003e, 2012, \u003cstrong\u003e227\u003c/strong\u003e, 3731-3743.\u003c/li\u003e\n\u003cli\u003eL. Chen and C. X. Deng, \u003cem\u003eFront Biosci\u003c/em\u003e, 2005, \u003cstrong\u003e10\u003c/strong\u003e, 1961-1976.\u003c/li\u003e\n\u003cli\u003eD. M. Ornitz and P. J. Marie, \u003cem\u003eGenes Dev\u003c/em\u003e, 2002, \u003cstrong\u003e16\u003c/strong\u003e, 1446-1465.\u003c/li\u003e\n\u003cli\u003eF. W. Hu, J. Hosomichi, Z. Kanno and K. Soma, \u003cem\u003eJ Med Dent Sci\u003c/em\u003e, 2008, \u003cstrong\u003e55\u003c/strong\u003e, 129-135.\u003c/li\u003e\n\u003cli\u003eS. Sugimoto, M. Ota, Y. Shibukawa and S. Yamada, \u003cem\u003eBiomedical Research-tokyo\u003c/em\u003e, 2004, \u003cstrong\u003e25\u003c/strong\u003e, 179-187.\u003c/li\u003e\n\u003cli\u003eM. Shen, L. Wang, L. Feng, Y. Gao, S. Li, Y. Wu, C. Xu and G. Pei, \u003cem\u003eInt J Nanomedicine\u003c/em\u003e, 2022, \u003cstrong\u003e17\u003c/strong\u003e, 2593-2608.\u003c/li\u003e\n\u003cli\u003eQ. Huang, B. Liu and W. Wu, \u003cem\u003eOxid Med Cell Longev\u003c/em\u003e, 2023, \u003cstrong\u003e2023\u003c/strong\u003e, 8003821.\u003c/li\u003e\n\u003cli\u003eY. Li, F. Yu, Y. Liu, Q. Liang, Y. Huang, Q. Xiang, Q. Zhang, Z. Su, Y. Yang and Y. Zhao, \u003cem\u003eJ Periodontol\u003c/em\u003e, 2020, \u003cstrong\u003e91\u003c/strong\u003e, 975-985.\u003c/li\u003e\n\u003cli\u003eS. Nakamura, T. Ito, K. Okamoto, T. Mima, K. Uchida, Y. D. Siddiqui, M. Ito, M. Tai, K. Okubo, K. Yamashiro, K. Omori, T. Yamamoto, O. Matsushita and S. Takashiba, \u003cem\u003eJ Periodontol\u003c/em\u003e, 2019, \u003cstrong\u003e90\u003c/strong\u003e, 1043-1052.\u003c/li\u003e\n\u003cli\u003eY. Zhao, Q. Wang, C. Xie, Y. Cai, X. Chen, Y. Hou, L. He, J. Li, M. Yao, S. Chen, W. Wu, X. Chen and A. Hong, \u003cem\u003eTheranostics\u003c/em\u003e, 2021, \u003cstrong\u003e11\u003c/strong\u003e, 10125-10147.\u003c/li\u003e\n\u003cli\u003eD. M. Ornitz and P. J. Marie, \u003cem\u003eGenes Dev\u003c/em\u003e, 2015, \u003cstrong\u003e29\u003c/strong\u003e, 1463-1486.\u003c/li\u003e\n\u003cli\u003eX. Li, \u003cem\u003eFront Med\u003c/em\u003e, 2019, \u003cstrong\u003e13\u003c/strong\u003e, 511-530.\u003c/li\u003e\n\u003cli\u003eS. Murakami, \u003cem\u003ePeriodontol 2000\u003c/em\u003e, 2011, \u003cstrong\u003e56\u003c/strong\u003e, 188-208.\u003c/li\u003e\n\u003cli\u003eD. H. Zheng, X. X. Wang, D. Ma, L. N. Zhang, Q. F. Qiao and J. Zhang, \u003cem\u003eDrug Des Devel Ther\u003c/em\u003e, 2019, \u003cstrong\u003e13\u003c/strong\u003e, 2543-2552.\u003c/li\u003e\n\u003cli\u003eT. Komori, \u003cem\u003eInt J Mol Sci\u003c/em\u003e, 2019, \u003cstrong\u003e20\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eT. Komori, \u003cem\u003eMol Cells\u003c/em\u003e, 2020, \u003cstrong\u003e43\u003c/strong\u003e, 168-175.\u003c/li\u003e\n\u003cli\u003eJ. Zhang, W. Zhang, J. Dai, X. Wang and S. G. Shen, \u003cem\u003eInt J Oral Sci\u003c/em\u003e, 2019, \u003cstrong\u003e11\u003c/strong\u003e, 12.\u003c/li\u003e\n\u003cli\u003eW. Wang, A. Wang, G. Hu, M. Bian, L. Chen, Q. Zhao, W. Sun and Y. Wu, \u003cem\u003eACS Biomater Sci Eng\u003c/em\u003e, 2023, \u003cstrong\u003e9\u003c/strong\u003e, 1961-1975.\u003c/li\u003e\n\u003cli\u003eH. Meng, L. Hu, Y. Zhou, Z. Ge, H. Wang, C. T. Wu and J. Jin, \u003cem\u003eStem Cells Dev\u003c/em\u003e, 2020, \u003cstrong\u003e29\u003c/strong\u003e, 521-532.\u003c/li\u003e\n\u003cli\u003eZ. Gan, X. Qin, H. Liu, J. Liu and J. Qin, \u003cem\u003eBioact Mater\u003c/em\u003e, 2023, \u003cstrong\u003e28\u003c/strong\u003e, 386-401.\u003c/li\u003e\n\u003cli\u003eX. T. He, X. Li, Y. Xia, Y. Yin, R. X. Wu, H. H. Sun and F. M. Chen, \u003cem\u003eActa Biomater\u003c/em\u003e, 2019, \u003cstrong\u003e88\u003c/strong\u003e, 162-180.\u003c/li\u003e\n\u003cli\u003eC. Liang, Q. Liang, X. Xu, X. Liu, X. Gao, M. Li, J. Yang, X. Xing, H. Huang, Q. Tang, L. Liao and W. Tian, \u003cem\u003eInt J Oral Sci\u003c/em\u003e, 2022, \u003cstrong\u003e14\u003c/strong\u003e, 38.\u003c/li\u003e\n\u003cli\u003eY. Yang, T. Xia, W. Zhi, L. Wei, J. Weng, C. Zhang and X. Li, \u003cem\u003eBiomaterials\u003c/em\u003e, 2011, \u003cstrong\u003e32\u003c/strong\u003e, 4243-4254.\u003c/li\u003e\n\u003cli\u003eD. A. Apatzidou, A. A. Bakopoulou, K. Kouzi-Koliakou, V. Karagiannis and A. Konstantinidis, \u003cem\u003eJ Clin Periodontol\u003c/em\u003e, 2021, \u003cstrong\u003e48\u003c/strong\u003e, 1111-1125.\u003c/li\u003e\n\u003cli\u003eF. M. Chen, L. N. Gao, B. M. Tian, X. Y. Zhang, Y. J. Zhang, G. Y. Dong, H. Lu, Q. Chu, J. Xu, Y. Yu, R. X. Wu, Y. Yin, S. Shi and Y. Jin, \u003cem\u003eStem Cell Res Ther\u003c/em\u003e, 2016, \u003cstrong\u003e7\u003c/strong\u003e, 33.\u003c/li\u003e\n\u003cli\u003eB. Hern\u0026aacute;ndez-Monjaraz, E. Santiago-Osorio, E. Ledesma-Mart\u0026iacute;nez, I. Agui\u0026ntilde;iga-S\u0026aacute;nchez, N. A. Sosa-Hern\u0026aacute;ndez and V. M. Mendoza-N\u0026uacute;\u0026ntilde;ez, \u003cem\u003eStem Cells Int\u003c/em\u003e, 2020, \u003cstrong\u003e2020\u003c/strong\u003e, 8890873.\u003c/li\u003e\n\u003cli\u003eN. S\u0026aacute;nchez, L. Fierravanti, J. N\u0026uacute;\u0026ntilde;ez, F. Vignoletti, M. Gonz\u0026aacute;lez-Zamora, S. Santamar\u0026iacute;a, S. Su\u0026aacute;rez-Sancho, M. E. Fern\u0026aacute;ndez-Santos, E. Figuero, D. Herrera, J. A. Garc\u0026iacute;a-Sanz and M. Sanz, \u003cem\u003eJ Clin Periodontol\u003c/em\u003e, 2020, \u003cstrong\u003e47\u003c/strong\u003e, 1391-1402.\u003c/li\u003e\n\u003cli\u003eM. Takedachi, K. Sawada, K. Sakura, C. Morimoto, A. Hirai, T. Iwayama, J. Shimomura, K. Kawasaki, C. Fujihara, Y. Kashiwagi, A. Miyake, T. Yamada, H. Okura, A. Matsuyama, M. Saito, M. Kitamura and S. Murakami, \u003cem\u003eSci Rep\u003c/em\u003e, 2022, \u003cstrong\u003e12\u003c/strong\u003e, 8126.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-oral-health","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ohea","sideBox":"Learn more about [BMC Oral Health](http://bmcoralhealth.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/ohea/default.aspx","title":"BMC Oral Health","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"PDLSCs, CH02 peptide, osteogenesis, periodontal regeneration","lastPublishedDoi":"10.21203/rs.3.rs-5382618/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5382618/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjectives\u003c/h2\u003e \u003cp\u003ePeriodontal ligament stem cells (PDLSCs) are considered ideal seed cells for periodontal tissue engineering and regeneration, and optimizing their efficacy is a pressing challenge. Although basic fibroblast growth factor (bFGF) has been extensively studied for promoting periodontal regeneration, its instability limits its application. This study introduces a smaller, less degradable peptide, CH02, to address this issue. Therefore, this study aims to explore the promoting effect of the CH02 peptide on the osteogenic differentiation of PDLSCs, providing new support for periodontal regeneration.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eExtracted PDLSCs from human premolars; used bFGF as a positive control to analyze the effects of CH02 on the proliferation, toxicity, migration, osteogenic differentiation, and calcification ability of PDLSCs; RT-qPCR analysis of osteogenesis-related gene expression; constructed a rat model of periodontal bone defect, delivered PDLSCs encapsulated in Matrigel to the defect site, and intervened with CH02 and bFGF for 2W and 4W respectively, then analyzed bone regeneration through Micro-CT, HE staining, Masson staining, and immunohistochemistry.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe extracted PDLSCs meet the international standards for mesenchymal stem cells. CH02 at 25 \u0026micro;g/mL promotes the proliferation, migration, and osteogenic differentiation of PDLSCs, with effects comparable to those of 25 ng/mL bFGF. CH02 enhances the expression of osteogenic-related genes RUNX2, OCN, and COL-1 in PDLSCs. In vivo, CH02 promotes the repair of periodontal bone defects in rats by PDLSCs.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003ePDLSCs have the potential for osteogenic differentiation; CH02 is more efficient than bFGF in promoting osteogenic differentiation of PDLSCs and the repair of periodontal bone defects in rats.\u003c/p\u003e","manuscriptTitle":"CH02 peptide-stimulated periodontal ligament stem cells enhance periodontal regeneration","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-18 14:48:45","doi":"10.21203/rs.3.rs-5382618/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-11-12T16:06:33+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-11-04T10:24:36+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-11-04T10:24:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Oral Health","date":"2024-11-03T14:52:29+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-oral-health","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ohea","sideBox":"Learn more about [BMC Oral Health](http://bmcoralhealth.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/ohea/default.aspx","title":"BMC Oral Health","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e7d2148d-a4aa-471a-ad66-23f6b57dfba7","owner":[],"postedDate":"November 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-07-07T16:01:17+00:00","versionOfRecord":{"articleIdentity":"rs-5382618","link":"https://doi.org/10.1186/s12903-025-06393-5","journal":{"identity":"bmc-oral-health","isVorOnly":false,"title":"BMC Oral Health"},"publishedOn":"2025-07-03 15:57:20","publishedOnDateReadable":"July 3rd, 2025"},"versionCreatedAt":"2024-11-18 14:48:45","video":"","vorDoi":"10.1186/s12903-025-06393-5","vorDoiUrl":"https://doi.org/10.1186/s12903-025-06393-5","workflowStages":[]},"version":"v1","identity":"rs-5382618","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5382618","identity":"rs-5382618","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}