Tam Kinase Receptor Inhibition-A Possible Therapeutic Intervention to Prevent Breast Cancer Recurrence After Therapy

Tam Kinase Receptor Inhibition-A Possible Therapeutic Intervention to Prevent Breast Cancer Recurrence After Therapy | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Tam Kinase Receptor Inhibition-A Possible Therapeutic Intervention to Prevent Breast Cancer Recurrence After Therapy Saba Naseem, Fawad Ur Rehman Khan, Afsar Ali Mian This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7385510/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Breast Cancer appears in various forms afflicting an increasing number of women around the globe. Therapeutic resistance in Breast Cancer has been associated with overexpression of Tyro3 Kinase Receptor. Inhibition of Tyro3 with LDC1267 is reported to control metastasis in breast cancer. The aim of the study was to investigate the apoptotic effect of Tyro3 inhibition relative to WNT signaling responsible for transforming MCF-7 and MDA-MB-231 cells. Soft agar colony formation assay and focus formation assay were carried out with 2× (0.81uM, 1.62uM, 3.24uM and 6.48uM) concentrations added to 1% bacto-agar 50% v/v in the bottom layer and 5000 cells with media containing 0.5% agar (50% v/v) in the top layer in triplicates in six well plates incubated on 37 o C and in 5% CO 2 for 15 days for forming colonies in soft agar. For Focus formation assay 40,000 cells /well were plated in 24 well plates in triplicates and incubated (for around 72 hours) until they reach confluence then inhibitor was added and plates were incubated at 37 o C and 5% CO 2 for 15 days after which crystal violet staining was undertaken. The expression analysis of WNT signaling mediators c-Myc and Axin-2 was carried out via RT-PCR using the following primer sequences (5’-3’) c-Myc (F) ‘GAAAAGGCCCCCAAGGTAGT’, c-Myc (R) ‘AGTTTGTGTTTCAACTGTTC’, Axin-2 (F) ‘CTATGTCTTTGCACCAGCCA’, Axin-2 (R) ‘TAGAGACACTTGGCCATTGG’, GAPDH (F) ‘CATCACCATCTTCCAGGAG’ and GAPDH (R)’ GATGATGACCCTTTTGGC’. Decreased foci and colony number indicated anti-transformation effects of Tyro3 inhibition. Western Blot analysis with cleaved caspase 3, Bax and BCl2 antibodies confirmed cell death by intrinsic apoptotic pathway. Elevated c-Myc and Axin-2 in MCF-7 and decreased expression of both in MDA-MB-231 indicated WNT pathway involvement, preferably feedback loop occurring in MCF-7 and aberrant gene suppression in MDA-MB-231 thereby halting its aggressiveness. This study proves that Tyro3 inhibition has significant inhibitory effects on transforming cells via WNT pathway. Breast Cancer Stem Cell Transformation Potential Relapse Tumor microenvironment Figures Figure 1 Figure 2 Figure 3 Figure 4 INTRODUCTION Breast cancer is the second most prevalent cancer among women across the globe. It appears in various forms with triple negative subtypes being the most aggressive and resistant to therapy in comparison to Luminal subtype of breast cancer which responds to therapy and has delayed relapse [ 1 ]. Currently many therapeutic interventions have been introduced for treatment such as targeting hormone receptors e.g. (FDA approved tamoxifen and aromatase inhibitors) yet the hormone negative types still pose a major challenge for scientists [ 2 ], even the approved drugs have side effects which restrict their usefulness [ 3 ]. Despite the vast majority of treatment strategies, relapse remains the main obstacle. Breast carcinogenesis has been linked to stem cells having enormous regenerative potential. Based on the TNM (Tumor, Node and Metastasis) classification breast cancer grading is carried out which facilitates in clinical proceedings however molecular subtyping helps in devising more targeted therapies[ 4 ]. When the tumor undergoes trauma, it sheds tumor cells which enter blood vessels (intravasation) and establish colonies after extravasation in immune sensitive sites. The tumor cells establish a microenvironment where stem cells remain dormant till the immune surveillance is altered. Breast cancer stem cells (BCSCs) are derived from the breast tumor. These cells colonize other body organs offering therapeutic resistance[ 5 ]. The presence of surface markers CD44+/CD24-/low or ALDH + after therapy indicates poor prognosis[ 6 ]. Stem cells have phenotypic plasticity which drives epithelial to mesenchymal transition (EMT) via WNT/β Catenin pathway. Phenotypic plasticity is actually switching of E-Cadherin by N-Cadherin and vimentin which leads to loss of cell polarity thereby altering normal tissue organization[ 7 ]. Relapse after chemotherapy occurs because chemotherapy targets rapidly dividing cells in the S and M phases of cell cycle which undergo apoptosis, while the tissue cells in resting phase i.e., G0 undergo DNA damage which offers severe resistance to the same therapy afterwards [ 8 ]. Alternative medication is available for hormonal subtypes of BC but TNBC prevalent in women under 40yrs of age offers resistance. Canonical Wnt signaling is a hallmark of various cancers particularly breast cancer. The WNT pathway has been reported to interact with PI3K/Akt and MAPK pathways thereby regulating the expression of TYRO3 kinase receptor which is targeted in our study and effects of its inhibition have been linked to cancer stem cells the main cause of relapse. Two advance strategies previously used for leukemic studies were used for the measurement of stem cell repopulation potential after tyrosine kinase inhibition. The LDC1267 inhibitor serves as a pan kinase inhibitor yet is more specific for tyro3 kinase receptor. The tyrosine kinase receptors comprise of a family of more than 50 receptors divided into 20 subfamilies [ 9 ]with AXL, MerTK and TYRO3 comprising TAM family of Receptor Tyrosine kinases[ 10 ]. Besides being important for normal physiological processes, TAM Kinase Receptors tend to play unique roles in various malignancies including hormone positive and triple negative breast cancer exhibiting cell line models [ 11 ]. The role of Tyro3 has been highlighted in both triple negative and hormone positive breast cancer cell line models MDA-MB-231 and MCF-7. The aim of the current study was to link Tyro3 inhibition with its potential effect on downstream targets such as axin-2, c-myc, BCl2 and Bax to further elucidate its role in various signaling pathways. As already researched, siRNA against Tyro3 effectively reduces proliferation potential in luminal breast cancer cell line MCF-7 having no substantial effect on triple negative MDA-MB-231 cell line. In our study the transformation potential of Luminal and triple negative breast cancer cell lines MCF-7 and MDA-MB-231 was determined by soft-agar colony formation assay and Focus formation assay with Tyro3 inhibitor LDC1267. MATERIALS/METHODS Cell Lines and Inhibitor MCF-7 and MDA-MB-231 cell lines were grown in low glucose DMEM medium with 10% FBS, 1% penstrep and 1% L-glutamin. The Tyro3 Inhibitor LDC1267 was purchased from Selleck chemicals Transformation Assay Soft agar colony formation assay was carried out by adding the inhibitor (1ml) to 1% bacto-agar (1ml) which gave 0.5% agar in bottom layer and 5000 cells/well were plated such that 5000 cells were in 750ul media to which 250ul (1%) agar was added which gave 0.25% agar in top layer in six well plates. The plates were incubated at 37oC and 5% CO2 for 15 days, after which colonies were counted on EVOS system. Focus Formation Assay The focus formation assay was carried out by plating 40,000 cells /well in 24 well plate and incubated (for around 72 hours) until they reach confluence then inhibitor was added and plates were incubated at 37oC and 5% CO2 for 15 days after which media was aspirated and wells were washed twice with ice cold PBS (1X). The plates were kept on ice and cells were fixed with ice-cold Methanol for 10 minutes. The plates were removed from ice, methanol was aspirated and 1ml of 0.5% crystal violet solution made in 25% methanol was added to each well. The plates were incubated for 5 minutes at RT (Room Temperature). Crystal violet solution was aspirated and wells were washed with DI water until no color came off the rinse. The plates were allowed to dry on a benchtop overnight and foci were imaged the next day. Western Blotting Western Blotting was carried out according to widely established protocols. 12% resolving and 4% stacking gel was prepared for proteins smaller than 50KDa and 10% resolving with 7% stacking for proteins smaller than 120kDa were prepared. Proteins were denatured in lammelli buffer after 24-hour treatment with inhibitor and were loaded and subsequently transferred to blotting membrane which was immersed in 5% blocking solution (non-fat dry milk dissolved in TBS with 0.1% Tween 20) for 1 hour. The antibodies used include BCL2 (sc-7382), Bax (sc-7480), Cleaved Caspase 3 (9664S) and B-actin(sc-47778). Real Time PCR Real Time PCR was carried out with the following primers for axin-2, c-myc and Gapdh, (5’-3’) c-Myc (F) ‘GAAAAGGCCCCCAAGGTAGT’, c-Myc (R) ‘AGTTTGTGTTTCAACTGTTC’, Axin-2 (F) ‘CTATGTCTTTGCACCAGCCA’, Axin-2 (R) ‘TAGAGACACTTGGCCATTGG’, GAPDH (F) ‘CATCACCATCTTCCAGGAG’ and GAPDH (R)’ GATGATGACCCTTTTGGC’. Statistical Analysis Statistical analysis was performed on Graph-pad Prism 8 and a p value < 0.05 was considered to be statistically significant. The experiments were repeated twice to ensure the significance of results obtained. RESULTS Tyro3 Inhibition has significant effect on transformation potential of MCF-7 and MDA-MB-231 Transformation potential reflects the ability of a cell to divide uncontrollably forming anchorage independent colonies. The LDC1267 inhibitor reduces colony formation potential of both the cell lines with increasing concentrations as depicted in Fig.1. Tyro3 Inhibition has profound effects on single cell colony formation c-Myc and Axin-2 appear to be potential downstream targets mediating oncogenesis in Breast Cancer Transcriptional Analysis of Intrinsic Apoptotic Pathway after treatment with LDC1267 Inhibitor DISCUSSION Transformation assay and focus formation assay depict the stem like behavior of cancer cells and their ability to induce tumors. These assays are a better alternative to animal studies for analysis of tumorigenesis [ 7 ]. Intrinsic apoptotic pathway seems to interact with Canonical WNT signaling to restrict stemness of Breast cancer cells as is evident in both luminal A subtype representative MCF-7 and TNBC subtype representative MDA-MB-231 upon treatment with Tyro3 inhibitor LDC1267 respectively Fig. 1 . Tyro3 is a tyrosine kinase receptor which is actively expressed in Breast cancer cells. It is a well-established fact that cancer cells have unlimited replicative potential that is severely affected upon tyrosine kinase inhibition supported by Western Blot results Fig. 4 . The inhibition of receptor tyrosine kinases halts the proliferation and induces apoptosis via intrinsic apoptotic pathway. The marked reduction in colony numbers and foci formation reflects that continuous treatment with kinase inhibitors along with standard therapies for cancer can help prevent relapse Fig. 1 &2. The results of the study support the hypothesis that apoptosis can be induced in dividing cells while the self-renewal potential of BCSCs also seems to be restricted to a greater extent Figs. 1 & 2. The colony formation assay and focus formation assay reveal the inability of cancer cells including cancer stem cells to withstand growth and proliferation inhibition by LDC1267 Fig. 1 . PI3K/Akt and RAS/MapK pathways are constitutively active in breast cancer[ 12 ]. LDC 1267 serves as a pan kinase inhibitor although known for targeting tyro3 receptor. Estrogen receptor activates tyro3 by activating STAT3 which in turn activates MAPK and PI3K/Akt pathways[ 13 ], tyro3 activation controls STAT3 in a feedback manner so when tyro3 is inhibited estrogen receptor still has the potential to activate MAPK pathway which cross links with Canonical Wnt pathway thereby activating c-myc and axin-2. The downregulation of c-myc and axin-2 in ER- TNBC supports the aforementioned description Fig. 3 . All the signaling pathways have one thing in common i.e., feedback loop. Although cancer cells have limitless replication potential yet there is a slight ongoing apoptosis due to feedback mechanisms operational to some extent. Apoptosis has been reported to be involved in epithelial development and differentiation, dysregulation of which contributes to breast cancer pathogenesis[ 14 ]. The consistent BCl2 expression in normal and tumor breast tissue were found to be linked to decreased Bax expression in tumor versus normal tissue. The proto-oncogene i.e., BCl2 expression has been found to be profound in lobular than in ductal breast carcinoma. Our findings correlate with the previous findings on bax and bcl2 expression in breast cancer reflecting low bax expression in breast cancer corresponding to normal breast tissue Fig. 4 . It has been validated through research that the breast cancer derived cell lines not expressing or having low expression of bax are resistant to apoptosis[ 15 ]. Therefore, in our study we treated the breast cancer cell lines MCF-7 and MDA-MB-231 with tyro3 inhibitor and checked for its effect on bax and bcl2 proteins and the results validated on translational level that Bax is less expressed in both the cancer cell lines and that the expression is enhanced upon treatment with LDC1267 inhibitor reflecting the role of tyro3 inhibitor towards apoptosis induction Fig. 4 . Wnt signaling is activated upon Wnt ligand binding to receptors which then stabilize β catenin thus activating downstream target genes, dysregulation of Wnt signalling has been reported in many cancers including breast cancer[ 16 ]. Β-catenin the important player of this pathway is a transcriptional regulator which regulates migration, apoptosis, morphogenesis, cell proliferation and differentiation[ 16 ]. Axin-2 is a negative regulator of B catenin owing to its role in B catenin degradation complex, however genetic alterations in axin-2 block its regulatory effect on B catenin and downstream activation of Wnt target genes in different cancers[ 17 ]. Axin-2 overexpression induces the expression of Snail1 which plays an important role in EMT in breast cancer. In addition to axin-2, snail 1 is also overexpressed in many cancers[ 18 ]. Axin-2 inhibition attenuates the invasiveness of Triple negative breast cancer cell line MDA-MB-231[ 19 ]. TP53 protein is a negative regulator of both Axin-2 and c-Myc thereby promoting apoptosis by upregulating bax and downregulating bcl2[ 20 ]. Hence, we can say that the tyro3 inhibitor upregulates the TP53 expression which downregulates c-myc and Axin-2 and upregulates Bax as evident in the current study. Upregulation of c-Myc inactivates p53 thus promoting cell survival and proliferation in cancer[ 20 ]. Recent studies indicate a potential link between aberrant overactivation of Wnt signaling and drug resistance in Cloangiocarcinoma. In comparison to MCF-7, MDA-MB-231 has elevated levels of mutant p53[ 15 ] which is validated to be stabilized by phospholipase D[ 16 ]. Tyro3 has oncogenic potential as it transforms rat-2 fibroblasts which grow in soft agar following transfection with tyro3 gene[ 17 ] and overexpression of tyro3 in rat fibroblasts develops tumors in nude mice. Tyro3 overexpression renders ligand independent activation [ 18 ]. Therefore, our study aimed at targeting Tyro3 with LDC1267 inhibitor and check for its anti-transformative potential and the results correlated with its inhibitory effects on metastasis and transformation potential. A study has shown that targeting Tyro3 with LDC1267 enables natural killer cells to target tumor cells in vivo[ 21 ]. Most of the cancer cells upon exposure to stressful conditions such as starvation die out i.e.., they neither form colonies nor foci but the transformed cells, remain active and form colonies i.e., single cell detaches from rest of cells and forms colonies and foci i.e., cells with transformation potential detach from confluent cells creating a tumor microenvironment and survive as evident by crystal violet staining in untreated control cells while in treated cells the colony number and foci formation decreased significantly. CONCLUSION This study strengthens the notion that inhibition of Tyro3 receptor can help prevent recurrence along with chemotherapy as well as can halt the development of cancer when diagnosed at early stages owing to its effect on cancer cell transformation potential. Abbreviations BC : Breast Cancer BCSCs: Breast Cancer Stem Cells TNBC: Triple Negative Breast Cancer Tyro3: Tyrosine Kinase Receptor TAM Receptors: Tyro3, Axl, Mertk kinase receptors WB: Western Blotting Bax: BCL2 associated X protein BCl2: B Cell Lymphoma 2 protein CCL3: Cleaved Caspase 3 Β-actin: Beta actin protein (loading control) μM: micromole MCF-7: Michigan Cancer Foundation 7 MDA-MB-231: M (Metastatic), D (Anderson), A (Breast) - MB (Metastatic Breast) 231 RAS/MAPK: Ras/Mitogen-activated Protein Kinase STAT3: Signal Transducer and Activator of Transcription 3 c-Myc: cellular myelocytomatosis oncogene Axin-2: Axis inhibition protein 2 Declarations Ethical Approval and Consent to participate: Approved Consent for Publication: Affirmative Availability of Data and Materials: N/A Competing Interests: None Funding: NUST Author Contributions: Study Design, planning and execution: Saba Naseem Workplace availability and writing: Afsar Ali Mian Experimental support: Fawad Ur Rehman ACKNOWLEDGEMENTS We acknowledge the support of Dr. Dilawar Khan, Miss Shariqa Khwaja, Dr. Rida-e- Maria Qazi and Miss Reena Zaman in the execution of this project work. References Carey LA, et al. Race, breast cancer subtypes, and survival in the Carolina Breast Cancer Study. JAMA. 2006;295(21):2492–502. Group EBCTC. Aromatase inhibitors versus tamoxifen in early breast cancer: patient-level meta-analysis of the randomised trials. Lancet. 2015;386(10001):1341–52. de Cremoux P, et al. Tamoxifen and aromatase inhibitors in the treatment of breast cancer in menopausal women: pharmacological and clinical aspects. Bull Cancer. 2004;91(12):917–27. Zepeda-Castilla EJ, et al. Molecular classification of breast cancer. Cir Cir. 2008;76(1):87–93. Reymond N, d'Água BB, Ridley AJ. Crossing the endothelial barrier during metastasis. Nat Rev Cancer. 2013;13(12):858–70. Al-Hajj M et al. Prospective identification of tumorigenic breast cancer cells. Proceedings of the National Academy of Sciences, 2003. 100(7): pp. 3983–3988. Yamashita N, et al. Epithelial paradox: clinical significance of coexpression of E-cadherin and vimentin with regard to invasion and metastasis of breast cancer. Clin Breast Cancer. 2018;18(5):e1003–9. Dittmer A, Dittmer J. Long-term exposure to carcinoma-associated fibroblasts makes breast cancer cells addictive to integrin β1. Oncotarget. 2018;9(31):22079. Cramer KS, Miko IJ. Eph-ephrin signaling in nervous system development. F1000Research, 2016. 5. van der Meer JH, van der Poll T. van ‘t Veer, TAM receptors, Gas6, and protein S: roles in inflammation and hemostasis. Blood. J Am Soc Hematol. 2014;123(16):2460–9. Ekyalongo RC, et al. TYRO3 as a potential therapeutic target in breast cancer. Anticancer Res. 2014;34(7):3337–45. Fu X, Osborne CK, Schiff R. Biology and therapeutic potential of PI3K signaling in ER+/HER2-negative breast cancer. Breast. 2013;22:S12–8. Renoir J-M, Marsaud V, Lazennec G. Estrogen receptor signaling as a target for novel breast cancer therapeutics.: new targets in estradiol receptor-positive breast cancers. 2013. Lü C-Y, Chen X-Y. Progress of research on apoptosis of breast cancer cells. Zhong xi yi jie he xue bao = Journal. Chin Integr Med. 2003;1(3):226–9. Krajewski S, et al. Reduced expression of proapoptotic gene BAX is associated with poor response rates to combination chemotherapy and shorter survival in women with metastatic breast adenocarcinoma. Cancer Res. 1995;55(19):4471–8. Xu X, et al. Wnt signaling in breast cancer: biological mechanisms, challenges and opportunities. Mol Cancer. 2020;19(1):165. Jho E-h, et al. Wnt/β-catenin/Tcf signaling induces the transcription of Axin2, a negative regulator of the signaling pathway. Mol Cell Biol. 2002;22(4):1172–83. Wu Z-Q et al. Canonical Wnt suppressor, Axin2, promotes colon carcinoma oncogenic activity. Proceedings of the National Academy of Sciences, 2012. 109(28): pp. 11312–11317. Ahn SY, Jo CH. Implications of Axis Inhibition Protein 2 in Breast Cancer Progression. in vivo, 2023. 37(2): pp. 634–643. Santoro A, et al. 53 loss in breast cancer leads to Myc activation, increased cell plasticity, and expression of a mitotic signature with prognostic value. Cell Rep. 2019;26(3):624–38. e8. Malki A, E.A. EL SAYED. In vitro and in vivo efficacy of a novel quinuclidinone derivative against breast cancer. Anticancer Res. 2014;34(3):1367–76. Additional Declarations No competing interests reported. Supplementary Files Saba2025022023h56m44sColorimetric.jpg Saba2025022023h54m59sChemiluminescenceCCL3.jpg SabaBetaActinBC242822548H1Chemiluminescence.jpg SabaBC48HBax63251Chemiluminescence.jpg SabaBCL2BC48H272251Chemiluminescence.jpg WesternBlottingMembraneBlots.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7385510","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":525370782,"identity":"b5add5ae-51c9-48b4-aca2-27e438cff502","order_by":0,"name":"Saba Naseem","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABf0lEQVRIie2RPWvCQBjHnxBIlytdldD0K1w4iBWFfJUcgi4RhIJ16BAQ0sWXNVKhX6FFkI6WgFlCXQMRahGcHFIEEZq+eNEWra1zofkNx3F/fs/94QGIifnTJADzAFm0vAoQsJfeVgqAf1byElM4i+U94AyWoP2KTZjCoz3KyVV1HASVLqTE6u2sFPK02bQn42wY0oZTd0bcna2qwN/7CIZkpeBhX0larg/pdv9MbJkCtbx8ihRNTFvuAzU416Y1EHIZBBNlrSQ0hT80fcCejsVDA1HDA0UsGpjeeLpscKatIUCKiMDOrotZhdns9S1SyAsKE/R64MzF03CpPE4jRUVwNN9QgA3njEhZjhIwwb3lBQT2C4oUrgZIYMpnMU8vJ2t9H6WtfDnTMjVJ9vRzuW4S0nJ12aJmgdZsgaTbeEK+inWCxYUvpRK5jl8K35E0cLqjRSgdNxwXB89mRj24rD5508pQNra2gnb2tEJjBx/16X3PflE22FFiYmJi/gsfLniUsMH22FkAAAAASUVORK5CYII=","orcid":"","institution":"Saba Naseem National University of Sciences and Technology, NUST","correspondingAuthor":true,"prefix":"","firstName":"Saba","middleName":"","lastName":"Naseem","suffix":""},{"id":525370783,"identity":"3aba71e7-b152-4377-b98f-48b81a7ae662","order_by":1,"name":"Fawad Ur Rehman Khan","email":"","orcid":"","institution":"Afsar Ali Mian Aga Khan University Hospital, AKU","correspondingAuthor":false,"prefix":"","firstName":"Fawad","middleName":"Ur Rehman","lastName":"Khan","suffix":""},{"id":525370786,"identity":"7935c9fa-de26-4bd5-bd53-3c01773b6387","order_by":2,"name":"Afsar Ali Mian","email":"","orcid":"","institution":"Afsar Ali Mian Aga Khan University Hospital, AKU","correspondingAuthor":false,"prefix":"","firstName":"Afsar","middleName":"Ali","lastName":"Mian","suffix":""}],"badges":[],"createdAt":"2025-08-16 06:53:04","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7385510/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7385510/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92961134,"identity":"8841f1c6-ca00-44e4-b588-d0b457d724d2","added_by":"auto","created_at":"2025-10-07 14:55:18","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2563795,"visible":true,"origin":"","legend":"","description":"","filename":"BreastCancerResearchPaperRevised.docx","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/ee83913590e9f2ac83787101.docx"},{"id":92958396,"identity":"e6c72fa9-d517-4d10-b3a0-ab08253d8c01","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5544,"visible":true,"origin":"","legend":"","description":"","filename":"c7495816d89043b48e808887e9201fdc.json","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/6f63f808866f198c885acfc4.json"},{"id":92958412,"identity":"f6fa898d-04a5-4593-b88c-466f030bd2bd","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1179967,"visible":true,"origin":"","legend":"","description":"","filename":"Saba2025022023h54m59sChemiluminescenceCCL3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/eb1c41f151f08d5cd68636ad.jpg"},{"id":92958399,"identity":"1784cb9b-d064-4f08-a828-160af6e6fc95","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":580041,"visible":true,"origin":"","legend":"","description":"","filename":"Saba2025022023h56m44sColorimetric.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/df647788c6d76f5d745f6f29.jpg"},{"id":92959701,"identity":"5a78959c-a699-4097-93a6-59ea3de1afa9","added_by":"auto","created_at":"2025-10-07 14:39:18","extension":"jpg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1900006,"visible":true,"origin":"","legend":"","description":"","filename":"SabaBC48HBax63251Chemiluminescence.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/c768007fe342006b803880e2.jpg"},{"id":92958405,"identity":"e7ca0753-2650-4634-9f57-6d12e8ae472c","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2603350,"visible":true,"origin":"","legend":"","description":"","filename":"SabaBCL2BC48H272251Chemiluminescence.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/da6dad6a3670e9388a460c98.jpg"},{"id":92959703,"identity":"cc55419a-3dea-4f15-b6cb-d492ae5d5f14","added_by":"auto","created_at":"2025-10-07 14:39:18","extension":"jpg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1448687,"visible":true,"origin":"","legend":"","description":"","filename":"SabaBetaActinBC242822548H1Chemiluminescence.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/316a92159f3585840065e167.jpg"},{"id":92958422,"identity":"5bde6da3-dcc7-461a-982d-42f8493d6855","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1498873,"visible":true,"origin":"","legend":"","description":"","filename":"WesternBlottingMembraneBlots.docx","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/bb3b7ae33ec01d7d8e8daf8e.docx"},{"id":92958421,"identity":"41967f0a-322a-4d6a-b527-e0af2d52b3b7","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"xml","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":55569,"visible":true,"origin":"","legend":"","description":"","filename":"c7495816d89043b48e808887e9201fdc1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/211c14a78bd288d9b55a5a81.xml"},{"id":92958415,"identity":"79ded933-8781-4d69-9c81-61f13e2d2e71","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2638049,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/c0202f3d5f30aa91c4950d87.jpeg"},{"id":92959706,"identity":"10585ca7-a3da-4b50-ac68-22e83d5ef156","added_by":"auto","created_at":"2025-10-07 14:39:18","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":24001,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/9eb03fce71b2e86792ba8abf.png"},{"id":92958414,"identity":"7e84c08d-3546-4ef7-8874-6350c0ef153e","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":25343,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/58d340ac55f201342ffb194e.png"},{"id":92960233,"identity":"17c3ceb4-a3c3-4380-811f-3cd92aa73b3a","added_by":"auto","created_at":"2025-10-07 14:47:18","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":74814,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/4d6dd0ef3ce8cbdf0f0a708b.png"},{"id":92958407,"identity":"a25b36a0-950f-4114-b60e-fe74939ad524","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"jpeg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":184749,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/0804d6f02090730a9d517d4d.jpeg"},{"id":92958423,"identity":"0d87e181-c652-4962-8146-6263feffb4c5","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":888164,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/d3d8ec97167b4839698a3581.png"},{"id":92959707,"identity":"3079379d-bfcd-4eba-8cb9-2f22ddd78d81","added_by":"auto","created_at":"2025-10-07 14:39:18","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6287,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/4c600ec1dcb9a5edfe7e3748.png"},{"id":92960235,"identity":"289f1d4a-4d64-4c32-bc70-27069b5ebb11","added_by":"auto","created_at":"2025-10-07 14:47:18","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6553,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/1ef50b22be3273abdbd9aa14.png"},{"id":92958420,"identity":"3ead553a-51f1-4fad-a1ae-29c3eab677bf","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16149,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/a3025900c285c2789b74ee56.png"},{"id":92958419,"identity":"5672aa00-e07b-4c23-8f73-6893dcd18806","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":186151,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/d6fd9d275edb5475daf846e8.png"},{"id":92958417,"identity":"68319347-d3b0-4e24-bd5b-cd7f8c4a891b","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"xml","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":54498,"visible":true,"origin":"","legend":"","description":"","filename":"c7495816d89043b48e808887e9201fdc1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/ee93537d16703250da2eab56.xml"},{"id":92959708,"identity":"206deb39-f5cd-48da-9bac-1df3097afeec","added_by":"auto","created_at":"2025-10-07 14:39:18","extension":"html","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":62179,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/0ca7dcd4c916ac866c2cbcfb.html"},{"id":92958392,"identity":"08b752b0-43cb-4d95-9022-3f9b789fb551","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":765073,"visible":true,"origin":"","legend":"\u003cp\u003eFocus Formation Assay was carried out using 0.81uM, 1.62uM, 3.24uM and 6.48uM concentrations of LDC1267 inhibitor of Tyro3 Receptor tyrosine kinase. Clusters of crystal violet-stained foci can be seen in both the cell lines. The staining was carried out after a couple of weeks of incubation at 37\u003csup\u003eo\u003c/sup\u003eC with 5% CO2. Stem cell potential exhibited by formation of foci (aggregates of live cells offering therapy resistance) was markedly reduced upon inhibition of Tyro3 in both cell lines specifically MDA-MB-231. The images are captured at (10X) magnification with inverted microscope. The results from one experiment out of two performed (in triplicates) are shown. \u0026nbsp;\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/01fb722d2a8b6670e683a015.png"},{"id":92959696,"identity":"1068232b-81af-43d0-9870-f51d0bcd5b18","added_by":"auto","created_at":"2025-10-07 14:39:18","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":70613,"visible":true,"origin":"","legend":"\u003cp\u003eSoft-Agar colony formation assay was carried out using 0.81uM, 1.62uM, 3.24uM and 6.48uM concentrations of LDC1267 inhibitor. The decrease in colony number reflects loss of transformation potential of Breast Cancer Cell lines. The colonies were counted on EVOS system at different depths and effect was estimated with respect to the untreated control. The mean +/- SD from one experiment out of three performed are given.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/894cb8c698e57bc478dac95a.png"},{"id":92958397,"identity":"86826e8f-9b4d-4165-864f-785d85b622d3","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":59397,"visible":true,"origin":"","legend":"\u003cp\u003eqPCR was performed using SYBR green and experiment was repeated three times. RNA was isolated after 72hours incubation with Inhibitor at 1.62uM concentration. The cDNA was prepared and qPCR was performed with c-myc and axin-2 primers. (A) Axin-2 expression in MCF-7 Control (Untreated) in comparison to MCF-7 treated with LDC1267,1.62uM. (B) Axin-2 expression in MDA-MB-231 (Untreated) in comparison to MDA-MB-231 treated with LDC1267,1.62uM.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/40f9b738e91b313bb90cbd3b.png"},{"id":92960230,"identity":"7a602f20-995e-4019-96d4-4635609ecb8b","added_by":"auto","created_at":"2025-10-07 14:47:18","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":74126,"visible":true,"origin":"","legend":"\u003cp\u003eWestern blotting was carried out using BCL2 (sc-7382), Bax (sc-7480), Cleaved Caspase 3 (9664S), B-actin (sc-47778) primary antibodies. MCF-7 and MDA-MB-231 were treated with LDC1267 inhibitor concentrations 0.81uM and 1.62uM and proteins were extracted after 48hours of treatment. There was a slight decrease in the expression of BCL2 upon increasing inhibitor concentration to 1.62uM, pro-apoptotic activity was also enhanced. In contrast to MCF-7, MDA-MB-231 undergoes significant apoptosis via intrinsic pathway as evident by expression of cleaved caspase 3. The details given in Spp. File.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/c9573ba809445f644812c9df.png"},{"id":93767813,"identity":"5306da76-6c4f-4481-b801-8eae67624338","added_by":"auto","created_at":"2025-10-17 11:02:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1485852,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/dd771b9b-ca94-4ff5-bdfe-b5fb2dad7074.pdf"},{"id":92958393,"identity":"34fdc820-eee6-4fa4-bcd6-90e4d16e9c94","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"jpg","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":580041,"visible":true,"origin":"","legend":"","description":"","filename":"Saba2025022023h56m44sColorimetric.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/00879f1426a666eabbd6a55d.jpg"},{"id":92958401,"identity":"e8a5cd2d-1fd3-46b7-8bc4-a56eb45ad56d","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1179967,"visible":true,"origin":"","legend":"","description":"","filename":"Saba2025022023h54m59sChemiluminescenceCCL3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/56be4cc4f95fd0f9a41e191b.jpg"},{"id":92959698,"identity":"2465fcfd-3f3e-4afc-901d-43b0f4caba06","added_by":"auto","created_at":"2025-10-07 14:39:18","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1448687,"visible":true,"origin":"","legend":"","description":"","filename":"SabaBetaActinBC242822548H1Chemiluminescence.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/309823209858ec4cc85b5fd9.jpg"},{"id":92960232,"identity":"a04a0d02-d319-468f-90b1-adc3101fce6e","added_by":"auto","created_at":"2025-10-07 14:47:18","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1900006,"visible":true,"origin":"","legend":"","description":"","filename":"SabaBC48HBax63251Chemiluminescence.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/b663777423ce6f4b7d274e0a.jpg"},{"id":92958409,"identity":"71e5160b-ab69-4439-9e8f-9725db2310e7","added_by":"auto","created_at":"2025-10-07 14:31:18","extension":"jpg","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":2603350,"visible":true,"origin":"","legend":"","description":"","filename":"SabaBCL2BC48H272251Chemiluminescence.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/fd5c8567ed3d80947059c252.jpg"},{"id":92959705,"identity":"40918570-7473-46d7-8e90-7d6307e05556","added_by":"auto","created_at":"2025-10-07 14:39:18","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":1498873,"visible":true,"origin":"","legend":"","description":"","filename":"WesternBlottingMembraneBlots.docx","url":"https://assets-eu.researchsquare.com/files/rs-7385510/v1/ca6a82188f4cd82475174d69.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eTam Kinase Receptor Inhibition-A Possible Therapeutic Intervention to Prevent Breast Cancer Recurrence After Therapy\u003c/p\u003e","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eBreast cancer is the second most prevalent cancer among women across the globe. It appears in various forms with triple negative subtypes being the most aggressive and resistant to therapy in comparison to Luminal subtype of breast cancer which responds to therapy and has delayed relapse [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Currently many therapeutic interventions have been introduced for treatment such as targeting hormone receptors e.g. (FDA approved tamoxifen and aromatase inhibitors) yet the hormone negative types still pose a major challenge for scientists [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], even the approved drugs have side effects which restrict their usefulness [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Despite the vast majority of treatment strategies, relapse remains the main obstacle. Breast carcinogenesis has been linked to stem cells having enormous regenerative potential. Based on the TNM (Tumor, Node and Metastasis) classification breast cancer grading is carried out which facilitates in clinical proceedings however molecular subtyping helps in devising more targeted therapies[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. When the tumor undergoes trauma, it sheds tumor cells which enter blood vessels (intravasation) and establish colonies after extravasation in immune sensitive sites. The tumor cells establish a microenvironment where stem cells remain dormant till the immune surveillance is altered. Breast cancer stem cells (BCSCs) are derived from the breast tumor. These cells colonize other body organs offering therapeutic resistance[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The presence of surface markers CD44+/CD24-/low or ALDH\u0026thinsp;+\u0026thinsp;after therapy indicates poor prognosis[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Stem cells have phenotypic plasticity which drives epithelial to mesenchymal transition (EMT) via WNT/β Catenin pathway. Phenotypic plasticity is actually switching of E-Cadherin by N-Cadherin and vimentin which leads to loss of cell polarity thereby altering normal tissue organization[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Relapse after chemotherapy occurs because chemotherapy targets rapidly dividing cells in the S and M phases of cell cycle which undergo apoptosis, while the tissue cells in resting phase i.e., G0 undergo DNA damage which offers severe resistance to the same therapy afterwards [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Alternative medication is available for hormonal subtypes of BC but TNBC prevalent in women under 40yrs of age offers resistance. Canonical Wnt signaling is a hallmark of various cancers particularly breast cancer. The WNT pathway has been reported to interact with PI3K/Akt and MAPK pathways thereby regulating the expression of TYRO3 kinase receptor which is targeted in our study and effects of its inhibition have been linked to cancer stem cells the main cause of relapse. Two advance strategies previously used for leukemic studies were used for the measurement of stem cell repopulation potential after tyrosine kinase inhibition. The LDC1267 inhibitor serves as a pan kinase inhibitor yet is more specific for tyro3 kinase receptor. The tyrosine kinase receptors comprise of a family of more than 50 receptors divided into 20 subfamilies [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]with AXL, MerTK and TYRO3 comprising TAM family of Receptor Tyrosine kinases[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Besides being important for normal physiological processes, TAM Kinase Receptors tend to play unique roles in various malignancies including hormone positive and triple negative breast cancer exhibiting cell line models [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The role of Tyro3 has been highlighted in both triple negative and hormone positive breast cancer cell line models MDA-MB-231 and MCF-7. The aim of the current study was to link Tyro3 inhibition with its potential effect on downstream targets such as axin-2, c-myc, BCl2 and Bax to further elucidate its role in various signaling pathways. As already researched, siRNA against Tyro3 effectively reduces proliferation potential in luminal breast cancer cell line MCF-7 having no substantial effect on triple negative MDA-MB-231 cell line. In our study the transformation potential of Luminal and triple negative breast cancer cell lines MCF-7 and MDA-MB-231 was determined by soft-agar colony formation assay and Focus formation assay with Tyro3 inhibitor LDC1267.\u003c/p\u003e"},{"header":"MATERIALS/METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eCell Lines and Inhibitor\u003c/h2\u003e\u003cp\u003eMCF-7 and MDA-MB-231 cell lines were grown in low glucose DMEM medium with 10% FBS, 1% penstrep and 1% L-glutamin. The Tyro3 Inhibitor LDC1267 was purchased from Selleck chemicals\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eTransformation Assay\u003c/h3\u003e\n\u003cp\u003eSoft agar colony formation assay was carried out by adding the inhibitor (1ml) to 1% bacto-agar (1ml) which gave 0.5% agar in bottom layer and 5000 cells/well were plated such that 5000 cells were in 750ul media to which 250ul (1%) agar was added which gave 0.25% agar in top layer in six well plates. The plates were incubated at 37oC and 5% CO2 for 15 days, after which colonies were counted on EVOS system.\u003c/p\u003e\n\u003ch3\u003eFocus Formation Assay\u003c/h3\u003e\n\u003cp\u003eThe focus formation assay was carried out by plating 40,000 cells /well in 24 well plate and incubated (for around 72 hours) until they reach confluence then inhibitor was added and plates were incubated at 37oC and 5% CO2 for 15 days after which media was aspirated and wells were washed twice with ice cold PBS (1X). The plates were kept on ice and cells were fixed with ice-cold Methanol for 10 minutes. The plates were removed from ice, methanol was aspirated and 1ml of 0.5% crystal violet solution made in 25% methanol was added to each well. The plates were incubated for 5 minutes at RT (Room Temperature). Crystal violet solution was aspirated and wells were washed with DI water until no color came off the rinse. The plates were allowed to dry on a benchtop overnight and foci were imaged the next day.\u003c/p\u003e\n\u003ch3\u003eWestern Blotting\u003c/h3\u003e\n\u003cp\u003eWestern Blotting was carried out according to widely established protocols. 12% resolving and 4% stacking gel was prepared for proteins smaller than 50KDa and 10% resolving with 7% stacking for proteins smaller than 120kDa were prepared. Proteins were denatured in lammelli buffer after 24-hour treatment with inhibitor and were loaded and subsequently transferred to blotting membrane which was immersed in 5% blocking solution (non-fat dry milk dissolved in TBS with 0.1% Tween 20) for 1 hour. The antibodies used include BCL2 (sc-7382), Bax (sc-7480), Cleaved Caspase 3 (9664S) and B-actin(sc-47778).\u003c/p\u003e\n\u003ch3\u003eReal Time PCR\u003c/h3\u003e\n\u003cp\u003eReal Time PCR was carried out with the following primers for axin-2, c-myc and Gapdh, (5\u0026rsquo;-3\u0026rsquo;) c-Myc (F) \u0026lsquo;GAAAAGGCCCCCAAGGTAGT\u0026rsquo;, c-Myc (R) \u0026lsquo;AGTTTGTGTTTCAACTGTTC\u0026rsquo;, Axin-2 (F) \u0026lsquo;CTATGTCTTTGCACCAGCCA\u0026rsquo;, Axin-2 (R) \u0026lsquo;TAGAGACACTTGGCCATTGG\u0026rsquo;, GAPDH (F) \u0026lsquo;CATCACCATCTTCCAGGAG\u0026rsquo; and GAPDH (R)\u0026rsquo; GATGATGACCCTTTTGGC\u0026rsquo;.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eStatistical analysis was performed on Graph-pad Prism 8 and a p value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered to be statistically significant. The experiments were repeated twice to ensure the significance of results obtained.\u003c/p\u003e\u003c/div\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cstrong\u003eTyro3 Inhibition has significant effect on transformation potential of MCF-7 and MDA-MB-231\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTransformation potential reflects the ability of a cell to divide uncontrollably forming anchorage independent colonies. The LDC1267 inhibitor reduces colony formation potential of both the cell lines with increasing concentrations as depicted in Fig.1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTyro3\u003c/strong\u003e \u003cstrong\u003eInhibition has profound effects on single cell colony formation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cstrong\u003ec-Myc and Axin-2 appear to be potential downstream targets mediating oncogenesis in Breast Cancer\u003c/strong\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cstrong\u003e\u003cstrong\u003eTranscriptional Analysis of Intrinsic Apoptotic Pathway after treatment with LDC1267 Inhibitor\u0026nbsp;\u003c/strong\u003e\u003c/strong\u003e\u003c/strong\u003e\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eTransformation assay and focus formation assay depict the stem like behavior of cancer cells and their ability to induce tumors. These assays are a better alternative to animal studies for analysis of tumorigenesis [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Intrinsic apoptotic pathway seems to interact with Canonical WNT signaling to restrict stemness of Breast cancer cells as is evident in both luminal A subtype representative MCF-7 and TNBC subtype representative MDA-MB-231 upon treatment with Tyro3 inhibitor LDC1267 respectively Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Tyro3 is a tyrosine kinase receptor which is actively expressed in Breast cancer cells. It is a well-established fact that cancer cells have unlimited replicative potential that is severely affected upon tyrosine kinase inhibition supported by Western Blot results Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e. The inhibition of receptor tyrosine kinases halts the proliferation and induces apoptosis via intrinsic apoptotic pathway. The marked reduction in colony numbers and foci formation reflects that continuous treatment with kinase inhibitors along with standard therapies for cancer can help prevent relapse Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u0026amp;2. The results of the study support the hypothesis that apoptosis can be induced in dividing cells while the self-renewal potential of BCSCs also seems to be restricted to a greater extent Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e \u0026amp; 2.\u003c/p\u003e\u003cp\u003eThe colony formation assay and focus formation assay reveal the inability of cancer cells including cancer stem cells to withstand growth and proliferation inhibition by LDC1267 Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. PI3K/Akt and RAS/MapK pathways are constitutively active in breast cancer[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. LDC 1267 serves as a pan kinase inhibitor although known for targeting tyro3 receptor. Estrogen receptor activates tyro3 by activating STAT3 which in turn activates MAPK and PI3K/Akt pathways[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], tyro3 activation controls STAT3 in a feedback manner so when tyro3 is inhibited estrogen receptor still has the potential to activate MAPK pathway which cross links with Canonical Wnt pathway thereby activating c-myc and axin-2. The downregulation of c-myc and axin-2 in ER- TNBC supports the aforementioned description Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003e. All the signaling pathways have one thing in common i.e., feedback loop. Although cancer cells have limitless replication potential yet there is a slight ongoing apoptosis due to feedback mechanisms operational to some extent.\u003c/p\u003e\u003cp\u003eApoptosis has been reported to be involved in epithelial development and differentiation, dysregulation of which contributes to breast cancer pathogenesis[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The consistent BCl2 expression in normal and tumor breast tissue were found to be linked to decreased Bax expression in tumor versus normal tissue. The proto-oncogene i.e., BCl2 expression has been found to be profound in lobular than in ductal breast carcinoma. Our findings correlate with the previous findings on bax and bcl2 expression in breast cancer reflecting low bax expression in breast cancer corresponding to normal breast tissue Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e. It has been validated through research that the breast cancer derived cell lines not expressing or having low expression of bax are resistant to apoptosis[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Therefore, in our study we treated the breast cancer cell lines MCF-7 and MDA-MB-231 with tyro3 inhibitor and checked for its effect on bax and bcl2 proteins and the results validated on translational level that Bax is less expressed in both the cancer cell lines and that the expression is enhanced upon treatment with LDC1267 inhibitor reflecting the role of tyro3 inhibitor towards apoptosis induction Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e. Wnt signaling is activated upon Wnt ligand binding to receptors which then stabilize β catenin thus activating downstream target genes, dysregulation of Wnt signalling has been reported in many cancers including breast cancer[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Β-catenin the important player of this pathway is a transcriptional regulator which regulates migration, apoptosis, morphogenesis, cell proliferation and differentiation[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Axin-2 is a negative regulator of B catenin owing to its role in B catenin degradation complex, however genetic alterations in axin-2 block its regulatory effect on B catenin and downstream activation of Wnt target genes in different cancers[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Axin-2 overexpression induces the expression of Snail1 which plays an important role in EMT in breast cancer. In addition to axin-2, snail 1 is also overexpressed in many cancers[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Axin-2 inhibition attenuates the invasiveness of Triple negative breast cancer cell line MDA-MB-231[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. TP53 protein is a negative regulator of both Axin-2 and c-Myc thereby promoting apoptosis by upregulating bax and downregulating bcl2[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Hence, we can say that the tyro3 inhibitor upregulates the TP53 expression which downregulates c-myc and Axin-2 and upregulates Bax as evident in the current study. Upregulation of c-Myc inactivates p53 thus promoting cell survival and proliferation in cancer[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Recent studies indicate a potential link between aberrant overactivation of Wnt signaling and drug resistance in Cloangiocarcinoma. In comparison to MCF-7, MDA-MB-231 has elevated levels of mutant p53[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] which is validated to be stabilized by phospholipase D[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Tyro3 has oncogenic potential as it transforms rat-2 fibroblasts which grow in soft agar following transfection with tyro3 gene[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] and overexpression of tyro3 in rat fibroblasts develops tumors in nude mice. Tyro3 overexpression renders ligand independent activation [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Therefore, our study aimed at targeting Tyro3 with LDC1267 inhibitor and check for its anti-transformative potential and the results correlated with its inhibitory effects on metastasis and transformation potential. A study has shown that targeting Tyro3 with LDC1267 enables natural killer cells to target tumor cells in vivo[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Most of the cancer cells upon exposure to stressful conditions such as starvation die out i.e.., they neither form colonies nor foci but the transformed cells, remain active and form colonies i.e., single cell detaches from rest of cells and forms colonies and foci i.e., cells with transformation potential detach from confluent cells creating a tumor microenvironment and survive as evident by crystal violet staining in untreated control cells while in treated cells the colony number and foci formation decreased significantly.\u003c/p\u003e"},{"header":"CONCLUSION","content":"\u003cp\u003eThis study strengthens the notion that inhibition of Tyro3 receptor can help prevent recurrence along with chemotherapy as well as can halt the development of cancer when diagnosed at early stages owing to its effect on cancer cell transformation potential.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eBC\u003cstrong\u003e:\u0026nbsp;\u003c/strong\u003eBreast Cancer\u003c/p\u003e\n\u003cp\u003eBCSCs: Breast Cancer Stem Cells\u003c/p\u003e\n\u003cp\u003eTNBC: Triple Negative Breast Cancer\u003c/p\u003e\n\u003cp\u003eTyro3: Tyrosine Kinase Receptor\u003c/p\u003e\n\u003cp\u003eTAM Receptors: Tyro3, Axl, Mertk kinase receptors\u003c/p\u003e\n\u003cp\u003eWB: Western Blotting\u003c/p\u003e\n\u003cp\u003eBax: BCL2 associated X protein\u003c/p\u003e\n\u003cp\u003eBCl2: B Cell Lymphoma 2 protein\u003c/p\u003e\n\u003cp\u003eCCL3: Cleaved Caspase 3\u003c/p\u003e\n\u003cp\u003eΒ-actin: Beta actin protein (loading control)\u003c/p\u003e\n\u003cp\u003eμM: micromole\u003c/p\u003e\n\u003cp\u003eMCF-7: Michigan Cancer Foundation 7\u003c/p\u003e\n\u003cp\u003eMDA-MB-231: M (Metastatic), D (Anderson), A (Breast) - MB (Metastatic Breast) 231\u003c/p\u003e\n\u003cp\u003eRAS/MAPK: Ras/Mitogen-activated Protein Kinase\u003c/p\u003e\n\u003cp\u003eSTAT3: Signal Transducer and Activator of Transcription 3\u003c/p\u003e\n\u003cp\u003ec-Myc: cellular myelocytomatosis oncogene\u003c/p\u003e\n\u003cp\u003eAxin-2: Axis inhibition protein 2\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical Approval and Consent to participate:\u0026nbsp;\u003c/strong\u003eApproved\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for Publication:\u0026nbsp;\u003c/strong\u003eAffirmative\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of Data and Materials:\u0026nbsp;\u003c/strong\u003eN/A\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests:\u003c/strong\u003e None\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e NUST\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u0026nbsp;\u003c/strong\u003eStudy Design, planning and execution: Saba Naseem\u003c/p\u003e\n\u003cp\u003eWorkplace availability and writing: Afsar Ali Mian\u003c/p\u003e\n\u003cp\u003eExperimental support: Fawad Ur Rehman\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eACKNOWLEDGEMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe acknowledge the support of Dr. Dilawar Khan, Miss Shariqa Khwaja, Dr. Rida-e- Maria Qazi and Miss Reena Zaman in the execution of this project work.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eCarey LA, et al. Race, breast cancer subtypes, and survival in the Carolina Breast Cancer Study. JAMA. 2006;295(21):2492\u0026ndash;502.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGroup EBCTC. Aromatase inhibitors versus tamoxifen in early breast cancer: patient-level meta-analysis of the randomised trials. Lancet. 2015;386(10001):1341\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ede Cremoux P, et al. Tamoxifen and aromatase inhibitors in the treatment of breast cancer in menopausal women: pharmacological and clinical aspects. Bull Cancer. 2004;91(12):917\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZepeda-Castilla EJ, et al. Molecular classification of breast cancer. Cir Cir. 2008;76(1):87\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eReymond N, d'\u0026Aacute;gua BB, Ridley AJ. Crossing the endothelial barrier during metastasis. Nat Rev Cancer. 2013;13(12):858\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAl-Hajj M et al. \u003cem\u003eProspective identification of tumorigenic breast cancer cells.\u003c/em\u003e Proceedings of the National Academy of Sciences, 2003. 100(7): pp. 3983\u0026ndash;3988.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYamashita N, et al. Epithelial paradox: clinical significance of coexpression of E-cadherin and vimentin with regard to invasion and metastasis of breast cancer. Clin Breast Cancer. 2018;18(5):e1003\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDittmer A, Dittmer J. Long-term exposure to carcinoma-associated fibroblasts makes breast cancer cells addictive to integrin β1. Oncotarget. 2018;9(31):22079.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCramer KS, Miko IJ. \u003cem\u003eEph-ephrin signaling in nervous system development.\u003c/em\u003e F1000Research, 2016. 5.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003evan der Meer JH, van der Poll T. van \u0026lsquo;t Veer, \u003cem\u003eTAM receptors, Gas6, and protein S: roles in inflammation and hemostasis.\u003c/em\u003e Blood. J Am Soc Hematol. 2014;123(16):2460\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEkyalongo RC, et al. TYRO3 as a potential therapeutic target in breast cancer. Anticancer Res. 2014;34(7):3337\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFu X, Osborne CK, Schiff R. Biology and therapeutic potential of PI3K signaling in ER+/HER2-negative breast cancer. Breast. 2013;22:S12\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRenoir J-M, Marsaud V, Lazennec G. \u003cem\u003eEstrogen receptor signaling as a target for novel breast cancer therapeutics.: new targets in estradiol receptor-positive breast cancers.\u003c/em\u003e 2013.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eL\u0026uuml; C-Y, Chen X-Y. \u003cem\u003eProgress of research on apoptosis of breast cancer cells.\u003c/em\u003e Zhong xi yi jie he xue bao\u0026thinsp;=\u0026thinsp;Journal. Chin Integr Med. 2003;1(3):226\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKrajewski S, et al. Reduced expression of proapoptotic gene BAX is associated with poor response rates to combination chemotherapy and shorter survival in women with metastatic breast adenocarcinoma. Cancer Res. 1995;55(19):4471\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu X, et al. Wnt signaling in breast cancer: biological mechanisms, challenges and opportunities. Mol Cancer. 2020;19(1):165.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJho E-h, et al. Wnt/β-catenin/Tcf signaling induces the transcription of Axin2, a negative regulator of the signaling pathway. Mol Cell Biol. 2002;22(4):1172\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu Z-Q et al. \u003cem\u003eCanonical Wnt suppressor, Axin2, promotes colon carcinoma oncogenic activity.\u003c/em\u003e Proceedings of the National Academy of Sciences, 2012. 109(28): pp. 11312\u0026ndash;11317.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAhn SY, Jo CH. \u003cem\u003eImplications of Axis Inhibition Protein 2 in Breast Cancer Progression.\u003c/em\u003e in vivo, 2023. 37(2): pp. 634\u0026ndash;643.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSantoro A, et al. 53 loss in breast cancer leads to Myc activation, increased cell plasticity, and expression of a mitotic signature with prognostic value. Cell Rep. 2019;26(3):624\u0026ndash;38. e8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMalki A, E.A. EL SAYED. In vitro and in vivo efficacy of a novel quinuclidinone derivative against breast cancer. Anticancer Res. 2014;34(3):1367\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Breast Cancer, Stem Cell Transformation Potential, Relapse, Tumor microenvironment","lastPublishedDoi":"10.21203/rs.3.rs-7385510/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7385510/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBreast Cancer appears in various forms afflicting an increasing number of women around the globe. Therapeutic resistance in Breast Cancer has been associated with overexpression of Tyro3 Kinase Receptor. Inhibition of Tyro3 with LDC1267 is reported to control metastasis in breast cancer. The aim of the study was to investigate the apoptotic effect of Tyro3 inhibition relative to WNT signaling responsible for transforming MCF-7 and MDA-MB-231 cells. Soft agar colony formation assay and focus formation assay were carried out with 2× (0.81uM, 1.62uM, 3.24uM and 6.48uM) concentrations added to 1% bacto-agar 50% v/v in the bottom layer and 5000 cells with media containing 0.5% agar (50% v/v) in the top layer in triplicates in six well plates incubated on 37\u003csup\u003eo\u003c/sup\u003eC and in 5% CO\u003csub\u003e2\u003c/sub\u003e for 15 days for forming colonies in soft agar. For Focus formation assay 40,000 cells /well were plated in 24 well plates in triplicates and incubated (for around 72 hours) until they reach confluence then inhibitor was added and plates were incubated at 37\u003csup\u003eo\u003c/sup\u003eC and 5% CO\u003csub\u003e2\u003c/sub\u003e for 15 days after which crystal violet staining was undertaken. The expression analysis of WNT signaling mediators c-Myc and Axin-2 was carried out via RT-PCR using the following primer sequences (5’-3’) c-Myc (F) ‘GAAAAGGCCCCCAAGGTAGT’, c-Myc (R) ‘AGTTTGTGTTTCAACTGTTC’, Axin-2 (F) ‘CTATGTCTTTGCACCAGCCA’, Axin-2 (R) ‘TAGAGACACTTGGCCATTGG’, GAPDH (F) ‘CATCACCATCTTCCAGGAG’ and GAPDH (R)’ GATGATGACCCTTTTGGC’. Decreased foci and colony number indicated anti-transformation effects of Tyro3 inhibition. Western Blot analysis with cleaved caspase 3, Bax and BCl2 antibodies confirmed cell death by intrinsic apoptotic pathway.\u0026nbsp; Elevated c-Myc and Axin-2 in MCF-7 and decreased expression of both in MDA-MB-231 indicated WNT pathway involvement, preferably feedback loop occurring in MCF-7 and aberrant gene suppression in MDA-MB-231 thereby halting its aggressiveness. This study proves that Tyro3 inhibition has significant inhibitory effects on transforming cells via WNT pathway.\u003c/p\u003e","manuscriptTitle":"Tam Kinase Receptor Inhibition-A Possible Therapeutic Intervention to Prevent Breast Cancer Recurrence After Therapy","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-07 14:31:13","doi":"10.21203/rs.3.rs-7385510/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"af4c43e5-c135-485e-83f6-391fa90e1be1","owner":[],"postedDate":"October 7th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-17T10:54:03+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-07 14:31:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7385510","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7385510","identity":"rs-7385510","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}