Immunogenicity of a duckweed-expressed multivariant circumsporozoite antigen administered orally to BALB/c mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Immunogenicity of a duckweed-expressed multivariant circumsporozoite antigen administered orally to BALB/c mice Nima Rad, Sedigheh Zakeri, Akram Abouie Mehrizi, Sadegh Shojaei Baghini, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8775151/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Malaria remains a significant global health challenge, with hundreds of millions of cases reported annually and limited access to effective and affordable vaccines. Owing to their scalability, safety, and potential for oral administration, plant-based vaccine platforms have emerged as promising alternatives. In this study, we evaluated the immunogenicity of a chimeric circumsporozoite protein (CS712) derived from Plasmodium vivax , expressed in transgenic Lemna minor , as a candidate oral malaria vaccine. Methods The CS712 gene was subsequently cloned and inserted into a plant expression vector and successfully introduced into duckweed via Agrobacterium -mediated transformation. The transgenic lines were verified via PCR, and target protein expression was confirmed via Western blot analysis; the protein reached concentrations of 0.4% of the total soluble protein. BALB/c mice were immunized via three different routes: oral administration, subcutaneous injection, and a prime–boost combination. Immune responses were analyzed by quantifying total IgG, IgA, and IgG subclasses (IgG1, IgG2a, IgG2b, and IgG3) and cytokine levels (IL-5 and IFN-γ). Splenocyte proliferation was also assessed via flow cytometry. Results Both the oral and prime-boost immunization strategies elicited robust humoral and mucosal immune responses, as evidenced by significant increases in serum IgG and IgA as well as fecal IgA. Analysis of the IgG subclass distribution and cytokine profiles revealed the activation of both Th1- and Th2-type immune pathways. Conclusions These findings support the feasibility of using transgenic duckweed as a plant-based bioreactor for oral vaccine candidate production. The capacity of CS712-expressing duckweed to induce both mucosal and systemic immunity underscores its potential as a cost-effective and scalable platform for developing oral malaria vaccines targeting P. vivax . Lemna minor malaria vaccine candidate CS712 oral immunization plant-based expression mucosal immunity IgG subclasses cytokines Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Malaria is an ancient and one of the most important parasitic diseases and significant health issues in tropical and subtropical countries worldwide ( 1 ). Malaria is a lethal disease that is accompanied by severe complications and causes profound disability in individuals. In 2023, approximately 263 million clinical cases and 597,000 deaths were reported due to this disease ( 2 ). Malaria leads to several symptoms, including fever, fatigue, vomiting, and headache, and in severe cases, it can result in skin yellowing, seizures, and coma, ultimately leading to death ( 3 ). The causative agent of malaria is a parasitic organism belonging to the Plasmodium genus. Plasmodium falciparum was first identified by Charles Louis Alphonse Laveran in the nineteenth century. During the 20th century, numerous other species were discovered and categorized in various hosts. Among them, five species, P. vivax, P. falciparum, P. malariae, P. ovale , and P. knowlesi , are involved in human infection ( 4 ). The distribution of malaria remains concentrated in specific regions, with 94% of cases occurring in the African region. Countries such as Nigeria, the Democratic Republic of the Congo, and Uganda bear the highest burden ( 5 ). Moreover, significant reductions in malaria incidence have been reported in regions such as Southeast Asia and the Americas. However, imported cases of malaria into nonendemic regions pose a new public health challenge, emphasizing the need for continued vigilance and intervention efforts ( 6 ). Despite progress in malaria control through measures such as insecticide-treated nets, indoor residual spraying (IRS), and immediate treatment with effective antimalarial drugs, progress has stagnated in recent years and even reversed in some areas ( 7 ). The emergence of resistance to insecticides and partial resistance to artemisinin has further complicated the challenges, while declining funding for malaria control, falling below the estimated $ 5.6 billion needed annually, has affected the effectiveness of existing measures ( 8 ). Consequently, having an effective vaccine, alongside other control strategies such as vector management and disease case management, remains a priority for the World Health Organization, as it could significantly reduce mortality rates ( 9 ). The development of an effective vaccine for malaria has been challenging because of the parasite's complex biology, diverse genomes, and immune evasion strategies ( 10 ). Preerythrocytic vaccines prevent infection, blood-stage vaccines reduce disease severity, and sexual-stage or vector-targeting vaccines limit parasite transmission. These approaches underscore the importance of a comprehensive strategy for malaria control ( 11 ). In recent years, there has been increased focus on developing transmission-blocking vaccines aimed at preventing the spread of malaria, with the recognition that vaccination is an efficient and cost-effective method for disease control ( 12 ). These vaccines often involve live attenuated organisms or subunit proteins, which are typical in human medicine ( 13 ). Recombinant proteins are often favored as biotechnological vaccines because of their ease of production in different expression systems, availability as highly purified products, ease of manipulation, and ability to stimulate both humoral and cellular immunity ( 14 ). In low-income countries, where malaria prevalence is highest, economic and infrastructural problems hinder access to effective vaccines. High production costs, the need for refrigerated transportation, and limited healthcare infrastructure are significant barriers to vaccine distribution, particularly in rural and malaria-endemic regions. The development of low-cost vaccines with easy distribution options, especially in remote areas, could significantly reduce the burden of disease ( 15 ). After years of research, RTS,S/AS01 remains the only vaccine approved by the European Medicines Agency (EMA) in 2015 with moderate efficacy ( 16 ). In addition, the R21/Matrix-M® vaccine has been reported to have a relatively high efficacy of 75%, indicating promising advantages. Further clinical trials and long-term studies are needed to confirm its durability and potential for broader application ( 17 ). However, there is currently no licensed vaccine against P. vivax , one of the main parasites that causes malaria outside Africa. A vaccine targeting this species could prevent sporozoites from infecting liver cells, prevent development to the blood stage, and stimulate lasting immunity ( 18 ). The circumsporozoite protein (CSP), which is abundant on the surface of sporozoites, is a prime candidate for vaccine development, with its variants VK210 and VK247 showing the greatest potential ( 19 ). In this context, oral vaccines have emerged as promising alternatives because of their ease of administration, potential for large-scale production, and reduced need for complex infrastructure compared with injectable vaccines. Recombinant proteins in oral vaccines can stimulate cellular and humoral immune responses, offering a robust defense ( 20 , 21 ). Plant systems are increasingly recognized for their ability to produce subunit vaccines, as they enable the expression of target antigens within plant tissues. Selecting an optimal plant species is crucial for maximizing antigen yield and stability, underscoring the importance of careful plant selection for effective production( 22 ). Over the past 30 years, plants have been used in molecular farming to create valuable biopharmaceuticals, including vaccines, antibodies, and antiviral peptides. Compared with traditional methods, plant-based production systems offer unique advantages, including lower production costs, scalability, and enhanced safety profiles. Additionally, plant systems allow for the generation of proteins with glycan structures that are either innately compatible with the human immune system or can be engineered to mimic human glycosylation patterns through glycan modification techniques ( 23 , 24 ). Recent developments in plant-based vaccines have shown promise across multiple diseases, including hepatitis C, influenza, and malaria. For example, plant-derived vaccines for hepatitis C and influenza have successfully induced strong immune responses in tobacco and canola ( 25 – 27 ). For malaria, various antigens, such as P. falciparum pfs25 VLPs and MSP1 19, have been produced in Nicotiana benthamiana , demonstrating safety and immunogenicity in early trials ( 28 ). These innovations highlight the potential of plant-based systems to address global health challenges efficiently, providing a scalable and cost-effective approach in vaccine production ( 29 ). Among various expression systems, duckweed is a valuable bioreactor capable of rapid growth and high protein content, making it suitable for producing recombinant proteins for vaccine development. Studies have demonstrated the potential of duckweed to express various proteins, including protective antigens and enzymes, which could be applied in oral vaccine formulations ( 30 ). Duckweed, the smallest and fastest-growing angiosperm, has proven to be a promising platform for producing recombinant proteins, making it a valuable tool in molecular agriculture ( 31 ). Its small size, rapid clonal expansion through asexual propagation, and high biomass production under optimized conditions make it an ideal candidate for the production of biopharmaceuticals ( 32 ). The remarkable adaptability of the plant and its ability to grow in a controlled environment reduce the risk of genetically modified organisms (GMOs) escaping into natural ecosystems, increasing its attractiveness for biotechnological applications ( 33 ). In addition, rapid biomass doubling, which usually takes less than two days, and high protein accumulation potential make duckweed an efficient and scalable system for the production of a variety of therapeutic proteins ( 34 ). These characteristics not only contribute to its sustainability but also solidify its role as an effective plant-based platform for large-scale biopharmaceutical production and offer a promising solution for the advancement of molecular agriculture ( 30 ). Advances in genetic transformation and regeneration techniques have enabled efficient recombinant protein expression in duckweed, making it a versatile and cost-effective biological reactor ( 35 ). This plant platform is particularly advantageous for the production of high-value proteins such as monoclonal antibodies, vaccines, and cytokines. For example, several Lemna species, including Lemna minor, have been successfully modified to express antigens for vaccines, such as porcine epidemic diarrhea virus (PEDV) and influenza, demonstrating their potential for oral immunization applications ( 36 ). In addition, duckweed has shown promise for the production of adjuvants for mucosal vaccines, such as chicken interleukin-17B, expanding its use in immunological therapies ( 31 ). To create a recombinant chimeric antigen capable of mimicking natural immune responses, two synthetic constructs (CS127 and CS712) were designed on the basis of P. vivax CSP variants VK210 and VK247. Among them, CS712 demonstrated superior expression and biological activity in animal models, making it a stronger candidate for P. vivax vaccine development ( 37 ). On the basis of these findings, the CS712 construct was selected, and its nucleotide sequence was specifically codon optimized for enhanced expression in the L. minor system, as detailed in our previous bioinformatic analysis ( 38 ). This optimized construct was then transferred into duckweed, and its immunogenicity was investigated. The bioinformatic analyses, including RNA stability, physicochemical property determination, and epitope prediction, were described in detail in a separate study ( 38 ). Building upon this foundational work, the current study investigated the in planta expression, purification, and subsequent molecular, proteomic, and murine immunogenicity evaluation of this codon-optimized CS712 protein produced in L. minor , further demonstrating the potential of this system for low-cost and scalable malaria vaccine production. Materials and methods 2.1. Construction of the expression vector and introduction to Agrobacterium tumefaciens The CS712 gene, optimized for plant codons, was synthesized by Shingene Biotechnology (China). The sequence of this synthetic construct is available in GenBank under accession number KY548404 ( 37 ). This gene was then cloned into the binary vector pBI121 via the restriction enzymes SacI and BamHI . The recombinant vector pBI121-CS712 was confirmed by restriction digestion and PCR analysis (using M13 primers). Once cloning was confirmed, the pBI121-CS712 plasmid was introduced into A. tumefaciens strain EHA105 via the standard freeze‒thaw method ( 39 ). To verify the successful transformation of Agrobacterium, colonies were selected on LB agar plates supplemented with kanamycin and rifampicin. The presence of the plasmid in the bacterial cells was confirmed via PCR analysis. 2.2. Genetic transformation and regeneration of L. minor The plant material of L. minor was obtained from the duckweed collection of the National Institute for Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran ( 32 ). To induce callus formation, the meristematic region of the fronds was excised, and the explants were cultured on suitable media under dark conditions as described by Taghipour et al. ( 40 ). The induced calli were cultured with A. tumefaciens strain EHA105 containing the binary vector pBI121-PvCS712 for genetic transformation. The bacteria were cultured in LB media supplemented with appropriate antibiotics, and transformation was performed according to the protocol of Liu et al., with slight modifications. ( 41 , 42 ), with slight modifications. After cocultivation, the calli are transferred to regeneration media to promote shoot development and plant regeneration ( 40 ). 2.3. Molecular analysis of the transgenic plants Genomic DNA was extracted from transgenic and nontransgenic duckweed via the CTAB method (Porebski et al., 1997). The quality and quantity of the DNA were assessed via electrophoresis on a 1% agarose gel and spectrophotometry at 260/280 nm. To confirm the presence of the transgene in the transformed plants, PCR analysis was performed using specific primers: forward, 5'CTATCCTTCGCAAGACCCTTCCTC3', and reverse, 5'CCATCTGCTCTATCCGCG3'. The PCRs were performed according to standard protocols. 2.4. Protein extraction and western blotting analysis Transgenic L. minor tissue (0.5–1 g) was ground in 1.5 mL of extraction buffer containing 50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1% SDS, 30 mM β-mercaptoethanol, 1 mM PMSF, and 10% glycerol. The homogenate was kept on ice and gently mixed for 30 minutes. Following centrifugation at 15,000 rpm for 20 minutes at 4°C, the supernatant was collected for protein analysis. Proteins were separated via 12% SDS‒PAGE. To evaluate the integrity and immunoreactivity of the recombinant CS712 protein, Western blotting was performed using anti-chimeric CS712 mouse antibodies (1:1000 dilution) ( 37 ) and human sera from Plasmodium vivax -infected individuals (1:500 dilution) provided by the Malaria and Vector Research Group, Pasteur Institute of Iran. 2.5. Analyzing the recombinant CS712 protein in plants via ELISA Regenerated L. minor fronds were ground in liquid nitrogen and extracted with 1.5 mL of protein extraction buffer. The total soluble protein content was determined via centrifugation (5 min, 16,000×g) via the Bradford method( 43 ). To quantify the CS712 concentration in transgenic Leishmania plants, immunized mouse serum was subjected to a quantitative ELISA ( 37 ). A standard curve was established using defined concentrations of purified CS712 protein, which was expressed and purified from a bacterial system (Malaria and Vector Research Group, Pasteur Institute of Iran). The amount of CS712 protein in the total plant extract was then estimated on the basis of this curve. 2.6. Immunization in an animal model Five-week-old female BALB/c mice (Pasteur Institute of Iran, Karaj, Iran) were randomly divided into five groups (five mice in each group). The immunization protocol for each group was as follows: Group 1 (edible): The mice were orally administered transgenic duckweed harboring a dose of 30 µg of CS712 protein four times at one-week intervals. Group 2 (prime boost): The mice were orally immunized (like those in group 1), followed by an intraperitoneal (IP) booster dose of 5 µg of purified recombinant CS712 protein. Group 3 (injection): Mice were immunized with the CS712 protein via four injections one week apart. The protocol began with a subcutaneous (SC) injection of 20 µg of CS712 protein with complete Freund’s adjuvant (CFA). This was followed by two subcutaneous (SC) booster doses (15 µg and 10 µg) in incomplete Freund’s adjuvant and a final intraperitoneal (IP) injection of 2 µg of purified CS712 protein. Groups 4 and 5 (controls): Four mice in group 4 were orally administered nontransgenic duckweed, while four mice in group 5 were immunized with PBS via the same injection protocol and adjuvants as those in group 3. Blood samples were taken from each mouse one day before each immunization and one week after the last immunization. All the collected sera were then stored at -70°C for subsequent immunological analysis. 2.7 Evaluation of the anti-CS712 humoral immune response elicited in immunized mice via ELISA The humoral immune response was investigated by indirect ELISA for the detection of anti-CS712 antibodies in both serum and stool samples. Total IgG, IgA and the IgG subclasses (IgG1, IgG2a, IgG2b and IgG3) were measured according to standard protocols ( 44 , 45 ). ELISA plates were coated with recombinant CS712 antigen and incubated with diluted serum samples (1:200) from immunized mice. After the samples were washed and blocked, HRP-conjugated anti-mouse IgG (1:5000) and IgA (1:8000) secondary antibodies were used. The reaction was then developed with TMB substrate, and the absorbance was measured at 450 nm. For the measurement of specific IgG subclasses, isotype-specific secondary antibodies for IgG subclasses (IgG1, IgG2a, IgG2b, and IgG3) (1:1000) (all from Sigma‒Aldrich, Germany) were used. After incubation and washing, HRP-conjugated anti-goat IgG was added to the wells to recognize these isotype-specific antibodies. The reaction was subsequently developed with TMB substrate, and the absorbance was measured at 450 nm. 2.8 Flow cytometric analysis To assess the impact of immunization on splenocyte proliferation, flow cytometric analysis of the cell cycle was performed. Splenocytes were isolated from immunized mice and cultured in 6-well plates under sterile conditions. The cells were stimulated with the CS712 antigen for 48 h, while unstimulated cultures containing complete medium supplemented with 5% fetal bovine serum (FBS; Sigma‒Aldrich, USA) served as controls. After 48 h of incubation, the cells were harvested, washed twice with PBS, and fixed in 75% cold ethanol at 4°C overnight. After ethanol removal by centrifugation, the cell pellets were resuspended and stained with 0.5 mL of propidium iodide (PI)/RNase staining buffer (Sigma‒Aldrich, Germany) according to the manufacturer’s instructions. The DNA content was analyzed via a BD FACSCalibur flow cytometer (BD Biosciences, USA), and the cell cycle distribution (G0/G1, S, and G2/M phases) was determined via FlowJo software (version 7.6.1). 2.9 Measurement of cytokines in immunized mice At the end of the experiment, mice were humanely euthanised using deep anaesthesia induced by an intraperitoneal (i.p.) injection of a ketamine and xylazine mixture. After loss of the pedal reflex (confirmed by toe pinch), cervical dislocation was performed as a secondary physical method to ensure death. All procedures were conducted in accordance with the approval of the NIGEB Animal Care and Use Ethics Committee (see Ethical Consideration section). Subsequently, the spleens from three mice in each group were removed and processed into single-cell suspensions. Splenocytes were cultured in complete RPMI-1640 medium supplemented with fetal bovine serum (FBS; Sigma‒Aldrich, USA), HEPES, and penicillin–streptomycin in 96-well flat-bottom plates. The cells were stimulated with purified recombinant CS712 protein (5 µg/mL), while concanavalin A (Con A, 5 µg/mL) was used as a stimulator in positive control wells, and unstimulated cells (medium alone) served as a negative control. Culture supernatants were collected after 72 h for IL-5 and after 120 h for IFN-γ measurement. Cytokine concentrations were quantified via commercial murine ELISA kits (R&D Systems, Minneapolis, USA) according to the manufacturer’s protocols. 2.10. Statistical analysis All the statistical analyses were performed via GraphPad Prism software (version 9.0; GraphPad Software, San Diego, USA). Differences between groups were evaluated via two-way analysis of variance (ANOVA), followed by Tukey’s post hoc test for multiple comparisons. For direct comparisons between two groups, an unpaired two-tailed Student’s t test was used. The data are presented as the means ± standard deviations (SDs), and p < 0.05 was considered statistically significant. Results 3.1. Callus induction, regeneration, and molecular confirmation of transgenic L. minor The process of callus induction and regeneration in the transgenic plants was completed in approximately four weeks (Fig. 1 ). After excision of the meristematic tissue, the callus grew on genetic-containing selective media, and healthy shoots developed from the calli. The shoots developed in vitro into fully plantlets. For successful integration of the transgene, PCR analysis with gene-specific primers was performed. The expected PCR fragment was amplified from the transgenic lines, and no amplification occurred in the nontransgenic controls (Fig. 1 ). PCR was also performed for the virG gene to ensure that the regenerated plants were not contaminated by Agrobacterium. 3.2. SDS‒PAGE and Western blot analysis of recombinant CS712 SDS‒PAGE analysis of the protein extracted from transgenic L. minor revealed a band of the expected size (~ 50 kDa). Western blotting with anti-CS712 mouse antibodies and P. vivax -positive human sera confirmed that the expressed protein retained its immunogenic properties and was specifically recognized by both antibody sources (Fig. 2 ). 3.3 Transgenic plants expressing the CS712 protein The expression levels of CS712 in the duckweed lines were estimated to range between 0.2% and 0.5% of total soluble protein (TSP) (Fig. 3 ). This finding indicates that nearly 80 µg of CS712 recombinant protein is present in one gram of duckweed frond. 3.7 Eliciting anti-CS712 antibodies in immunized mice On day 28 after immunization, humoral immune responses were examined in sera and fecal samples from immunized mice. The highest serum anti-CS712 IgG levels were detected in the injection group (mean OD 45 ₀ = 2.09), followed by the prime-boost and oral groups. The serum IgG levels in the oral group were significantly greater than those in the control group (p < 0.01) (Fig. 4 A). In addition, the serum IgA levels were significantly greater in both the prime-boost and oral groups than in the control group (p < 0.01) (Fig. 4 B), and the fecal IgA levels were also greater in these groups (Fig. 4 C). No antibody response was detected in the mice that received nontransgenic plant material or PBS. To further investigate the quality of the antibody response, the IgG subclasses (IgG1, IgG2a, IgG2b, and IgG3) were measured in the prime-boost and oral groups. All four subclasses were detected in both groups. IgG1 levels were significantly greater in the prime-boost group (mean OD₄ 5 ₀ = 0.941) than in the oral group (mean OD₄ 5 ₀ = 0.305) (p < 0.05) (Fig. 4 D). There was no statistically significant difference in the IgG2a and IgG2b levels between the prime-boost and oral groups, although the mean levels in the prime-boost group (IgG2a = 0.236, IgG2b = 0.226) were slightly greater than those in the oral group (IgG2a = 0.106, IgG2b = 0.124). However, the IgG3 values were comparable in both groups (approximately OD₄ 5 ₀ = 0.135). To assess the Th1/Th2 balance in the humoral response, the IgG2a/IgG1 ratio was calculated. Compared with the prime-boost group, the oral immunization group presented a significantly greater IgG2a/IgG1 ratio (≈ 0.348) (≈ 0.251) (p < 0.01) (Fig. 4 E). 3.8 Assessment of cellular immunity Flow cytometric analysis of splenocytes after 96 hours of in vitro stimulation with the CS712 antigen revealed an increase in the percentage of cells in the S and G2/M phases of the cell cycle, indicating increased cell proliferation (Fig. 5 A). Cytokine levels in the supernatants of splenocyte cultures were determined to assess T helper responses. Compared with those in the edible group, the levels of IFN-γ and IL-5 production in the prime-boost group were significantly greater (p < 0.05) (Fig. 5 B and 5 C). Both inoculated groups (prime-boost and edible) presented significantly higher IFN-γ and IL-5 levels than did the control group, which received nontransgenic duckweed (p < 0.05). To further assess the Th1/Th2 balance at the cytokine level, the IFN-γ/IL-5 ratio was calculated. Compared with the prime-boost group, the oral immunization group presented a greater IFN-γ/IL-5 ratio (p < 0.05) (Fig. 5 D). Discussion Malaria remains a major global health concern. According to the World Malaria Report 2024, an estimated 263 million malaria cases and nearly 597,000 deaths occurred in 2023. Although mortality has slightly declined, the continued increase in cases highlights the persistent transmission of the disease and the urgent need for more effective preventive and therapeutic strategies ( 46 ). These alarming figures highlight the urgent need for novel and highly effective strategies to combat and eradicate malaria. While existing measures have had some impact, the development of cost-effective and easy-to-use vaccines remains crucial for reducing the spread of the disease, especially in malaria endemic areas. Transmission-blocking vaccines designed to interrupt the parasite's life cycle are an important part of a multifaceted approach to eradication ( 47 ). Oral vaccination, with its potential to induce both systemic and mucosal immunity, offers a promising way to achieve a broad protective response and improve vaccine feasibility, despite ongoing challenges in delivery and implementation ( 48 ). Duckweed (genus Lemna) has proven to be a promising bioreactor for the production of recombinant proteins, including active pharmaceutical ingredients and vaccine antigens. Owing to their exceptionally fast growth rate, high biomass yield, and ability to store and administer proteins orally without purification, these methods are particularly attractive for the development of plant-based vaccines ( 35 , 49 ). L. minor also offers unique advantages, including wide global distribution, adaptability to different climates, and asexual reproduction, which minimizes biosafety risks such as pollen dispersal and horizontal gene transfer ( 50 – 52 ). In addition, its high crude protein content provides a solid basis for the enrichment of recombinant proteins ( 35 , 53 ). The ability of plant systems to express malaria antigens effectively underlines their adaptability. For example, the key candidate Pfs25, which blocks transmission, has been produced in different plant platforms. ( 47 ). Similarly, a fully human antibody targeting the leading vaccine candidate AMA1 was recently expressed in Nicotiana benthamiana . This antibody showed high binding affinity and effectively inhibited P. falciparum growth in vitro, further highlighting the capacity of plant-based systems to generate complex, functional molecules for malaria intervention ( 47 , 54 ) In this study, the chimeric CS712 antigen was expressed in transgenic L. minor at levels up to 0.4% total soluble protein (TSP), which is consistent with other heterologous proteins previously produced in duckweed. Hirudin-1, for example, reached 0.02% TSP, whereas β-glucuronidase (GUS) reached 1.43% TSP ( 55 ). These results underscore the potential of L. minor as a competitive platform for the expression of malaria antigens. A major advantage of our system, in contrast to platforms that require intensive purification, such as the CLCT vaccine in N. benthamiana (final purity of 83%) or the Pfs25 antigen, which is also produced in N. benthamiana (which requires enhanced purification for both yield and purity), is the natural compatibility of duckweed with the oral administration of vaccines. This property is supported by evidence that incompletely purified transgenic plant proteins remain immunogenic when ingested ( 35 ), eliminating the need for costly and time-consuming purification steps. As a result, overall production costs are significantly reduced, improving access to vaccines, especially in resource-limited areas ( 47 , 56 ). This study investigated the immunogenic potential of the chimeric CS712 antigen expressed in transgenic L. minor via oral and prime-boost immunization strategies in mice. The results showed that the antigen triggers both systemic and mucosal immune responses, as evidenced by increased levels of IgG and IgA in the serum and IgA in the feces of the immunized animals. In particular, the significant increase in serum IgG levels in the oral group (p < 0.01) underscores the ability of this herbal platform to stimulate systemic immunity even without injection, highlighting its potential for noninvasive vaccine delivery. The induction of mucosal immunity, as reflected by elevated fecal IgA levels, is particularly relevant for malaria, given the potential exposure of sporozoites to mucosal surfaces during the early stages of infection. Secretory IgA is known to play a key role in neutralizing pathogens at mucosal barriers and thus contributes to the first line of defense in orally administered vaccines ( 57 ). Further analysis of the IgG subclass profile revealed a comprehensive humoral response. All four IgG subclasses (IgG1, IgG2a, IgG2b, and IgG3) were detected in both the prime-boost and the oral immunization groups. IgG1 levels were significantly greater in the primary immunization group (p < 0.05), indicating a Th2-skewed response under this regimen. Although the differences in IgG2a and IgG2b levels between the groups were not statistically significant, their measurable presence—especially in the prime-boost group—indicates partial activation of Th1-associated pathways. The detection of IgG3, which is typically associated with complement activation and pathogen neutralization, provides further evidence of a functionally diverse antibody repertoire. Although the IgG subclass nomenclature differs between mice and humans, the functional pattern observed in mice, characterized by elevated IgG1 (Th2-associated) and IgG2a/IgG2b (Th1-associated) levels, closely mirrors the protective IgG1/IgG3 profile observed in naturally acquired immunity to Plasmodium falciparum in humans. While the Th1-associated antibody responses induced by oral immunization are relatively modest, their successful induction highlights an important opportunity: enhancing these responses with human-compatible adjuvants could further improve the protective efficacy of this plant-based vaccine approach ( 58 ). Our results revealed measurable levels of both IgG1 (Th2-associated) and IgG2a (Th1-associated), indicating the activation of both the humoral and cell-mediated arms of the adaptive immune system. This dual activation suggests that the duckweed-based vaccine platform can induce a balanced Th1/Th2 response. This balance is especially important in malaria, where both antibody-mediated neutralization and cellular immunity are required to control the parasite’s complex life cycle ( 59 ). The evidence for cellular immune activation was further supported by the proliferation of splenocytes following in vitro stimulation with CS712. Although detailed T-cell phenotyping was not performed, the increased proportion of cells in the S and G2/M phases of the cell cycle suggests active proliferation, possibly reflecting antigen-specific lymphocyte activation. Although these results are not definitive proof of T-cell involvement, they provide an initial indication of cellular immune activity. Cytokine profiling revealed significantly elevated levels of IFN-γ and IL-5 in both the oral and prime-boost groups compared with the control group, with the prime-boost regimen eliciting the strongest overall responses (p < 0.05). IFN-γ, a hallmark Th1 cytokine, promotes macrophage activation and cytotoxic T-cell responses ( 60 ), whereas IL-5, associated with Th2 activity, supports B-cell differentiation and IgA class switching, which is consistent with the enhanced mucosal IgA observed in immunized mice( 61 ). Notably, the IFN-γ/IL-5 ratio was greater in the orally immunized group than in the prime-boost group, indicating that the oral platform, despite inducing lower absolute cytokine levels, favors a Th1-biased immune profile. This pattern was also reflected in the antibody subclass data, where the oral group demonstrated a higher IgG2a/IgG1 ratio, again indicating a shift toward Th1-associated humoral responses. Such Th1 dominance is particularly relevant for malaria, where protection relies heavily on cell-mediated mechanisms in addition to antibody-mediated immunity ( 62 ). Collectively, these findings suggest that the duckweed-based oral vaccine, while quantitatively less potent, may qualitatively direct immune responses toward those most critical for protective immunity against P. falciparum ( 63 ). This qualitative advantage highlights the intrinsic potential of plant-based vaccine platforms to elicit targeted and durable immune profiles. Nevertheless, further optimization, such as the inclusion of safe, human-compatible adjuvants, could increase the magnitude of protection without compromising the favorable Th1-biased response observed in this study. Overall, these data confirm that CS712 expressed by Lemna is capable of eliciting a comprehensive immune response that encompasses systemic and mucosal compartments and includes both humoral and cellular components. These results are not only consistent with previous reports on plant vaccine candidates against viral and parasitic pathogens ( 31 , 44 ) but also provide new evidence that L. minor is a scalable and effective platform for oral malaria vaccination. Conclusion This study revealed that transgenic L. minor expressing the chimeric CS712 antigen can elicit both mucosal and systemic immune responses in mice. Oral and prime-boost immunization strategies effectively increased serum antigen-specific IgG and IgA levels as well as fecal IgA concentrations. IgG subclass distribution and cytokine profiling indicated the activation of both Th1- and Th2-associated responses, with a predominant Th1 bias, which is especially relevant for protective immunity against malaria. Given the inherent advantages of duckweed — such as rapid growth, ease of genetic transformation and compatibility with oral administration — L. minor proves to be a promising platform for cost-effective and scalable vaccine production. These results highlight the potential of plant-based malaria vaccines and support further research into their long-term efficacy and protective capacity in relevant experimental models. Declarations Acknowledgments The authors gratefully acknowledge the National Institute of Genetic Engineering and Biotechnology (NIGEB), Iran, for providing financial, technical, and material support for this research. We also thank all individuals whose valuable assistance contributed to this work but who did not meet the criteria for authorship. Ethical consideration All procedures involving animals were conducted in accordance with institutional regulations and standard protocols approved by the NIGEB Animal Care and Use Ethics Committee (IR.NIGEB.EC.1404.2.29.B). Availability of data and materials The CS712 gene sequence analyzed during the current study is a synthetic construct previously deposited in the GenBank repository under accession number KY548404. Competing Interests The authors declare that they have no direct or indirect financial conflicts of interest related to the content of this manuscript. Author contributions statement Ali Hatef Salmanian, Sedigheh Zakeri, and Nima Rad contributed to the conceptualization of the study. Ali Hatef Salmanian, Sedigheh Zakeri, Nima Rad, and Akram Abouei Mehrez developed the methodology. Ali Hatef Salmanian and Sedigheh Zakeri supervised the project. Nima Rad prepared the original draft, while Ali Hatef Salmanian, Sedigheh Zakeri, and Akram Abouei Mehrez reviewed and edited the manuscript. Data curation was performed by Sadegh Shojaei Baghini, Elham Taghipour, Mahdi Arezoumandi, Akram Abouei Mehrez, Fateme Frootan, and Mahyat Jafari. Investigation was conducted by Nima Rad, Mahdi Arezoumandi, Elham Taghipour, Sadegh Shojaei Baghini, Fateme Frootan, and Mahyat Jafari. Ali Hatef Salmanian and Nima Rad managed project administration. Ali Hatef Salmanian, Sedigheh Zakeri, Akram Abouei Mehrez, and Nima Rad performed validation. Data availability statements All data supporting the findings of this study are included in the article. Conflict of interest Not Applicable Funding Partial financial support for this research was provided by the National Institute of Genetic Engineering and Biotechnology (NIGEB), Iran (grants 784 and 831). References World Health Organization. World health statistics 2024: monitoring health for the SDGs, sustainable development goals: World Health Organization; 2024. Venkatesan P. WHO world malaria report 2024. The Lancet Microbe. 2025;6(4). Long B, MacDonald A, Liang SY, Brady WJ, Koyfman A, Gottlieb M, et al. Malaria: A focused review for the emergency medicine clinician. The American Journal of Emergency Medicine. 2024;77:7-16. Mace KE, Arguin PM, Tan KR. Malaria surveillance—United States, 2015. MMWR Surveillance Summaries. 2018;67(7):1. World Health Organization. World malaria report 2020: 20 years of global progress and challenges. Geneva: World Health Organization; 2020 2020. Al-Awadhi M, Ahmad S, Iqbal J. Current status and the epidemiology of malaria in the Middle East Region and beyond. Microorganisms. 2021;9(2):338. World Health Organization. World malaria report 2023: World Health Organization; 2023. Patouillard E, Griffin J, Bhatt S, Ghani A, Cibulskis R. Global investment targets for malaria control and elimination between 2016 and 2030. BMJ global health. 2017;2(2):e000176. World Health Organization. World malaria report 2022. Geneva: World Health Organization; 2022 2022. Mahmoudi S, Keshavarz H. Malaria vaccine development: the need for novel approaches: a review article. Iranian journal of parasitology. 2018;13(1):1. Stanisic DI, Good MF. Malaria vaccines: progress to date. BioDrugs. 2023;37(6):737-56. Duffy PE. Transmission-blocking vaccines: harnessing herd immunity for malaria elimination. Expert Review of Vaccines. 2021;20(2):185-98. Gupta S, Pellett S. Recent developments in vaccine design: from live vaccines to recombinant toxin vaccines. Toxins. 2023;15(9):563. Karakavuk T, Gül C, Karakavuk M, Gül A, Can H, Ün C, et al. Biotechnological Based Recombinant Protein Vaccines Developed Against Toxoplasmosis. Turkiye Parazitolojii Dergisi. 2022;46(4):342-57. Sibomana O, Bukuru J, Saka SA, Uwizeyimana MG, Kihunyu AM, Obianke A, et al. Routine malaria vaccination in Africa: a step toward malaria eradication? Malaria Journal. 2025;24(1):1-9. Salmon DA, Lambert PH, Nohynek HM, Gee J, Parashar UD, Tate JE, et al. Novel vaccine safety issues and areas that would benefit from further research. BMJ Global Health. 2021;6(Suppl 2):e003814. Datoo MS, Natama HM, Somé A, Bellamy D, Traoré O, Rouamba T, et al. Efficacy and immunogenicity of R21/Matrix-M vaccine against clinical malaria after 2 years' follow-up in children in Burkina Faso: a phase 1/2b randomised controlled trial. The Lancet Infectious Diseases. 2022;22(12):1728-36. Kucharska I, Hossain L, Ivanochko D, Yang Q, Rubinstein JL, Pomès R, et al. Structural basis of Plasmodium vivax inhibition by antibodies binding to the circumsporozoite protein repeats. Elife. 2022;11:e72908. Cruz Murphy E. Immunogenicity of a Plasmodium vivax Circumsporozoite Protein Vaccine. 2024. Kar S, Devnath P, Emran TB, Tallei TE, Mitra S, Dhama K. Oral and intranasal vaccines against SARS‐CoV‐2: Current progress, prospects, advantages, and challenges. Immunity, inflammation and disease. 2022;10(4):e604. Correa VA, Portilho AI, De Gaspari E. Vaccines, adjuvants and key factors for mucosal immune response. Immunology. 2022;167(2):124-38. Monreal-Escalante E, Ramos-Vega A, Angulo C, Bañuelos-Hernández B. Plant-based vaccines: Antigen Design, Diversity, and strategies for high Level production. Vaccines. 2022;10(1):100. Ortega-Berlanga B, Pniewski T. Plant-based vaccines in combat against coronavirus diseases. Vaccines. 2022;10(2):138. Eidenberger L, Kogelmann B, Steinkellner H. Plant-based biopharmaceutical engineering. Nature Reviews Bioengineering. 2023;1(6):426-39. Huang Z, LePore K, Elkin G, Thanavala Y, Mason HS. High‐yield rapid production of hepatitis B surface antigen in plant leaf by a viral expression system. Plant biotechnology journal. 2008;6(2):202-9. Mohammadzadeh S, Roohvand F, Ehsani P, Salmanian AH, Ajdary S. Canola oilseed‐and Escherichia coli‐derived hepatitis C virus (HCV) core proteins adjuvanted with oil bodies, induced robust Th1‐oriented immune responses in immunized mice. Apmis. 2020;128(11):593-602. Pham NB, Ho TT, Nguyen GT, Le TT, Le NT, Chang H-C, et al. Nanodiamond enhances immune responses in mice against recombinant HA/H7N9 protein. Journal of nanobiotechnology. 2017;15:1-12. Ghosh S, Malhotra P, Lalitha P, Guha-Mukherjee S, Chauhan V. Expression of Plasmodium falciparum C-terminal region of merozoite surface protein (PfMSP119), a potential malaria vaccine candidate, in tobacco. Plant Science. 2002;162(3):335-43. Karki U, Fang H, Guo W, Unnold-Cofre C, Xu J. Cellular engineering of plant cells for improved therapeutic protein production. Plant Cell Reports. 2021;40:1087-99. Wei C, Hu Z, Wang S, Tan X, Jin Y, Yi Z, et al. An endogenous promoter LpSUT2 discovered in duckweed: a promising transgenic tool for plants. Frontiers in Plant Science. 2024;15:1368284. Tan X, Chen S, Fang Y, Liu P, Hu Z, Jin Y, et al. Rapid and highly efficient genetic transformation and application of interleukin-17B expressed in duckweed as mucosal vaccine adjuvant. Biomolecules. 2022;12(12):1881. Taghipour E, Bog M, Frootan F, Shojaei S, Rad N, Arezoumandi M, et al. DNA barcoding and biomass accumulation rates of native Iranian duckweed species for biotechnological applications. Frontiers in Plant Science. 2022;13:1034238. Heenatigala P, Hou H. Duckweed, an Efficient Green Bio-Factory for the Production of Recombinant Proteins. Applications of Plant Molecular Farming. 2024:613-30. Sembada AA, Theda Y, Faizal A. Duckweeds as edible vaccines in the animal farming industry. 3 Biotech. 2024;14(10):1-20. Yang G-L, Feng D, Liu Y-T, Lv S-M, Zheng M-M, Tan A-J. Research progress of a potential bioreactor: duckweed. Biomolecules. 2021;11(1):93. Thingujam D, Pajerowska-Mukhtar KM, Mukhtar MS. Duckweed: Beyond an Efficient Plant Model System. Biomolecules. 2024;14(6):628. Shabani SH, Zakeri S, Salmanian AH, Amani J, Mehrizi AA, Snounou G, et al. Biological, immunological and functional properties of two novel multi-variant chimeric recombinant proteins of CSP antigens for vaccine development against Plasmodium vivax infection. Molecular immunology. 2017;90:158-71. Rad N, Arezoumandi M, Taghipour E, Frootan F, Salmanian AH. Design, Codon Optimization, and Bioinformatic-Assisted Development of a Chimeric Circumsporozoite Protein for Malaria Vaccine Production Using Duckweed (Lemna minor) as a Plant Bioreactor: Bioinformatic analysis of malaria surface antigen for vaccine developm. Trends in Peptide and Protein Sciences. 2025;10(1):1-13 (e2). Weigel D, Glazebrook J. Transformation of agrobacterium using the freeze-thaw method. CSH protocols. 2006;2006(7):pdb. prot4666-pdb. prot. Taghipour E, Rad N, Shojaei S, Arezoumandi M, Frootan F, Yaghoubi S, et al. The Effect of culture conditions and medium on the in-vitro cultivation of three species of duckweed native to Iran as a plant with biotechnological applications. Journal of Plant Research (Iranian Journal of Biology). 2024. Liu Y, Wang Y, Xu S, Tang X, Zhao J, Yu C, et al. Efficient genetic transformation and CRISPR/Cas9‐mediated genome editing in Lemna aequinoctialis. Plant biotechnology journal. 2019;17(11):2143-52. Arezoumandi M, Taghipour E, Shojaei Baghini S, Rad N, Foroutan F, Jafari M, et al. Callus induction, frond regeneration, and genetic transformation of the aquatic plant Lemna minor using Agrobacterium tumefaciens. Iranian Journal of Genetics and Plant Breeding. 2025. Kruger NJ. The Bradford method for protein quantitation. The protein protocols handbook. 2009:17-24. Cen Q, Gao T, Ren Y, Lu X, Lei H. Immune evaluation of a Saccharomyces cerevisiae‐based oral vaccine against Helicobacter pylori in mice. Helicobacter. 2021;26(1):e12772. Beutier H, Gillis CM, Iannascoli B, Godon O, England P, Sibilano R, et al. IgG subclasses determine pathways of anaphylaxis in mice. Journal of Allergy and Clinical Immunology. 2017;139(1):269-80. e7. Organization WH. World Malaria Report 2024. Geneva: World Health Organization; 2024. Tottey S, Shoji Y, Jones RM, Musiychuk K, Chichester JA, Miura K, et al. Engineering of a plant-produced virus-like particle to improve the display of the Plasmodium falciparum Pfs25 antigen and transmission-blocking activity of the vaccine candidate. Vaccine. 2023;41(4):938-44. Hammershaimb EA, Berry AA. Pre-erythrocytic malaria vaccines: RTS, S, R21, and beyond. Expert Review of Vaccines. 2024;23(1):49-52. Acosta K, Appenroth KJ, Borisjuk L, Edelman M, Heinig U, Jansen MA, et al. Return of the Lemnaceae: duckweed as a model plant system in the genomics and postgenomics era. The Plant Cell. 2021;33(10):3207-34. Sender J, Grzywna A. Influence of temperature and photoperiod on the growth and development of Lemna trisulca and Lemna minor in controlled conditions. Journal of Ecological Engineering. 2025;26(2). Tippery NP, Les DH. Tiny plants with enormous potential: phylogeny and evolution of duckweeds. The duckweed genomes: Springer; 2020. p. 19-38. Liu Y, Xu H, Yu C, Zhou G. Multifaceted roles of duckweed in aquatic phytoremediation and bioproducts synthesis. Gcb Bioenergy. 2021;13(1):70-82. Grieš M, Rosputinský M, Mećava M, del Valle AC. Vertical farming of duckweed: advancing edible vaccine production for global health. Discover Biotechnology. 2025;2(1):14. Maskus DJ, Królik M, Bethke S, Spiegel H, Kapelski S, Seidel M, et al. Characterization of a novel inhibitory human monoclonal antibody directed against Plasmodium falciparum Apical Membrane Antigen 1. Scientific reports. 2016;6(1):39462. Kozlov O, Mitiouchkina TY, Tarasenko I, Shaloiko L, Firsov A, Dolgov S. Agrobacterium-mediated transformation of Lemna minor L. with Hirudin and β-glucuronidase genes. Applied Biochemistry and Microbiology. 2019;55(8):805-15. Knödler M, Buyel JF. Extraction and purification of malaria vaccine candidate CLCT produced by transient expression in Nicotiana benthamiana plants. Discover Chemical Engineering. 2023;3(1):14. Muwonge H, Ssewanyana I, Yeka A, Byakika-Kibwika P. Targeting mucosal immunity in malaria control: the underexplored role of IgA. Frontiers in Malaria. 2025;3:1557371. Dobaño C, Santano R, Vidal M, Jiménez A, Jairoce C, Ubillos I, et al. Differential patterns of IgG subclass responses to Plasmodium falciparum antigens in relation to malaria protection and RTS, S vaccination. Frontiers in immunology. 2019;10:439. Kurtovic L, Boyle MJ, Opi DH, Kennedy AT, Tham WH, Reiling L, et al. Complement in malaria immunity and vaccines. Immunological reviews. 2020;293(1):38-56. Mahittikorn A, Mala W, Masangkay FR, Kotepui KU, Wilairatana P, Kotepui M. Increased interferon-γ levels and risk of severe malaria: a meta-analysis. Scientific reports. 2022;12(1):18917. Hopp CS, Skinner J, Anzick SL, Tipton CM, Peterson ME, Li S, et al. Atypical B cells up-regulate costimulatory molecules during malaria and secrete antibodies with T follicular helper cell support. Science immunology. 2022;7(71):eabn1250. Obeagu EI. Role of cytokines in immunomodulation during malaria clearance. Annals of Medicine and Surgery. 2024;86(5):2873-82. Jelínková L, Jhun H, Eaton A, Petrovsky N, Zavala F, Chackerian B. An epitope-based malaria vaccine targeting the junctional region of circumsporozoite protein. npj Vaccines. 2021;6(1):13. Additional Declarations No competing interests reported. Supplementary Files OriginalRawImages2.jpg OriginalRawImages1.jpg OriginalRawImages1.jpeg OriginalRawImages2.jpeg Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8775151","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":589461180,"identity":"9f5e02fe-8f7d-4939-8a85-1e7248d87cb7","order_by":0,"name":"Nima Rad","email":"","orcid":"","institution":"National Institute of Genetic Engineering and Biotechnology (NIGEB)","correspondingAuthor":false,"prefix":"","firstName":"Nima","middleName":"","lastName":"Rad","suffix":""},{"id":589461181,"identity":"de5b3d23-5828-4b24-9ce4-59fff8f8b594","order_by":1,"name":"Sedigheh Zakeri","email":"","orcid":"","institution":"Institut Pasteur Iran","correspondingAuthor":false,"prefix":"","firstName":"Sedigheh","middleName":"","lastName":"Zakeri","suffix":""},{"id":589461182,"identity":"256248bd-362f-4f75-88f2-c0d4dd6d2d89","order_by":2,"name":"Akram Abouie Mehrizi","email":"","orcid":"","institution":"Institut Pasteur Iran","correspondingAuthor":false,"prefix":"","firstName":"Akram","middleName":"Abouie","lastName":"Mehrizi","suffix":""},{"id":589461183,"identity":"4e050dae-cd3a-4248-9e68-e4a41eb99f70","order_by":3,"name":"Sadegh Shojaei Baghini","email":"","orcid":"","institution":"National Institute of Genetic Engineering and Biotechnology (NIGEB)","correspondingAuthor":false,"prefix":"","firstName":"Sadegh","middleName":"Shojaei","lastName":"Baghini","suffix":""},{"id":589461184,"identity":"446e928c-d123-4a12-842e-041322b3baec","order_by":4,"name":"Mahdi Arezoumandi","email":"","orcid":"","institution":"National Institute of Genetic Engineering and Biotechnology (NIGEB)","correspondingAuthor":false,"prefix":"","firstName":"Mahdi","middleName":"","lastName":"Arezoumandi","suffix":""},{"id":589461185,"identity":"13ecaa96-1f81-4aec-a519-fd5adb44d418","order_by":5,"name":"Elham Taghipour","email":"","orcid":"","institution":"National Institute of Genetic Engineering and Biotechnology (NIGEB)","correspondingAuthor":false,"prefix":"","firstName":"Elham","middleName":"","lastName":"Taghipour","suffix":""},{"id":589461186,"identity":"021bad2c-a4a0-41a9-8924-ef5a8ade3074","order_by":6,"name":"Fateme frootan","email":"","orcid":"","institution":"National Institute of Genetic Engineering and Biotechnology (NIGEB)","correspondingAuthor":false,"prefix":"","firstName":"Fateme","middleName":"","lastName":"frootan","suffix":""},{"id":589461189,"identity":"e97b5df3-c4f6-4da2-b59b-ad397eef3534","order_by":7,"name":"Mahyat Jafari","email":"","orcid":"","institution":"National Institute of Genetic Engineering and Biotechnology (NIGEB)","correspondingAuthor":false,"prefix":"","firstName":"Mahyat","middleName":"","lastName":"Jafari","suffix":""},{"id":589461191,"identity":"3a8c40ce-6c8c-47ff-98dc-8dcfd395fb93","order_by":8,"name":"Ali Hatef Salmanian","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1UlEQVRIiWNgGAWjYFAC5gYgYcPAxgBCDDASL2AEaUkjXcthIhWDgHz7wdYNP3ecz+PjX3zsAUONHQOf9AH8WgzOJLbd7D1zu5hN4lm6AcOxZAY2vgQCWhgS227wtt1ObJM4YybBwHaAgY2HkMP6H7bd/Nt2Dqjl/DcJhn9EaGG4kdh2m7ftQGIbfw+bBGMbEVoMbjxsuy3blgy0hc3cILEvmYcIhyUfu/m2zS5xfv/hZw8+fLOTk+8h5DA4kEhgYAAigj5BAvwHSFA8CkbBKBgFIwoAAKR/QKcQw0+BAAAAAElFTkSuQmCC","orcid":"","institution":"National Institute of Genetic Engineering and Biotechnology (NIGEB)","correspondingAuthor":true,"prefix":"","firstName":"Ali","middleName":"Hatef","lastName":"Salmanian","suffix":""}],"badges":[],"createdAt":"2026-02-03 11:38:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8775151/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8775151/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":102760897,"identity":"d2e40854-ea1b-491d-b3ac-271d50a4c3ac","added_by":"auto","created_at":"2026-02-16 10:33:22","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":704650,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic representation of callus induction, regeneration, and transgene confirmation in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eL. minor\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003e(a) Induction of resistant calli on selective medium. (b) Regeneration of fronds from callus on regeneration medium. (c) Development of transgenic fronds on rooting medium. (d) Growth and production of transgenic fronds in liquid medium. (e) Schematic representation of CS712 gene and primer binding sites. (f) PCR confirmation of transgene presence: C− (nontransformed plant), C+ (recombinant plasmid DNA), and M (10 kb DNA ladder). A proximate 760 bp fragment was amplified in transgenic lines.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8775151/v1/9fd21fc45fa955cccf4400ba.png"},{"id":102760894,"identity":"f3719195-daa0-406c-b960-787d135f4295","added_by":"auto","created_at":"2026-02-16 10:33:22","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":283313,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of the CS712 chimeric protein expression in transgenic L. minor by SDS‒PAGE and Western bloting analyses.\u003c/strong\u003e (\u003cstrong\u003ea\u003c/strong\u003e) SDS‒PAGE was stained with Coomassie brilliant blue R-250: C-, nontransgenic duckweed (control negative); lanes 1–3, transgenic duckweed plants. (\u003cstrong\u003eb\u003c/strong\u003e) Western blot analysis using anti-CS712 chimeric mouse antibodies: C-, nontransgenic duckweed (control negative); lanes 1 and 3, transgenic duckweed plants. (c) Western bloting analysis using P.vivax infected human sera: lanes 1 and 2, transgenic duckweed plants. M in all figures represents the protein molecular weight marker (SinaClon, Iran).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8775151/v1/4c9643bdf810f21f802aca74.png"},{"id":102760895,"identity":"e9a43b63-e996-4c6a-965f-c0832520496e","added_by":"auto","created_at":"2026-02-16 10:33:22","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":56532,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTransgenic duckweed plants were measured for chimeric CS712 protein by quantitative ELISA (L1-L5 in different transgenic lines). \u003c/strong\u003eThe expression level was estimated to be between 0.2% and 0.5% of TSP.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8775151/v1/2b6f8b20300167cfb0d48d6d.png"},{"id":102760892,"identity":"81177c87-fde1-4888-a2fe-6dfbaba02e16","added_by":"auto","created_at":"2026-02-16 10:33:22","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":127603,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eELISA results for CS712-specific antibodies, including total IgG, IgA, and IgG subclasses in immunized mice. \u003c/strong\u003eSerum IgG and IgA levels were measured in mice immunized via injection, oral administration, and a prime-boost strategy (A). Serum IgA (B) and fecal IgA (C) concentrations were also assessed in mouse groups receiving the antigen orally or in a prime-boost manner. Mice in the control group received soluble protein extracted from nontransgenic duckweed. As shown, both serum and fecal IgA levels were elevated in immunized groups compared to controls. In addition, the levels of IgG subclasses, including IgG1, IgG2a, IgG2b, and IgG3, were determined in serum samples collected from prime-boost and oral groups (D). To further assess the Th1/Th2 balance at the cytokine level, the IgG2a/IgG1 ratio was calculated. The oral immunization group showed a higher IgG2a/IgG1 ratio compared to the prime-boost group (p \u0026lt; 0.05) (Fig. 5E). For each group (n = 5), the bars represent the mean optical density (OD) values, and error bars indicate standard deviation (SD).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8775151/v1/9a63161857dee0623911b48b.png"},{"id":102760889,"identity":"3f25a1a5-044a-412e-a264-ee01963cfd5a","added_by":"auto","created_at":"2026-02-16 10:33:21","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":116160,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExamining the cell cycle and measuring the levels of IFN-γ and IL-5 cytokines in the edible, prime-boost, and control groups. \u003c/strong\u003eA) T-cell proliferation assessed by flow cytometry. B and C) evaluation of IFN-\u003cstrong\u003eγ\u003c/strong\u003e and IL-5 cytokines in immunized mice. Based on pooled lymphocytes from each group of immunized mice (n = 3), the bars represent average concentrations of IFN-γ and IL-5. The error bars indicate standard deviations. The positive control was ConA, and the negative control was medium alone. D) The ratio of IFN-γ/IL-5 in mouse groups. The data was analyzed with GraphPad Prism 9.0.0. The values are presented as means ± SDs. Asterisk-designated bars indicate statistically significant variations (P \u0026lt; 0.0005).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8775151/v1/45d8190747c1f9524506d959.png"},{"id":103503876,"identity":"69fb3cdb-c9a5-4bdc-ba01-8cf7b0775e39","added_by":"auto","created_at":"2026-02-26 13:03:47","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2567190,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8775151/v1/bc419be9-54af-479d-87fa-60a42dbc213d.pdf"},{"id":102760898,"identity":"e0f08548-c7f3-4745-8899-58a7c1e6207b","added_by":"auto","created_at":"2026-02-16 10:33:22","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":153106,"visible":true,"origin":"","legend":"","description":"","filename":"OriginalRawImages2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8775151/v1/39830d1aacb28dfe6c49ba63.jpg"},{"id":102760893,"identity":"2efd2339-dfc2-4857-93ff-3ff974125ebe","added_by":"auto","created_at":"2026-02-16 10:33:22","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":624179,"visible":true,"origin":"","legend":"","description":"","filename":"OriginalRawImages1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8775151/v1/3fc668686734a0fdc1856742.jpg"},{"id":102760896,"identity":"928872ca-9879-4531-ab6d-e791d52a8468","added_by":"auto","created_at":"2026-02-16 10:33:22","extension":"jpeg","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":2159408,"visible":true,"origin":"","legend":"","description":"","filename":"OriginalRawImages1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8775151/v1/90a52df00f0adbe0ac4891e8.jpeg"},{"id":102760899,"identity":"a1e0d28a-b59f-4694-bb1d-f9ca50f2370b","added_by":"auto","created_at":"2026-02-16 10:33:22","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":2367169,"visible":true,"origin":"","legend":"","description":"","filename":"OriginalRawImages2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8775151/v1/9a45e3553fe829dea3c59bed.jpeg"}],"financialInterests":"No competing interests reported.","formattedTitle":"Immunogenicity of a duckweed-expressed multivariant circumsporozoite antigen administered orally to BALB/c mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMalaria is an ancient and one of the most important parasitic diseases and significant health issues in tropical and subtropical countries worldwide (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Malaria is a lethal disease that is accompanied by severe complications and causes profound disability in individuals. In 2023, approximately 263\u0026nbsp;million clinical cases and 597,000 deaths were reported due to this disease (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Malaria leads to several symptoms, including fever, fatigue, vomiting, and headache, and in severe cases, it can result in skin yellowing, seizures, and coma, ultimately leading to death (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). The causative agent of malaria is a parasitic organism belonging to the \u003cem\u003ePlasmodium\u003c/em\u003e genus. \u003cem\u003ePlasmodium falciparum\u003c/em\u003e was first identified by Charles Louis Alphonse Laveran in the nineteenth century. During the 20th century, numerous other species were discovered and categorized in various hosts. Among them, five species, \u003cem\u003eP. vivax, P. falciparum, P. malariae, P. ovale\u003c/em\u003e, and \u003cem\u003eP. knowlesi\u003c/em\u003e, are involved in human infection (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). The distribution of malaria remains concentrated in specific regions, with 94% of cases occurring in the African region. Countries such as Nigeria, the Democratic Republic of the Congo, and Uganda bear the highest burden (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Moreover, significant reductions in malaria incidence have been reported in regions such as Southeast Asia and the Americas. However, imported cases of malaria into nonendemic regions pose a new public health challenge, emphasizing the need for continued vigilance and intervention efforts (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDespite progress in malaria control through measures such as insecticide-treated nets, indoor residual spraying (IRS), and immediate treatment with effective antimalarial drugs, progress has stagnated in recent years and even reversed in some areas (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). The emergence of resistance to insecticides and partial resistance to artemisinin has further complicated the challenges, while declining funding for malaria control, falling below the estimated \u003cspan\u003e$\u003c/span\u003e5.6\u0026nbsp;billion needed annually, has affected the effectiveness of existing measures (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Consequently, having an effective vaccine, alongside other control strategies such as vector management and disease case management, remains a priority for the World Health Organization, as it could significantly reduce mortality rates (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). The development of an effective vaccine for malaria has been challenging because of the parasite's complex biology, diverse genomes, and immune evasion strategies (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Preerythrocytic vaccines prevent infection, blood-stage vaccines reduce disease severity, and sexual-stage or vector-targeting vaccines limit parasite transmission. These approaches underscore the importance of a comprehensive strategy for malaria control (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). In recent years, there has been increased focus on developing transmission-blocking vaccines aimed at preventing the spread of malaria, with the recognition that vaccination is an efficient and cost-effective method for disease control (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). These vaccines often involve live attenuated organisms or subunit proteins, which are typical in human medicine (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Recombinant proteins are often favored as biotechnological vaccines because of their ease of production in different expression systems, availability as highly purified products, ease of manipulation, and ability to stimulate both humoral and cellular immunity (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). In low-income countries, where malaria prevalence is highest, economic and infrastructural problems hinder access to effective vaccines. High production costs, the need for refrigerated transportation, and limited healthcare infrastructure are significant barriers to vaccine distribution, particularly in rural and malaria-endemic regions. The development of low-cost vaccines with easy distribution options, especially in remote areas, could significantly reduce the burden of disease (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). After years of research, RTS,S/AS01 remains the only vaccine approved by the European Medicines Agency (EMA) in 2015 with moderate efficacy (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). In addition, the R21/Matrix-M\u0026reg; vaccine has been reported to have a relatively high efficacy of 75%, indicating promising advantages. Further clinical trials and long-term studies are needed to confirm its durability and potential for broader application (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). However, there is currently no licensed vaccine against \u003cem\u003eP. vivax\u003c/em\u003e, one of the main parasites that causes malaria outside Africa. A vaccine targeting this species could prevent sporozoites from infecting liver cells, prevent development to the blood stage, and stimulate lasting immunity (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). The circumsporozoite protein (CSP), which is abundant on the surface of sporozoites, is a prime candidate for vaccine development, with its variants VK210 and VK247 showing the greatest potential (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this context, oral vaccines have emerged as promising alternatives because of their ease of administration, potential for large-scale production, and reduced need for complex infrastructure compared with injectable vaccines. Recombinant proteins in oral vaccines can stimulate cellular and humoral immune responses, offering a robust defense (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). Plant systems are increasingly recognized for their ability to produce subunit vaccines, as they enable the expression of target antigens within plant tissues. Selecting an optimal plant species is crucial for maximizing antigen yield and stability, underscoring the importance of careful plant selection for effective production(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). Over the past 30 years, plants have been used in molecular farming to create valuable biopharmaceuticals, including vaccines, antibodies, and antiviral peptides. Compared with traditional methods, plant-based production systems offer unique advantages, including lower production costs, scalability, and enhanced safety profiles. Additionally, plant systems allow for the generation of proteins with glycan structures that are either innately compatible with the human immune system or can be engineered to mimic human glycosylation patterns through glycan modification techniques (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). Recent developments in plant-based vaccines have shown promise across multiple diseases, including hepatitis C, influenza, and malaria. For example, plant-derived vaccines for hepatitis C and influenza have successfully induced strong immune responses in tobacco and canola (\u003cspan additionalcitationids=\"CR26\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). For malaria, various antigens, such as \u003cem\u003eP. falciparum\u003c/em\u003e pfs25 VLPs and MSP1\u003csub\u003e19,\u003c/sub\u003e have been produced in \u003cem\u003eNicotiana benthamiana\u003c/em\u003e, demonstrating safety and immunogenicity in early trials (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). These innovations highlight the potential of plant-based systems to address global health challenges efficiently, providing a scalable and cost-effective approach in vaccine production (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAmong various expression systems, duckweed is a valuable bioreactor capable of rapid growth and high protein content, making it suitable for producing recombinant proteins for vaccine development. Studies have demonstrated the potential of duckweed to express various proteins, including protective antigens and enzymes, which could be applied in oral vaccine formulations (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). Duckweed, the smallest and fastest-growing angiosperm, has proven to be a promising platform for producing recombinant proteins, making it a valuable tool in molecular agriculture (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). Its small size, rapid clonal expansion through asexual propagation, and high biomass production under optimized conditions make it an ideal candidate for the production of biopharmaceuticals (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). The remarkable adaptability of the plant and its ability to grow in a controlled environment reduce the risk of genetically modified organisms (GMOs) escaping into natural ecosystems, increasing its attractiveness for biotechnological applications (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). In addition, rapid biomass doubling, which usually takes less than two days, and high protein accumulation potential make duckweed an efficient and scalable system for the production of a variety of therapeutic proteins (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). These characteristics not only contribute to its sustainability but also solidify its role as an effective plant-based platform for large-scale biopharmaceutical production and offer a promising solution for the advancement of molecular agriculture (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). Advances in genetic transformation and regeneration techniques have enabled efficient recombinant protein expression in duckweed, making it a versatile and cost-effective biological reactor (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). This plant platform is particularly advantageous for the production of high-value proteins such as monoclonal antibodies, vaccines, and cytokines. For example, several Lemna species, including Lemna minor, have been successfully modified to express antigens for vaccines, such as porcine epidemic diarrhea virus (PEDV) and influenza, demonstrating their potential for oral immunization applications (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). In addition, duckweed has shown promise for the production of adjuvants for mucosal vaccines, such as chicken interleukin-17B, expanding its use in immunological therapies (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTo create a recombinant chimeric antigen capable of mimicking natural immune responses, two synthetic constructs (CS127 and CS712) were designed on the basis of \u003cem\u003eP. vivax\u003c/em\u003e CSP variants VK210 and VK247. Among them, CS712 demonstrated superior expression and biological activity in animal models, making it a stronger candidate for P. vivax vaccine development (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). On the basis of these findings, the CS712 construct was selected, and its nucleotide sequence was specifically codon optimized for enhanced expression in the \u003cem\u003eL. minor\u003c/em\u003e system, as detailed in our previous bioinformatic analysis (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). This optimized construct was then transferred into duckweed, and its immunogenicity was investigated. The bioinformatic analyses, including RNA stability, physicochemical property determination, and epitope prediction, were described in detail in a separate study (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). Building upon this foundational work, the current study investigated the in planta expression, purification, and subsequent molecular, proteomic, and murine immunogenicity evaluation of this codon-optimized CS712 protein produced in \u003cem\u003eL. minor\u003c/em\u003e, further demonstrating the potential of this system for low-cost and scalable malaria vaccine production.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Construction of the expression vector and introduction to \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eThe CS712 gene, optimized for plant codons, was synthesized by Shingene Biotechnology (China). The sequence of this synthetic construct is available in GenBank under accession number KY548404 (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). This gene was then cloned into the binary vector pBI121 via the restriction enzymes \u003cem\u003eSacI\u003c/em\u003e and \u003cem\u003eBamHI\u003c/em\u003e. The recombinant vector pBI121-CS712 was confirmed by restriction digestion and PCR analysis (using M13 primers).\u003c/p\u003e \u003cp\u003eOnce cloning was confirmed, the pBI121-CS712 plasmid was introduced into \u003cem\u003eA. tumefaciens\u003c/em\u003e strain EHA105 via the standard freeze‒thaw method (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). To verify the successful transformation of Agrobacterium, colonies were selected on LB agar plates supplemented with kanamycin and rifampicin. The presence of the plasmid in the bacterial cells was confirmed via PCR analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Genetic transformation and regeneration of \u003cem\u003eL. minor\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eThe plant material of \u003cem\u003eL. minor\u003c/em\u003e was obtained from the duckweed collection of the National Institute for Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). To induce callus formation, the meristematic region of the fronds was excised, and the explants were cultured on suitable media under dark conditions as described by Taghipour et al. (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe induced calli were cultured with \u003cem\u003eA. tumefaciens\u003c/em\u003e strain EHA105 containing the binary vector pBI121-PvCS712 for genetic transformation. The bacteria were cultured in LB media supplemented with appropriate antibiotics, and transformation was performed according to the protocol of Liu et al., with \u003cb\u003eslight\u003c/b\u003e modifications. (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e), with slight modifications. After cocultivation, the calli are transferred to regeneration media to promote shoot development and plant regeneration (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Molecular analysis of the transgenic plants\u003c/h2\u003e \u003cp\u003eGenomic DNA was extracted from transgenic and nontransgenic duckweed via the CTAB method (Porebski et al., 1997). The quality and quantity of the DNA were assessed via electrophoresis on a 1% agarose gel and spectrophotometry at 260/280 nm. To confirm the presence of the transgene in the transformed plants, PCR analysis was performed using specific primers: forward, 5'CTATCCTTCGCAAGACCCTTCCTC3', and reverse, 5'CCATCTGCTCTATCCGCG3'. The PCRs were performed according to standard protocols.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Protein extraction and western blotting analysis\u003c/h2\u003e \u003cp\u003eTransgenic \u003cem\u003eL. minor\u003c/em\u003e tissue (0.5\u0026ndash;1 g) was ground in 1.5 mL of extraction buffer containing 50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1% SDS, 30 mM β-mercaptoethanol, 1 mM PMSF, and 10% glycerol. The homogenate was kept on ice and gently mixed for 30 minutes. Following centrifugation at 15,000 rpm for 20 minutes at 4\u0026deg;C, the supernatant was collected for protein analysis.\u003c/p\u003e \u003cp\u003eProteins were separated via 12% SDS‒PAGE. To evaluate the integrity and immunoreactivity of the recombinant CS712 protein, Western blotting was performed using anti-chimeric CS712 mouse antibodies (1:1000 dilution) (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e) and human sera from \u003cem\u003ePlasmodium vivax\u003c/em\u003e-infected individuals (1:500 dilution) provided by the Malaria and Vector Research Group, Pasteur Institute of Iran.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Analyzing the recombinant CS712 protein in plants via ELISA\u003c/h2\u003e \u003cp\u003eRegenerated \u003cem\u003eL. minor\u003c/em\u003e fronds were ground in liquid nitrogen and extracted with 1.5 mL of protein extraction buffer. The total soluble protein content was determined via centrifugation (5 min, 16,000\u0026times;g) via the Bradford method(\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). To quantify the CS712 concentration in transgenic Leishmania plants, immunized mouse serum was subjected to a quantitative ELISA (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). A standard curve was established using defined concentrations of purified CS712 protein, which was expressed and purified from a bacterial system (Malaria and Vector Research Group, Pasteur Institute of Iran). The amount of CS712 protein in the total plant extract was then estimated on the basis of this curve.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Immunization in an animal model\u003c/h2\u003e \u003cp\u003eFive-week-old female BALB/c mice (Pasteur Institute of Iran, Karaj, Iran) were randomly divided into five groups (five mice in each group). The immunization protocol for each group was as follows: Group 1 (edible): The mice were orally administered transgenic duckweed harboring a dose of 30 \u0026micro;g of CS712 protein four times at one-week intervals. Group 2 (prime boost): The mice were orally immunized (like those in group 1), followed by an intraperitoneal (IP) booster dose of 5 \u0026micro;g of purified recombinant CS712 protein. Group 3 (injection): Mice were immunized with the CS712 protein via four injections one week apart. The protocol began with a subcutaneous (SC) injection of 20 \u0026micro;g of CS712 protein with complete Freund\u0026rsquo;s adjuvant (CFA). This was followed by two subcutaneous (SC) booster doses (15 \u0026micro;g and 10 \u0026micro;g) in incomplete Freund\u0026rsquo;s adjuvant and a final intraperitoneal (IP) injection of 2 \u0026micro;g of purified CS712 protein. Groups 4 and 5 (controls): Four mice in group 4 were orally administered nontransgenic duckweed, while four mice in group 5 were immunized with PBS via the same injection protocol and adjuvants as those in group 3. Blood samples were taken from each mouse one day before each immunization and one week after the last immunization. All the collected sera were then stored at -70\u0026deg;C for subsequent immunological analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Evaluation of the anti-CS712 humoral immune response elicited in immunized mice via ELISA\u003c/h2\u003e \u003cp\u003eThe humoral immune response was investigated by indirect ELISA for the detection of anti-CS712 antibodies in both serum and stool samples. Total IgG, IgA and the IgG subclasses (IgG1, IgG2a, IgG2b and IgG3) were measured according to standard protocols (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eELISA plates were coated with recombinant CS712 antigen and incubated with diluted serum samples (1:200) from immunized mice. After the samples were washed and blocked, HRP-conjugated anti-mouse IgG (1:5000) and IgA (1:8000) secondary antibodies were used. The reaction was then developed with TMB substrate, and the absorbance was measured at 450 nm.\u003c/p\u003e \u003cp\u003eFor the measurement of specific IgG subclasses, isotype-specific secondary antibodies for IgG subclasses (IgG1, IgG2a, IgG2b, and IgG3) (1:1000) (all from Sigma‒Aldrich, Germany) were used. After incubation and washing, HRP-conjugated anti-goat IgG was added to the wells to recognize these isotype-specific antibodies. The reaction was subsequently developed with TMB substrate, and the absorbance was measured at 450 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Flow cytometric analysis\u003c/h2\u003e \u003cp\u003eTo assess the impact of immunization on splenocyte proliferation, flow cytometric analysis of the cell cycle was performed. Splenocytes were isolated from immunized mice and cultured in 6-well plates under sterile conditions. The cells were stimulated with the CS712 antigen for 48 h, while unstimulated cultures containing complete medium supplemented with 5% fetal bovine serum (FBS; Sigma‒Aldrich, USA) served as controls.\u003c/p\u003e \u003cp\u003eAfter 48 h of incubation, the cells were harvested, washed twice with PBS, and fixed in 75% cold ethanol at 4\u0026deg;C overnight. After ethanol removal by centrifugation, the cell pellets were resuspended and stained with 0.5 mL of propidium iodide (PI)/RNase staining buffer (Sigma‒Aldrich, Germany) according to the manufacturer\u0026rsquo;s instructions. The DNA content was analyzed via a BD FACSCalibur flow cytometer (BD Biosciences, USA), and the cell cycle distribution (G0/G1, S, and G2/M phases) was determined via FlowJo software (version 7.6.1).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Measurement of cytokines in immunized mice\u003c/h2\u003e \u003cp\u003eAt the end of the experiment, mice were humanely euthanised using deep anaesthesia induced by an intraperitoneal (i.p.) injection of a ketamine and xylazine mixture. After loss of the pedal reflex (confirmed by toe pinch), cervical dislocation was performed as a secondary physical method to ensure death. All procedures were conducted in accordance with the approval of the NIGEB Animal Care and Use Ethics Committee (see Ethical Consideration section). Subsequently, the spleens from three mice in each group were removed and processed into single-cell suspensions. Splenocytes were cultured in complete RPMI-1640 medium supplemented with fetal bovine serum (FBS; Sigma‒Aldrich, USA), HEPES, and penicillin\u0026ndash;streptomycin in 96-well flat-bottom plates.\u003c/p\u003e \u003cp\u003eThe cells were stimulated with purified recombinant CS712 protein (5 \u0026micro;g/mL), while concanavalin A (Con A, 5 \u0026micro;g/mL) was used as a stimulator in positive control wells, and unstimulated cells (medium alone) served as a negative control. Culture supernatants were collected after 72 h for IL-5 and after 120 h for IFN-γ measurement. Cytokine concentrations were quantified via commercial murine ELISA kits (R\u0026amp;D Systems, Minneapolis, USA) according to the manufacturer\u0026rsquo;s protocols.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Statistical analysis\u003c/h2\u003e \u003cp\u003eAll the statistical analyses were performed via GraphPad Prism software (version 9.0; GraphPad Software, San Diego, USA). Differences between groups were evaluated via two-way analysis of variance (ANOVA), followed by Tukey\u0026rsquo;s post hoc test for multiple comparisons. For direct comparisons between two groups, an unpaired two-tailed Student\u0026rsquo;s t test was used. The data are presented as the means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviations (SDs), and p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Callus induction, regeneration, and molecular confirmation of transgenic \u003cem\u003eL. minor\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eThe process of callus induction and regeneration in the transgenic plants was completed in approximately four weeks (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). After excision of the meristematic tissue, the callus grew on genetic-containing selective media, and healthy shoots developed from the calli. The shoots developed in vitro into fully plantlets.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFor successful integration of the transgene, PCR analysis with gene-specific primers was performed. The expected PCR fragment was amplified from the transgenic lines, and no amplification occurred in the nontransgenic controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). PCR was also performed for the virG gene to ensure that the regenerated plants were not contaminated by Agrobacterium.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.2. SDS‒PAGE and Western blot analysis of recombinant CS712\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSDS‒PAGE analysis of the protein extracted from transgenic \u003cem\u003eL. minor\u003c/em\u003e revealed a band of the expected size (~\u0026thinsp;50 kDa). Western blotting with anti-CS712 mouse antibodies and \u003cem\u003eP. vivax\u003c/em\u003e-positive human sera confirmed that the expressed protein retained its immunogenic properties and was specifically recognized by both antibody sources (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Transgenic plants expressing the CS712 protein\u003c/h2\u003e \u003cp\u003eThe expression levels of CS712 in the duckweed lines were estimated to range between 0.2% and 0.5% of total soluble protein (TSP) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). This finding indicates that nearly 80 \u0026micro;g of CS712 recombinant protein is present in one gram of duckweed frond.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.7 Eliciting anti-CS712 antibodies in immunized mice\u003c/h2\u003e \u003cp\u003eOn day 28 after immunization, humoral immune responses were examined in sera and fecal samples from immunized mice. The highest serum anti-CS712 IgG levels were detected in the injection group (mean OD\u003csub\u003e45\u003c/sub\u003e₀ = 2.09), followed by the prime-boost and oral groups. The serum IgG levels in the oral group were significantly greater than those in the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). In addition, the serum IgA levels were significantly greater in both the prime-boost and oral groups than in the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), and the fecal IgA levels were also greater in these groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). No antibody response was detected in the mice that received nontransgenic plant material or PBS.\u003c/p\u003e \u003cp\u003eTo further investigate the quality of the antibody response, the IgG subclasses (IgG1, IgG2a, IgG2b, and IgG3) were measured in the prime-boost and oral groups. All four subclasses were detected in both groups. IgG1 levels were significantly greater in the prime-boost group (mean OD₄\u003csub\u003e5\u003c/sub\u003e₀ = 0.941) than in the oral group (mean OD₄\u003csub\u003e5\u003c/sub\u003e₀ = 0.305) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). There was no statistically significant difference in the IgG2a and IgG2b levels between the prime-boost and oral groups, although the mean levels in the prime-boost group (IgG2a\u0026thinsp;=\u0026thinsp;0.236, IgG2b\u0026thinsp;=\u0026thinsp;0.226) were slightly greater than those in the oral group (IgG2a\u0026thinsp;=\u0026thinsp;0.106, IgG2b\u0026thinsp;=\u0026thinsp;0.124). However, the IgG3 values were comparable in both groups (approximately OD₄\u003csub\u003e5\u003c/sub\u003e₀ = 0.135). To assess the Th1/Th2 balance in the humoral response, the IgG2a/IgG1 ratio was calculated. Compared with the prime-boost group, the oral immunization group presented a significantly greater IgG2a/IgG1 ratio (\u0026asymp;\u0026thinsp;0.348) (\u0026asymp;\u0026thinsp;0.251) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.8 Assessment of cellular immunity\u003c/h2\u003e \u003cp\u003eFlow cytometric analysis of splenocytes after 96 hours of in vitro stimulation with the CS712 antigen revealed an increase in the percentage of cells in the S and G2/M phases of the cell cycle, indicating increased cell proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Cytokine levels in the supernatants of splenocyte cultures were determined to assess T helper responses. Compared with those in the edible group, the levels of IFN-γ and IL-5 production in the prime-boost group were significantly greater (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Both inoculated groups (prime-boost and edible) presented significantly higher IFN-γ and IL-5 levels than did the control group, which received nontransgenic duckweed (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). To further assess the Th1/Th2 balance at the cytokine level, the IFN-γ/IL-5 ratio was calculated. Compared with the prime-boost group, the oral immunization group presented a greater IFN-γ/IL-5 ratio (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eMalaria remains a major global health concern. According to the World Malaria Report 2024, an estimated 263\u0026nbsp;million malaria cases and nearly 597,000 deaths occurred in 2023. Although mortality has slightly declined, the continued increase in cases highlights the persistent transmission of the disease and the urgent need for more effective preventive and therapeutic strategies (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e). These alarming figures highlight the urgent need for novel and highly effective strategies to combat and eradicate malaria. While existing measures have had some impact, the development of cost-effective and easy-to-use vaccines remains crucial for reducing the spread of the disease, especially in malaria endemic areas. Transmission-blocking vaccines designed to interrupt the parasite's life cycle are an important part of a multifaceted approach to eradication (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e). Oral vaccination, with its potential to induce both systemic and mucosal immunity, offers a promising way to achieve a broad protective response and improve vaccine feasibility, despite ongoing challenges in delivery and implementation (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDuckweed (genus Lemna) has proven to be a promising bioreactor for the production of recombinant proteins, including active pharmaceutical ingredients and vaccine antigens. Owing to their exceptionally fast growth rate, high biomass yield, and ability to store and administer proteins orally without purification, these methods are particularly attractive for the development of plant-based vaccines (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). \u003cem\u003eL. minor\u003c/em\u003e also offers unique advantages, including wide global distribution, adaptability to different climates, and asexual reproduction, which minimizes biosafety risks such as pollen dispersal and horizontal gene transfer (\u003cspan additionalcitationids=\"CR51\" citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e). In addition, its high crude protein content provides a solid basis for the enrichment of recombinant proteins (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe ability of plant systems to express malaria antigens effectively underlines their adaptability. For example, the key candidate Pfs25, which blocks transmission, has been produced in different plant platforms. (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e). Similarly, a fully human antibody targeting the leading vaccine candidate AMA1 was recently expressed in \u003cem\u003eNicotiana benthamiana\u003c/em\u003e. This antibody showed high binding affinity and effectively inhibited \u003cem\u003eP. falciparum\u003c/em\u003e growth in vitro, further highlighting the capacity of plant-based systems to generate complex, functional molecules for malaria intervention (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eIn this study, the chimeric CS712 antigen was expressed in transgenic \u003cem\u003eL. minor\u003c/em\u003e at levels up to 0.4% total soluble protein (TSP), which is consistent with other heterologous proteins previously produced in duckweed. Hirudin-1, for example, reached 0.02% TSP, whereas β-glucuronidase (GUS) reached 1.43% TSP (\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e). These results underscore the potential of \u003cem\u003eL. minor\u003c/em\u003e as a competitive platform for the expression of malaria antigens. A major advantage of our system, in contrast to platforms that require intensive purification, such as the CLCT vaccine in \u003cem\u003eN. benthamiana\u003c/em\u003e (final purity of 83%) or the Pfs25 antigen, which is also produced in \u003cem\u003eN. benthamiana\u003c/em\u003e (which requires enhanced purification for both yield and purity), is the natural compatibility of duckweed with the oral administration of vaccines. This property is supported by evidence that incompletely purified transgenic plant proteins remain immunogenic when ingested (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e), eliminating the need for costly and time-consuming purification steps. As a result, overall production costs are significantly reduced, improving access to vaccines, especially in resource-limited areas (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThis study investigated the immunogenic potential of the chimeric CS712 antigen expressed in transgenic \u003cem\u003eL. minor\u003c/em\u003e via oral and prime-boost immunization strategies in mice. The results showed that the antigen triggers both systemic and mucosal immune responses, as evidenced by increased levels of IgG and IgA in the serum and IgA in the feces of the immunized animals. In particular, the significant increase in serum IgG levels in the oral group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) underscores the ability of this herbal platform to stimulate systemic immunity even without injection, highlighting its potential for noninvasive vaccine delivery.\u003c/p\u003e \u003cp\u003eThe induction of mucosal immunity, as reflected by elevated fecal IgA levels, is particularly relevant for malaria, given the potential exposure of sporozoites to mucosal surfaces during the early stages of infection. Secretory IgA is known to play a key role in neutralizing pathogens at mucosal barriers and thus contributes to the first line of defense in orally administered vaccines (\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFurther analysis of the IgG subclass profile revealed a comprehensive humoral response. All four IgG subclasses (IgG1, IgG2a, IgG2b, and IgG3) were detected in both the prime-boost and the oral immunization groups. IgG1 levels were significantly greater in the primary immunization group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), indicating a Th2-skewed response under this regimen. Although the differences in IgG2a and IgG2b levels between the groups were not statistically significant, their measurable presence\u0026mdash;especially in the prime-boost group\u0026mdash;indicates partial activation of Th1-associated pathways. The detection of IgG3, which is typically associated with complement activation and pathogen neutralization, provides further evidence of a functionally diverse antibody repertoire. Although the IgG subclass nomenclature differs between mice and humans, the functional pattern observed in mice, characterized by elevated IgG1 (Th2-associated) and IgG2a/IgG2b (Th1-associated) levels, closely mirrors the protective IgG1/IgG3 profile observed in naturally acquired immunity to Plasmodium falciparum in humans. While the Th1-associated antibody responses induced by oral immunization are relatively modest, their successful induction highlights an important opportunity: enhancing these responses with human-compatible adjuvants could further improve the protective efficacy of this plant-based vaccine approach (\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e). Our results revealed measurable levels of both IgG1 (Th2-associated) and IgG2a (Th1-associated), indicating the activation of both the humoral and cell-mediated arms of the adaptive immune system. This dual activation suggests that the duckweed-based vaccine platform can induce a balanced Th1/Th2 response. This balance is especially important in malaria, where both antibody-mediated neutralization and cellular immunity are required to control the parasite\u0026rsquo;s complex life cycle (\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe evidence for cellular immune activation was further supported by the proliferation of splenocytes following in vitro stimulation with CS712. Although detailed T-cell phenotyping was not performed, the increased proportion of cells in the S and G2/M phases of the cell cycle suggests active proliferation, possibly reflecting antigen-specific lymphocyte activation. Although these results are not definitive proof of T-cell involvement, they provide an initial indication of cellular immune activity.\u003c/p\u003e \u003cp\u003eCytokine profiling revealed significantly elevated levels of IFN-γ and IL-5 in both the oral and prime-boost groups compared with the control group, with the prime-boost regimen eliciting the strongest overall responses (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). IFN-γ, a hallmark Th1 cytokine, promotes macrophage activation and cytotoxic T-cell responses (\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e), whereas IL-5, associated with Th2 activity, supports B-cell differentiation and IgA class switching, which is consistent with the enhanced mucosal IgA observed in immunized mice(\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e). Notably, the IFN-γ/IL-5 ratio was greater in the orally immunized group than in the prime-boost group, indicating that the oral platform, despite inducing lower absolute cytokine levels, favors a Th1-biased immune profile.\u003c/p\u003e \u003cp\u003eThis pattern was also reflected in the antibody subclass data, where the oral group demonstrated a higher IgG2a/IgG1 ratio, again indicating a shift toward Th1-associated humoral responses. Such Th1 dominance is particularly relevant for malaria, where protection relies heavily on cell-mediated mechanisms in addition to antibody-mediated immunity (\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e). Collectively, these findings suggest that the duckweed-based oral vaccine, while quantitatively less potent, may qualitatively direct immune responses toward those most critical for protective immunity against \u003cem\u003eP. falciparum\u003c/em\u003e (\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e). This qualitative advantage highlights the intrinsic potential of plant-based vaccine platforms to elicit targeted and durable immune profiles. Nevertheless, further optimization, such as the inclusion of safe, human-compatible adjuvants, could increase the magnitude of protection without compromising the favorable Th1-biased response observed in this study.\u003c/p\u003e \u003cp\u003eOverall, these data confirm that CS712 expressed by Lemna is capable of eliciting a comprehensive immune response that encompasses systemic and mucosal compartments and includes both humoral and cellular components. These results are not only consistent with previous reports on plant vaccine candidates against viral and parasitic pathogens (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e) but also provide new evidence that \u003cem\u003eL. minor\u003c/em\u003e is a scalable and effective platform for oral malaria vaccination.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study revealed that transgenic \u003cem\u003eL. minor\u003c/em\u003e expressing the chimeric CS712 antigen can elicit both mucosal and systemic immune responses in mice. Oral and prime-boost immunization strategies effectively increased serum antigen-specific IgG and IgA levels as well as fecal IgA concentrations. IgG subclass distribution and cytokine profiling indicated the activation of both Th1- and Th2-associated responses, with a predominant Th1 bias, which is especially relevant for protective immunity against malaria. Given the inherent advantages of duckweed \u0026mdash; such as rapid growth, ease of genetic transformation and compatibility with oral administration \u0026mdash; \u003cem\u003eL. minor\u003c/em\u003e proves to be a promising platform for cost-effective and scalable vaccine production. These results highlight the potential of plant-based malaria vaccines and support further research into their long-term efficacy and protective capacity in relevant experimental models.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors gratefully acknowledge the National Institute of Genetic Engineering and Biotechnology (NIGEB), Iran, for providing financial, technical, and material support for this research. We also thank all individuals whose valuable assistance contributed to this work but who did not meet the criteria for authorship.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical consideration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll procedures involving animals were conducted in accordance with institutional regulations and standard protocols approved by the NIGEB Animal Care and Use Ethics Committee (IR.NIGEB.EC.1404.2.29.B).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe \u003cstrong\u003eCS712\u003c/strong\u003e gene sequence analyzed during the current study is a synthetic construct previously deposited in the GenBank repository under accession number KY548404.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no direct or indirect financial conflicts of interest related to the content of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAli Hatef Salmanian, Sedigheh Zakeri, and Nima Rad contributed to the conceptualization of the study. Ali Hatef Salmanian, Sedigheh Zakeri, Nima Rad, and Akram Abouei Mehrez developed the methodology. Ali Hatef Salmanian and Sedigheh Zakeri supervised the project. Nima Rad prepared the original draft, while Ali Hatef Salmanian, Sedigheh Zakeri, and Akram Abouei Mehrez reviewed and edited the manuscript. Data curation was performed by Sadegh Shojaei Baghini, Elham Taghipour, Mahdi Arezoumandi, Akram Abouei Mehrez, Fateme Frootan, and Mahyat Jafari. Investigation was conducted by Nima Rad, Mahdi Arezoumandi, Elham Taghipour, Sadegh Shojaei Baghini, Fateme Frootan, and Mahyat Jafari. Ali Hatef Salmanian and Nima Rad managed project administration. Ali Hatef Salmanian, Sedigheh Zakeri, Akram Abouei Mehrez, and Nima Rad performed validation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data supporting the findings of this study are included in the article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;Partial financial support for this research was provided by the National Institute of Genetic Engineering and Biotechnology (NIGEB), Iran (grants 784 and 831).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eWorld Health Organization. World health statistics 2024: monitoring health for the SDGs, sustainable development goals: World Health Organization; 2024.\u003c/li\u003e\n\u003cli\u003eVenkatesan P. WHO world malaria report 2024. The Lancet Microbe. 2025;6(4).\u003c/li\u003e\n\u003cli\u003eLong B, MacDonald A, Liang SY, Brady WJ, Koyfman A, Gottlieb M, et al. Malaria: A focused review for the emergency medicine clinician. The American Journal of Emergency Medicine. 2024;77:7-16.\u003c/li\u003e\n\u003cli\u003eMace KE, Arguin PM, Tan KR. Malaria surveillance\u0026mdash;United States, 2015. MMWR Surveillance Summaries. 2018;67(7):1.\u003c/li\u003e\n\u003cli\u003eWorld Health Organization. World malaria report 2020: 20 years of global progress and challenges. Geneva: World Health Organization; 2020 2020.\u003c/li\u003e\n\u003cli\u003eAl-Awadhi M, Ahmad S, Iqbal J. Current status and the epidemiology of malaria in the Middle East Region and beyond. Microorganisms. 2021;9(2):338.\u003c/li\u003e\n\u003cli\u003eWorld Health Organization. World malaria report 2023: World Health Organization; 2023.\u003c/li\u003e\n\u003cli\u003ePatouillard E, Griffin J, Bhatt S, Ghani A, Cibulskis R. Global investment targets for malaria control and elimination between 2016 and 2030. BMJ global health. 2017;2(2):e000176.\u003c/li\u003e\n\u003cli\u003eWorld Health Organization. World malaria report 2022. Geneva: World Health Organization; 2022 2022.\u003c/li\u003e\n\u003cli\u003eMahmoudi S, Keshavarz H. Malaria vaccine development: the need for novel approaches: a review article. Iranian journal of parasitology. 2018;13(1):1.\u003c/li\u003e\n\u003cli\u003eStanisic DI, Good MF. Malaria vaccines: progress to date. BioDrugs. 2023;37(6):737-56.\u003c/li\u003e\n\u003cli\u003eDuffy PE. Transmission-blocking vaccines: harnessing herd immunity for malaria elimination. Expert Review of Vaccines. 2021;20(2):185-98.\u003c/li\u003e\n\u003cli\u003eGupta S, Pellett S. Recent developments in vaccine design: from live vaccines to recombinant toxin vaccines. Toxins. 2023;15(9):563.\u003c/li\u003e\n\u003cli\u003eKarakavuk T, G\u0026uuml;l C, Karakavuk M, G\u0026uuml;l A, Can H, \u0026Uuml;n C, et al. Biotechnological Based Recombinant Protein Vaccines Developed Against Toxoplasmosis. Turkiye Parazitolojii Dergisi. 2022;46(4):342-57.\u003c/li\u003e\n\u003cli\u003eSibomana O, Bukuru J, Saka SA, Uwizeyimana MG, Kihunyu AM, Obianke A, et al. Routine malaria vaccination in Africa: a step toward malaria eradication? Malaria Journal. 2025;24(1):1-9.\u003c/li\u003e\n\u003cli\u003eSalmon DA, Lambert PH, Nohynek HM, Gee J, Parashar UD, Tate JE, et al. Novel vaccine safety issues and areas that would benefit from further research. BMJ Global Health. 2021;6(Suppl 2):e003814.\u003c/li\u003e\n\u003cli\u003eDatoo MS, Natama HM, Som\u0026eacute; A, Bellamy D, Traor\u0026eacute; O, Rouamba T, et al. Efficacy and immunogenicity of R21/Matrix-M vaccine against clinical malaria after 2 years\u0026apos; follow-up in children in Burkina Faso: a phase 1/2b randomised controlled trial. The Lancet Infectious Diseases. 2022;22(12):1728-36.\u003c/li\u003e\n\u003cli\u003eKucharska I, Hossain L, Ivanochko D, Yang Q, Rubinstein JL, Pom\u0026egrave;s R, et al. Structural basis of Plasmodium vivax inhibition by antibodies binding to the circumsporozoite protein repeats. Elife. 2022;11:e72908.\u003c/li\u003e\n\u003cli\u003eCruz Murphy E. Immunogenicity of a Plasmodium vivax Circumsporozoite Protein Vaccine. 2024.\u003c/li\u003e\n\u003cli\u003eKar S, Devnath P, Emran TB, Tallei TE, Mitra S, Dhama K. Oral and intranasal vaccines against SARS‐CoV‐2: Current progress, prospects, advantages, and challenges. Immunity, inflammation and disease. 2022;10(4):e604.\u003c/li\u003e\n\u003cli\u003eCorrea VA, Portilho AI, De Gaspari E. Vaccines, adjuvants and key factors for mucosal immune response. Immunology. 2022;167(2):124-38.\u003c/li\u003e\n\u003cli\u003eMonreal-Escalante E, Ramos-Vega A, Angulo C, Ba\u0026ntilde;uelos-Hern\u0026aacute;ndez B. Plant-based vaccines: Antigen Design, Diversity, and strategies for high Level production. Vaccines. 2022;10(1):100.\u003c/li\u003e\n\u003cli\u003eOrtega-Berlanga B, Pniewski T. Plant-based vaccines in combat against coronavirus diseases. Vaccines. 2022;10(2):138.\u003c/li\u003e\n\u003cli\u003eEidenberger L, Kogelmann B, Steinkellner H. Plant-based biopharmaceutical engineering. Nature Reviews Bioengineering. 2023;1(6):426-39.\u003c/li\u003e\n\u003cli\u003eHuang Z, LePore K, Elkin G, Thanavala Y, Mason HS. High‐yield rapid production of hepatitis B surface antigen in plant leaf by a viral expression system. Plant biotechnology journal. 2008;6(2):202-9.\u003c/li\u003e\n\u003cli\u003eMohammadzadeh S, Roohvand F, Ehsani P, Salmanian AH, Ajdary S. Canola oilseed‐and Escherichia coli‐derived hepatitis C virus (HCV) core proteins adjuvanted with oil bodies, induced robust Th1‐oriented immune responses in immunized mice. Apmis. 2020;128(11):593-602.\u003c/li\u003e\n\u003cli\u003ePham NB, Ho TT, Nguyen GT, Le TT, Le NT, Chang H-C, et al. Nanodiamond enhances immune responses in mice against recombinant HA/H7N9 protein. Journal of nanobiotechnology. 2017;15:1-12.\u003c/li\u003e\n\u003cli\u003eGhosh S, Malhotra P, Lalitha P, Guha-Mukherjee S, Chauhan V. Expression of Plasmodium falciparum C-terminal region of merozoite surface protein (PfMSP119), a potential malaria vaccine candidate, in tobacco. Plant Science. 2002;162(3):335-43.\u003c/li\u003e\n\u003cli\u003eKarki U, Fang H, Guo W, Unnold-Cofre C, Xu J. Cellular engineering of plant cells for improved therapeutic protein production. Plant Cell Reports. 2021;40:1087-99.\u003c/li\u003e\n\u003cli\u003eWei C, Hu Z, Wang S, Tan X, Jin Y, Yi Z, et al. An endogenous promoter LpSUT2 discovered in duckweed: a promising transgenic tool for plants. Frontiers in Plant Science. 2024;15:1368284.\u003c/li\u003e\n\u003cli\u003eTan X, Chen S, Fang Y, Liu P, Hu Z, Jin Y, et al. Rapid and highly efficient genetic transformation and application of interleukin-17B expressed in duckweed as mucosal vaccine adjuvant. Biomolecules. 2022;12(12):1881.\u003c/li\u003e\n\u003cli\u003eTaghipour E, Bog M, Frootan F, Shojaei S, Rad N, Arezoumandi M, et al. DNA barcoding and biomass accumulation rates of native Iranian duckweed species for biotechnological applications. Frontiers in Plant Science. 2022;13:1034238.\u003c/li\u003e\n\u003cli\u003eHeenatigala P, Hou H. Duckweed, an Efficient Green Bio-Factory for the Production of Recombinant Proteins. Applications of Plant Molecular Farming. 2024:613-30.\u003c/li\u003e\n\u003cli\u003eSembada AA, Theda Y, Faizal A. Duckweeds as edible vaccines in the animal farming industry. 3 Biotech. 2024;14(10):1-20.\u003c/li\u003e\n\u003cli\u003eYang G-L, Feng D, Liu Y-T, Lv S-M, Zheng M-M, Tan A-J. Research progress of a potential bioreactor: duckweed. Biomolecules. 2021;11(1):93.\u003c/li\u003e\n\u003cli\u003eThingujam D, Pajerowska-Mukhtar KM, Mukhtar MS. Duckweed: Beyond an Efficient Plant Model System. Biomolecules. 2024;14(6):628.\u003c/li\u003e\n\u003cli\u003eShabani SH, Zakeri S, Salmanian AH, Amani J, Mehrizi AA, Snounou G, et al. Biological, immunological and functional properties of two novel multi-variant chimeric recombinant proteins of CSP antigens for vaccine development against Plasmodium vivax infection. Molecular immunology. 2017;90:158-71.\u003c/li\u003e\n\u003cli\u003eRad N, Arezoumandi M, Taghipour E, Frootan F, Salmanian AH. Design, Codon Optimization, and Bioinformatic-Assisted Development of a Chimeric Circumsporozoite Protein for Malaria Vaccine Production Using Duckweed (Lemna minor) as a Plant Bioreactor: Bioinformatic analysis of malaria surface antigen for vaccine developm. Trends in Peptide and Protein Sciences. 2025;10(1):1-13 (e2).\u003c/li\u003e\n\u003cli\u003eWeigel D, Glazebrook J. Transformation of agrobacterium using the freeze-thaw method. CSH protocols. 2006;2006(7):pdb. prot4666-pdb. prot.\u003c/li\u003e\n\u003cli\u003eTaghipour E, Rad N, Shojaei S, Arezoumandi M, Frootan F, Yaghoubi S, et al. The Effect of culture conditions and medium on the in-vitro cultivation of three species of duckweed native to Iran as a plant with biotechnological applications. Journal of Plant Research (Iranian Journal of Biology). 2024.\u003c/li\u003e\n\u003cli\u003eLiu Y, Wang Y, Xu S, Tang X, Zhao J, Yu C, et al. Efficient genetic transformation and CRISPR/Cas9‐mediated genome editing in Lemna aequinoctialis. Plant biotechnology journal. 2019;17(11):2143-52.\u003c/li\u003e\n\u003cli\u003eArezoumandi M, Taghipour E, Shojaei Baghini S, Rad N, Foroutan F, Jafari M, et al. Callus induction, frond regeneration, and genetic transformation of the aquatic plant Lemna minor using Agrobacterium tumefaciens. Iranian Journal of Genetics and Plant Breeding. 2025.\u003c/li\u003e\n\u003cli\u003eKruger NJ. The Bradford method for protein quantitation. The protein protocols handbook. 2009:17-24.\u003c/li\u003e\n\u003cli\u003eCen Q, Gao T, Ren Y, Lu X, Lei H. Immune evaluation of a Saccharomyces cerevisiae‐based oral vaccine against Helicobacter pylori in mice. Helicobacter. 2021;26(1):e12772.\u003c/li\u003e\n\u003cli\u003eBeutier H, Gillis CM, Iannascoli B, Godon O, England P, Sibilano R, et al. IgG subclasses determine pathways of anaphylaxis in mice. Journal of Allergy and Clinical Immunology. 2017;139(1):269-80. e7.\u003c/li\u003e\n\u003cli\u003eOrganization WH. World Malaria Report 2024. Geneva: World Health Organization; 2024.\u003c/li\u003e\n\u003cli\u003eTottey S, Shoji Y, Jones RM, Musiychuk K, Chichester JA, Miura K, et al. Engineering of a plant-produced virus-like particle to improve the display of the Plasmodium falciparum Pfs25 antigen and transmission-blocking activity of the vaccine candidate. Vaccine. 2023;41(4):938-44.\u003c/li\u003e\n\u003cli\u003eHammershaimb EA, Berry AA. Pre-erythrocytic malaria vaccines: RTS, S, R21, and beyond. Expert Review of Vaccines. 2024;23(1):49-52.\u003c/li\u003e\n\u003cli\u003eAcosta K, Appenroth KJ, Borisjuk L, Edelman M, Heinig U, Jansen MA, et al. Return of the Lemnaceae: duckweed as a model plant system in the genomics and postgenomics era. The Plant Cell. 2021;33(10):3207-34.\u003c/li\u003e\n\u003cli\u003eSender J, Grzywna A. Influence of temperature and photoperiod on the growth and development of Lemna trisulca and Lemna minor in controlled conditions. Journal of Ecological Engineering. 2025;26(2).\u003c/li\u003e\n\u003cli\u003eTippery NP, Les DH. Tiny plants with enormous potential: phylogeny and evolution of duckweeds. The duckweed genomes: Springer; 2020. p. 19-38.\u003c/li\u003e\n\u003cli\u003eLiu Y, Xu H, Yu C, Zhou G. Multifaceted roles of duckweed in aquatic phytoremediation and bioproducts synthesis. Gcb Bioenergy. 2021;13(1):70-82.\u003c/li\u003e\n\u003cli\u003eGrie\u0026scaron; M, Rosputinsk\u0026yacute; M, Mećava M, del Valle AC. Vertical farming of duckweed: advancing edible vaccine production for global health. Discover Biotechnology. 2025;2(1):14.\u003c/li\u003e\n\u003cli\u003eMaskus DJ, Kr\u0026oacute;lik M, Bethke S, Spiegel H, Kapelski S, Seidel M, et al. Characterization of a novel inhibitory human monoclonal antibody directed against Plasmodium falciparum Apical Membrane Antigen 1. Scientific reports. 2016;6(1):39462.\u003c/li\u003e\n\u003cli\u003eKozlov O, Mitiouchkina TY, Tarasenko I, Shaloiko L, Firsov A, Dolgov S. Agrobacterium-mediated transformation of Lemna minor L. with Hirudin and \u0026beta;-glucuronidase genes. Applied Biochemistry and Microbiology. 2019;55(8):805-15.\u003c/li\u003e\n\u003cli\u003eKn\u0026ouml;dler M, Buyel JF. Extraction and purification of malaria vaccine candidate CLCT produced by transient expression in Nicotiana benthamiana plants. Discover Chemical Engineering. 2023;3(1):14.\u003c/li\u003e\n\u003cli\u003eMuwonge H, Ssewanyana I, Yeka A, Byakika-Kibwika P. Targeting mucosal immunity in malaria control: the underexplored role of IgA. Frontiers in Malaria. 2025;3:1557371.\u003c/li\u003e\n\u003cli\u003eDoba\u0026ntilde;o C, Santano R, Vidal M, Jim\u0026eacute;nez A, Jairoce C, Ubillos I, et al. Differential patterns of IgG subclass responses to Plasmodium falciparum antigens in relation to malaria protection and RTS, S vaccination. Frontiers in immunology. 2019;10:439.\u003c/li\u003e\n\u003cli\u003eKurtovic L, Boyle MJ, Opi DH, Kennedy AT, Tham WH, Reiling L, et al. Complement in malaria immunity and vaccines. Immunological reviews. 2020;293(1):38-56.\u003c/li\u003e\n\u003cli\u003eMahittikorn A, Mala W, Masangkay FR, Kotepui KU, Wilairatana P, Kotepui M. Increased interferon-\u0026gamma; levels and risk of severe malaria: a meta-analysis. Scientific reports. 2022;12(1):18917.\u003c/li\u003e\n\u003cli\u003eHopp CS, Skinner J, Anzick SL, Tipton CM, Peterson ME, Li S, et al. Atypical B cells up-regulate costimulatory molecules during malaria and secrete antibodies with T follicular helper cell support. Science immunology. 2022;7(71):eabn1250.\u003c/li\u003e\n\u003cli\u003eObeagu EI. Role of cytokines in immunomodulation during malaria clearance. Annals of Medicine and Surgery. 2024;86(5):2873-82.\u003c/li\u003e\n\u003cli\u003eJel\u0026iacute;nkov\u0026aacute; L, Jhun H, Eaton A, Petrovsky N, Zavala F, Chackerian B. An epitope-based malaria vaccine targeting the junctional region of circumsporozoite protein. npj Vaccines. 2021;6(1):13.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Lemna minor, malaria vaccine candidate, CS712, oral immunization, plant-based expression, mucosal immunity, IgG subclasses, cytokines","lastPublishedDoi":"10.21203/rs.3.rs-8775151/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8775151/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eMalaria remains a significant global health challenge, with hundreds of millions of cases reported annually and limited access to effective and affordable vaccines. Owing to their scalability, safety, and potential for oral administration, plant-based vaccine platforms have emerged as promising alternatives. In this study, we evaluated the immunogenicity of a chimeric circumsporozoite protein (CS712) derived from \u003cem\u003ePlasmodium vivax\u003c/em\u003e, expressed in transgenic \u003cem\u003eLemna minor\u003c/em\u003e, as a candidate oral malaria vaccine.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eCS712\u003c/em\u003e gene was subsequently cloned and inserted into a plant expression vector and successfully introduced into duckweed via \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation. The transgenic lines were verified via PCR, and target protein expression was confirmed via Western blot analysis; the protein reached concentrations of 0.4% of the total soluble protein. BALB/c mice were immunized via three different routes: oral administration, subcutaneous injection, and a prime\u0026ndash;boost combination. Immune responses were analyzed by quantifying total IgG, IgA, and IgG subclasses (IgG1, IgG2a, IgG2b, and IgG3) and cytokine levels (IL-5 and IFN-γ). Splenocyte proliferation was also assessed via flow cytometry.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eBoth the oral and prime-boost immunization strategies elicited robust humoral and mucosal immune responses, as evidenced by significant increases in serum IgG and IgA as well as fecal IgA. Analysis of the IgG subclass distribution and cytokine profiles revealed the activation of both Th1- and Th2-type immune pathways.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThese findings support the feasibility of using transgenic duckweed as a plant-based bioreactor for oral vaccine candidate production. The capacity of CS712-expressing duckweed to induce both mucosal and systemic immunity underscores its potential as a cost-effective and scalable platform for developing oral malaria vaccines targeting \u003cem\u003eP. vivax\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Immunogenicity of a duckweed-expressed multivariant circumsporozoite antigen administered orally to BALB/c mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-16 10:33:10","doi":"10.21203/rs.3.rs-8775151/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4d1b1923-7b2a-4e54-bcd7-ad0e96d03320","owner":[],"postedDate":"February 16th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-02-23T07:24:58+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-16 10:33:10","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8775151","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8775151","identity":"rs-8775151","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.