Estrogen-induced circFAM171A1 regulates sheep myoblasts proliferation through the oar-miR-485-5p/MAPK15/MAPK pathway

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Estrogen is an important hormone affecting muscle development in female animals. Studies have shown that estrogen can protect muscle cells from apoptosis by inhibiting MAPK signaling pathway. However, the molecular mechanisms by which estrogen-induced MAPK signaling regulates myoblasts growth and development remain unclear. In this study, RNA-seq was performed in the ovariectomized small-tailed Han (OR-STH) sheep and sham surgery small-tailed Han (STH) sheep groups to analyze the effect of estrogen on muscle growth and development in female animals. There were identified 8721 differentially expressed circRNAs (DECs), 143 differentially expressed miRNAs (DEMs) and 2238 differentially expressed mRNAs (DEGs) in the longissimus dorsi between the OR-STH and STH groups. Bioinformatics analysis showed that the differentially expressed gene MAPK15 was significantly enriched in the MAPK signaling pathway, which is important for muscle development. Therefore, we constructed the ceRNA network circFAM171A1/oar-miR-485-5p/MAPK15 and explored its effect on muscle growth and development. The results of molecular mechanism experiments indicated that circFAM171A1 could act as a sponge adsorbing oar-miR-485-5p to regulate MAPK15. Addition of the exogenous hormone estradiol (E2) to sheep myoblasts could induce circFAM171A1, regulate the expression of oar-miR-485-5p and MAPK15, and promote the proliferation of sheep myoblasts. The results showed that MAPK15 and circFAM171A1 significantly promoted proliferation of myoblasts and inhibited apoptosis of myoblasts in sheep, whereas oar-miR-485-5p inhibited expression of MAPK15 and circFAM171A1 and inhibited myoblast proliferation and promoted apoptosis. Furthermore, circFAM171A1 could attenuate the inhibitory effect of oar-miR-485-5p on myoblasts. In summary, estrogen induced the expression of circFAM171A1 in sheep myoblasts, and circFAM171A1 can act as a sponge for oar-miR-485-5p to promote the expression of the target gene, MAPK15, and finally regulated the proliferation of sheep myoblasts. This study provided new insights for molecular mechanism of estrogen regulation on muscle growth and development in female animals.
Full text 188,911 characters · extracted from preprint-html · click to expand
Estrogen-induced circFAM171A1 regulates sheep myoblasts proliferation through the oar-miR-485-5p/MAPK15/MAPK pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Estrogen-induced circFAM171A1 regulates sheep myoblasts proliferation through the oar-miR-485-5p/MAPK15/MAPK pathway Runqing Chi, Yufang Liu, Peng Wang, Fan Yang, Xiangyu Wang, Xiaoyun He, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4806193/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Mar, 2025 Read the published version in Cellular and Molecular Life Sciences → Version 1 posted 5 You are reading this latest preprint version Abstract Estrogen is an important hormone affecting muscle development in female animals. Studies have shown that estrogen can protect muscle cells from apoptosis by inhibiting MAPK signaling pathway. However, the molecular mechanisms by which estrogen-induced MAPK signaling regulates myoblasts growth and development remain unclear. In this study, RNA-seq was performed in the ovariectomized small-tailed Han (OR-STH) sheep and sham surgery small-tailed Han (STH) sheep groups to analyze the effect of estrogen on muscle growth and development in female animals. There were identified 8721 differentially expressed circRNAs (DECs), 143 differentially expressed miRNAs (DEMs) and 2238 differentially expressed mRNAs (DEGs) in the longissimus dorsi between the OR-STH and STH groups. Bioinformatics analysis showed that the differentially expressed gene MAPK15 was significantly enriched in the MAPK signaling pathway, which is important for muscle development. Therefore, we constructed the ceRNA network circFAM171A1/oar-miR-485-5p/MAPK15 and explored its effect on muscle growth and development. The results of molecular mechanism experiments indicated that circFAM171A1 could act as a sponge adsorbing oar-miR-485-5p to regulate MAPK15 . Addition of the exogenous hormone estradiol (E 2 ) to sheep myoblasts could induce circFAM171A1, regulate the expression of oar-miR-485-5p and MAPK15 , and promote the proliferation of sheep myoblasts. The results showed that MAPK15 and circFAM171A1 significantly promoted proliferation of myoblasts and inhibited apoptosis of myoblasts in sheep, whereas oar-miR-485-5p inhibited expression of MAPK15 and circFAM171A1 and inhibited myoblast proliferation and promoted apoptosis. Furthermore, circFAM171A1 could attenuate the inhibitory effect of oar-miR-485-5p on myoblasts. In summary, estrogen induced the expression of circFAM171A1 in sheep myoblasts, and circFAM171A1 can act as a sponge for oar-miR-485-5p to promote the expression of the target gene, MAPK15 , and finally regulated the proliferation of sheep myoblasts. This study provided new insights for molecular mechanism of estrogen regulation on muscle growth and development in female animals. Sheep Muscle development Estrogen-induced circRNA Oar-miR-485-5p MAPK15 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1 Introduction Estrogen is an important hormone affecting muscle development in female animals. It is mainly secreted by the ovary. The research suggests that estrogen lack induces bone muscle cell apoptosis, leading to a loss of bone muscle quality and force [ 1 ] . Studies on mouse C2C12 (myoblast) cells have shown that estrogen exposure could protect against hydrogen peroxide-induced apoptosis by up-regulating HSP27, which combines with Caspase-3, blocking it from cleavage and inactivating the inhibitor, thereby modulating the downstream goals of Bcl-2, BAD, AKT, ERK, and MAPK, and ultimately preventing cell death and ultimately preventing apoptosis and promoting the viability of C2C12 cells [ 2 – 8 ] . Studies in several rodents have shown that estrogen treatment reduces locomotion-induced HSP70 and HSP72 replays in males or ovariectomized females, but has no effect on HSP27 in stifle muscles [ 9 – 12 ] . Wang also revealed that the underlying protein ranks of HSP70, HSP27, and HSP90 in bone muscle were reduced in female rats after the loss of estrogen [ 13 ] . In addition, Karvinen et al. identified that estrogen resistance down-regulates a variety of miRNAs that may inhibit the apoptotic pathway, thus leading to enhanced cell death and loss of bone muscle quality [ 14 ] . However, the detailed molecular mechanisms of estrogen on muscle development remain unclear. Estrogen may play a biological role by inducing the production of circRNA. In studies of ER-positive breast cancer, estrogen was found to induce the production of circPGR, which is positioned in the stroma of the cell and serves as a rival internal RNA (ceRNA) to the sponge miR-301a-5p, regulating the development of a number of cell cycle factors [ 15 ] . Thus, the mechanism of action by which estrogen functions in animals has been further understood. CircRNA in animals was produced by cyclization of specific exons [ 16 ] or a few introns [ 17 ] , and it is a particularly stable RNA. In vivo, circRNA is produced from the spliceosome by reverse splice: the 3’ side of the exon is attached by covalent splicing to the 5’ side of the upstairs exon and is immune to the nucleic acid epimerase RNase R. The circRNA is also resistant to the nucleic acid epimerase RNase R [ 18 – 20 ] . CircRNAs play a critical function in the development of animal muscle, not only through the competitive endogenous RNA to regulate the expression of miRNAs, but also can bind to proteins to constitute functional communities, which are involved with the modulation of biological functions [ 21 ] . For example, circHIPK3 can promote skeletal muscle development in chicken embryos by sponging miR-30a-3p [ 22 ] . CircRNA FUT10 aims to target HOXA9 by combining with miR-365a-3p to ameliorate degenerative muscle disorders [ 23 ] . CircNDST1 governs the bovine myogenic cell multiplication and specialization through the miR-411a/Smad4 axial [ 24 ] . CircFoxo3 delays cell cytosolic advancement by entering into a triplet complicated with p21 and CDK2 [ 25 ] . Therefore, the above studies suggested that estrogen can first induce specific circRNA, and further this circRNA can regulate miRNA-gene-pathway to participate in muscle development. The most of these circRNAs have been characterized in human, mouse, bovine, and porcine myoblasts. The spectrum of expression of circRNAs throughout in vitro myoblast differentiation in mouse and human cells has been analyzed, and conservative circRNAs have been identified across species during the process of myogenesis and the development of Duchenne dystrophy [ 26 ] . Wei obtained circRNA profiles of bovine skeletal muscle at two stages of development (embryonic and mature muscle), revealing for the first time their hidden participation in bovine muscle formation [ 27 ] . Sun et al. demonstrated that a number of circRNAs are involved in muscle growth in the longissimus dorsi muscles of Rand and Blue Pond pigs [ 28 ] . Studies have also identified circRNAs in sheep muscle, but have not yet revealed differences in the expression and action of circRNAs in the muscles of ovariectomized and intact sheep. Skeletal muscle derives and originates from myogenic progenitor cells (MPC), which mainly includes somatic and myogenic cell multiplication and polarization, myotube fusion, and myofibril formation [ 29 , 30 ] . Myogenesis is regulated by myogenic factors, including the Pax families Pax3 and Pax7 [ 31 ] , and the MRF families (Myf5, MyoD, MyoG, and MRF4) [ 32 ] . Pax3 was required for the migration of MPCs and, together with a family of MRFs, for mediating the myoblasts program. Pax3 activates Myf5, which, together with MRF4, determines the myoblasts process of proliferation and differentiation.Pax3 is also required for the migration of MPCs and, together with a family of MRFs, for the mediation of the myoblasts program.Pax3 is required for the migration of MPCs and, together with a family of MRFs, for the mediation of the myoblasts program [ 33 , 34 ] . P-CaMK-II promotes myogenic differentiation and the formation of type II myofibers by inhibiting β-catenin and p-ERK1/2 dephosphorylation under the activation of the Zac1/GPR39 system [ 31 ] . Muscle MSCs also give rise to muscle stem cells (also called satellite cells) that are activated immediately after muscle damage and split into proliferating myoblasts, which are characterized by the presence of Pax7 and MyoD [ 35 , 36 ] . Although the transcriptional regulation of myogenesis has been explored, the essential function of non-coding RNAs (e.g. circRNA and miRNA) during myogenesis are very worth further investigating. The objective of this work was to characterize estrogen-induced circRNAs with potential functions in modulating muscle development in sheep. Making use of high-throughput RNA sequencing we first investigated systematically the expression profiles and functions of circRNAs in longissimus dorsi muscle of 8-month-old small-tailed Han sheep with and without ovaries. Here, one significantly up-regulated circRNAs (novel_circ_0011822) in intact ewes, which was named circFAM171A1 based on its source gene, was highlighted. Then bioinformatics analysis showed that circFAM171A1-oar-miR-485-5p-MAPK15 could form ceRNA, in which MAPK15 is an important gene in the MAPK signaling pathway. In addition, we verified the influence of estrogen-induced ceRNA on the growth and progression of sheep myoblasts in vitro. These findings will help to discover the molecular mechanisms by which estrogen regulates muscle progression in sheep. 2 Materials and Methods 2.1 Ethics statement The study was approved by the IAS-CAAS Animal Ethics Committee under approval number IAS2019-63. Under the premise of strict compliance with relevant regulations, scientists are committed to promoting animal science research in order to contribute to the development of agriculture in our country. 2.2 Sample collection and preparation In this study, we selected 10 small-tailed Han sheep ewes aged 2 months from the Wulat Zhongqi Farm, Bayannur City, Inner Mongolia Autonomous Region, China. For comparative observations, the sheep were randomized into two groups: ovariectomized group (n = 5, OR-STH) and sham surgery (n = 5, STH). There were no significant differences between the two groups in terms of height, weight, and age. After surgery, both groups of sheep were kept in the same feeding environment. Over a 6-month period, sheep weights were measured and tissue samples were collected from the longissimus dorsi muscle. Mean body weight was 72.4 ± 1.86 kg and 88.4 ± 3.97 kg in the OR-STH and STH groups, respectively ( P < 0.05). Estrogen levels in the serum of sheep were 28.71 ± 2.73 pg/mL and 12.23 ± 0.82 pg/mL in the STH group and OR-STH group, respectively ( P < 0.05). All tissue samples were immediately frozen in liquid nitrogen to ensure the stability of the samples. Subsequently, the samples were stored in a cryogenic environment at -80 ℃ in order to maintain their original condition when further analysis was performed. 2.3 Library preparation and Illumina sequencing In this study, we first extracted total RNA from 10 muscle tissue powders using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), strictly following the manufacturer’s instructions. The total amount of RNA extracted was 2 µg (concentration ≥ 300 ng/µL, OD260/280 between 1.8 and 2.2), which was used as raw material for constructing miRNA and cDNA libraries. To remove ribosomal RNA (rRNA), we employed the Epicentre Ribo-Zero™ rRNA Removal Kit (Epicentre, Madison, WI, USA). After rRNA removal, we constructed sequencing libraries using the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB, Ipswich, MA, USA) following the manufacturer’s instructions. Throughout the process, we also purified the products using the AMPure XP system and assessed the quality of the library by gel electrophoresis, NanoDrop 2000, Qubit 2.0, and Agilent Bioanalyzer 2100 systems. Finally, the libraries were sequenced on an Illumina Hiseq 2500 platform, yielding 150 bp paired end reads. 2.4 Identification of differentially expressed circRNAs, miRNAs and mRNAs In the present work, we first approximated the levels of expression of circRNAs in the built muscle tissue libraries by Illumina sequencing data and FPKM/readcount of these values. To recognize differentially expressing genes (DEGs), we used the DE-Seq R software package (version 4.2.1). In the DE-Seq analysis, we used a threshold of q-value less than 0.05 and |log2FoldChange| greater than 1 to adjust for DE genes. Next, we used the DEG-seq R package to analyze differentially expressed modules (DEMs) and differentially expressed clusters (DECs) based on normalized reads per thousand bases per mil (TPM) values. During the analysis, we modified the q-value and set the thresholds for significant DEMs and DECs as q-value less than 0.05 and |log2FoldChange| greater than 1. This series of analyses provided us with information about the differential expression of circRNAs in muscle tissues as well as the related genes, which provided an important basis for further studies. 2.5 Comprehensive functional enrichment analysis In the present study, we used functional annotation to analyze DE circRNA host genes based on GO and KEGG annotations. First, for the source genes, we performed GO annotation based on the corresponding genes and their GO annotations in NCBI. This information was stored in the following database: https://ftp.ncbi.nlm.nih.gov/gene/DATA/gene2go.gz . Next, we used KOBAS software to test the statistical enrichment of host genes associated with DE circRNAs in the KEGG pathway [ 37 ] . To determine the significance of the enrichment analysis, we set a threshold of P < 0.05. This series of functional annotation analyses helped us to gain a deeper understanding of the functions of DE circRNAs in organisms and the roles of their related genes in specific pathways. 2.6 ceRNA and PPI networks We first built a ceRNA network that is based on forecast circRNA, miRNA and mRNA binding sites from whole transcriptome sequencing, and demonstrated the circRNA-miRNA-mRNA interface network using Cytoscape software. This step helped us to understand the function of circRNAs in organisms and their interaction relationship with other genes. Next, we constructed protein-protein interaction (PPI) networks of differentially expressed genes (DEGs) using STRING (version 11.5, https://string-db.org/ ). For PPI analysis, we used the STRING database v11.5 (species: Ovis aries ). In constructing the PPI network, we collected target genes from the database and selected protein pairs with a score greater than 700 from the STRING database. Finally, we used Cytoscape software to visualize the protein pairs. This series of analyses helped us to gain insight into the interactions between DEGs, providing strong support for studying the physiological functions of organisms and the mechanisms of disease occurrence. 2.7 Immunofluorescence (IF) We first inoculated sheep primary myoblasts in 6-well plates maintained at a population density of 1 × 10 6 cells per well, with each group containing three replicates. Next, polylysine-treated glass crawlers were placed in the 6-well plates and removed after 16 h. To fix the cells, we treated them with 4% formaldehyde for 15 min and then washed them with PBS 3 times for 3 min each. Next, 10% goat serum (China) was incubated for 30 min. For immunofluorescence staining, we used appropriate amounts of Desmin (1:500) and MYOD1 (1:500) antibodies (Proteintech, USA) for overnight incubation at 4 ℃. After the incubation was completed, the membrane was washed with PBS five times for 5 min each. Next, incubation was performed with appropriate amount of fluorescent IgG (1:2000) (Saixin, China) for 1 h at 37 ℃. Finally, DAPI (Beyotime, China) was added to stain the nuclei for 5 min and washed 5 times for 5 min each. Through this series of experimental manipulations, we successfully isolated sheep primary myoblasts, which provided the basis for subsequent studies. 2.8 Ribonuclease R (RNase R) The 1 µg of sheep muscle tissue RNA was added to RNase R reagent (1 U/µg) and incubated at 37 ℃ for 10 min. The cDNA was reverse transcribed from RNase R processed RNA and untreated pre-treated RNA, and RT-qPCR was utilized to measure the expression of circRNA and the corresponding linear transcripts. 2.9 Fluorescence in Situ Hybridization (FISH) The FISH kit SA-Biotin System (JiMa, Shanghai, China) and circFAM171A1 probe mixture (Cy3 labeled) were used (Table 1 ). FISH was conducted according to the manufacturer’s instructions to assess the localization of circFAM171A1 in sheep myoblasts. The procedure was as shown below: cells were cultured by creeping in 6-well plates overnight, stabilized with 4% paraformaldehyde for 15 min at room condition, incubated in probe workup (1 µL 1 µM biotin-probe + 1 µL 1 µM SA-Cy3 + 8 µL PBS) for 30 min at 37 ℃, added to the medium, and placed in an incubator at 37 ℃ overnight (12–16 h) after taking measures for hybridization to avoid light. The cells were stained with DAPI solution (2 µg/mL) for 15 min at room condition and protected from darkness. Antifluorescence quenching blocker was added. Images were photographed using a computerized laser scanning confocal microscope. Table 1 The probe sequences of multicolor fluorescent in situ hybridization Name Marker Sequence circFAM171A1 Cy3 5’ GTGCCCGGCCACAGCCTCGAGTACATTTCCAGAGAAGAGCC CTGCGGCTGCCAGAGAACACCAGCTACAGTGACCTGACCGCCT TTCTCACGGCCGCCAGCTCTCCCTCCGAGGTGGACGGCTTTCCT TATTTGCGAGGATTAGATGGAAACGGAACAG 3’ 18S 5’ CTGCCTTCCTTGGATGTGGTAGCCGTTTC 3’ NC 5’ TGCTTTGCACGGTAACGCCTGTTTT 3’ 2.10 Nucleoplasmic separation Sheep myoblasts were inoculated at a density of ≤ 3×10 6 in 6-cm culture dishes, and after 24 h of cell apposition, the cells were cleaned by PBS twice, and the PBS was abandoned. Added 200 µL of pre-chilled buffer J to the culture dish to cover the cell surface, Chill for 5 min, collected the lysis products, move to an RNase-free sponge tube and allow centrifugation at 14000 ×g for 10 min at 4 ℃. The liquid supernatant (cytoplasmic RNA) was pipetted into another centrifuge tube and 200 µL of buffer SK and to the precipitate (cytosolic RNA) added 400 µL buffer SK, vortexed for 10 s, then added 200 µL anhydrous ethanol, vortexed for 10 s, respectively. Transferred the liquid to a centrifuge column and centrifuged at 6000 rpm for 1 min at 4 ℃; discarded the liquid and put the column back into the centrifuge tube. Added 400 µL wash solution A, centrifuged at 14000 ×g 4 ℃ for 1 min, discarded the liquid, repeat washing once; put the column back into the collection tube, centrifuged at 14000 ×g 4 ℃ for 2 min. Then, added 50 µL Elution buffer E, centrifuged at 6000 rpm 4 ℃ for 2 min; centrifuged at 14000 ×g 4 ℃ for 1 min; detected RNA concentration. After that, stored at -80 ℃. 2.11 The expression validation by RT-qPCR The mRNA and miRNA back-transcription were performed using the HiScript® IiI All-in-one RT SuperMix kit (Vazyme, Nanjing, China) and the miRNA first-strand cDNA synthetic kit (Vazyme, Nanjing, China). RT-qPCR was carried out on a RocheLight Cycler® 480 II system (Roche Applied Science, Mannheim, Germany), and the mRNA and miRNA were extracted using the Taq Pro Universal SYBR qPCR Master Mix (Vazyme). RT-qPCR was performed on a RocheLight Cycler® 480 II system (Roche Applied Science, Mannheim, Germany), and mRNA and miRNA were extracted using Taq Pro Universal SYBR qPCR Master Mix (Vazyme). The RT-qPCR procedure was as follows: preliminary denaturation at 95 ℃ for 5 min, denaturation at 95 ℃ for 5 s, and degradation at 60 ℃ for 30 s, and 35 cycles. The data were analyzed by 2 −ΔΔCt method with sheep β-actin and U6 gene as inner genes. The relative expression was analyzed by t -test of dependent samples, and the significance of differences was analyzed by SPSS 20.0. The primers for RT-qPCR were designed by Primer 5 software and composited by Sangon Biotech (Shanghai) Co. The primer sequences are listed in Table 2 . Table 2 Primer information for RT-qPCR Gene Name Primer Sequence (5’-3’) Tm (℃) MAPK15 F: GGAGGAGGCAGGCGTGTAAG R: TCTCTGGCAGGGCTCAAACC 60 PCNA F: TTGAAGAAAGTGCTGGAGGC R: TTGGACATGCTGGTGAGGTT 60 Pax7 F: CGTGCCCTCAGTGAGTTCGA R: CCAGACGGTTCCCTTTGTCG 60 CDK2 F: AAGTGGCTGCATCACAAGGA R: CAAGCTCCGTCCATCTTCAT 60 circFAM171A1 F: CGAGGATTAGATGGAAACGG R: AGAAAGGCGGTCAGGTCACT 60 oar-miR-485-5p F: AGAGGCTGGCCGTGATGAATT R: CAGTTTTTTTTTTTTTTTGGGCAG 60 β-actin F: AGCCTTCCTTCCTGGGCATGGA R: GGACAGCACCGTGTTGGCGTAGA 60 U6 F: AACGCTTCACGAATTTGCGT R: CTCGCTTCGGCAGCACA 60 GAPDH F: CACGGCACAGTCAAGGCAG R: AGATGATGACCCTCTTGGCG 60 novel_circ_0004268 F: ATGTTATACCCCAGCCCAAA R: GAATCCAAAGTCCCAGCCAC 60 novel_circ_0009805 F: AACATGAAGCGTATGTCACAG R: TTCTTCTTCCCGTTCTACTGA 60 novel_circ_0015927 F: AACAACAGCATCTTCTGGGTA 60 R: GGACTCTAAGAATCCAAAACC novel_circ_0006391 F: AGTTCATCCAGATGGGCAGC 60 R: GACCAGTTTAACCAGCGTCC novel_circ_0002443 F: GCTGACCTCCTGAAAGACCC 60 R: GAGTGTTGTTCTTCACGGGG novel_circ_0006225 F: GGTGGGAAGAAGGCGAAATAC 60 R: TTCATTATGGCTCCACTTTGC novel_circ_0005017 F: TTGCCAAACTAACATGGAATC 60 R: CCGATGTTCTGAAAATGATGA 2.12 Cell culture The longissimus dorsi muscle tissues from both surfaces of the fetal spine of 90-day-old small-tailed Han sheep were isolated in an aseptic condition, and combinations of connective tissues and blood tubes were removed and then washed with PBS (2% penicillin/streptomycin). The muscle organizations were pelleted and digestions were performed with 0.25% trypsin (Solarbio, Beijing, China) for 18 h at 4 ℃, and then cultured in an incubator (37 ℃, 5% CO 2 ) for about 2 h. The cells were then incubated in the incubator for about 2 h. The cells were then cultured in the incubator for about 1 h at 4 ℃. The isolated cells were inoculated into 100 mm culture dishes and cultured with complete media (DMEM-F12, 10% FBS and 1% penicillin/streptomycin). After the cells achieved more than 90% fusion, they were transferred to 6-well plates for follow-up experiments. The HEK293T cell line was cultivated under the same cultivation requirements. 2.13 Plasmids construction and transfection Overexpression of pcDNA3.1-circFAM171A1 and interfering siRNA vectors were designed and synthesized based on the sequence of circFAM171A1. The mimic and inhibitor of oar-miR-485-5p were designed and synthesized based on the sequence of oar-miR-485-5p. MAPK15 overexpressing pIRES2-EGFP-MAPK15 and interfering with si-MAPK15 were designed and synthesized based on the sequence of MAPK15 provided by NCBI. overexpressing and interfering vectors, mimics and inhibitors were synthesized by Shanghai Gemma Pharmaceuticals Technology Co. All vectors were sequenced and sheep myoblasts and HEK293T cells were transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) with the manufacturer’s recommendations, and cell growth and gene presentation were assessed 48 h post-transfection. 2.14 Western blot Proteins in cell samples were withdrawn with RIPA (radioimmunoprecipitation assay) buffer (Solebro, Beijing, China) containing 1% PMSF. Protein concentration was measured by BCA test kit (Solebro, Beijing, China). Proteins were isolated by the election on a 10% SDS-polyacrylamide gel (Bio-Rad, Hercules, CA, USA) and then shifted to a polyfluoroethylene membrane. The films were then incubated with specific primary antibodies for PCNA, CDK2 and Pax7 and the corresponding secondary antibodies, and then the membranes were color developed with an ultrasensitive ECL chemiluminescent reagent (Biyuntian, Beijing, China), exposed with an Odyssey CLX imaging screen system (Li-COR), photographed and archived. The relative expression level of the target protein was determined by the ratio of the gray value of the target protein to that of GAPDH/β-tubulin. 2.15 Cell proliferation assay Proliferation of sheep myoblasts was detected with the Cell Counting Kit-8 (CCK-8) (Biyun Tian, Beijing, China). Full details of the procedure are given in the manufacturer’s manual. After transfection of related plasmids, 10 µL of CCK-8 was added to every well at 0, 6, 12, 24, and 48 h of cell growth, respectively. After 2 h of incubation in an incubator, the proliferation rate of myoblasts was calculated by measuring the absorbance at 450 nm with an enzyme marker. The proliferation of sheep myoblasts was detected by EdU Cell Proliferation Detection Kit (Biyuntian, Beijing, China). After transfection of the plasmid, the cells were cultured for 48 h. EdU working solution preheated at 37 ℃ was added, and the cells were transfected for 2 h. The findings were visualized and photographed under a fluorescence microscope (Leica, Germany). 2.16 Dual luciferase reporter assay Inoculate sheep myoblasts evenly into 24-well cell culture plates. When the desired cell density was reached, psiCHECK2-circFAM171A1-WT and psiCHECK2-circFAM171A1-MUT-co-transfected cells were co-transfected with psiCHECK2- MAPK15-WT or psiCHECK2-MAPK15-MUT and oar-miR-485-5p mimics or mimics NC. CircFAM171A1-MUT-oar-miR-485-5p transfected cells. The serum luciferase detection was carried out according to the manufacturer's directions using the Dual-Luciferase Detection Kit (Vazyme, Nanjing, China). Luciferase enzyme activity was recorded 48 h after transfection and measured by a multi-mode microtitration system (EnS pire, Perkin Elmer, USA). 2.17 Estradiol Test The 17β-estradiol (10 mM/mL, DMSO) was purchased from MedChe mExpress (New Jersey, USA). To establish the best concentration for the experiment, estradiol was diluted in a gradient (0 nM, 1 nM, 10 nM, and 100 nM) and then incorporated into the myoblast culture medium along with the suspended cells. Cells were cultured in the gradient-diluted estradiol medium for 48 h, and then RNA and proteins were extracted. 2.18 Statistical Analysis All analyses were performed with at minimum three technical replications. Data were expressed as average ± standard error of measurement (SEM) and plotted with GraphPad Prism software. Statistical data were analyzed using SPSS 20 (SPSS INC. Chicago, IL, USA) software, with separate samples t-tests for making comparisons between two datasets and one-way ANOVA for making comparisons between more than two datasets. Statistical significance was expressed as ** P < 0.01, * P < 0.05. Table 3 Statistics on the yield and quality of raw sequencing data from 10 sheep Sample Raw Reads Number Clean Reads Number GC_content Q30 Uniquely Mapped Aligned Rate OR_STH_1 104585290 95544247 49.18% 92.55% 88502315 84.62% OR_STH_2 101968696 93513704 50.12% 93.03% 85876093 84.22% OR_STH_3 100490536 90061492 50.55% 92.42% 83926739 83.52% OR_STH_4 113484726 102438833 51.03% 91.78% 94625925 83.38% OR_STH_5 96930428 84250266 57.00% 91.14% 76198353 78.61% STH_1 105677792 96351036 49.63% 92.89% 89110737 84.32% STH_2 99401202 92321713 49.57% 93.12% 85175337 85.69% STH_3 105305476 95083678 48.00% 93.21% 89194000 84.70% STH_4 101215956 92765887 49.70% 92.88% 85287779 84.26% STH_5 97234736 90305800 49.72% 92.93% 82470400 84.82% 3 Results 3.1 CircRNAs expression profile in the longissimus dorsi of the ovariectomized and sham-operated small-tailed Han sheep A complete amount of 1,026,294,838 raw_Reads were derived from 10 muscle sequencing libraries from OR-STH and STH groups, and 932,636,656 clean data (clean_Reads), which accounted for 90.87% of the raw data, were obtained after quality control (Table 3 ). In addition, the Q30 were all greater than 91.14%, indicating good sequencing quality, and the average net read rate of 83.81% (from 78.61 to 85.69%) for the only mapping to the sheep genome, which can be analyzed in subsequent experiments. Following removal of ribosomal RNA (rRNA), 8721 potential candidate circRNAs were identified (Supplementary Table S1 ). To identify circRNAs with potential functions in sheep muscle development, we performed a count of the identified circRNAs. The findings showed that the OR-STH group library contained 2042 circRNAs and the STH group library contained 1972 circRNAs (Fig. 1 A). The major circRNA types identified in the study were all exonic (OR_STH: 93.70%; STH: 93.75%), lasso-type circRNA (OR_STH:4.26%; STH:4.16%) and intergenic (OR_STH: 2.03%; STH:2.09%; Fig. 1 B, C). CircRNAs were generated primarily from exon splicing, with a smaller share of intronic and regenerative splicing (Fig. 1 D). Statistics of circRNA density per chromosome indicated that circRNAs were located on chromosomes 1 to 9, with the proportion of circRNAs on chromosomes 1, 2, 3, and 4 being the highest (about 42%) (Fig. 1 E-G). 3.2 Differential expression analysis of circRNAs The amount of circRNAs expressed by each individual was calculated and standardized to SRPBM. The expression of circRNAs was normalized to SRPBM based on the normalized expression, |log2 (foldchange)|>1, P -value < 0.05. 118 DE circRNAs (71 up- and 47 down-regulated) were identified when OR-STH was compared to STH (Fig. 2 A). The general assignment of differentially exhibited circRNAs is shown as a scatterplot in Fig. 2 B and a clustered heatmap, boxplot and violin plot in Fig. 2 C-E. To make sure the precision of the RNA-seq ploy, we randomly selected eight circRNAs that were differentially expressed and designed certain RT-qPCR primers in the circRNA boundary region. The levels of DE circRNA expression measured by RT-qPCR and RNA-seq showed the same trend (Figure. 2F). This means that the RNA-seq acquisition and subsequent organization of the data in this study are reliable. In summary, Gene Ontology (GO) and Kyoto Encyclopedia of Genomes (KEGG) profiling were also utilized to predict the features and signaling pathways of the circRNAs. The GO enrichment results indicated that the molecules hosting genes of the circRNAs play significant roles in muscle progression, including muscle cell formation (GO: 0055001), forward control of differentiation of myoblasts (GO: 0045663), bone muscle fiber production (GO: 0048741) and muscle organ production (GO: 0007517), as well as other subclasses. In the comparison of OR-STH with STH, GO terms are more focused on calcium transport (GO: 0006816), metabolic processes of C21-steroid hormones (GO: 0008207), regulation of hormone levels (GO: 0010817) and cellular metabolic processes (GO: 0044237). We hypothesized that the abundance of host genes in each of these GO terms is linked to the cyclic activity of hormone secretion by the ovary. We sorted these categories in a downward order based on the counts of differentially represented genes (S-gene counts) commented by each GO term and chose the genes with a high count of enriched genes in terms of all three classes to plot the histograms (Fig. 2 G). In the KEGG enrichment assays, 98 of the pathways were significantly enriched. We selected the top 20 notably enriched KEGG terms ( P -value) and plotted a scatter plot (Fig. 2 H). The pathways with the highest number of enriched genes were local adhesion (ko04510), MAPK signaling pathway (ko04010), and TGF-β signaling pathway (ko04350). According to the KEGG enrichment analysis, we defined other pathways of enriched genes that may be related to muscle development. These complete results were shown in Supplementary Tables S2, S3. 3.3 Analysis of ceRNA regulatory networks (circRNA-miRNA-mRNA) A combination of differentially expanded circRNAs (DECs), differentially expanded miRNAs (DEMs), and differentially expanded mRNAs (DEGs) were identified from sheep longissimus dorsi muscle by analyzing the whole transcriptome data to generate a ceRNA regulatory network. A total of 41 circRNA-miRNA couples and 3499 miRNA-mRNA couples were filtered by comparing negatively correlated circRNA-miRNA pairs and miRNA-mRNA pairs in the OR-STH and STH data ( P < 0.05). Four randomly picked differentially excited circRNAs with more or less than three breeding sites, and 14 miRNAs and 90 mRNAs, all of which were differentially exposed, were selected, resulting in the construction of an interaction network: the circRNA-miRNA-mRNA interface network (Fig. 3 A). The screened differential genes were analyzed against the host genes using the STRING database. We selected > 700-point protein pairs and constructed PPI networks of host genes using Cytoscape (Fig. 3 B). Subsequently, six sets of differential circRNA-miRNA-mRNA were chosen for RT-qPCR demonstration: circFAM171A1-oar-miR-485-5p-MAPK15, novel_circ_0002443-novel_329-GIPC1, novel_circ_0009805-novel_141-PRPSAP1, novel_circ_0006391-novel_210-BRPF1, novel_circ_0015927-novel_563-MAPKBP1. RT-qPCR confirmed that the expansion of circRNA, miRNA and mRNA expression levels in sheep muscle tissues were consistent with the RNA-seq data and were adversely correlated ( P < 0.05) (Fig. 3 C). 3.4 Estrogen induced circFAM171A1 production in sheep myoblasts RNA-seq and RT-qPCR showed that the abundance of circFAM171A1 in the STH group was obviously greater than that in the OR-STH group, suggesting that the difference in the expression level of circFAM171A1 may be a result of estrogen induction. To clarify the above results, we added different concentrations of estrogen to in vitro isolated myoblasts to detect the circulation of circFAM171A1 level in myoblasts. The findings indicated that the level of circFAM171A1 increased significantly in all groups after the addition of estrogen, and the concentration of the addition reached 10 nM, the expression level of circFAM171A1 was significantly higher than that of the other groups (Fig. 4 ). This result suggested that the level of circFAM171A1 expression in sheep myoblasts was indeed affected by estrogen. 3.5 Identification of circFAM171A1 as a candidate circRNA Earlier research has demonstrated that circRNAs can eliminate the potential for miRNAs to negatively affect the expression of target genes [ 38 , 39 ] . CircFAM171A1 is 159 bp long and comes from exon 5 of the gene encoding protein FAM171A1. The reverse splice junction of circFAM171A1 was verified based on Sanger sequencing (Fig. 5 A). The level of circFAM171A1 expression was not markedly reduced in sheep myoblasts after RNase R treatment, but the level of linear FAM171A1 and GAPDH mRNA expression was reduced (Fig. 5 B). Next, we examined the expression of circFAM171A1 in muscle tissues from both the ovariectomized and sham surgery of the small-tailed Han sheep based on RT-qPCR. The results showed that circFAM171A1 was expressed in muscle tissues from both OR-STH and STH groups, and the expression level of circFAM171A1 was significantly higher in STH than that in OR-STH, which is consistent with our RNA-seq data (Fig. 5 C). Subsequent RNA nucleoplasmic isolation assays showed that circFAM171A1 was localized predominantly in the cytoplasm (more than 80%) and to a lesser extent in the nucleus (Fig. 5 D). RNA fluorescence in situ hybridization experiments further confirmed this finding (Fig. 5 E). Immunofluorescence staining showed that the myoblasts marker MYOD1 was expressed predominantly in the nucleus, whereas Desmin was expressed predominantly in the cytoplasm (Fig. 5 F). The outcomes indicated that the circularized fabric of circFAM171A1 was more stable than the linear transcript RNA, and circFAM171A1 was primarily functional by being expressed in the cytoplasm. 3.6 Effect of circFAM171A1 on the proliferation of sheep myoblasts To validate the influence of circFAM171A1 on muscle progression in sheep, we built overexpression and interfere plasmids of circFAM171A1 and transfected them in sheep primary myoblasts for 48 h. The findings revealed that overexpression of circFAM171A1 significantly promoted the proliferation of sheep myoblast (Fig. 6 A), whereas the opposite was true after inhibiting its expression (Fig. 6 C). RT-qPCR and Western blot results showed that the expression levels of CDK2, PCNA and Pax7, which are markers of cell proliferation, were significantly increased in sheep myoblasts after overexpression of circFAM171A1, whereas the opposite was observed after inhibition of their expression. (Fig. 6 B, D-F). CCK-8 results showed that overexpression of circFAM171A1 significantly increased the cell viability of sheep myoblasts, whereas inhibition of its expression did the opposite (Fig. 6 I, J). EdU staining assay also showed that overexpression of circFAM171A1 significantly increased the number of EdU-positive cells, whereas the opposite was true after inhibiting its expression (Fig. 6 G, H). These findings indicated that circFAM171A1 promoted the proliferation of sheep myoblasts. 3.7 CircFAM171A1 acts as a sponge for oar-miR-485-5p to regulate myoblast proliferation Cellular localization of circFAM171A1 using nucleoplasmic separation and FISH probes indicated that circFAM171A1 is located mainly in the cytoplasm. It has been shown that when circRNA is contained in the cytoplasm, it mainly functions by acting in interaction of miRNAs [ 40 ] . Therefore, we hypothesized that circFAM171A1 might be a possible sponge for miRNAs. Then, to verify that circFAM171A1 is a ceRNA aiming at miRNAs, we selected miRNAs participating in the development of sheep myoblasts by transcriptomic data and confirmed the binding relationship between circFAM171A1 and miRNAs by RNA hybridization. We discovered that circFAM171A1 might bind to oar-miR-485-5p, with the binding information shown in Fig. 7 A. By RT-qPCR, we found that overexpression of circFAM171A1 decreased the expression of olar-miR-485-5p, while disruption of circFAM171A1 increased the expression of olar-miR-485-5p (Fig. 7 B, C). Following this, we built plasmids for luciferase reporter assays to validate the binding of circFAM171A1 to oar-miR-485-5p. Dual luciferase reporter assays suggested that oar-miR-485-5p significantly inhibited the Rluc expression of pCK-circFAM171A1-WT in HEK293T cells, yet it had no influence on pCK-circFAM171A1-MUT (Fig. 7 D, E). To further confirm that circFAM171A1 can bind oar-miR-485-5p to regulate myoblast proliferation. As analyzed by RT-qPCR and Western blotting, the mRNA and protein values of CDK2, PCNA, and Pax7 were significantly decreased after transfection of the mimics, whereas the exact opposite was observed after transfection of the inhibitors (Fig. 7 F-K). In addition, CCK-8 and EdU assays identified similar changes (Fig. 7 L-O). These findings demonstrated that circFAM171A1 could act as a sponge for oar-miR-485-5p and confirmed that oar-miR-485-5p could inhibit the proliferation of sheep myoblasts. 3.8 CircFAM171A1 impairs the inhibition of oar-miR-485-5p on MAPK15 expression To clarify the circRNA-miRNA-mRNA ceRNA mechanism, our study investigated the target gene MAPK15 of oar-miR-485-5p. To this end, we examined the expression level of the target gene MAPK15 in sheep muscle. Western blotting revealed that there was a statistically significant variation in MAPK15 protein activity between the OR-STH and STH groups (Fig. 8 A, 8 B). The expression of MAPK15 increased significantly after overexpression of circFAM171A1, and decreased after circFAM171A1 inhibition by RT-qPCR (Fig. 8 C). The expression of MAPK15 was significantly reduced after oar-miR-485-5p overexpression, whereas the expression of MAPK15 increased after inhibitor of oar-miR-485-5p (Fig. 8 D). To verify the binding association of miRNAs with target genes, we constructed wild-type (WT) and mutant (MUT) psi-CHECK2 plasmids of the 3’UTR of MAPK15 (Fig. 8 E). Dual luciferase activity assay demonstrated that oar-miR-485-5p significantly inhibited the luciferase activity of wild type MAPK15 3’UTR plasmid but not that of mutant APK15 3’UTR plasmid in HEK293T cells (Fig. 8 E). Subsequently, we synthesized the MAPK15 overexpression plasmid pIRES2-EGFP-MAPK15 and the interference plasmid si-MAPK15, which were transfected into sheep myoblasts for subsequent validation. We detected a significant increase in MAPK15 expression after transfection of pIRES2-EGFP-MAPK15 (Fig. 8 F). Following transfection of si-MAPK15, we detected a significant decrease in MAPK15 expression (Fig. 8 H). RT-qPCR and Western blot analyses demonstrated that overexpression or inhibition of MAPK15 significantly increased or decreased the expression of CDK2, PCNA, and Pax7 at both the mRNA and protein levels (Fig. 8 G, 8 I-K). CCK-8 and EdU assays illustrated that overexpression of MAPK15 increased the proliferation rate of myoblasts, whereas interference with MAPK15 also inhibited the proliferation rate of myoblasts (Fig. 8 L-O). These findings indicate that MAPK15 acts in concert with circFAM171A1 on sheep myoblasts and that circFAM171A1 realizes the mechanism of ceRNA. In summary, circFAM171A1 acted as a sponge of oar-miR-485-5p, weakened its inhibitory effect on MAPK15, and promoted the proliferation of sheep myoblasts. 3.9 Estrogen regulates sheep myoblast proliferation through the circFAM171A1/oar-miR-485-5p/MAPK15 pathway In order to study the influence of estrogen on the proliferation of sheep myoblasts, we examined the proliferation of myoblasts after the addition of 10 nM estradiol. RT-qPCR and Western blotting indicated that the levels of PCNA and CDK2 expression in the estradiol-treated group were significantly elevated (Fig. 9 A, 9 B), and the proliferation rate of sheep myoblasts with an estradiol concentration of 10 nM was significantly higher, as indicated by the results of CCK8 and EdU assays (Fig. 9 C, 9 D). To verify the pathway of estrogen regulation of myoblast proliferation, we validated the level of expression of oar-miR-485-5p and MAPK15 in sheep myoblasts after addition of estrogen. The findings indicated that the expression level of oar-miR-485-5p was significantly declined, while the protein and mRNA levels of MAPK15 were significantly increased ( P < 0.05) (Fig. 9 A, 9 B). The foregoing findings indicated that estrogen could facilitate the proliferation of sheep myoblasts through the circFAM171A1/oar-miR-485-5p/MAPK15 pathway (Fig. 9 E). 4 Discussion The important role of estrogen in female mammalian reproduction is well known. However, its functions are not limited to the reproductive system, but also play important roles in different physiological processes such as cardiovascular, skeletal muscle and neural networks, which are often overlooked [ 41 ] . In living organisms, the estrogen receptors ERα, ERβ and the G protein-coupled estrogen receptor (GPER) play a key role. The coordinated action of these three receptors in the body ensures the effective action of estrogenic substances on target tissues [ 42 ] . In our bodies, estrogen plays an important role in regulating the growth of bone tissue. However, in women, estrogen deficiency during menopause or after bilateral oophorectomy may lead to loss of cancellous and cortical bone, which in turn can lead to osteoporosis [ 43 – 45 ] . In the current study, the mechanisms of estrogen regulation of muscle development are unclear, which poses a challenge for further research. In this work, we constructed a model of longissimus dorsi muscle of small-tailed Han sheep in sham surgery group (STH) and ovariectomy group (OR-STH), and collected RNA extracted from longissimus dorsi muscle tissue for RNA-seq and molecular biology analysis. We successfully identified 11,297 circRNAs in a comparison between STH group and OR-STH group, of which a total of 118 were differentially expressed circRNAs. In a follow-up study, the researchers analyzed the differentially expressed circRNA host genes for GO terms and KEGG pathway enrichment. This analysis revealed multiple important pathways involved in muscle growth, development and degradation, such as the AMPK signaling pathway, ECM receptor interactions, ErbB signaling pathway, ubiquitin-mediated protein hydrolysis and mTOR signaling pathway. These pathways play key roles in muscle development and are important for muscle growth and functional maintenance [ 46 – 49 ] . As key gene expression regulators, circRNAs play an important role in animal growth and development. Our study revealed that changes in circRNA abundance may be associated with ovariectomy. Further studies on the role of circRNAs in skeletal muscle growth and development will help to gain insight into the relevant physiological mechanisms and provide useful references for clinical practice. In late years, with the completion of the assembly and annotation of sheep breed genomes, we have a wealth of reference data for sheep transcriptome analysis. As a functionally conserved molecule, circRNA has been shown to be important for animal development and growth in humans and mice [ 47 – 50 ] . However, few studies on functional circRNAs in sheep have been reported. In this study, circRNA sequencing results showed that estrogen induced the production of high abundance of circFAM171A1. Subsequently, we confirmed this result using in vitro addition of different concentrations of estradiol. In the subsequent study, we used cell transfection technique to investigate the key role of circFAM171A1 in the proliferation of sheep myoblasts. The experimental results showed that circFAM171A1 had a significant promotional effect on the proliferation of myoblasts. This finding reveals the important role of circFAM171A1 in sheep muscle progression and provides a basis for further research on the function of circRNAs in mammalian muscle biology. Increasingly, circRNAs have been found to function as miRNA sponges in the cytoplasm. This phenomenon was exemplified by circRNA-UBE2G1, a circRNA found mainly in the cytoplasm. circRNA-UBE2G1 was found to act as a sponge for miR-373 to modulate chondrocyte damage after lipopolysaccharide (LPS) treatment [ 46 ] . CircFGFR2 is located in the cytoplasm and can serve as a molecular sponge for miR-133a-5p and miR-29b-1-5p to promote myoblast proliferation and differentiation [ 47 ] . In the present study, we confirmed that circFAM171A1 was mostly distributed in the cytoplasm through nucleoplasmic separation and fluorescence in situ hybridization (FISH) experiments. Transcriptome integration analysis showed that circFAM171A1 could function as a ceRNA and mediate the expression of oar-miR-485-5p and MAPK15. Notably, miR-485-5p has been shown to be closely associated with the prevention and treatment of kidney and ovarian cancer [ 48 , 49 ] . Furthermore, there is substantial evidence that miR-485-5p can function by binding to circRNAs. For example, circRUNX1 elevates SLC38A1 by adsorbing miR-485-5p to promote colorectal cancer cell growth, metastasis, and glutamine metabolism [ 50 ] . CircFOXK2 can bind miR-485-5p and activate PD-L1, thereby accelerating the development of non-small cell lung cancer (NSCLC) [ 51 ] . Circ_0008529 modulates high glucose (HG)-induced apoptosis and inflammatory injury in human kidney cells (HK-2) by targeting the miR-485-5p/WNT2B pathway, showing that Circ_0008529 plays a key role in the development of diabetic nephropathy (DN) [ 52 ] . In our study, it was confirmed by dual luciferase reporter assay that circFAM171A1 was able to bind oar-miR-485-5p. Functional study further revealed that oar-miR-485-5p could inhibit the proliferation of sheep primary myoblasts. However, over-expression of circFAM171A1 attenuated or even reversed this inhibitory effect. These results indicated that the effect of oar-miR-485-5p is opposite to that of circFAM171A1, implying that circFAM171A1 acts as a sponge for oar-miR-485-5p to regulate the proliferation of sheep myoblasts. These findings provided an important basis for further exploring the function of circRNA in biology and medicine. The discovery that MAPK15, ERK8 and MAPK7 (ERK7) are atypical members of the MAP kinase family has provided a new perspective on the study of the MAP kinase family, a group of serine/threonine kinases that are widely found in eukaryotes and play key roles in cell growth, differentiation, apoptosis and other biological processes [ 53 ] , MAPK8 and MAPK11 are also important members of the MAP kinase family [ 21 ] . MAPK8 and MAPK11 are also important members of the MAP kinase family, which makes the study of the MAP kinase family more colorful. It was demonstrated that circACTA1 has the property of acting as a miR199a-5p and miR-433 sponge, thereby eliminating the inhibitory effect on these target genes, MAP3K11 and MAPK8. circACTA1 further affects the biological behaviors of bovine primary myoblasts by activating the MAP3K11/MAP2K7/JNK signaling pathway. During cell proliferation, apoptosis and differentiation, circACTA1 plays an important regulatory role [ 21 ] . Moreover, miR-138 prevents anoxia-induced apoptosis in cardiomyocytes through the MAP3K11/JNK/c-Jun pathway [ 54 ] . Recent studies have shown that MAPK15 intervenes in BCR-ABL the 1-induced phagocytosis and modulates cancer gene-dependent cell proliferation and neighboring tumor formation [ 55 ] . Building on these findings, we hypothesized that circFAM171A1 modulates cell growth through the oar-miR-485-5p/MAPK15 signaling pathway. In the present study, overexpression of circFAM171A1 significantly enhanced the expression of MAPK15. However, interference with circFAM171A1 obtained the opposite result. Transfection of mimics of oar-miR-485-5p significantly decreased MAPK15 expression, but inhibitors of oar-miR-485-5p also obtained the opposite result. These results suggested that circFAM171A1 can regulate sheep myoblast proliferation via the oar-miR-485-5p/MAPK15 pathway. Estrogen deficiency has been found to induce hormonal endocrine and metaphorical disruption in women after menopause, resulting in osteoporosis, metabolic syndrome, and loss of muscle force and mass [ 56 ] . Studies have shown that estrogen therapy reduces hepatic lipoatrophy by hastening liver aquaporin 7 (AQP7) secretion in an ovariectomized (OR) mouse phantom and a steatosis cell model [ 57 ] . Seko et al. confirmed that estrogen has a modulatory role in muscle growing and rejuvenation in young adult female mice via ERβ in bone-muscle-specific stem cells [ 58 ] . We found that the addition of estradiol to sheep myoblasts promoted their proliferation and that the expression level of oar-miR-485-5p was decreased while that of MAPK15 was increased. These results suggested that the addition of appropriate levels of estrogen stimulates the growth and proliferation of sheep myoblasts through the circFAM171A1/oar-miR-485-5p/MAPK15 pathway. 5 Conclusion In this study, we found that estrogen induced circFAM171A1 expression in sheep myoblasts. Transcriptome integration analysis showed that circFAM171A1 could act as a ceRNA to regulate the expression of oar-miR-485-5p and MAPK15 in sheep myoblasts. In vitro addition of estrogen promoted myoblast proliferation through the circFAM171A1/oar-miR-485-5p/MAPK15 pathway. These findings offer new perspectives for further knowledge of estrogen regulation of myoblast proliferation in female animals and contribute to shaping our insights into the molecular processes by which estrogen affects muscle uptake and growth. Declarations Ethics approval and consent to participate The study was approved by the IAS-CAAS Animal Ethics Committee under approval number IAS2019-63. Under the premise of strict compliance with relevant regulations, scientists are committed to promoting animal science research in order to contribute to the development of agriculture in our country. Consent for publication All the authors involved in this manuscript give the consent for the publication. Availability of data and material All the data supporting the findings of this study are available within the manuscript. Data will be made available on reasonable request, not applicable for material. Competing interests The authors have declared no conflict of interest. Author Contributions Conceptualization: Runqing Chi, Yufang Liu, Peng Wang. Formal analysis: Runqing Chi, Peng Wang. Funding acquisition: Mingxing Chu. Investigation: Runqing Chi, Yufang Liu, Peng Wang. Project administration: Yufang Liu, Ran Di, Mingxing Chu. Resources: Peng Wang,Fan Yang, Xiangyu Wang. Validation: Runqing Chi, Fan Yang. Writing – original draft: Runqing Chi, Yufang Liu. Writing – review & editing: Runqing Chi, Yufang Liu, Peng Wang, Fan Yang, Xiangyu Wang, Xiaoyun He, Ran Di, Mingxing Chu. Acknowledgements The author wishes to thank all participants of technical and academic support. Funding This research was funded by the Program of Anhui Provincial Key Laboratory of Livestock and Poultry Product Safety Engineering (XM2404), the National Natural Science Foundation of China (32172704), the Agricultural Science and Technology Innovation Program of China (CAAS-ZDRW202106 and ASTIP-IAS13), the China Agriculture Research System of MOF and MARA (CARS-38) and the Postdoctoral Fellowship Program of CPSF (GZC20233053). References Collins BC, Laakkonen EK, Lowe DA (2019) Aging of the musculoskeletal system: How the loss of estrogen impacts muscle strength. Bone 123:137–144 Vasconsuelo A, Milanesi L, Boland R (2010) Participation of HSP27 in the antiapoptotic action of 17beta-estradiol in skeletal muscle cells. Cell stress chaperones 15(2):183–192 Boland R, Vasconsuelo A, Milanesi L, Ronda AC, de Boland AR (2008) 17beta-estradiol signaling in skeletal muscle cells and its relationship to apoptosis. Steroids 73(9–10):859–863 La Colla A, Boland R, Vasconsuelo A (2015) 17β-Estradiol Abrogates Apoptosis Inhibiting PKCδ, JNK, and p66Shc Activation in C2C12 Cells. J Cell Biochem 116(7):1454–1465 La Colla A, Vasconsuelo A, Boland R (2013) Estradiol exerts antiapoptotic effects in skeletal myoblasts via mitochondrial PTP and MnSOD. J Endocrinol 216(3):331–341 La Colla A, Vasconsuelo A, Milanesi L, Pronsato L (2017) 17β-Estradiol Protects Skeletal Myoblasts From Apoptosis Through p53, Bcl-2, and FoxO Families. J Cell Biochem 118(1):104–115 Ronda AC, Vasconsuelo A, Boland R (2010) Extracellular-regulated kinase and p38 mitogen-activated protein kinases are involved in the antiapoptotic action of 17beta-estradiol in skeletal muscle cells. J Endocrinol 206(2):235–246 Ronda AC, Vasconsuelo A, Boland R (2013) 17β-estradiol protects mitochondrial functions through extracellular-signal-regulated kinase in C2C12 muscle cells. Cell Physiol biochemistry: Int J experimental Cell Physiol Biochem Pharmacol 32(4):1011–1023 Paroo Z, Dipchand ES, Noble EG (2002) Estrogen attenuates postexercise HSP70 expression in skeletal muscle. Am J Physiol Cell Physiol 282(2):C245–251 Paroo Z, Tiidus PM, Noble EG (1999) Estrogen attenuates HSP 72 expression in acutely exercised male rodents. Eur J Appl Physiol Occup Physiol 80(3):180–184 Bombardier E, Vigna C, Bloemberg D, Quadrilatero J, Tiidus PM, Tupling AR (2013) The role of estrogen receptor-α in estrogen-mediated regulation of basal and exercise-induced Hsp70 and Hsp27 expression in rat soleus. Can J Physiol Pharmacol 91(10):823–829 Bombardier E, Vigna C, Iqbal S, Tiidus PM, Tupling AR (2009) Effects of ovarian sex hormones and downhill running on fiber-type-specific HSP70 expression in rat soleus. J Appl Physiol (Bethesda Md: 1985) 106(6):2009–2015 Wang H, Alencar A, Lin M, Sun X, Sudo RT, Zapata-Sudo G, Lowe DA, Groban L (2016) Activation of GPR30 improves exercise capacity and skeletal muscle strength in senescent female Fischer344 × Brown Norway rats. Biochem Biophys Res Commun 475(1):81–86 Karvinen S, Juppi HK, Le G, Cabelka CA, Mader TL, Lowe DA, Laakkonen EK (2021) Estradiol deficiency and skeletal muscle apoptosis: Possible contribution of microRNAs. Exp Gerontol 147:111267 Wang L, Yi J, Lu LY, Zhang YY, Wang L, Hu GS, Liu YC, Ding JC, Shen HF, Zhao FQ et al (2021) Estrogen-induced circRNA, circPGR, functions as a ceRNA to promote estrogen receptor-positive breast cancer cell growth by regulating cell cycle-related genes. Theranostics 11(4):1732–1752 Jeck WR, Sharpless NE (2014) Detecting and characterizing circular RNAs. Nat Biotechnol 32(5):453–461 Li Z, Huang C, Bao C, Chen L, Lin M, Wang X, Zhong G, Yu B, Hu W, Dai L et al (2015) Exon-intron circular RNAs regulate transcription in the nucleus. Nat Struct Mol Biol 22(3):256–264 Ashwal-Fluss R, Meyer M, Pamudurti NR, Ivanov A, Bartok O, Hanan M, Evantal N, Memczak S, Rajewsky N, Kadener S (2014) circRNA biogenesis competes with pre-mRNA splicing. Mol Cell 56(1):55–66 Starke S, Jost I, Rossbach O, Schneider T, Schreiner S, Hung LH, Bindereif A (2015) Exon circularization requires canonical splice signals. Cell Rep 10(1):103–111 Chen W, Schuman E (2016) Circular RNAs in Brain and Other Tissues: A Functional Enigma. Trends Neurosci 39(9):597–604 Qi A, Ru W, Yang H, Yang Y, Tang J, Yang S, Lan X, Lei C, Sun X, Chen H (2022) Circular RNA ACTA1 Acts as a Sponge for miR-199a-5p and miR-433 to Regulate Bovine Myoblast Development through the MAP3K11/MAP2K7/JNK Pathway. J Agric Food Chem 70(10):3357–3373 Chen B, Yu J, Guo L, Byers MS, Wang Z, Chen X, Xu H, Nie Q (2019) Circular RNA circHIPK3 Promotes the Proliferation and Differentiation of Chicken Myoblast Cells by Sponging miR-30a-3p. Cells 8(2) Zhu M, Lian C, Chen G, Zou P, Qin BG (2021) CircRNA FUT10 regulates the regenerative potential of aged skeletal muscle stem cells by targeting HOXA9. Aging 13(13):17428–17441 Yang Z, Song C, Jiang R, Huang Y, Lan X, Lei C, Qi X, Zhang C, Huang B, Chen H (2022) CircNDST1 Regulates Bovine Myoblasts Proliferation and Differentiation via the miR-411a/Smad4 Axis. J Agric Food Chem 70(32):10044–10057 Du WW, Yang W, Liu E, Yang Z, Dhaliwal P, Yang BB (2016) Foxo3 circular RNA retards cell cycle progression via forming ternary complexes with p21 and CDK2. Nucleic Acids Res 44(6):2846–2858 Legnini I, Di Timoteo G, Rossi F, Morlando M, Briganti F, Sthandier O, Fatica A, Santini T, Andronache A, Wade M et al (2017) Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Mol Cell 66(1):22–37e29 Wei X, Li H, Yang J, Hao D, Dong D, Huang Y, Lan X, Plath M, Lei C, Lin F et al (2017) Circular RNA profiling reveals an abundant circLMO7 that regulates myoblasts differentiation and survival by sponging miR-378a-3p. Cell Death Dis 8(10):e3153 Sun J, Xie M, Huang Z, Li H, Chen T, Sun R, Wang J, Xi Q, Wu T, Zhang Y (2017) Integrated analysis of non-coding RNA and mRNA expression profiles of 2 pig breeds differing in muscle traits. J Anim Sci 95(3):1092–1103 Yue B, Wang J, Song C, Wu J, Cao X, Huang Y, Lan X, Lei C, Huang B, Chen H (2019) Biogenesis and ceRNA role of circular RNAs in skeletal muscle myogenesis. Int J Biochem Cell Biol 117:105621 Chen MM, Zhao YP, Zhao Y, Deng SL, Yu K (2021) Regulation of Myostatin on the Growth and Development of Skeletal Muscle. Front cell Dev biology 9:785712 Buckingham M, Relaix F (2015) PAX3 and PAX7 as upstream regulators of myogenesis. Semin Cell Dev Biol 44:115–125 Megeney LA, Rudnicki MA (1995) Determination versus differentiation and the MyoD family of transcription factors. Biochem cell biology = Biochimie et Biol cellulaire 73(9–10):723–732 Daubas P, Buckingham ME (2013) Direct molecular regulation of the myogenic determination gene Myf5 by Pax3, with modulation by Six1/4 factors, is exemplified by the – 111 kb-Myf5 enhancer. Dev Biol 376(2):236–244 Kassar-Duchossoy L, Gayraud-Morel B, Gomès D, Rocancourt D, Buckingham M, Shinin V, Tajbakhsh S (2004) Mrf4 determines skeletal muscle identity in Myf5:Myod double-mutant mice. Nature 431(7007):466–471 Fan CM, Li L, Rozo ME, Lepper C (2012) Making skeletal muscle from progenitor and stem cells: development versus regeneration. Wiley interdisciplinary reviews Dev biology 1(3):315–327 Yin H, Price F, Rudnicki MA (2013) Satellite cells and the muscle stem cell niche. Physiol Rev 93(1):23–67 Xie C, Mao X, Huang J, Ding Y, Wu J, Dong S, Kong L, Gao G, Li CY, Wei L (2011) KOBAS 2.0: a web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res 39(Web Server issue):W316–322 Wang X, Cao X, Dong D, Shen X, Cheng J, Jiang R, Yang Z, Peng S, Huang Y, Lan X et al (2019) Circular RNA TTN Acts As a miR-432 Sponge to Facilitate Proliferation and Differentiation of Myoblasts via the IGF2/PI3K/AKT Signaling Pathway. Mol therapy Nucleic acids 18:966–980 Xiong Y, Zhang J, Song C (2019) CircRNA ZNF609 functions as a competitive endogenous RNA to regulate FOXP4 expression by sponging miR-138-5p in renal carcinoma. J Cell Physiol 234(7):10646–10654 Kristensen LS, Andersen MS, Stagsted LVW, Ebbesen KK, Hansen TB, Kjems J (2019) The biogenesis, biology and characterization of circular RNAs. Nat Rev Genet 20(11):675–691 Mauvais-Jarvis F, Clegg DJ, Hevener AL (2013) The role of estrogens in control of energy balance and glucose homeostasis. Endocr Rev 34(3):309–338 Eyster KM (2016) The Estrogen Receptors: An Overview from Different Perspectives. Methods Mol biology (Clifton NJ) 1366:1–10 Pöllänen E, Sipilä S, Alen M, Ronkainen PH, Ankarberg-Lindgren C, Puolakka J, Suominen H, Hämäläinen E, Turpeinen U, Konttinen YT et al (2011) Differential influence of peripheral and systemic sex steroids on skeletal muscle quality in pre- and postmenopausal women. Aging Cell 10(4):650–660 Gillies GE, McArthur S (2010) Estrogen actions in the brain and the basis for differential action in men and women: a case for sex-specific medicines. Pharmacol Rev 62(2):155–198 Dumont NA, Bentzinger CF, Sincennes MC, Rudnicki MA (2015) Satellite Cells and Skeletal Muscle Regeneration. Compr Physiol 5(3):1027–1059 Chen G, Liu T, Yu B, Wang B, Peng Q (2020) CircRNA-UBE2G1 regulates LPS-induced osteoarthritis through miR-373/HIF-1a axis. Cell cycle (Georgetown Tex) 19(13):1696–1705 Chen X, Ouyang H, Wang Z, Chen B, Nie Q (2018) A Novel Circular RNA Generated by FGFR2 Gene Promotes Myoblast Proliferation and Differentiation by Sponging miR-133a-5p and miR-29b-1-5p. Cells 7(11) Liu H, Hu G, Wang Z, Liu Q, Zhang J, Chen Y, Huang Y, Xue W, Xu Y, Zhai W (2020) circPTCH1 promotes invasion and metastasis in renal cell carcinoma via regulating miR-485-5p/MMP14 axis. Theranostics 10(23):10791–10807 Wang W, Yu S, Li W, Hu H, Zou G (2022) Silencing of lncRNA SNHG17 inhibits the tumorigenesis of epithelial ovarian cancer through regulation of miR-485-5p/AKT1 axis. Biochem Biophys Res Commun 637:117–126 Yu J, Chen X, Li J, Wang F (2021) CircRUNX1 functions as an oncogene in colorectal cancer by regulating circRUNX1/miR-485-5p/SLC38A1 axis. Eur J Clin Invest 51(7):e13540 Zhang N, Fan J, Deng Z (2022) CircFOXK2 enhances tumorigenesis and immune evasion in non-small cell lung cancer by miR-485-5p/PD-L1 axis. Anticancer Drugs 33(5):437–447 Wang W, Lu H (2022) High Glucose-Induced Human Kidney Cell Apoptosis and Inflammatory Injury Are Alleviated by Circ_0008529 Knockdown via Circ_0008529-Mediated miR-485-5p/WNT2B Signaling. Appl Biochem Biotechnol 194(12):6287–6301 Franci L, Tubita A, Bertolino FM, Palma A, Cannino G, Settembre C, Rasola A, Rovida E, Chiariello M (2022) MAPK15 protects from oxidative stress-dependent cellular senescence by inducing the mitophagic process. Aging Cell 21(7):e13620 He S, Liu P, Jian Z, Li J, Zhu Y, Feng Z, Xiao Y (2013) miR-138 protects cardiomyocytes from hypoxia-induced apoptosis via MLK3/JNK/c-jun pathway. Biochem Biophys Res Commun 441(4):763–769 Colecchia D, Rossi M, Sasdelli F, Sanzone S, Strambi A, Chiariello M (2015) MAPK15 mediates BCR-ABL1-induced autophagy and regulates oncogene-dependent cell proliferation and tumor formation. Autophagy 11(10):1790–1802 Ikeda K, Horie-Inoue K, Inoue S (2019) Functions of estrogen and estrogen receptor signaling on skeletal muscle. J Steroid Biochem Mol Biol 191:105375 Fu X, Xing L, Xu W, Shu J (2016) Treatment with estrogen protects against ovariectomy-induced hepatic steatosis by increasing AQP7 expression. Mol Med Rep 14(1):425–431 Seko D, Fujita R, Kitajima Y, Nakamura K, Imai Y, Ono Y (2020) Estrogen Receptor β Controls Muscle Growth and Regeneration in Young Female Mice. Stem cell Rep 15(3):577–586 Supplementary Files S1ORSTHvsSTH.Differentialanalysisresults.xls S2ORSTHvsSTH.DEG.GOenrichment.xls S3ORSTHvsSTH.DEG.KEGGenrichment.xls Cite Share Download PDF Status: Published Journal Publication published 19 Mar, 2025 Read the published version in Cellular and Molecular Life Sciences → Version 1 posted Editorial decision: Major Revision 19 Sep, 2024 Reviewers agreed at journal 17 Aug, 2024 Reviewers invited by journal 16 Aug, 2024 Editor assigned by journal 02 Aug, 2024 First submitted to journal 01 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4806193","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":341329364,"identity":"6e084852-4c77-4777-a937-d93534d43e8c","order_by":0,"name":"Runqing Chi","email":"","orcid":"","institution":"Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Runqing","middleName":"","lastName":"Chi","suffix":""},{"id":341329365,"identity":"65b556ac-8a62-44e6-a865-38267a326e15","order_by":1,"name":"Yufang Liu","email":"","orcid":"","institution":"Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Yufang","middleName":"","lastName":"Liu","suffix":""},{"id":341329366,"identity":"1616d14b-1d10-4888-9e8d-95dc90cae5e0","order_by":2,"name":"Peng Wang","email":"","orcid":"","institution":"Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Peng","middleName":"","lastName":"Wang","suffix":""},{"id":341329367,"identity":"56c6fb0d-79a2-491c-9d51-f5f376ce8367","order_by":3,"name":"Fan Yang","email":"","orcid":"","institution":"Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Fan","middleName":"","lastName":"Yang","suffix":""},{"id":341329368,"identity":"93e724c4-e9d8-41e5-89f6-fdfdea869ca2","order_by":4,"name":"Xiangyu Wang","email":"","orcid":"","institution":"Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Xiangyu","middleName":"","lastName":"Wang","suffix":""},{"id":341329369,"identity":"005b8d27-a3e9-4ec8-9ac0-728b4d6990c5","order_by":5,"name":"Xiaoyun He","email":"","orcid":"","institution":"Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Xiaoyun","middleName":"","lastName":"He","suffix":""},{"id":341329370,"identity":"ac2e67cb-6dd1-4acf-8287-970292abf28a","order_by":6,"name":"Ran Di","email":"","orcid":"","institution":"Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Ran","middleName":"","lastName":"Di","suffix":""},{"id":341329371,"identity":"caa05d5e-61e3-4c46-b4ec-9d0bbedb514d","order_by":7,"name":"Mingxing Chu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAp0lEQVRIiWNgGAWjYHACNgaGChs5eRK1nEkzNmwAMg8QrYWx7XAiWDlRWnRnJD97zDuPOYGxgffg4w/EaDE7c8zcmHcbWx47A1+yAVG2mB3vYZPm3cZTzNjAYyZBnJbDPEAtcyQSGw7wmP8gwZYGA5AWM+K8D/SLmeScYwnGhs08xhJniNJyI/mZxJua/3Ly7D2GHyqI0YIAzKQpHwWjYBSMglGADwAAt88vMEv2a70AAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-5164-0310","institution":"Chinese Academy of Agricultural Sciences Institute of Animal Science","correspondingAuthor":true,"prefix":"","firstName":"Mingxing","middleName":"","lastName":"Chu","suffix":""}],"badges":[],"createdAt":"2024-07-26 07:38:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4806193/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4806193/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00018-025-05639-3","type":"published","date":"2025-03-19T15:57:59+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":66548694,"identity":"2abd3082-c9d6-4dcd-aa59-76dd950a7fb0","added_by":"auto","created_at":"2024-10-14 08:47:38","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":450052,"visible":true,"origin":"","legend":"\u003cp\u003eBasic characteristics of circRNAs in muscle tissue of small-tailed Han sheep. (A) Venn diagram of different circRNAs identified in OR-STH and STH. (B) Types of circRNAs in STH. (C) Types of circRNAs in OR-STH. (D) Functional region statistics of circRNAs. (E) Density statistics of circRNAs in OR-STH and STH chromosomes. (F) Chromosome distribution in OR-STH. (G) Chromosome distribution in STH.\u003c/p\u003e","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4806193/v1/ff16e24938f42d62bfea5757.jpg"},{"id":66547862,"identity":"1924edd1-24d4-4472-9644-fee36a8f6d81","added_by":"auto","created_at":"2024-10-14 08:39:35","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5096748,"visible":true,"origin":"","legend":"\u003cp\u003eDifferentially expressed circRNA. (A) Histogram of differentially expressed circRNAs. (B) Scatter plot of differentially expressed circRNAs. (C) Cluster heat map of differentially expressed circRNAs; The horizontal coordinates are the samples and the vertical coordinates are the genes screened out by differential expression. Different colors indicate different gene expression levels. The color changes from blue to white to red, red indicates highly expressed genes and blue indicates lowly expressed genes. (D) Box plot of differentially expressed circRNA. (E) Violin map of differentially expressed circRNA. (F) Comparison of the results of DE circRNAs in RNA-seq and RT-qPCR analysis. (G) Histogram of GO enrichment analysis of differentially expressed circRNA host genes. (H) Scatter plot of KEGG enrichment analysis of differentially expressed circRNA host genes.\u003c/p\u003e","description":"","filename":"Fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4806193/v1/07a28ad44c37f0251c4d9ae1.jpg"},{"id":66547854,"identity":"a66010e0-7f74-4ff9-97c6-8d96ed58574b","added_by":"auto","created_at":"2024-10-14 08:39:29","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":718859,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of differentially expressed circRNAs, miRNAs and mRNAs. (A) circRNA-miRNA-mRNA interaction network. (B) PPI network of differential mRNAs. (C) RT-qPCR validation of differentially expressed circRNA-miRNA-mRNA. U6 and β-actin were used as internal controls.\u003c/p\u003e","description":"","filename":"Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4806193/v1/19e4cf79fef94441143e092d.jpg"},{"id":66547871,"identity":"698668e3-ba0b-483b-aef8-6eb30405c0de","added_by":"auto","created_at":"2024-10-14 08:39:39","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":397030,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of circFAM171A1 in sheep myocytes after addition of estradiol with 0 nM, 1 nM, 10 nM and 100 nM. β-actin were used as internal controls.\u003c/p\u003e","description":"","filename":"Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4806193/v1/ab3d9186da3f6e95980dc7f9.jpg"},{"id":66547857,"identity":"19106404-dd7f-419d-a47a-4eef807022fe","added_by":"auto","created_at":"2024-10-14 08:39:34","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":192834,"visible":true,"origin":"","legend":"\u003cp\u003eIdentification and expression level analysis of circFAM171A1. (A) Schematic showing the circularization of FAM171A1 forming circFAM171A1. The head-to-tail splicing of circFAM171A1 was identified by Sanger sequencing. (B) Resistance to RNase R was tested by RT-qPCR, which showed that circFAM171A1 was more stable than linear FAM171A1. (C) The expression levels of circFAM171A1 in STH and OR-STH groups. (D and E) Nucleoplasmic separation (D) and FISH (E) analysis of cellular localization revealed that circFAM171A1 was mainly localized in the cytoplasm. (F) Immunofluorescence confirmed to be sheep myoblasts.\u003c/p\u003e","description":"","filename":"Fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4806193/v1/f45ce44d7786174d08767454.jpg"},{"id":66547860,"identity":"445eb98c-d027-495c-bf4e-a7505820b0fb","added_by":"auto","created_at":"2024-10-14 08:39:35","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1399749,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of circFAM171A1 on the proliferation of sheep myoblasts. (A) circFAM171A1 was successfully overexpressed in sheep primary myoblasts. (B) Expression levels of CDK2, PCNA and Pax7 was detected by RT-qPCR after overexpression of circFAM171A1. (C) circFAM171A1 was successfully inhibited in sheep primary myoblasts. (D) Expression levels of CDK2, PCNA and Pax7 was detected by RT-qPCR after inhibition of circFAM171A1. (E and F) Protein levels of CDK2, PCNA and Pax7 was detected by Western blots after overexpression or inhibition of circFAM171A1. (G and H) EdU (scale bar, 200 μm) was used to measure the proliferation capacity. (I and J) CCK8 assay for proliferation of overexpression or inhibition of circFAM171A1 in sheep myoblasts.\u003c/p\u003e","description":"","filename":"OnlineFig6.png","url":"https://assets-eu.researchsquare.com/files/rs-4806193/v1/0611ac1e23c2a0c9737211aa.png"},{"id":66547863,"identity":"de50224d-d4bf-46cf-b57c-376467ef126d","added_by":"auto","created_at":"2024-10-14 08:39:36","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1249540,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of oar-miR-485-5p on sheep myoblast proliferation. (A) The proposed circFAM171A1 binding site on oar-miR-485-5p was identified using RNAhybrid. (B) Relative expression of oar-miR-485-5p after successful overexpression of circFAM171A1. (C) The relative expression of oar-miR-485-5p after interfering with circFAM171A1. (D and E) Construction of luciferase expression plasmid with oar-miR-485-5p binding site in circFAM171A1. (F and G) Relative expression of oar-miR-485-5p and expression of CDK2, PCNA and Pax7 after transfection of oar-miR-485-5p mimics. (H and I) Relative expression of oar-miR-485-5p and expression of CDK2, PCNA and Pax7 after transfection with inhibitor of oar-miR-485-5p. (J and K) Protein expression of CDK2, PCNA and Pax7 after transfection with mimics or inhibitors of oar-miR-485-5p. (L and M) After transfection with mimics or inhibitors of oar-miR-485-5p, EdU (scale bar, 200 μm) was used to measure proliferative capacity. (N and O) Proliferative capacity was measured with CCK-8 after transfection with mimics or inhibitors of oar-miR-485-5p.\u003c/p\u003e","description":"","filename":"OnlineFig7.png","url":"https://assets-eu.researchsquare.com/files/rs-4806193/v1/b944b18e7eabf378a4cdd618.png"},{"id":66547855,"identity":"0ab28b05-f73a-4d2a-b965-b4a5a5a8c7f7","added_by":"auto","created_at":"2024-10-14 08:39:30","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1489292,"visible":true,"origin":"","legend":"\u003cp\u003eCircFAM171A1 acts as a sponge for oar-miR-485-5p and impairs the inhibition of MAPK15. (A and B) Expression of MAPK15 protein in sheep muscle tissue. (C) The relative expression of MAPK15 after overexpression or inhibition of circFAM171A1. (D) Relative expression of MAPK15 after transfection with oar-miR-485-5p mimics or inhibitors. (E) Construction of a putative binding site for oar-miR-485-5p in the 3’-UTR of MAPK15 and a luciferase expression plasmid containing the 3’-UTR of MAPK15. (F and G) Relative expression of MAPK15 and expression of CDK2, PCNA and Pax7 after overexpression of MAPK15. (H and I) Relative expression of MAPK15 and expression of CDK2, PCNA and Pax7 after MAPK15 inhibition. (J and K) Overexpression of MAPK15 or interference with protein expression of MAPK15, CDK2, PCNA and Pax7 after transfection. (L and M) After overexpression or interference transfection of MAPK15, EdU (scale bar, 200 μm) was used to measure proliferative capacity. (N and O) After overexpression of MAPK15 or interference transfection, CCK-8 was used to measure proliferative capacity.\u003c/p\u003e","description":"","filename":"OnlineFig8.png","url":"https://assets-eu.researchsquare.com/files/rs-4806193/v1/4c453543ad19d04139553d7c.png"},{"id":66547859,"identity":"f5452946-d048-4a89-bf70-464e6a2a05a6","added_by":"auto","created_at":"2024-10-14 08:39:34","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":1212418,"visible":true,"origin":"","legend":"\u003cp\u003eEstradiol (E\u003csub\u003e2\u003c/sub\u003e) affects the proliferation of sheep myoblasts by circFAM171A1/oar-miR-485-5p/MAPK15 pathway. (A) Expression of oar-miR-485-5p, MAPK15, CDK2 and PCNA in sheep myoblasts after addition of estradiol. β-actin were used as internal controls. (B) Protein expression of MAPK15, PCNA and CDK2 in sheep myoblasts after addition of estradiol. β-tubulin was used as an internal control. (C) CCK-8 assay analysis of the proliferation of sheep myoblasts addition with estradiol. (D) EdU assay analysis of the proliferation of sheep myoblasts addition with estradiol. (E) Sketch map of estrogen regulation of sheep myoblast proliferation through the circFAM171A1/oar-miR-485-5p/MAPK15 pathway. Bar: 200 μm.\u003c/p\u003e","description":"","filename":"OnlineFig9.png","url":"https://assets-eu.researchsquare.com/files/rs-4806193/v1/22ec6d80a557dfd310787bc6.png"},{"id":79120521,"identity":"fb881d08-7da9-4637-9618-a61cb6a2f51a","added_by":"auto","created_at":"2025-03-24 16:09:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":16039277,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4806193/v1/041ff6fc-8cf8-4410-90b6-ae7cbda0d256.pdf"},{"id":66547868,"identity":"8a06144b-4612-4a7e-879c-517fbd0f10e2","added_by":"auto","created_at":"2024-10-14 08:39:38","extension":"xls","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":601116,"visible":true,"origin":"","legend":"","description":"","filename":"S1ORSTHvsSTH.Differentialanalysisresults.xls","url":"https://assets-eu.researchsquare.com/files/rs-4806193/v1/17e4a114c81be304142008a0.xls"},{"id":66548695,"identity":"c1396a45-5dac-45a8-9e6c-ea54481d3a0a","added_by":"auto","created_at":"2024-10-14 08:47:39","extension":"xls","order_by":15,"title":"","display":"","copyAsset":false,"role":"supplement","size":509102,"visible":true,"origin":"","legend":"","description":"","filename":"S2ORSTHvsSTH.DEG.GOenrichment.xls","url":"https://assets-eu.researchsquare.com/files/rs-4806193/v1/557bdbf20a039dcff884de49.xls"},{"id":66547853,"identity":"438cbc65-badd-4847-b1be-66a42165feef","added_by":"auto","created_at":"2024-10-14 08:39:28","extension":"xls","order_by":16,"title":"","display":"","copyAsset":false,"role":"supplement","size":14610,"visible":true,"origin":"","legend":"","description":"","filename":"S3ORSTHvsSTH.DEG.KEGGenrichment.xls","url":"https://assets-eu.researchsquare.com/files/rs-4806193/v1/125149779abfdd20215a29b1.xls"}],"financialInterests":"","formattedTitle":"Estrogen-induced circFAM171A1 regulates sheep myoblasts proliferation through the oar-miR-485-5p/MAPK15/MAPK pathway","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eEstrogen is an important hormone affecting muscle development in female animals. It is mainly secreted by the ovary. The research suggests that estrogen lack induces bone muscle cell apoptosis, leading to a loss of bone muscle quality and force \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. Studies on mouse C2C12 (myoblast) cells have shown that estrogen exposure could protect against hydrogen peroxide-induced apoptosis by up-regulating HSP27, which combines with Caspase-3, blocking it from cleavage and inactivating the inhibitor, thereby modulating the downstream goals of Bcl-2, BAD, AKT, ERK, and MAPK, and ultimately preventing cell death and ultimately preventing apoptosis and promoting the viability of C2C12 cells \u003csup\u003e[\u003cspan additionalcitationids=\"CR3 CR4 CR5 CR6 CR7\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Studies in several rodents have shown that estrogen treatment reduces locomotion-induced HSP70 and HSP72 replays in males or ovariectomized females, but has no effect on HSP27 in stifle muscles \u003csup\u003e[\u003cspan additionalcitationids=\"CR10 CR11\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. Wang also revealed that the underlying protein ranks of HSP70, HSP27, and HSP90 in bone muscle were reduced in female rats after the loss of estrogen \u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. In addition, Karvinen et al. identified that estrogen resistance down-regulates a variety of miRNAs that may inhibit the apoptotic pathway, thus leading to enhanced cell death and loss of bone muscle quality \u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. However, the detailed molecular mechanisms of estrogen on muscle development remain unclear.\u003c/p\u003e \u003cp\u003eEstrogen may play a biological role by inducing the production of circRNA. In studies of ER-positive breast cancer, estrogen was found to induce the production of circPGR, which is positioned in the stroma of the cell and serves as a rival internal RNA (ceRNA) to the sponge miR-301a-5p, regulating the development of a number of cell cycle factors \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Thus, the mechanism of action by which estrogen functions in animals has been further understood. CircRNA in animals was produced by cyclization of specific exons \u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e or a few introns \u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e, and it is a particularly stable RNA. In vivo, circRNA is produced from the spliceosome by reverse splice: the 3\u0026rsquo; side of the exon is attached by covalent splicing to the 5\u0026rsquo; side of the upstairs exon and is immune to the nucleic acid epimerase RNase R. The circRNA is also resistant to the nucleic acid epimerase RNase R \u003csup\u003e[\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. CircRNAs play a critical function in the development of animal muscle, not only through the competitive endogenous RNA to regulate the expression of miRNAs, but also can bind to proteins to constitute functional communities, which are involved with the modulation of biological functions \u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. For example, circHIPK3 can promote skeletal muscle development in chicken embryos by sponging miR-30a-3p \u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. CircRNA FUT10 aims to target HOXA9 by combining with miR-365a-3p to ameliorate degenerative muscle disorders \u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. CircNDST1 governs the bovine myogenic cell multiplication and specialization through the miR-411a/Smad4 axial \u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. CircFoxo3 delays cell cytosolic advancement by entering into a triplet complicated with p21 and CDK2 \u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. Therefore, the above studies suggested that estrogen can first induce specific circRNA, and further this circRNA can regulate miRNA-gene-pathway to participate in muscle development.\u003c/p\u003e \u003cp\u003eThe most of these circRNAs have been characterized in human, mouse, bovine, and porcine myoblasts. The spectrum of expression of circRNAs throughout in vitro myoblast differentiation in mouse and human cells has been analyzed, and conservative circRNAs have been identified across species during the process of myogenesis and the development of Duchenne dystrophy \u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. Wei obtained circRNA profiles of bovine skeletal muscle at two stages of development (embryonic and mature muscle), revealing for the first time their hidden participation in bovine muscle formation \u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. Sun et al. demonstrated that a number of circRNAs are involved in muscle growth in the \u003cem\u003elongissimus dorsi\u003c/em\u003e muscles of Rand and Blue Pond pigs \u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. Studies have also identified circRNAs in sheep muscle, but have not yet revealed differences in the expression and action of circRNAs in the muscles of ovariectomized and intact sheep.\u003c/p\u003e \u003cp\u003eSkeletal muscle derives and originates from myogenic progenitor cells (MPC), which mainly includes somatic and myogenic cell multiplication and polarization, myotube fusion, and myofibril formation \u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. Myogenesis is regulated by myogenic factors, including the Pax families Pax3 and Pax7 \u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e, and the MRF families (Myf5, MyoD, MyoG, and MRF4) \u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. Pax3 was required for the migration of MPCs and, together with a family of MRFs, for mediating the myoblasts program. Pax3 activates Myf5, which, together with MRF4, determines the myoblasts process of proliferation and differentiation.Pax3 is also required for the migration of MPCs and, together with a family of MRFs, for the mediation of the myoblasts program.Pax3 is required for the migration of MPCs and, together with a family of MRFs, for the mediation of the myoblasts program \u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. P-CaMK-II promotes myogenic differentiation and the formation of type II myofibers by inhibiting β-catenin and p-ERK1/2 dephosphorylation under the activation of the Zac1/GPR39 system \u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. Muscle MSCs also give rise to muscle stem cells (also called satellite cells) that are activated immediately after muscle damage and split into proliferating myoblasts, which are characterized by the presence of Pax7 and MyoD \u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. Although the transcriptional regulation of myogenesis has been explored, the essential function of non-coding RNAs (e.g. circRNA and miRNA) during myogenesis are very worth further investigating.\u003c/p\u003e \u003cp\u003eThe objective of this work was to characterize estrogen-induced circRNAs with potential functions in modulating muscle development in sheep. Making use of high-throughput RNA sequencing we first investigated systematically the expression profiles and functions of circRNAs in \u003cem\u003elongissimus dorsi\u003c/em\u003e muscle of 8-month-old small-tailed Han sheep with and without ovaries. Here, one significantly up-regulated circRNAs (novel_circ_0011822) in intact ewes, which was named circFAM171A1 based on its source gene, was highlighted. Then bioinformatics analysis showed that circFAM171A1-oar-miR-485-5p-MAPK15 could form ceRNA, in which MAPK15 is an important gene in the MAPK signaling pathway. In addition, we verified the influence of estrogen-induced ceRNA on the growth and progression of sheep myoblasts in vitro. These findings will help to discover the molecular mechanisms by which estrogen regulates muscle progression in sheep.\u003c/p\u003e"},{"header":"2 Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Ethics statement\u003c/h2\u003e \u003cp\u003e The study was approved by the IAS-CAAS Animal Ethics Committee under approval number IAS2019-63. Under the premise of strict compliance with relevant regulations, scientists are committed to promoting animal science research in order to contribute to the development of agriculture in our country.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Sample collection and preparation\u003c/h2\u003e \u003cp\u003eIn this study, we selected 10 small-tailed Han sheep ewes aged 2 months from the Wulat Zhongqi Farm, Bayannur City, Inner Mongolia Autonomous Region, China. For comparative observations, the sheep were randomized into two groups: ovariectomized group (n\u0026thinsp;=\u0026thinsp;5, OR-STH) and sham surgery (n\u0026thinsp;=\u0026thinsp;5, STH). There were no significant differences between the two groups in terms of height, weight, and age. After surgery, both groups of sheep were kept in the same feeding environment. Over a 6-month period, sheep weights were measured and tissue samples were collected from the \u003cem\u003elongissimus dorsi\u003c/em\u003e muscle. Mean body weight was 72.4\u0026thinsp;\u0026plusmn;\u0026thinsp;1.86 kg and 88.4\u0026thinsp;\u0026plusmn;\u0026thinsp;3.97 kg in the OR-STH and STH groups, respectively (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Estrogen levels in the serum of sheep were 28.71\u0026thinsp;\u0026plusmn;\u0026thinsp;2.73 pg/mL and 12.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.82 pg/mL in the STH group and OR-STH group, respectively (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). All tissue samples were immediately frozen in liquid nitrogen to ensure the stability of the samples. Subsequently, the samples were stored in a cryogenic environment at -80 ℃ in order to maintain their original condition when further analysis was performed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Library preparation and Illumina sequencing\u003c/h2\u003e \u003cp\u003eIn this study, we first extracted total RNA from 10 muscle tissue powders using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), strictly following the manufacturer\u0026rsquo;s instructions. The total amount of RNA extracted was 2 \u0026micro;g (concentration\u0026thinsp;\u0026ge;\u0026thinsp;300 ng/\u0026micro;L, OD260/280 between 1.8 and 2.2), which was used as raw material for constructing miRNA and cDNA libraries. To remove ribosomal RNA (rRNA), we employed the Epicentre Ribo-Zero\u0026trade; rRNA Removal Kit (Epicentre, Madison, WI, USA). After rRNA removal, we constructed sequencing libraries using the NEBNext\u0026reg; Ultra\u0026trade; Directional RNA Library Prep Kit for Illumina\u0026reg; (NEB, Ipswich, MA, USA) following the manufacturer\u0026rsquo;s instructions. Throughout the process, we also purified the products using the AMPure XP system and assessed the quality of the library by gel electrophoresis, NanoDrop 2000, Qubit 2.0, and Agilent Bioanalyzer 2100 systems. Finally, the libraries were sequenced on an Illumina Hiseq 2500 platform, yielding 150 bp paired end reads.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Identification of differentially expressed circRNAs, miRNAs and mRNAs\u003c/h2\u003e \u003cp\u003eIn the present work, we first approximated the levels of expression of circRNAs in the built muscle tissue libraries by Illumina sequencing data and FPKM/readcount of these values. To recognize differentially expressing genes (DEGs), we used the DE-Seq R software package (version 4.2.1). In the DE-Seq analysis, we used a threshold of q-value less than 0.05 and |log2FoldChange| greater than 1 to adjust for DE genes. Next, we used the DEG-seq R package to analyze differentially expressed modules (DEMs) and differentially expressed clusters (DECs) based on normalized reads per thousand bases per mil (TPM) values. During the analysis, we modified the q-value and set the thresholds for significant DEMs and DECs as q-value less than 0.05 and |log2FoldChange| greater than 1. This series of analyses provided us with information about the differential expression of circRNAs in muscle tissues as well as the related genes, which provided an important basis for further studies.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Comprehensive functional enrichment analysis\u003c/h2\u003e \u003cp\u003eIn the present study, we used functional annotation to analyze DE circRNA host genes based on GO and KEGG annotations. First, for the source genes, we performed GO annotation based on the corresponding genes and their GO annotations in NCBI. This information was stored in the following database: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ftp.ncbi.nlm.nih.gov/gene/DATA/gene2go.gz\u003c/span\u003e\u003cspan address=\"https://ftp.ncbi.nlm.nih.gov/gene/DATA/gene2go.gz\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Next, we used KOBAS software to test the statistical enrichment of host genes associated with DE circRNAs in the KEGG pathway \u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e. To determine the significance of the enrichment analysis, we set a threshold of \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05. This series of functional annotation analyses helped us to gain a deeper understanding of the functions of DE circRNAs in organisms and the roles of their related genes in specific pathways.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 ceRNA and PPI networks\u003c/h2\u003e \u003cp\u003eWe first built a ceRNA network that is based on forecast circRNA, miRNA and mRNA binding sites from whole transcriptome sequencing, and demonstrated the circRNA-miRNA-mRNA interface network using Cytoscape software. This step helped us to understand the function of circRNAs in organisms and their interaction relationship with other genes. Next, we constructed protein-protein interaction (PPI) networks of differentially expressed genes (DEGs) using STRING (version 11.5, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://string-db.org/\u003c/span\u003e\u003cspan address=\"https://string-db.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). For PPI analysis, we used the STRING database v11.5 (species: \u003cem\u003eOvis aries\u003c/em\u003e). In constructing the PPI network, we collected target genes from the database and selected protein pairs with a score greater than 700 from the STRING database. Finally, we used Cytoscape software to visualize the protein pairs. This series of analyses helped us to gain insight into the interactions between DEGs, providing strong support for studying the physiological functions of organisms and the mechanisms of disease occurrence.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Immunofluorescence (IF)\u003c/h2\u003e \u003cp\u003eWe first inoculated sheep primary myoblasts in 6-well plates maintained at a population density of 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells per well, with each group containing three replicates. Next, polylysine-treated glass crawlers were placed in the 6-well plates and removed after 16 h. To fix the cells, we treated them with 4% formaldehyde for 15 min and then washed them with PBS 3 times for 3 min each. Next, 10% goat serum (China) was incubated for 30 min. For immunofluorescence staining, we used appropriate amounts of Desmin (1:500) and MYOD1 (1:500) antibodies (Proteintech, USA) for overnight incubation at 4 ℃. After the incubation was completed, the membrane was washed with PBS five times for 5 min each. Next, incubation was performed with appropriate amount of fluorescent IgG (1:2000) (Saixin, China) for 1 h at 37 ℃. Finally, DAPI (Beyotime, China) was added to stain the nuclei for 5 min and washed 5 times for 5 min each. Through this series of experimental manipulations, we successfully isolated sheep primary myoblasts, which provided the basis for subsequent studies.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Ribonuclease R (RNase R)\u003c/h2\u003e \u003cp\u003eThe 1 \u0026micro;g of sheep muscle tissue RNA was added to RNase R reagent (1 U/\u0026micro;g) and incubated at 37 ℃ for 10 min. The cDNA was reverse transcribed from RNase R processed RNA and untreated pre-treated RNA, and RT-qPCR was utilized to measure the expression of circRNA and the corresponding linear transcripts.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Fluorescence in Situ Hybridization (FISH)\u003c/h2\u003e \u003cp\u003eThe FISH kit SA-Biotin System (JiMa, Shanghai, China) and circFAM171A1 probe mixture (Cy3 labeled) were used (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). FISH was conducted according to the manufacturer\u0026rsquo;s instructions to assess the localization of circFAM171A1 in sheep myoblasts. The procedure was as shown below: cells were cultured by creeping in 6-well plates overnight, stabilized with 4% paraformaldehyde for 15 min at room condition, incubated in probe workup (1 \u0026micro;L 1 \u0026micro;M biotin-probe\u0026thinsp;+\u0026thinsp;1 \u0026micro;L 1 \u0026micro;M SA-Cy3\u0026thinsp;+\u0026thinsp;8 \u0026micro;L PBS) for 30 min at 37 ℃, added to the medium, and placed in an incubator at 37 ℃ overnight (12\u0026ndash;16 h) after taking measures for hybridization to avoid light. The cells were stained with DAPI solution (2 \u0026micro;g/mL) for 15 min at room condition and protected from darkness. Antifluorescence quenching blocker was added. Images were photographed using a computerized laser scanning confocal microscope.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe probe sequences of multicolor fluorescent in situ hybridization\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMarker\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecircFAM171A1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCy3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo; GTGCCCGGCCACAGCCTCGAGTACATTTCCAGAGAAGAGCC\u003c/p\u003e \u003cp\u003eCTGCGGCTGCCAGAGAACACCAGCTACAGTGACCTGACCGCCT\u003c/p\u003e \u003cp\u003eTTCTCACGGCCGCCAGCTCTCCCTCCGAGGTGGACGGCTTTCCT\u003c/p\u003e \u003cp\u003eTATTTGCGAGGATTAGATGGAAACGGAACAG 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003e18S\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo; CTGCCTTCCTTGGATGTGGTAGCCGTTTC 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eNC\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo; TGCTTTGCACGGTAACGCCTGTTTT 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Nucleoplasmic separation\u003c/h2\u003e \u003cp\u003eSheep myoblasts were inoculated at a density of \u0026le;\u0026thinsp;3\u0026times;10\u003csup\u003e6\u003c/sup\u003e in 6-cm culture dishes, and after 24 h of cell apposition, the cells were cleaned by PBS twice, and the PBS was abandoned. Added 200 \u0026micro;L of pre-chilled buffer J to the culture dish to cover the cell surface, Chill for 5 min, collected the lysis products, move to an RNase-free sponge tube and allow centrifugation at 14000 \u0026times;g for 10 min at 4 ℃. The liquid supernatant (cytoplasmic RNA) was pipetted into another centrifuge tube and 200 \u0026micro;L of buffer SK and to the precipitate (cytosolic RNA) added 400 \u0026micro;L buffer SK, vortexed for 10 s, then added 200 \u0026micro;L anhydrous ethanol, vortexed for 10 s, respectively. Transferred the liquid to a centrifuge column and centrifuged at 6000 rpm for 1 min at 4 ℃; discarded the liquid and put the column back into the centrifuge tube. Added 400 \u0026micro;L wash solution A, centrifuged at 14000 \u0026times;g 4 ℃ for 1 min, discarded the liquid, repeat washing once; put the column back into the collection tube, centrifuged at 14000 \u0026times;g 4 ℃ for 2 min. Then, added 50 \u0026micro;L Elution buffer E, centrifuged at 6000 rpm 4 ℃ for 2 min; centrifuged at 14000 \u0026times;g 4 ℃ for 1 min; detected RNA concentration. After that, stored at -80 ℃.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 The expression validation by RT-qPCR\u003c/h2\u003e \u003cp\u003eThe mRNA and miRNA back-transcription were performed using the HiScript\u0026reg; IiI All-in-one RT SuperMix kit (Vazyme, Nanjing, China) and the miRNA first-strand cDNA synthetic kit (Vazyme, Nanjing, China). RT-qPCR was carried out on a RocheLight Cycler\u0026reg; 480 II system (Roche Applied Science, Mannheim, Germany), and the mRNA and miRNA were extracted using the Taq Pro Universal SYBR qPCR Master Mix (Vazyme). RT-qPCR was performed on a RocheLight Cycler\u0026reg; 480 II system (Roche Applied Science, Mannheim, Germany), and mRNA and miRNA were extracted using Taq Pro Universal SYBR qPCR Master Mix (Vazyme). The RT-qPCR procedure was as follows: preliminary denaturation at 95 ℃ for 5 min, denaturation at 95 ℃ for 5 s, and degradation at 60 ℃ for 30 s, and 35 cycles. The data were analyzed by 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method with sheep β-actin and U6 gene as inner genes. The relative expression was analyzed by \u003cem\u003et\u003c/em\u003e-test of dependent samples, and the significance of differences was analyzed by SPSS 20.0. The primers for RT-qPCR were designed by Primer 5 software and composited by Sangon Biotech (Shanghai) Co. The primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer information for RT-qPCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTm (℃)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMAPK15\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGAGGAGGCAGGCGTGTAAG\u003c/p\u003e \u003cp\u003eR: TCTCTGGCAGGGCTCAAACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePCNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TTGAAGAAAGTGCTGGAGGC\u003c/p\u003e \u003cp\u003eR: TTGGACATGCTGGTGAGGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePax7\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CGTGCCCTCAGTGAGTTCGA\u003c/p\u003e \u003cp\u003eR: CCAGACGGTTCCCTTTGTCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCDK2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AAGTGGCTGCATCACAAGGA\u003c/p\u003e \u003cp\u003eR: CAAGCTCCGTCCATCTTCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecircFAM171A1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CGAGGATTAGATGGAAACGG\u003c/p\u003e \u003cp\u003eR: AGAAAGGCGGTCAGGTCACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eoar-miR-485-5p\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AGAGGCTGGCCGTGATGAATT\u003c/p\u003e \u003cp\u003eR: CAGTTTTTTTTTTTTTTTGGGCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AGCCTTCCTTCCTGGGCATGGA\u003c/p\u003e \u003cp\u003eR: GGACAGCACCGTGTTGGCGTAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eU6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AACGCTTCACGAATTTGCGT\u003c/p\u003e \u003cp\u003eR: CTCGCTTCGGCAGCACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CACGGCACAGTCAAGGCAG\u003c/p\u003e \u003cp\u003eR: AGATGATGACCCTCTTGGCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003enovel_circ_0004268\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATGTTATACCCCAGCCCAAA\u003c/p\u003e \u003cp\u003eR: GAATCCAAAGTCCCAGCCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003enovel_circ_0009805\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AACATGAAGCGTATGTCACAG\u003c/p\u003e \u003cp\u003eR: TTCTTCTTCCCGTTCTACTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003enovel_circ_0015927\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AACAACAGCATCTTCTGGGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GGACTCTAAGAATCCAAAACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003enovel_circ_0006391\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AGTTCATCCAGATGGGCAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GACCAGTTTAACCAGCGTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003enovel_circ_0002443\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCTGACCTCCTGAAAGACCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GAGTGTTGTTCTTCACGGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003enovel_circ_0006225\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGTGGGAAGAAGGCGAAATAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TTCATTATGGCTCCACTTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003enovel_circ_0005017\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TTGCCAAACTAACATGGAATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CCGATGTTCTGAAAATGATGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Cell culture\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003elongissimus dorsi\u003c/em\u003e muscle tissues from both surfaces of the fetal spine of 90-day-old small-tailed Han sheep were isolated in an aseptic condition, and combinations of connective tissues and blood tubes were removed and then washed with PBS (2% penicillin/streptomycin). The muscle organizations were pelleted and digestions were performed with 0.25% trypsin (Solarbio, Beijing, China) for 18 h at 4 ℃, and then cultured in an incubator (37 ℃, 5% CO\u003csub\u003e2\u003c/sub\u003e) for about 2 h. The cells were then incubated in the incubator for about 2 h. The cells were then cultured in the incubator for about 1 h at 4 ℃. The isolated cells were inoculated into 100 mm culture dishes and cultured with complete media (DMEM-F12, 10% FBS and 1% penicillin/streptomycin). After the cells achieved more than 90% fusion, they were transferred to 6-well plates for follow-up experiments. The HEK293T cell line was cultivated under the same cultivation requirements.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13 Plasmids construction and transfection\u003c/h2\u003e \u003cp\u003eOverexpression of pcDNA3.1-circFAM171A1 and interfering siRNA vectors were designed and synthesized based on the sequence of circFAM171A1. The mimic and inhibitor of oar-miR-485-5p were designed and synthesized based on the sequence of oar-miR-485-5p. MAPK15 overexpressing pIRES2-EGFP-MAPK15 and interfering with si-MAPK15 were designed and synthesized based on the sequence of MAPK15 provided by NCBI. overexpressing and interfering vectors, mimics and inhibitors were synthesized by Shanghai Gemma Pharmaceuticals Technology Co. All vectors were sequenced and sheep myoblasts and HEK293T cells were transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) with the manufacturer\u0026rsquo;s recommendations, and cell growth and gene presentation were assessed 48 h post-transfection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.14 Western blot\u003c/h2\u003e \u003cp\u003eProteins in cell samples were withdrawn with RIPA (radioimmunoprecipitation assay) buffer (Solebro, Beijing, China) containing 1% PMSF. Protein concentration was measured by BCA test kit (Solebro, Beijing, China). Proteins were isolated by the election on a 10% SDS-polyacrylamide gel (Bio-Rad, Hercules, CA, USA) and then shifted to a polyfluoroethylene membrane. The films were then incubated with specific primary antibodies for PCNA, CDK2 and Pax7 and the corresponding secondary antibodies, and then the membranes were color developed with an ultrasensitive ECL chemiluminescent reagent (Biyuntian, Beijing, China), exposed with an Odyssey CLX imaging screen system (Li-COR), photographed and archived. The relative expression level of the target protein was determined by the ratio of the gray value of the target protein to that of GAPDH/β-tubulin.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.15 Cell proliferation assay\u003c/h2\u003e \u003cp\u003eProliferation of sheep myoblasts was detected with the Cell Counting Kit-8 (CCK-8) (Biyun Tian, Beijing, China). Full details of the procedure are given in the manufacturer\u0026rsquo;s manual. After transfection of related plasmids, 10 \u0026micro;L of CCK-8 was added to every well at 0, 6, 12, 24, and 48 h of cell growth, respectively. After 2 h of incubation in an incubator, the proliferation rate of myoblasts was calculated by measuring the absorbance at 450 nm with an enzyme marker. The proliferation of sheep myoblasts was detected by EdU Cell Proliferation Detection Kit (Biyuntian, Beijing, China). After transfection of the plasmid, the cells were cultured for 48 h. EdU working solution preheated at 37 ℃ was added, and the cells were transfected for 2 h. The findings were visualized and photographed under a fluorescence microscope (Leica, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e2.16 Dual luciferase reporter assay\u003c/h2\u003e \u003cp\u003eInoculate sheep myoblasts evenly into 24-well cell culture plates. When the desired cell density was reached, psiCHECK2-circFAM171A1-WT and psiCHECK2-circFAM171A1-MUT-co-transfected cells were co-transfected with psiCHECK2- MAPK15-WT or psiCHECK2-MAPK15-MUT and oar-miR-485-5p mimics or mimics NC. CircFAM171A1-MUT-oar-miR-485-5p transfected cells. The serum luciferase detection was carried out according to the manufacturer's directions using the Dual-Luciferase Detection Kit (Vazyme, Nanjing, China). Luciferase enzyme activity was recorded 48 h after transfection and measured by a multi-mode microtitration system (EnS pire, Perkin Elmer, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e2.17 Estradiol Test\u003c/h2\u003e \u003cp\u003eThe 17β-estradiol (10 mM/mL, DMSO) was purchased from MedChe mExpress (New Jersey, USA). To establish the best concentration for the experiment, estradiol was diluted in a gradient (0 nM, 1 nM, 10 nM, and 100 nM) and then incorporated into the myoblast culture medium along with the suspended cells. Cells were cultured in the gradient-diluted estradiol medium for 48 h, and then RNA and proteins were extracted.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e2.18 Statistical Analysis\u003c/h2\u003e \u003cp\u003eAll analyses were performed with at minimum three technical replications. Data were expressed as average\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of measurement (SEM) and plotted with GraphPad Prism software. Statistical data were analyzed using SPSS 20 (SPSS INC. Chicago, IL, USA) software, with separate samples t-tests for making comparisons between two datasets and one-way ANOVA for making comparisons between more than two datasets. Statistical significance was expressed as **\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, *\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eStatistics on the yield and quality of raw sequencing data from 10 sheep\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSample\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRaw Reads Number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eClean Reads Number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGC_content\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eQ30\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eUniquely Mapped\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAligned Rate\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOR_STH_1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e104585290\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e95544247\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e49.18%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e92.55%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e88502315\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e84.62%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOR_STH_2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e101968696\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e93513704\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e50.12%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e93.03%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e85876093\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e84.22%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOR_STH_3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e100490536\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e90061492\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e50.55%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e92.42%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e83926739\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e83.52%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOR_STH_4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e113484726\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e102438833\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e51.03%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e91.78%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e94625925\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e83.38%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOR_STH_5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e96930428\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e84250266\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e57.00%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e91.14%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e76198353\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e78.61%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSTH_1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e105677792\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e96351036\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e49.63%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e92.89%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e89110737\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e84.32%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSTH_2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e99401202\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e92321713\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e49.57%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e93.12%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e85175337\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e85.69%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSTH_3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e105305476\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e95083678\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e48.00%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e93.21%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e89194000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e84.70%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSTH_4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e101215956\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e92765887\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e49.70%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e92.88%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e85287779\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e84.26%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSTH_5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e97234736\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e90305800\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e49.72%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e92.93%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e82470400\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e84.82%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.1 CircRNAs expression profile in the \u003cem\u003elongissimus dorsi\u003c/em\u003e of the ovariectomized and sham-operated small-tailed Han sheep\u003c/h2\u003e \u003cp\u003eA complete amount of 1,026,294,838 raw_Reads were derived from 10 muscle sequencing libraries from OR-STH and STH groups, and 932,636,656 clean data (clean_Reads), which accounted for 90.87% of the raw data, were obtained after quality control (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In addition, the Q30 were all greater than 91.14%, indicating good sequencing quality, and the average net read rate of 83.81% (from 78.61 to 85.69%) for the only mapping to the sheep genome, which can be analyzed in subsequent experiments. Following removal of ribosomal RNA (rRNA), 8721 potential candidate circRNAs were identified (Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). To identify circRNAs with potential functions in sheep muscle development, we performed a count of the identified circRNAs. The findings showed that the OR-STH group library contained 2042 circRNAs and the STH group library contained 1972 circRNAs (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The major circRNA types identified in the study were all exonic (OR_STH: 93.70%; STH: 93.75%), lasso-type circRNA (OR_STH:4.26%; STH:4.16%) and intergenic (OR_STH: 2.03%; STH:2.09%; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, C). CircRNAs were generated primarily from exon splicing, with a smaller share of intronic and regenerative splicing (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Statistics of circRNA density per chromosome indicated that circRNAs were located on chromosomes 1 to 9, with the proportion of circRNAs on chromosomes 1, 2, 3, and 4 being the highest (about 42%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-G).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Differential expression analysis of circRNAs\u003c/h2\u003e \u003cp\u003eThe amount of circRNAs expressed by each individual was calculated and standardized to SRPBM. The expression of circRNAs was normalized to SRPBM based on the normalized expression, |log2 (foldchange)|\u0026gt;1, \u003cem\u003eP\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05. 118 DE circRNAs (71 up- and 47 down-regulated) were identified when OR-STH was compared to STH (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The general assignment of differentially exhibited circRNAs is shown as a scatterplot in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and a clustered heatmap, boxplot and violin plot in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-E. To make sure the precision of the RNA-seq ploy, we randomly selected eight circRNAs that were differentially expressed and designed certain RT-qPCR primers in the circRNA boundary region. The levels of DE circRNA expression measured by RT-qPCR and RNA-seq showed the same trend (Figure. 2F). This means that the RNA-seq acquisition and subsequent organization of the data in this study are reliable.\u003c/p\u003e \u003cp\u003eIn summary, Gene Ontology (GO) and Kyoto Encyclopedia of Genomes (KEGG) profiling were also utilized to predict the features and signaling pathways of the circRNAs. The GO enrichment results indicated that the molecules hosting genes of the circRNAs play significant roles in muscle progression, including muscle cell formation (GO: 0055001), forward control of differentiation of myoblasts (GO: 0045663), bone muscle fiber production (GO: 0048741) and muscle organ production (GO: 0007517), as well as other subclasses. In the comparison of OR-STH with STH, GO terms are more focused on calcium transport (GO: 0006816), metabolic processes of C21-steroid hormones (GO: 0008207), regulation of hormone levels (GO: 0010817) and cellular metabolic processes (GO: 0044237). We hypothesized that the abundance of host genes in each of these GO terms is linked to the cyclic activity of hormone secretion by the ovary. We sorted these categories in a downward order based on the counts of differentially represented genes (S-gene counts) commented by each GO term and chose the genes with a high count of enriched genes in terms of all three classes to plot the histograms (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). In the KEGG enrichment assays, 98 of the pathways were significantly enriched. We selected the top 20 notably enriched KEGG terms (\u003cem\u003eP\u003c/em\u003e-value) and plotted a scatter plot (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). The pathways with the highest number of enriched genes were local adhesion (ko04510), MAPK signaling pathway (ko04010), and TGF-β signaling pathway (ko04350). According to the KEGG enrichment analysis, we defined other pathways of enriched genes that may be related to muscle development. These complete results were shown in Supplementary Tables S2, S3.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Analysis of ceRNA regulatory networks (circRNA-miRNA-mRNA)\u003c/h2\u003e \u003cp\u003eA combination of differentially expanded circRNAs (DECs), differentially expanded miRNAs (DEMs), and differentially expanded mRNAs (DEGs) were identified from sheep \u003cem\u003elongissimus dorsi\u003c/em\u003e muscle by analyzing the whole transcriptome data to generate a ceRNA regulatory network. A total of 41 circRNA-miRNA couples and 3499 miRNA-mRNA couples were filtered by comparing negatively correlated circRNA-miRNA pairs and miRNA-mRNA pairs in the OR-STH and STH data (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Four randomly picked differentially excited circRNAs with more or less than three breeding sites, and 14 miRNAs and 90 mRNAs, all of which were differentially exposed, were selected, resulting in the construction of an interaction network: the circRNA-miRNA-mRNA interface network (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). The screened differential genes were analyzed against the host genes using the STRING database. We selected\u0026thinsp;\u0026gt;\u0026thinsp;700-point protein pairs and constructed PPI networks of host genes using Cytoscape (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Subsequently, six sets of differential circRNA-miRNA-mRNA were chosen for RT-qPCR demonstration: circFAM171A1-oar-miR-485-5p-MAPK15, novel_circ_0002443-novel_329-GIPC1, novel_circ_0009805-novel_141-PRPSAP1, novel_circ_0006391-novel_210-BRPF1, novel_circ_0015927-novel_563-MAPKBP1. RT-qPCR confirmed that the expansion of circRNA, miRNA and mRNA expression levels in sheep muscle tissues were consistent with the RNA-seq data and were adversely correlated (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Estrogen induced circFAM171A1 production in sheep myoblasts\u003c/h2\u003e \u003cp\u003eRNA-seq and RT-qPCR showed that the abundance of circFAM171A1 in the STH group was obviously greater than that in the OR-STH group, suggesting that the difference in the expression level of circFAM171A1 may be a result of estrogen induction. To clarify the above results, we added different concentrations of estrogen to in vitro isolated myoblasts to detect the circulation of circFAM171A1 level in myoblasts. The findings indicated that the level of circFAM171A1 increased significantly in all groups after the addition of estrogen, and the concentration of the addition reached 10 nM, the expression level of circFAM171A1 was significantly higher than that of the other groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). This result suggested that the level of circFAM171A1 expression in sheep myoblasts was indeed affected by estrogen.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Identification of circFAM171A1 as a candidate circRNA\u003c/h2\u003e \u003cp\u003eEarlier research has demonstrated that circRNAs can eliminate the potential for miRNAs to negatively affect the expression of target genes \u003csup\u003e[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. CircFAM171A1 is 159 bp long and comes from exon 5 of the gene encoding protein FAM171A1. The reverse splice junction of circFAM171A1 was verified based on Sanger sequencing (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). The level of circFAM171A1 expression was not markedly reduced in sheep myoblasts after RNase R treatment, but the level of linear FAM171A1 and GAPDH mRNA expression was reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Next, we examined the expression of circFAM171A1 in muscle tissues from both the ovariectomized and sham surgery of the small-tailed Han sheep based on RT-qPCR. The results showed that circFAM171A1 was expressed in muscle tissues from both OR-STH and STH groups, and the expression level of circFAM171A1 was significantly higher in STH than that in OR-STH, which is consistent with our RNA-seq data (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Subsequent RNA nucleoplasmic isolation assays showed that circFAM171A1 was localized predominantly in the cytoplasm (more than 80%) and to a lesser extent in the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). RNA fluorescence in situ hybridization experiments further confirmed this finding (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). Immunofluorescence staining showed that the myoblasts marker MYOD1 was expressed predominantly in the nucleus, whereas Desmin was expressed predominantly in the cytoplasm (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). The outcomes indicated that the circularized fabric of circFAM171A1 was more stable than the linear transcript RNA, and circFAM171A1 was primarily functional by being expressed in the cytoplasm.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Effect of circFAM171A1 on the proliferation of sheep myoblasts\u003c/h2\u003e \u003cp\u003eTo validate the influence of circFAM171A1 on muscle progression in sheep, we built overexpression and interfere plasmids of circFAM171A1 and transfected them in sheep primary myoblasts for 48 h. The findings revealed that overexpression of circFAM171A1 significantly promoted the proliferation of sheep myoblast (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA), whereas the opposite was true after inhibiting its expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). RT-qPCR and Western blot results showed that the expression levels of CDK2, PCNA and Pax7, which are markers of cell proliferation, were significantly increased in sheep myoblasts after overexpression of circFAM171A1, whereas the opposite was observed after inhibition of their expression. (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, D-F). CCK-8 results showed that overexpression of circFAM171A1 significantly increased the cell viability of sheep myoblasts, whereas inhibition of its expression did the opposite (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eI, J). EdU staining assay also showed that overexpression of circFAM171A1 significantly increased the number of EdU-positive cells, whereas the opposite was true after inhibiting its expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG, H). These findings indicated that circFAM171A1 promoted the proliferation of sheep myoblasts.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003e3.7 CircFAM171A1 acts as a sponge for oar-miR-485-5p to regulate myoblast proliferation\u003c/h2\u003e \u003cp\u003eCellular localization of circFAM171A1 using nucleoplasmic separation and FISH probes indicated that circFAM171A1 is located mainly in the cytoplasm. It has been shown that when circRNA is contained in the cytoplasm, it mainly functions by acting in interaction of miRNAs \u003csup\u003e[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e. Therefore, we hypothesized that circFAM171A1 might be a possible sponge for miRNAs. Then, to verify that circFAM171A1 is a ceRNA aiming at miRNAs, we selected miRNAs participating in the development of sheep myoblasts by transcriptomic data and confirmed the binding relationship between circFAM171A1 and miRNAs by RNA hybridization. We discovered that circFAM171A1 might bind to oar-miR-485-5p, with the binding information shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA. By RT-qPCR, we found that overexpression of circFAM171A1 decreased the expression of olar-miR-485-5p, while disruption of circFAM171A1 increased the expression of olar-miR-485-5p (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB, C). Following this, we built plasmids for luciferase reporter assays to validate the binding of circFAM171A1 to oar-miR-485-5p. Dual luciferase reporter assays suggested that oar-miR-485-5p significantly inhibited the Rluc expression of pCK-circFAM171A1-WT in HEK293T cells, yet it had no influence on pCK-circFAM171A1-MUT (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD, E). To further confirm that circFAM171A1 can bind oar-miR-485-5p to regulate myoblast proliferation. As analyzed by RT-qPCR and Western blotting, the mRNA and protein values of CDK2, PCNA, and Pax7 were significantly decreased after transfection of the mimics, whereas the exact opposite was observed after transfection of the inhibitors (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF-K). In addition, CCK-8 and EdU assays identified similar changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eL-O). These findings demonstrated that circFAM171A1 could act as a sponge for oar-miR-485-5p and confirmed that oar-miR-485-5p could inhibit the proliferation of sheep myoblasts.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003e3.8 CircFAM171A1 impairs the inhibition of oar-miR-485-5p on MAPK15 expression\u003c/h2\u003e \u003cp\u003eTo clarify the circRNA-miRNA-mRNA ceRNA mechanism, our study investigated the target gene MAPK15 of oar-miR-485-5p. To this end, we examined the expression level of the target gene MAPK15 in sheep muscle. Western blotting revealed that there was a statistically significant variation in MAPK15 protein activity between the OR-STH and STH groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA, \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). The expression of MAPK15 increased significantly after overexpression of circFAM171A1, and decreased after circFAM171A1 inhibition by RT-qPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). The expression of MAPK15 was significantly reduced after oar-miR-485-5p overexpression, whereas the expression of MAPK15 increased after inhibitor of oar-miR-485-5p (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD). To verify the binding association of miRNAs with target genes, we constructed wild-type (WT) and mutant (MUT) psi-CHECK2 plasmids of the 3\u0026rsquo;UTR of MAPK15 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE). Dual luciferase activity assay demonstrated that oar-miR-485-5p significantly inhibited the luciferase activity of wild type MAPK15 3\u0026rsquo;UTR plasmid but not that of mutant APK15 3\u0026rsquo;UTR plasmid in HEK293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE). Subsequently, we synthesized the MAPK15 overexpression plasmid pIRES2-EGFP-MAPK15 and the interference plasmid si-MAPK15, which were transfected into sheep myoblasts for subsequent validation. We detected a significant increase in MAPK15 expression after transfection of pIRES2-EGFP-MAPK15 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eF). Following transfection of si-MAPK15, we detected a significant decrease in MAPK15 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eH). RT-qPCR and Western blot analyses demonstrated that overexpression or inhibition of MAPK15 significantly increased or decreased the expression of CDK2, PCNA, and Pax7 at both the mRNA and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eG, \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eI-K). CCK-8 and EdU assays illustrated that overexpression of MAPK15 increased the proliferation rate of myoblasts, whereas interference with MAPK15 also inhibited the proliferation rate of myoblasts (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eL-O). These findings indicate that MAPK15 acts in concert with circFAM171A1 on sheep myoblasts and that circFAM171A1 realizes the mechanism of ceRNA. In summary, circFAM171A1 acted as a sponge of oar-miR-485-5p, weakened its inhibitory effect on MAPK15, and promoted the proliferation of sheep myoblasts.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec30\" class=\"Section2\"\u003e \u003ch2\u003e3.9 Estrogen regulates sheep myoblast proliferation through the circFAM171A1/oar-miR-485-5p/MAPK15 pathway\u003c/h2\u003e \u003cp\u003eIn order to study the influence of estrogen on the proliferation of sheep myoblasts, we examined the proliferation of myoblasts after the addition of 10 nM estradiol. RT-qPCR and Western blotting indicated that the levels of PCNA and CDK2 expression in the estradiol-treated group were significantly elevated (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA, \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB), and the proliferation rate of sheep myoblasts with an estradiol concentration of 10 nM was significantly higher, as indicated by the results of CCK8 and EdU assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eC, \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eD). To verify the pathway of estrogen regulation of myoblast proliferation, we validated the level of expression of oar-miR-485-5p and MAPK15 in sheep myoblasts after addition of estrogen. The findings indicated that the expression level of oar-miR-485-5p was significantly declined, while the protein and mRNA levels of MAPK15 were significantly increased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA, \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB). The foregoing findings indicated that estrogen could facilitate the proliferation of sheep myoblasts through the circFAM171A1/oar-miR-485-5p/MAPK15 pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eThe important role of estrogen in female mammalian reproduction is well known. However, its functions are not limited to the reproductive system, but also play important roles in different physiological processes such as cardiovascular, skeletal muscle and neural networks, which are often overlooked \u003csup\u003e[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e. In living organisms, the estrogen receptors ERα, ERβ and the G protein-coupled estrogen receptor (GPER) play a key role. The coordinated action of these three receptors in the body ensures the effective action of estrogenic substances on target tissues \u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e. In our bodies, estrogen plays an important role in regulating the growth of bone tissue. However, in women, estrogen deficiency during menopause or after bilateral oophorectomy may lead to loss of cancellous and cortical bone, which in turn can lead to osteoporosis \u003csup\u003e[\u003cspan additionalcitationids=\"CR44\" citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]\u003c/sup\u003e. In the current study, the mechanisms of estrogen regulation of muscle development are unclear, which poses a challenge for further research. In this work, we constructed a model of \u003cem\u003elongissimus dorsi\u003c/em\u003e muscle of small-tailed Han sheep in sham surgery group (STH) and ovariectomy group (OR-STH), and collected RNA extracted from \u003cem\u003elongissimus dorsi\u003c/em\u003e muscle tissue for RNA-seq and molecular biology analysis. We successfully identified 11,297 circRNAs in a comparison between STH group and OR-STH group, of which a total of 118 were differentially expressed circRNAs. In a follow-up study, the researchers analyzed the differentially expressed circRNA host genes for GO terms and KEGG pathway enrichment. This analysis revealed multiple important pathways involved in muscle growth, development and degradation, such as the AMPK signaling pathway, ECM receptor interactions, ErbB signaling pathway, ubiquitin-mediated protein hydrolysis and mTOR signaling pathway. These pathways play key roles in muscle development and are important for muscle growth and functional maintenance \u003csup\u003e[\u003cspan additionalcitationids=\"CR47 CR48\" citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/sup\u003e. As key gene expression regulators, circRNAs play an important role in animal growth and development. Our study revealed that changes in circRNA abundance may be associated with ovariectomy. Further studies on the role of circRNAs in skeletal muscle growth and development will help to gain insight into the relevant physiological mechanisms and provide useful references for clinical practice.\u003c/p\u003e \u003cp\u003eIn late years, with the completion of the assembly and annotation of sheep breed genomes, we have a wealth of reference data for sheep transcriptome analysis. As a functionally conserved molecule, circRNA has been shown to be important for animal development and growth in humans and mice \u003csup\u003e[\u003cspan additionalcitationids=\"CR48 CR49\" citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/sup\u003e. However, few studies on functional circRNAs in sheep have been reported. In this study, circRNA sequencing results showed that estrogen induced the production of high abundance of circFAM171A1. Subsequently, we confirmed this result using in vitro addition of different concentrations of estradiol. In the subsequent study, we used cell transfection technique to investigate the key role of circFAM171A1 in the proliferation of sheep myoblasts. The experimental results showed that circFAM171A1 had a significant promotional effect on the proliferation of myoblasts. This finding reveals the important role of circFAM171A1 in sheep muscle progression and provides a basis for further research on the function of circRNAs in mammalian muscle biology.\u003c/p\u003e \u003cp\u003eIncreasingly, circRNAs have been found to function as miRNA sponges in the cytoplasm. This phenomenon was exemplified by circRNA-UBE2G1, a circRNA found mainly in the cytoplasm. circRNA-UBE2G1 was found to act as a sponge for miR-373 to modulate chondrocyte damage after lipopolysaccharide (LPS) treatment \u003csup\u003e[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/sup\u003e. CircFGFR2 is located in the cytoplasm and can serve as a molecular sponge for miR-133a-5p and miR-29b-1-5p to promote myoblast proliferation and differentiation \u003csup\u003e[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/sup\u003e. In the present study, we confirmed that circFAM171A1 was mostly distributed in the cytoplasm through nucleoplasmic separation and fluorescence in situ hybridization (FISH) experiments. Transcriptome integration analysis showed that circFAM171A1 could function as a ceRNA and mediate the expression of oar-miR-485-5p and MAPK15. Notably, miR-485-5p has been shown to be closely associated with the prevention and treatment of kidney and ovarian cancer \u003csup\u003e[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/sup\u003e. Furthermore, there is substantial evidence that miR-485-5p can function by binding to circRNAs. For example, circRUNX1 elevates SLC38A1 by adsorbing miR-485-5p to promote colorectal cancer cell growth, metastasis, and glutamine metabolism\u003csup\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/sup\u003e. CircFOXK2 can bind miR-485-5p and activate PD-L1, thereby accelerating the development of non-small cell lung cancer (NSCLC) \u003csup\u003e[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]\u003c/sup\u003e. Circ_0008529 modulates high glucose (HG)-induced apoptosis and inflammatory injury in human kidney cells (HK-2) by targeting the miR-485-5p/WNT2B pathway, showing that Circ_0008529 plays a key role in the development of diabetic nephropathy (DN) \u003csup\u003e[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]\u003c/sup\u003e. In our study, it was confirmed by dual luciferase reporter assay that circFAM171A1 was able to bind oar-miR-485-5p. Functional study further revealed that oar-miR-485-5p could inhibit the proliferation of sheep primary myoblasts. However, over-expression of circFAM171A1 attenuated or even reversed this inhibitory effect. These results indicated that the effect of oar-miR-485-5p is opposite to that of circFAM171A1, implying that circFAM171A1 acts as a sponge for oar-miR-485-5p to regulate the proliferation of sheep myoblasts. These findings provided an important basis for further exploring the function of circRNA in biology and medicine.\u003c/p\u003e \u003cp\u003eThe discovery that MAPK15, ERK8 and MAPK7 (ERK7) are atypical members of the MAP kinase family has provided a new perspective on the study of the MAP kinase family, a group of serine/threonine kinases that are widely found in eukaryotes and play key roles in cell growth, differentiation, apoptosis and other biological processes\u003csup\u003e[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]\u003c/sup\u003e, MAPK8 and MAPK11 are also important members of the MAP kinase family \u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. MAPK8 and MAPK11 are also important members of the MAP kinase family, which makes the study of the MAP kinase family more colorful. It was demonstrated that circACTA1 has the property of acting as a miR199a-5p and miR-433 sponge, thereby eliminating the inhibitory effect on these target genes, MAP3K11 and MAPK8. circACTA1 further affects the biological behaviors of bovine primary myoblasts by activating the MAP3K11/MAP2K7/JNK signaling pathway. During cell proliferation, apoptosis and differentiation, circACTA1 plays an important regulatory role \u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. Moreover, miR-138 prevents anoxia-induced apoptosis in cardiomyocytes through the MAP3K11/JNK/c-Jun pathway \u003csup\u003e[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]\u003c/sup\u003e. Recent studies have shown that MAPK15 intervenes in BCR-ABL the 1-induced phagocytosis and modulates cancer gene-dependent cell proliferation and neighboring tumor formation \u003csup\u003e[\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]\u003c/sup\u003e. Building on these findings, we hypothesized that circFAM171A1 modulates cell growth through the oar-miR-485-5p/MAPK15 signaling pathway. In the present study, overexpression of circFAM171A1 significantly enhanced the expression of MAPK15. However, interference with circFAM171A1 obtained the opposite result. Transfection of mimics of oar-miR-485-5p significantly decreased MAPK15 expression, but inhibitors of oar-miR-485-5p also obtained the opposite result. These results suggested that circFAM171A1 can regulate sheep myoblast proliferation via the oar-miR-485-5p/MAPK15 pathway.\u003c/p\u003e \u003cp\u003eEstrogen deficiency has been found to induce hormonal endocrine and metaphorical disruption in women after menopause, resulting in osteoporosis, metabolic syndrome, and loss of muscle force and mass \u003csup\u003e[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]\u003c/sup\u003e. Studies have shown that estrogen therapy reduces hepatic lipoatrophy by hastening liver aquaporin 7 (AQP7) secretion in an ovariectomized (OR) mouse phantom and a steatosis cell model \u003csup\u003e[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]\u003c/sup\u003e. Seko et al. confirmed that estrogen has a modulatory role in muscle growing and rejuvenation in young adult female mice via ERβ in bone-muscle-specific stem cells \u003csup\u003e[\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]\u003c/sup\u003e. We found that the addition of estradiol to sheep myoblasts promoted their proliferation and that the expression level of oar-miR-485-5p was decreased while that of MAPK15 was increased. These results suggested that the addition of appropriate levels of estrogen stimulates the growth and proliferation of sheep myoblasts through the circFAM171A1/oar-miR-485-5p/MAPK15 pathway.\u003c/p\u003e"},{"header":"5 Conclusion","content":"\u003cp\u003eIn this study, we found that estrogen induced circFAM171A1 expression in sheep myoblasts. Transcriptome integration analysis showed that circFAM171A1 could act as a ceRNA to regulate the expression of oar-miR-485-5p and MAPK15 in sheep myoblasts. In vitro addition of estrogen promoted myoblast proliferation through the circFAM171A1/oar-miR-485-5p/MAPK15 pathway. These findings offer new perspectives for further knowledge of estrogen regulation of myoblast proliferation in female animals and contribute to shaping our insights into the molecular processes by which estrogen affects muscle uptake and growth.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by the IAS-CAAS Animal Ethics Committee under approval number IAS2019-63. Under the premise of strict compliance with relevant regulations, scientists are committed to promoting animal science research in order to contribute to the development of agriculture in our country.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the authors involved in this manuscript give the consent for the publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the data supporting the findings of this study are available within the manuscript. Data will be made available on reasonable request, not applicable for material.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have declared no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConceptualization:\u003c/strong\u003e Runqing Chi, Yufang Liu, Peng Wang.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFormal analysis:\u003c/strong\u003e Runqing Chi, Peng Wang.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding acquisition:\u003c/strong\u003e Mingxing Chu.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInvestigation:\u003c/strong\u003e Runqing Chi, Yufang Liu, Peng Wang.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProject administration:\u003c/strong\u003e Yufang Liu, Ran Di, Mingxing Chu.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResources:\u003c/strong\u003e Peng Wang,Fan Yang, Xiangyu Wang.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eValidation:\u0026nbsp;\u003c/strong\u003eRunqing Chi, Fan Yang.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWriting \u0026ndash; original draft:\u003c/strong\u003e Runqing Chi, Yufang Liu.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWriting \u0026ndash; review \u0026amp; editing:\u003c/strong\u003e Runqing Chi, Yufang Liu, Peng Wang, Fan Yang, Xiangyu Wang, Xiaoyun He, Ran Di, Mingxing Chu.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe author wishes to thank all participants of technical and academic support.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by the Program of Anhui Provincial Key Laboratory of Livestock and Poultry Product Safety Engineering (XM2404), the National Natural Science Foundation of China (32172704), the Agricultural Science and Technology Innovation Program of China (CAAS-ZDRW202106 and ASTIP-IAS13), \u0026nbsp;the China Agriculture Research System of MOF and MARA (CARS-38) and the Postdoctoral Fellowship Program of CPSF (GZC20233053).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eCollins BC, Laakkonen EK, Lowe DA (2019) Aging of the musculoskeletal system: How the loss of estrogen impacts muscle strength. Bone 123:137\u0026ndash;144\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVasconsuelo A, Milanesi L, Boland R (2010) Participation of HSP27 in the antiapoptotic action of 17beta-estradiol in skeletal muscle cells. Cell stress chaperones 15(2):183\u0026ndash;192\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoland R, Vasconsuelo A, Milanesi L, Ronda AC, de Boland AR (2008) 17beta-estradiol signaling in skeletal muscle cells and its relationship to apoptosis. Steroids 73(9\u0026ndash;10):859\u0026ndash;863\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLa Colla A, Boland R, Vasconsuelo A (2015) 17β-Estradiol Abrogates Apoptosis Inhibiting PKCδ, JNK, and p66Shc Activation in C2C12 Cells. J Cell Biochem 116(7):1454\u0026ndash;1465\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLa Colla A, Vasconsuelo A, Boland R (2013) Estradiol exerts antiapoptotic effects in skeletal myoblasts via mitochondrial PTP and MnSOD. J Endocrinol 216(3):331\u0026ndash;341\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLa Colla A, Vasconsuelo A, Milanesi L, Pronsato L (2017) 17β-Estradiol Protects Skeletal Myoblasts From Apoptosis Through p53, Bcl-2, and FoxO Families. J Cell Biochem 118(1):104\u0026ndash;115\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRonda AC, Vasconsuelo A, Boland R (2010) Extracellular-regulated kinase and p38 mitogen-activated protein kinases are involved in the antiapoptotic action of 17beta-estradiol in skeletal muscle cells. J Endocrinol 206(2):235\u0026ndash;246\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRonda AC, Vasconsuelo A, Boland R (2013) 17β-estradiol protects mitochondrial functions through extracellular-signal-regulated kinase in C2C12 muscle cells. Cell Physiol biochemistry: Int J experimental Cell Physiol Biochem Pharmacol 32(4):1011\u0026ndash;1023\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParoo Z, Dipchand ES, Noble EG (2002) Estrogen attenuates postexercise HSP70 expression in skeletal muscle. Am J Physiol Cell Physiol 282(2):C245\u0026ndash;251\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParoo Z, Tiidus PM, Noble EG (1999) Estrogen attenuates HSP 72 expression in acutely exercised male rodents. Eur J Appl Physiol Occup Physiol 80(3):180\u0026ndash;184\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBombardier E, Vigna C, Bloemberg D, Quadrilatero J, Tiidus PM, Tupling AR (2013) The role of estrogen receptor-α in estrogen-mediated regulation of basal and exercise-induced Hsp70 and Hsp27 expression in rat soleus. Can J Physiol Pharmacol 91(10):823\u0026ndash;829\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBombardier E, Vigna C, Iqbal S, Tiidus PM, Tupling AR (2009) Effects of ovarian sex hormones and downhill running on fiber-type-specific HSP70 expression in rat soleus. J Appl Physiol (Bethesda Md: 1985) 106(6):2009\u0026ndash;2015\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang H, Alencar A, Lin M, Sun X, Sudo RT, Zapata-Sudo G, Lowe DA, Groban L (2016) Activation of GPR30 improves exercise capacity and skeletal muscle strength in senescent female Fischer344 \u0026times; Brown Norway rats. Biochem Biophys Res Commun 475(1):81\u0026ndash;86\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarvinen S, Juppi HK, Le G, Cabelka CA, Mader TL, Lowe DA, Laakkonen EK (2021) Estradiol deficiency and skeletal muscle apoptosis: Possible contribution of microRNAs. Exp Gerontol 147:111267\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Yi J, Lu LY, Zhang YY, Wang L, Hu GS, Liu YC, Ding JC, Shen HF, Zhao FQ et al (2021) Estrogen-induced circRNA, circPGR, functions as a ceRNA to promote estrogen receptor-positive breast cancer cell growth by regulating cell cycle-related genes. Theranostics 11(4):1732\u0026ndash;1752\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeck WR, Sharpless NE (2014) Detecting and characterizing circular RNAs. Nat Biotechnol 32(5):453\u0026ndash;461\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Z, Huang C, Bao C, Chen L, Lin M, Wang X, Zhong G, Yu B, Hu W, Dai L et al (2015) Exon-intron circular RNAs regulate transcription in the nucleus. Nat Struct Mol Biol 22(3):256\u0026ndash;264\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAshwal-Fluss R, Meyer M, Pamudurti NR, Ivanov A, Bartok O, Hanan M, Evantal N, Memczak S, Rajewsky N, Kadener S (2014) circRNA biogenesis competes with pre-mRNA splicing. Mol Cell 56(1):55\u0026ndash;66\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStarke S, Jost I, Rossbach O, Schneider T, Schreiner S, Hung LH, Bindereif A (2015) Exon circularization requires canonical splice signals. Cell Rep 10(1):103\u0026ndash;111\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen W, Schuman E (2016) Circular RNAs in Brain and Other Tissues: A Functional Enigma. Trends Neurosci 39(9):597\u0026ndash;604\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQi A, Ru W, Yang H, Yang Y, Tang J, Yang S, Lan X, Lei C, Sun X, Chen H (2022) Circular RNA ACTA1 Acts as a Sponge for miR-199a-5p and miR-433 to Regulate Bovine Myoblast Development through the MAP3K11/MAP2K7/JNK Pathway. J Agric Food Chem 70(10):3357\u0026ndash;3373\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen B, Yu J, Guo L, Byers MS, Wang Z, Chen X, Xu H, Nie Q (2019) Circular RNA circHIPK3 Promotes the Proliferation and Differentiation of Chicken Myoblast Cells by Sponging miR-30a-3p. Cells 8(2)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu M, Lian C, Chen G, Zou P, Qin BG (2021) CircRNA FUT10 regulates the regenerative potential of aged skeletal muscle stem cells by targeting HOXA9. Aging 13(13):17428\u0026ndash;17441\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Z, Song C, Jiang R, Huang Y, Lan X, Lei C, Qi X, Zhang C, Huang B, Chen H (2022) CircNDST1 Regulates Bovine Myoblasts Proliferation and Differentiation via the miR-411a/Smad4 Axis. J Agric Food Chem 70(32):10044\u0026ndash;10057\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu WW, Yang W, Liu E, Yang Z, Dhaliwal P, Yang BB (2016) Foxo3 circular RNA retards cell cycle progression via forming ternary complexes with p21 and CDK2. Nucleic Acids Res 44(6):2846\u0026ndash;2858\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLegnini I, Di Timoteo G, Rossi F, Morlando M, Briganti F, Sthandier O, Fatica A, Santini T, Andronache A, Wade M et al (2017) Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Mol Cell 66(1):22\u0026ndash;37e29\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei X, Li H, Yang J, Hao D, Dong D, Huang Y, Lan X, Plath M, Lei C, Lin F et al (2017) Circular RNA profiling reveals an abundant circLMO7 that regulates myoblasts differentiation and survival by sponging miR-378a-3p. Cell Death Dis 8(10):e3153\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun J, Xie M, Huang Z, Li H, Chen T, Sun R, Wang J, Xi Q, Wu T, Zhang Y (2017) Integrated analysis of non-coding RNA and mRNA expression profiles of 2 pig breeds differing in muscle traits. J Anim Sci 95(3):1092\u0026ndash;1103\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYue B, Wang J, Song C, Wu J, Cao X, Huang Y, Lan X, Lei C, Huang B, Chen H (2019) Biogenesis and ceRNA role of circular RNAs in skeletal muscle myogenesis. Int J Biochem Cell Biol 117:105621\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen MM, Zhao YP, Zhao Y, Deng SL, Yu K (2021) Regulation of Myostatin on the Growth and Development of Skeletal Muscle. Front cell Dev biology 9:785712\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuckingham M, Relaix F (2015) PAX3 and PAX7 as upstream regulators of myogenesis. Semin Cell Dev Biol 44:115\u0026ndash;125\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMegeney LA, Rudnicki MA (1995) Determination versus differentiation and the MyoD family of transcription factors. Biochem cell biology = Biochimie et Biol cellulaire 73(9\u0026ndash;10):723\u0026ndash;732\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDaubas P, Buckingham ME (2013) Direct molecular regulation of the myogenic determination gene Myf5 by Pax3, with modulation by Six1/4 factors, is exemplified by the \u0026ndash;\u0026thinsp;111 kb-Myf5 enhancer. Dev Biol 376(2):236\u0026ndash;244\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKassar-Duchossoy L, Gayraud-Morel B, Gom\u0026egrave;s D, Rocancourt D, Buckingham M, Shinin V, Tajbakhsh S (2004) Mrf4 determines skeletal muscle identity in Myf5:Myod double-mutant mice. Nature 431(7007):466\u0026ndash;471\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan CM, Li L, Rozo ME, Lepper C (2012) Making skeletal muscle from progenitor and stem cells: development versus regeneration. Wiley interdisciplinary reviews Dev biology 1(3):315\u0026ndash;327\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin H, Price F, Rudnicki MA (2013) Satellite cells and the muscle stem cell niche. Physiol Rev 93(1):23\u0026ndash;67\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie C, Mao X, Huang J, Ding Y, Wu J, Dong S, Kong L, Gao G, Li CY, Wei L (2011) KOBAS 2.0: a web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res 39(Web Server issue):W316\u0026ndash;322\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Cao X, Dong D, Shen X, Cheng J, Jiang R, Yang Z, Peng S, Huang Y, Lan X et al (2019) Circular RNA TTN Acts As a miR-432 Sponge to Facilitate Proliferation and Differentiation of Myoblasts via the IGF2/PI3K/AKT Signaling Pathway. Mol therapy Nucleic acids 18:966\u0026ndash;980\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiong Y, Zhang J, Song C (2019) CircRNA ZNF609 functions as a competitive endogenous RNA to regulate FOXP4 expression by sponging miR-138-5p in renal carcinoma. J Cell Physiol 234(7):10646\u0026ndash;10654\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKristensen LS, Andersen MS, Stagsted LVW, Ebbesen KK, Hansen TB, Kjems J (2019) The biogenesis, biology and characterization of circular RNAs. Nat Rev Genet 20(11):675\u0026ndash;691\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMauvais-Jarvis F, Clegg DJ, Hevener AL (2013) The role of estrogens in control of energy balance and glucose homeostasis. Endocr Rev 34(3):309\u0026ndash;338\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEyster KM (2016) The Estrogen Receptors: An Overview from Different Perspectives. Methods Mol biology (Clifton NJ) 1366:1\u0026ndash;10\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eP\u0026ouml;ll\u0026auml;nen E, Sipil\u0026auml; S, Alen M, Ronkainen PH, Ankarberg-Lindgren C, Puolakka J, Suominen H, H\u0026auml;m\u0026auml;l\u0026auml;inen E, Turpeinen U, Konttinen YT et al (2011) Differential influence of peripheral and systemic sex steroids on skeletal muscle quality in pre- and postmenopausal women. Aging Cell 10(4):650\u0026ndash;660\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGillies GE, McArthur S (2010) Estrogen actions in the brain and the basis for differential action in men and women: a case for sex-specific medicines. Pharmacol Rev 62(2):155\u0026ndash;198\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDumont NA, Bentzinger CF, Sincennes MC, Rudnicki MA (2015) Satellite Cells and Skeletal Muscle Regeneration. Compr Physiol 5(3):1027\u0026ndash;1059\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen G, Liu T, Yu B, Wang B, Peng Q (2020) CircRNA-UBE2G1 regulates LPS-induced osteoarthritis through miR-373/HIF-1a axis. Cell cycle (Georgetown Tex) 19(13):1696\u0026ndash;1705\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X, Ouyang H, Wang Z, Chen B, Nie Q (2018) A Novel Circular RNA Generated by FGFR2 Gene Promotes Myoblast Proliferation and Differentiation by Sponging miR-133a-5p and miR-29b-1-5p. \u003cem\u003eCells\u003c/em\u003e 7(11)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu H, Hu G, Wang Z, Liu Q, Zhang J, Chen Y, Huang Y, Xue W, Xu Y, Zhai W (2020) circPTCH1 promotes invasion and metastasis in renal cell carcinoma via regulating miR-485-5p/MMP14 axis. Theranostics 10(23):10791\u0026ndash;10807\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang W, Yu S, Li W, Hu H, Zou G (2022) Silencing of lncRNA SNHG17 inhibits the tumorigenesis of epithelial ovarian cancer through regulation of miR-485-5p/AKT1 axis. Biochem Biophys Res Commun 637:117\u0026ndash;126\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu J, Chen X, Li J, Wang F (2021) CircRUNX1 functions as an oncogene in colorectal cancer by regulating circRUNX1/miR-485-5p/SLC38A1 axis. Eur J Clin Invest 51(7):e13540\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang N, Fan J, Deng Z (2022) CircFOXK2 enhances tumorigenesis and immune evasion in non-small cell lung cancer by miR-485-5p/PD-L1 axis. Anticancer Drugs 33(5):437\u0026ndash;447\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang W, Lu H (2022) High Glucose-Induced Human Kidney Cell Apoptosis and Inflammatory Injury Are Alleviated by Circ_0008529 Knockdown via Circ_0008529-Mediated miR-485-5p/WNT2B Signaling. Appl Biochem Biotechnol 194(12):6287\u0026ndash;6301\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFranci L, Tubita A, Bertolino FM, Palma A, Cannino G, Settembre C, Rasola A, Rovida E, Chiariello M (2022) MAPK15 protects from oxidative stress-dependent cellular senescence by inducing the mitophagic process. Aging Cell 21(7):e13620\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe S, Liu P, Jian Z, Li J, Zhu Y, Feng Z, Xiao Y (2013) miR-138 protects cardiomyocytes from hypoxia-induced apoptosis via MLK3/JNK/c-jun pathway. Biochem Biophys Res Commun 441(4):763\u0026ndash;769\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColecchia D, Rossi M, Sasdelli F, Sanzone S, Strambi A, Chiariello M (2015) MAPK15 mediates BCR-ABL1-induced autophagy and regulates oncogene-dependent cell proliferation and tumor formation. Autophagy 11(10):1790\u0026ndash;1802\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIkeda K, Horie-Inoue K, Inoue S (2019) Functions of estrogen and estrogen receptor signaling on skeletal muscle. J Steroid Biochem Mol Biol 191:105375\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu X, Xing L, Xu W, Shu J (2016) Treatment with estrogen protects against ovariectomy-induced hepatic steatosis by increasing AQP7 expression. Mol Med Rep 14(1):425\u0026ndash;431\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeko D, Fujita R, Kitajima Y, Nakamura K, Imai Y, Ono Y (2020) Estrogen Receptor β Controls Muscle Growth and Regeneration in Young Female Mice. Stem cell Rep 15(3):577\u0026ndash;586\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cellular-and-molecular-life-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"life","sideBox":"Learn more about [Cellular and Molecular Life Sciences](https://link.springer.com/journal/18)","snPcode":"18","submissionUrl":"https://www.editorialmanager.com/life/default2.aspx","title":"Cellular and Molecular Life Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Open","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Sheep, Muscle development, Estrogen-induced circRNA, Oar-miR-485-5p, MAPK15","lastPublishedDoi":"10.21203/rs.3.rs-4806193/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4806193/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEstrogen is an important hormone affecting muscle development in female animals. Studies have shown that estrogen can protect muscle cells from apoptosis by inhibiting MAPK signaling pathway. However, the molecular mechanisms by which estrogen-induced MAPK signaling regulates myoblasts growth and development remain unclear. In this study, RNA-seq was performed in the ovariectomized small-tailed Han (OR-STH) sheep and sham surgery small-tailed Han (STH) sheep groups to analyze the effect of estrogen on muscle growth and development in female animals. There were identified 8721 differentially expressed circRNAs (DECs), 143 differentially expressed miRNAs (DEMs) and 2238 differentially expressed mRNAs (DEGs) in the \u003cem\u003elongissimus dorsi\u003c/em\u003e between the OR-STH and STH groups. Bioinformatics analysis showed that the differentially expressed gene MAPK15 was significantly enriched in the MAPK signaling pathway, which is important for muscle development. Therefore, we constructed the ceRNA network circFAM171A1/oar-miR-485-5p/MAPK15 and explored its effect on muscle growth and development. The results of molecular mechanism experiments indicated that circFAM171A1 could act as a sponge adsorbing oar-miR-485-5p to regulate \u003cem\u003eMAPK15\u003c/em\u003e. Addition of the exogenous hormone estradiol (E\u003csub\u003e2\u003c/sub\u003e) to sheep myoblasts could induce circFAM171A1, regulate the expression of oar-miR-485-5p and \u003cem\u003eMAPK15\u003c/em\u003e, and promote the proliferation of sheep myoblasts. The results showed that \u003cem\u003eMAPK15\u003c/em\u003e and circFAM171A1 significantly promoted proliferation of myoblasts and inhibited apoptosis of myoblasts in sheep, whereas oar-miR-485-5p inhibited expression of \u003cem\u003eMAPK15\u003c/em\u003e and circFAM171A1 and inhibited myoblast proliferation and promoted apoptosis. Furthermore, circFAM171A1 could attenuate the inhibitory effect of oar-miR-485-5p on myoblasts. In summary, estrogen induced the expression of circFAM171A1 in sheep myoblasts, and circFAM171A1 can act as a sponge for oar-miR-485-5p to promote the expression of the target gene, \u003cem\u003eMAPK15\u003c/em\u003e, and finally regulated the proliferation of sheep myoblasts. This study provided new insights for molecular mechanism of estrogen regulation on muscle growth and development in female animals.\u003c/p\u003e","manuscriptTitle":"Estrogen-induced circFAM171A1 regulates sheep myoblasts proliferation through the oar-miR-485-5p/MAPK15/MAPK pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-14 08:39:08","doi":"10.21203/rs.3.rs-4806193/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major Revision","date":"2024-09-19T22:54:44+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2024-08-17T05:30:42+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-08-17T02:35:55+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-08-02T12:57:20+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cellular and Molecular Life Sciences","date":"2024-08-01T20:46:17+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cellular-and-molecular-life-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"life","sideBox":"Learn more about [Cellular and Molecular Life Sciences](https://link.springer.com/journal/18)","snPcode":"18","submissionUrl":"https://www.editorialmanager.com/life/default2.aspx","title":"Cellular and Molecular Life Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Open","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2d19a8e4-207f-45d8-8521-e26bf2928d67","owner":[],"postedDate":"October 14th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-03-24T16:02:44+00:00","versionOfRecord":{"articleIdentity":"rs-4806193","link":"https://doi.org/10.1007/s00018-025-05639-3","journal":{"identity":"cellular-and-molecular-life-sciences","isVorOnly":false,"title":"Cellular and Molecular Life Sciences"},"publishedOn":"2025-03-19 15:57:59","publishedOnDateReadable":"March 19th, 2025"},"versionCreatedAt":"2024-10-14 08:39:08","video":"","vorDoi":"10.1007/s00018-025-05639-3","vorDoiUrl":"https://doi.org/10.1007/s00018-025-05639-3","workflowStages":[]},"version":"v1","identity":"rs-4806193","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4806193","identity":"rs-4806193","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00