Rapid detection of Tomato brown rugose fruit virus (ToBRFV) using a CRISPR-Cas12a trans-cleavage fluorescence assay | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Rapid detection of Tomato brown rugose fruit virus (ToBRFV) using a CRISPR-Cas12a trans-cleavage fluorescence assay Khadeeja Mucheth Arshad This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7986207/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Tomato brown rugose fruit virus (ToBRFV) has emerged as a significant threat to global tomato cultivation. While current diagnostic tools can detect ToBRFV, they are often expensive, technically demanding, and not easily adapted for use outside the laboratory. In this study, we developed a CRISPR-Cas12a trans-cleavage fluorescence assay integrated with PCR amplification for sensitive and specific detection of ToBRFV. The assay was developed using in silico-designed and chemically synthesised viral DNA templates, primers and CRISPR RNA (crRNA), enabling precise validation of Cas12a-mediated trans-cleavage activity. The use of a fluorophore-quencher (FQ) reporter allowed the direct visualisation of results under a portable blue/UV transilluminator. This PCR-Cas12a method demonstrated high sensitivity under the tested conditions and a faster turnaround, with visible detection possible in 30 min of Cas12a assay incubation following PCR amplification without the need for advanced equipment. This study highlights the advantages of Cas12a-based diagnostics and provides a foundation for developing rapid, efficient, and field-friendly assays for ToBRFV and other plant viruses. Tomato brown rugose fruit virus (ToBRFV) CRISPR Cas12a plant diagnostics PCR fluorescence assay Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Global food security is increasingly challenged by a rapidly growing population, with many people suffering from malnutrition and hidden hunger. While there is an urgent need to increase crop production, plant pathogens pose a major threat to yields. Plant diseases cause an estimated 10% loss in global crop production each year (Venkataraman et al., 2024 ), with plant viruses alone accounting for approximately US $ 30 billion in annual losses. When combined with other pathogens and pests, the total impact reaches nearly US $ 220 billion worldwide (Salem et al., 2023 ). Several factors contribute to the emergence of new plant viruses, including monoculture practices that reduce genetic diversity, global trade of plant material that facilitates the spread of viruses and vectors, climate change altering host and vector distributions, and the inherent ability of viruses to rapidly evolve and adapt (Rubio et al., 2020 ). These challenges demonstrate the need for improved crop protection to maintain global food production. Viruses have a high genetic diversity and reproduce quickly, forming large populations (Rubio et al., 2020 ). Many agricultural and horticultural crops are infected by positive-sense, single-stranded RNA viruses, which exhibit high mutation rates that produce haplotypes or variants around a dominant master sequence (Choudhary et al., 2020 ). As a result, diverse populations of closely related viruses and viroids often coexist in plants, facilitating their adaptability and emergence (Rubio et al., 2020 ). Tomatoes (Solanum lycopersicum) and peppers (Capsicum annuum) are two of the most widely grown vegetables in the world (Baenas et al., 2019 ). Viruses such as begomoviruses, tospoviruses, cucumoviruses, potyviruses, and tobamoviruses pose a threat to these crops, and they are increasingly affected by new pathogens. Among the most serious is Tomato brown rugose fruit virus (ToBRFV), a newly discovered tobamovirus that is now considered a major global threat to tomato cultivation (Zhang et al., 2022 ). In Florida, yield losses of 30–70% have been reported, resulting in annual economic losses of approximately US $ 262 million (Salem et al., 2023 ). Previously tomato resistance genes Tm-2 and Tm-2 2 were used to control tobamoviruses, but ToBRFV has overcome this resistance, causing major outbreaks in Asia, Europe, and North America (Chanda et al., 2021 ). In peppers, ToBRFV overcomes resistance in L1 and L2 genotypes and causes hypersensitive responses in L3 and L4 cultivars (Salem et al., 2023 ). The potential of ToBRFV to overcome genetic resistance, along with inadequate conventional control techniques, poses a significant threat to tomato and pepper production (Zhang et al., 2022 ). The rapid spread of ToBRFV highlights the importance of early detection to enable effective control measures. The viral genome is a positive-sense, single-stranded RNA encoding replication proteins such as p126 (helicase/methyltransferase) and p183 (RNA-dependent RNA polymerase), both of which are needed for infection (Besati et al., 2024). Conventional techniques such as RT-PCR and ELISA are widely used for ToBRFV detection. RT-PCR offers high sensitivity and specificity but requires specialised equipment, trained personnel, and long processing times and may also produce false-positive or false-negative results (Cao et al., 2023 ; Salem et al., 2022 ). Loop-mediated isothermal amplification (LAMP) and RT-LAMP have become increasingly popular in detecting plant viruses, as they are simpler, faster, and low-cost alternatives that do not require a thermocycler (Wang et al., 2022 ). However, these techniques are prone to non-specific amplification, potentially leading to false-positive outcomes, and they still require prior nucleic acid extraction, multiple primer sets and careful temperature control, limiting their field application (Aman et al., 2020 ; Cao et al., 2023 ; Rizzo et al., 2021 ). Other diagnostic platforms, such as transmission electron microscopy (TEM) and serological assays, face limitations, including poor differentiation among tobamoviruses and antibody cross-reactivity (Alfaro-Fernández et al., 2021 ). Next-generation sequencing (NGS) can provide extensive genome information and track viral evolution but is impractical for routine diagnosis due to its high cost, technical complexity, and long turnaround times. More recent advances, such as seed extract–qPCR (SE-qPCR), identify both infectious and non-infectious viral particles, necessitating additional bioassays that are still required to confirm infectivity (Zhang et al., 2022 ). ToBRFV can be detected using several methods, but each has limitations in terms of specificity, cost, infrastructure, processing time, or the need for additional confirmatory steps, especially at low viral concentrations or when distinguishing related viruses. These limitations show how important it is to have innovative platforms such as CRISPR-Cas-based diagnostics, which combine high sensitivity and specificity with faster, simpler procedures ideal for field use. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated (Cas) nucleases detect viral targets by forming a ribonucleoprotein (RNP) complex with a complementary CRISPR RNA (crRNA), enabling specific recognition and cleavage (Alon et al., 2021 ). Recent research has demonstrated the application of CRISPR-Cas12a for detecting both RNA and DNA plant viruses, highlighting its strong potential for plant disease diagnostics (Bernabé-Orts et al., 2022 ). The CRISPR-Cas12a system improves pathogen detection accuracy, offers high specificity, and expands possible opportunities for accurate genomic analysis (Besati et al., 2024). A well-established example of CRISPR-based diagnostics is the DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR) assay, which was developed by Chen et al. ( 2018 ) based on the CRISPR-Cas12a system. DETECTR uses a reporter molecule consisting of single-stranded DNA (ssDNA) labelled with a fluorophore and quencher at opposite ends by using Cas12a trans-cleavage activity (Yin et al., 2021 ). Upon identifying a specific target sequence guided by a crRNA, Cas12a becomes activated and indiscriminately cleaves nearby ssDNA reporters, releasing the fluorophore and producing a visible fluorescence signal. In the absence of target recognition, the reporter remains intact, and fluorescence is suppressed (Shashikala et al., 2025 ). This study presents an in vitro PCR-Cas12a trans-cleavage fluorescence assay for the detection of ToBRFV. Instead of using RT-PCR and other techniques that require RNA extraction and reverse transcription from infected plant material, target regions of the viral genome were identified in silico, and the corresponding DNA templates, crRNAs, and primers were chemically synthesised. The assay was subsequently developed and optimised, offering a safer, reproducible, and time-efficient strategy that can be adapted for future field applications. 2. Materials and methods 2.1 Synthetic Cas12a CRISPR RNAs (crRNAs) Cas12a crRNAs were chemically synthesised by Integrated DNA Technologies (IDT) at a 10 nmol scale. Target sequences (20–24 nt) were selected from ToBRFV reference genome (GenBank accession KT383474) by identifying Cas12a PAM sites (TTTN) using Benchling ( www.benchling.com , accessed July 2022). These sites were further screened for GC content and potential off-target interactions. IDT synthesised the crRNAs by incorporating the selected sequences into the standard Cas12a crRNA scaffold. For this study, a control crRNA described by Li et al. ( 2018 ) was used (Table 1 ). The crRNAs were resuspended in nuclease-free water to a working concentration of 330 nM. 2.2 Synthetic DNA Oligonucleotides Synthetic DNA oligonucleotides corresponding to the ToBRFV target region were purchased from IDT. Two ssDNA oligonucleotides were synthesised, a target strand (TS) containing the protospacer complementary to the crRNA spacer, and a non-target strand (NTS), the reverse complement of the TS. In this assay, ssDNA oligos were tested individually as TS or NTS substrates, or annealed to generate dsDNA templates. Each oligo was resuspended separately in nuclease-free water to prepare individual 100 µM stock solutions. The stocks were diluted 1:10 by mixing 10 µL of the 100 µM solution with 90 µL of nuclease-free water to obtain 10 µM working solutions. These were further diluted 1:30 by mixing 10 µL of the 10 µM solution with 290 µL of nuclease-free water to yield final concentrations of 330 nM. Separate 330 nM working solutions were thus prepared for both TS and NTS. For dsDNA assembly, equimolar TS and NTS (10 µM each in 1× annealing buffer: 10 mM Tris-HCl, pH 7.5–8.0; 50 mM NaCl; 1 mM EDTA) were heated to 95°C for 3 min, then cooled slowly to room temperature (30–45 min) and held at 4°C; the duplex was subsequently diluted to 330 nM for assays. For single-stranded assays, TS or NTS working solutions (330 nM) were used directly. Table 1 List of crRNAs, primers, and oligonucleotides used in this study Name Sequence (5′ → 3′) crRNA (spacer) TTATCGCAACTTTCTACTGAATTC DNA template TS GGATCCTTTCTCCTCTTTCTAGAGTAAAGCTTGAATTCAGTAGAAAGTTG CGATAACAAACAGAAA DNA template NTS TTTCTGTTTGTTATCGCAACTTTCTACTGAATTCAAGCTTTACTCTAGA AAGAGGAGAAAGGATCC ToBRFV-R ACGAGCGTCACGGATGGAGGGC ToBRFV-F ACACATTTGTCCCGCGCGCTCC ssDNA-FQ reporter /5′6-FAM/TTATT/3′IABkFQ/ 2.3 Design of gBlocks and PCR primers Synthetic dsDNA fragments (gBlocks) purchased from IDT, were designed to generate longer DNA templates mimicking a realistic portion of the ToBRFV genome. This gBlock fragment included the Cas12a target site and its flanking regions. The gBlock provided a continuous DNA segment that served as the template for PCR amplification, generating dsDNA amplicons for subsequent Cas12a assays. Target sequences were designed using the Benchling ( www.benchling.com , accessed July 2022), which identifies Cas12a PAM sites (TTTN) and predicts potential off-target interactions. A 24 bp target site containing a PAM sequence was selected from the ToBRFV genome (GenBank accession: KT383474; nt 5714–6193), located within the coat protein gene (Fig. 1 ) and synthesised within the gBlock fragment. A forward primer (ToBRFV-F) and reverse primer (ToBRFV-R) were designed using Benchling based on the gBlock sequence. Each primer was 22 nt in length with a melting temperature of 77.3°C. Short synthetic oligonucleotides (Section 2.2 ) were used as substrates to validate Cas12a cleavage specificity, whereas gBlocks served as viral templates enabling PCR amplification and subsequent assay development. 2.4 PCR Amplification of gBlock ToBRFV Fragment The gBlock was supplied at a concentration of 1000 ng (1682 fmol). It was resuspended in nuclease-free water to prepare a stock concentration of 10 ng/µL. The forward (ToBRFV-F) and reverse (ToBRFV-R) primers were purchased from IDT at 100 µM stock concentration. The primers were diluted 1:10 in nuclease-free water to a working concentration of 10 µM. PCR amplification was carried out in 25 µL reactions containing 12.5 µL of MyFiMix, 1 µL of forward primer (10 µM), 1 µL of reverse primer (10 µM), 100 ng of gBlock template, and nuclease-free water to final volume. Thermocycling program (MyFiMix, 25 µL): 95°C for 2 min; 30 cycles of 95°C for 15 s, 62°C for 20 s, and 72°C for 20 s; final extension 72°C for 5 min; hold 4°C. The resulting PCR amplicons generated from the gBlock were used as dsDNA templates for downstream CRISPR-Cas12a fluorescence detection assays. 2.5 CRISPR-Cas12a PCR Fluorescence Detection Assay For Cas12a detection, Lachnospiraceae bacterium Cas12a (LbCas12a; New England Biolabs) was supplied at a stock concentration of 1 µM and pre-incubated with the corresponding crRNA to form a ribonucleoprotein (RNP) complex. Each 30 µL Cas12a reaction contained 17.2 µL nuclease-free water, 3 µL of 10× NEBuffer r2.1 (diluted to a final concentration of 1×), 3 µL crRNA (330 nM), 1 µL LbCas12a (1 µM), and 3 µL of PCR amplicon generated from the gBlock template (Section 2.4 ). The Cas12a–crRNA (RNP) complex was assembled by incubating the reaction mixture at 37°C for 10 min in PCR microtubes. Subsequently, 2.8 µl of fluorophore–quencher (FQ) ssDNA reporter (/5′6-FAM/TTATT/3′IABkFQ/; Table 1 ) was added to initiate trans-cleavage assay. This reporter design followed the principle described by Li et al. ( 2018 ), where Cas12a-mediated trans-cleavage of ssDNA separates the FAM dye from the quencher, resulting in a measurable fluorescence signal. Reactions were incubated at 37°C for 30 min to allow trans-cleavage and fluorescence development. Fluorescence signals were visualised under a portable blue light transilluminator equipped with a transparent orange acrylic filter to block background light and enhance signal contrast. A photo hood was placed over the setup to minimise stray light, and images were captured using a smartphone camera. 2.6 Establishing Cas12a Detection Assay Using M13mp18 ssDNA The crRNA used in this assay was the same sequence described in Section 2.1 . DNA templates for the reactions were prepared as described in Section 2.2 . Single-stranded M13mp18 DNA purchased from New England Biolabs was used as a reporter substrate to assess trans-cleavage activity of the Cas12a–crRNA complex. Each 30 µL Cas12a reaction contained 17.2 µL nuclease-free water, 3 µL of 10× NEBuffer r2.1 (final concentration of 1×), 3 µL crRNA (330 nM), 1 µL LbCas12a (1 µM), and 3 µL of either TS or NTS oligonucleotides (Section 2.2 ). Reactions were pre-incubated for 10 minutes at 37°C to allow RNP complex formation. Subsequently, 2.8 µL of M13mp18 ssDNA reporter substrate was added, and reactions were incubated for 15 min at 37°C to allow trans-cleavage. Reaction products were mixed with 10 µL of E-Gel loading dye, and 20 µL of each sample was loaded onto an Invitrogen 1% precast agarose E-Gel. Electrophoresis was performed for 30 min, and DNA cleavage patterns were visualised using the Invitrogen E-Gel imaging system. M13mp18 ssDNA was used as a generic trans-cleavage substrate, as Cas12a has been reported to trans-cleave circular ssDNA like M13mp18 (Li et al., 2018 ). This approach is widely used to validate nonspecific ssDNA degradation by Cas12a (Nguyen et al., 2020 ) 2.7 Optimisation and Visualisation of Cas12a Assays To optimise Cas12a trans-cleavage activity, different volumes of the M13mp18 ssDNA substrate (0–9 µL) were tested in reactions containing LbCas12a, crRNA, and either target strand (TS) or non-target (NTS) oligonucleotides (Section 2.2 ). LbCas12a was diluted to a working concentration of 1:60, and crRNA was diluted to 1:9 prior to use. Substrate volumes were varied systematically to evaluate the effect on cleavage efficiency and fluorescence intensity. Control reactions were performed without one or more assay components (LbCas12a, crRNA, or DNA template) to evaluate background cleavage. 3. Results 3.1 Validation of Cas12a activity with synthetic oligos LbCas12a was assembled with crRNA and tested for trans-cleavage activity using circular M13mp18 ssDNA as the reporter substrate (Section 2.6 ). Synthetic oligonucleotides (Section 2.2 ) were used as activators. In reactions containing the target strand (TS), the M13mp18 DNA was fully degraded, visible as smeared bands on agarose gel electrophoresis. In contrast, reactions with the non-target strand (NTS) or lacking either crRNA or Cas12a showed intact M13mp18 bands (Fig. 2 ). 3.2 Optimisation of the Cas12a assay To improve the assay performance, the key reaction components were optimised to maximise on-target signal while minimising background activity Substrate titrations Different volumes of M13mp18 ssDNA (0, 5, 7, and 9 µL per reaction) were tested in complete reactions containing both LbCas12a and crRNA, as well as in control mixtures lacking one of these components (Fig. 3 A). Strong cleavage activity was observed in complete reactions, whereas controls showed only background signal indicating absence of significant cleavage activity. Enzyme and crRNA dilution : LbCas12a was diluted 1:60 (1 µL enzyme in 60 µL of 1× NEBuffer r2.1), and crRNA was diluted 1:9 (1 µL crRNA in 9 µL of 1× NEBuffer r2.1). From these diluted stocks, 1 µL of enzyme and 3 µL of crRNA were added per 30 µL reaction. These conditions produced strong cleavage activity on the M13mp18 substrate, showing that lower amounts of enzyme and crRNA were sufficient for robust assay performance while reducing reagent use (Fig. 3 B). Specificity controls To confirm reaction specificity, Cas12a assays were performed either without crRNA, without Cas12a, without the target DNA, or by substituting with non-target DNA (Fig. 3 C). No detectable degradation of M13mp18 was observed in these controls, indicating that cleavage activity required the presence of both Cas12a and a sequence-matched activator. 3.3 Visual fluorescence readout with FQ reporter To enable direct visual detection, the M13mp18 substrate was replaced with the fluorophore–quencher (FQ) ssDNA probe described in Section 2.5 (Table 1 ). Complete reactions containing LbCas12a, crRNA, and the complementary target strand (TS) produced a clear fluorescent signal under blue/UV illumination. In contrast, reactions containing the non-target strand (NTS) or lacking activator DNA showed no detectable fluorescence. This result demonstrates that Cas12a-mediated recognition of the target strand is sufficient to activate trans-cleavage of the FQ probe, generating a visible fluorescence signal suitable for rapid visual readout (Fig. 4 ). 3.4 Integration with PCR amplicons from ToBRFV To evaluate assay applicability for viral sequence detection, a gBlock-derived fragment of the ToBRFV genome (Section 2.4 ) was PCR amplified and introduced as an activator in Cas12a reactions. Visual fluorescence detection When PCR amplicons were added to Cas12a–crRNA reactions containing the FQ probe, a clear fluorescence signal was observed. Partial reactions lacking either crRNA or Cas12a showed weak background fluorescence, and reactions without the reporter showed no signal (Fig. 5 ). Gel-based detection of trans-cleavage activity Gel- based detection was performed using M13mp18 ssDNA as the substrate, Cas12a–crRNA reactions with ToBRFV amplicons exhibited extensive degradation of ssDNA, visible as diffuse or smeared bands on agarose gels, whereas omitting crRNA or Cas12a retained intact ssDNA (Fig. 6 ). Together, these results demonstrate that PCR-generated ToBRFV fragments specifically activated Cas12a trans-cleavage, confirming detection by both fluorescence-based and gel-based assays. 4. Discussion ToBRFV is a highly destructive virus for tomato crops, posing a serious threat to tomato production due to the lack of effective resistant varieties, its high stability, and ease of transmission (Zhao et al., 2025 ). A key aspect of disease control is identifying the pathogen and preventing its spread. CRISPR-based diagnostics hold the potential to bring the sensitivity and specificity of genetic testing into field applications, enabling faster decision-making at a lower cost. Our findings address the urgent demand for rapid and reliable detection of ToBRFV in field settings. By combining PCR amplification with Cas12a-mediated trans-cleavage, we developed a fluorescence assay that is both rapid and cost-efficient. This experiment validated the target-activated trans-cleavage activity of LbCas12a, which is consistent with previous reports of Cas12a-mediated indiscriminate ssDNA degradation following target recognition (Li et al., 2018 ). In this assay, Cas12a completely degraded M13mp18 ssDNA in complete reactions when a cognate activator was present, while non-target controls showed no cleavage, demonstrating a clear distinction between specific and non-specific sequences. This sequence-dependent activation underlies the diagnostic specificity of the platform. Optimisation studies showed that both enzyme and crRNA concentrations significantly affect assay performance. Dilution experiments showed that even at reduced levels, Cas12a (1:60) and crRNA (1:9) maintained strong cleavage activity, showing that the assay is robust while minimising reagent use. Substrate titration further confirmed that trans-cleavage is concentration dependent, allowing the reaction to be tuned for sensitivity. Specificity controls, in which one or more components were omitted, produced no detectable degradation, confirming that cleavage requires both Cas12a and a sequence-matched activator. Together, these results emphasise that careful optimisation maximises sensitivity while preventing background signal. To simplify detection, we used a fluorophore–quencher (FQ) probe as an alternative reporter substrate. Complete reactions containing Cas12a, crRNA, and target DNA produced strong fluorescence under handheld UV illumination. This simple visual readout eliminates the need for specialised instruments and highlights the potential for on-site use in agricultural settings. Importantly, integrating PCR-amplified ToBRFV fragments into Cas12a reactions yielded clear tube-level fluorescence and significant ssDNA degradation when M13mp18 was used as the collateral cleavage substrate, whereas partial mixes lacking crRNA or Cas12a showed weak background fluorescence. Cas12a is the first Cas nuclease shown to exhibit trans-ssDNA cleavage activity within its ternary complex (Li et al., 2018 ; Li et al., 2023 ). This property may reflect its evolutionary role in defence against ssDNA viruses and provides a powerful basis for nucleic acid diagnostics. The Lachnospiraceae bacterium Cas12a (LbCas12a) enzyme used in this study is advantageous due to its robust cleavage efficiency and tolerance to reduced reaction temperatures (Marqués et al., 2022 ). Conventional diagnostics for ToBRFV and related tobamoviruses rely heavily on RT-qPCR and ELISA. While RT-qPCR provides high sensitivity and specificity, it requires purified RNA, costly reagents, and trained personnel, and endpoint assays can be unreliable with crude extracts (Panno et al., 2019 ; Ota et al., 2025 ). Serological tests such as immunostrips are portable but generally less sensitive (Bernabé-Orts et al., 2021 ). Advanced tools like droplet digital PCR and high-throughput sequencing offer accuracy but remain impractical for field use (Hak et al., 2024 ). Portable nucleic acid detection platforms with high sensitivity and single-base resolution offer great promise for diagnostics and surveillance. However, existing methods vary in sensitivity, cost, and turnaround time (Gootenberg et al., 2017 ). CRISPR-based diagnostics overcome many of these limitations by combining sequence-specific recognition with trans-cleavage of reporter probes, producing clear signals that can be detected visually. CRISPR/Cas systems address many of these challenges, with Cas12a for dsDNA/ssDNA, Cas13a for RNA, and Cas14 for ssDNA, demonstrating broad versatility (Curti et al., 2020 ; Hillary and Ceasar, 2022 ). In particular, Cas12a efficiently cleaves fluorophore–quencher (FQ) reporters, releasing a strong fluorescent signal upon target recognition (Shashikala et al., 2025 ). This feature underpins our assay and supports its potential as a sensitive, simple, and field-deployable diagnostic tool for ToBRFV. This study developed a CRISPR-Cas12a fluorescence assay for ToBRFV detection using synthetic DNA templates along with designed crRNAs and primers, facilitating a controlled and reproducible platform without the need for direct viral extraction. Incorporating PCR amplification into the workflow ensured high sensitivity and specificity, enabling reliable detection even at low template concentrations. Most importantly, the visual fluorescence readout with the naked eye under a simple UV lamp eliminates the need for advanced instrumentation, supporting potential field applicability. ToBRFV clinical specimens were not used in this study. The assay was developed using synthetic DNA templates and a single ToBRFV strain, and therefore further study with virus-infected plant material and multiple strains is required to confirm robustness and broader applicability. Despite these constraints, the assay produces results that are sensitive and rapidly visible to the naked eye. While not yet demonstrated under field conditions, this study establishes a foundation for developing simple, rapid, and effective CRISPR-based diagnostics for ToBRFV and potentially other plant viruses. Declarations Conflict of interest The author declares that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Author Contribution Conceptualization: Khadeeja Mucheth Arshad; Methodology: Khadeeja Mucheth Arshad; Investigation: Khadeeja Mucheth Arshad; Data curation: Khadeeja Mucheth Arshad; Writing – original draft: Khadeeja Mucheth Arshad; Writing – review & editing: Khadeeja Mucheth Arshad Acknowledgement The author gratefully acknowledges the supervision and guidance of Dr. James Stach during the MSc dissertation project, and thanks Newcastle University for providing facilities and support. Data availability The data supporting the findings of this study are available from the corresponding author upon reasonable request. References Alfaro-Fernández A, Castillo P, Sanahuja E, Carmen D, Font MI (2021) First report of tomato brown rugose fruit virus in tomato in Spain. Plant Dis 105(2):515. https://doi.org/10.1094/pdis-06-20-1251-pdn Alon DM, Hak H, Bornstein M, Pines G, Spiegelman Z (2021) Differential detection of the tobamoviruses tomato mosaic virus (ToMV) and tomato brown rugose fruit virus (ToBRFV) using CRISPR-Cas12a. Plants 10(6):1256. https://doi.org/10.3390/plants10061256 Aman R, Mahas A, Marsic T, Hassan N, Mahfouz MM (2020) Efficient, rapid, and sensitive detection of plant RNA viruses with one-pot RT-RPA–CRISPR/Cas12a assay. Front Microbiol 11:610872. https://doi.org/10.3389/fmicb.2020.610872 Baenas N, Belović M, Ilic N, Moreno DA, García-Viguera C (2019) Industrial use of pepper ( Capsicum annuum L.) derived products: Technological benefits and biological advantages. Food Chem 274:872–885. https://doi.org/10.1016/j.foodchem.2018.09.047 Benchling (2022) Benchling: Cloud-based life sciences R&D platform. Available at: https://www.benchling.com (accessed 20 July 2022) Bernabé-Orts JM, Hernando Y, Aranda MA (2022) Toward a CRISPR-based point-of-care test for tomato brown rugose fruit virus detection. PhytoFrontiers 2(2), 92–100. https://doi.org/10.1094/phytofr-08-21-0053-ta Bernabé-Orts JM, Torre C, Méndez-López E, Hernando Y, Aranda MA (2021) New resources for the specific and sensitive detection of the emerging tomato brown rugose fruit virus. Viruses 13(9):1680. https://doi.org/10.3390/v13091680 Cao Y, Weng H, Rao S, Li J, Yan F, Song X (2023) Rapid and visual field diagnosis of tomato brown rugose fruit virus using reverse transcription recombinase aided amplification (RT-RAA) combined with lateral flow strips. Crop Prot 173:106355. https://doi.org/10.1016/j.cropro.2023.106355 Chanda B, Gilliard A, Jaiswal N, Ling KS (2021) Comparative analysis of host range, ability to infect tomato cultivars with Tm-22 gene, and real-time reverse transcription PCR detection of tomato brown rugose fruit virus. Plant Dis 105(11):3643–3652. https://doi.org/10.1094/pdis-05-20-1070-re Chen JS, Ma E, Harrington LB, Da Costa M, Tian X, Palefsky JM, Doudna JA (2018) CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 360(6387):436–439. https://doi.org/10.1126/science.aar6245 Choudhary N, Kumari P, Panda S (2020) RNA plant viruses: Biochemistry, replication and molecular genetics. Appl Plant Virol 183–195. https://doi.org/10.1016/b978-0-12-818654-1.00014-1 Curti LA, Pereyra-Bonnet F, Repizo GD, Fay JV, Salvatierra K, Blariza MJ, Ibañez-Alegre D, Rinflerch AR, Miretti M, Gimenez CA (2020) CRISPR-based platform for carbapenemases and emerging viruses detection using Cas12a (Cpf1) effector nuclease. Emerg Microbes Infect 9(1):1140–1148. https://doi.org/10.1080/22221751.2020.1763857 Gootenberg JS, Abudayyeh OO, Lee JW, Essletzbichler P, Dy AJ, Joung J, Verdine V, Donghia N, Daringer NM, Freije CA, Myhrvold C, Bhattacharyya RP, Livny J, Regev A, Koonin EV, Hung DT, Sabeti PC, Collins JJ, Zhang F (2017) Nucleic acid detection with CRISPR-Cas13a/C2c2. Science 356(6336):438–442. https://doi.org/10.1126/science.aam9321 Hak H, Ostendorp S, Reza A, Greenberg SI, Pines G, Kehr J, Spiegelman Z (2024) Rapid on-site detection of crop RNA viruses using CRISPR/Cas13a. J Exp Bot. https://doi.org/10.1093/jxb/erae495 Hillary VE, Ceasar SA (2022) A review on the mechanism and applications of CRISPR/Cas9/Cas12/Cas13/Cas14 proteins utilized for genome engineering. Mol Biotechnol 65(3):567–580. https://doi.org/10.1007/s12033-022-00567-0 Li SY, Cheng QX, Liu JK, Nie XQ, Zhao GP, Wang J (2018) CRISPR-Cas12a has both cis- and trans-cleavage activities on single-stranded DNA. Cell Res 28(4):491–493. https://doi.org/10.1038/s41422-018-0022-x Li Y, Liu Y, Tang X, Qiao J, Kou J, Man S, Zhu L, Ma L (2023) CRISPR/Cas-powered amplification-free detection of nucleic acids: Current state of the art, challenges, and futuristic perspectives. ACS Sens 8(12):4420–4441. https://doi.org/10.1021/acssensors.3c01463 Marqués MC, Sánchez-Vicente J, Ruiz R, Montagud-Martínez R, Márquez-Costa R, Gómez G, Carbonell A, Daròs JA, Rodrigo G (2022) Diagnostics of infections produced by the plant viruses TMV, TEV, and PVX with CRISPR-Cas12 and CRISPR-Cas13. ACS Synth Biol 11(7):2384–2393. https://doi.org/10.1021/acssynbio.2c00090 Masoud Besati A, Safarnejad MR, Aliahmadi A, Farzaneh M, Rafati H (2024) Enhanced diagnosis of tomato brown rugose fruit virus (ToBRFV) infections through CRISPR-Cas12 and CRISPR-Cas9 technologies. Research Square [preprint]. https://doi.org/10.21203/rs.3.rs-4734515/v1 Nguyen LT, Smith BM, Jain PK (2020) Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection. Nat Commun 11(1):4906. https://doi.org/10.1038/s41467-020-18615-1 Ota E, Shinosaka H, Ishibashi K, Takeyama S, Matsuyama M, Tomitaka Y, Matsushita Y, Osaki K, Kubota K (2025) Development and evaluation of a SYBR Green-based RT-qPCR assay with a specific primer set for tomato seed testing against tomato brown rugose fruit virus. J Gen Plant Pathol. https://doi.org/10.1007/s10327-025-01222-7 Panno S, Ruiz-Ruiz S, Caruso AG, Alfaro-Fernandez A, Ambrosio MIFS, Davino S (2019) Real-time reverse transcription polymerase chain reaction development for rapid detection of tomato brown rugose fruit virus and comparison with other techniques. PeerJ 7:e7928. https://doi.org/10.7717/peerj.7928 Rizzo D, Lio D, Panattoni D, Salemi A, Cappellini C, Bartolini G, Parrella L, G (2021) Rapid and sensitive detection of tomato brown rugose fruit virus in tomato and pepper seeds by reverse transcription loop-mediated isothermal amplification assays (real time and visual) and comparison with RT-PCR end-point and RT-qPCR methods. Front Microbiol 12:640932. https://doi.org/10.3389/fmicb.2021.640932 Rubio L, Galipienso L, Ferriol I (2020) Detection of plant viruses and disease management: Relevance of genetic diversity and evolution. Front Plant Sci 11:1092. https://doi.org/10.3389/fpls.2020.01092 Salem NM, Abumuslem M, Turina M, Samarah N, Sulaiman A, Abu-Irmaileh B, Ata Y (2022) New weed hosts for tomato brown rugose fruit virus in wild Mediterranean vegetation. Plants 11(17):2287. https://doi.org/10.3390/plants11172287 Salem NM, Jewehan A, Aranda MA, Fox A (2023) Tomato brown rugose fruit virus pandemic. Annu Rev Phytopathol 61:1–23. https://doi.org/10.1146/annurev-phyto-021622-120703 Shashikala T, Yogi D, Akshay K, Ashok K, Nagesha SN, Manamohan M, Jha GK, Asokan R (2025) CRISPR/Cas12a mediated rapid and efficient detection of tomato leaf curl Karnataka virus without amplification. Biocatal Agric Biotechnol 64:103528. https://doi.org/10.1016/j.bcab.2025.103528 Venkataraman S, Shahgolzari M, Hefferon K, Atri E, De Steur H (2024) Economic impacts of viroids. Preprints [preprint]. https://doi.org/10.20944/preprints202405.2134.v1 Wang YM, Ostendorf B, Gautam D, Habili N, Pagay V (2022) Plant viral disease detection: From molecular diagnosis to optical sensing technology—A multidisciplinary review. Remote Sens 14(7):1542. https://doi.org/10.3390/rs14071542 Yin L, Man S, Ye S, Liu G, Ma L (2021) CRISPR-Cas based virus detection: Recent advances and perspectives. Biosens Bioelectron 193:113541. https://doi.org/10.1016/j.bios.2021.113541 Zhang S, Griffiths JS, Marchand G, Bernards MA, Wang A (2022) Tomato brown rugose fruit virus: An emerging and rapidly spreading plant RNA virus that threatens tomato production worldwide. Mol Plant Pathol 23(9):1262–1277. https://doi.org/10.1111/mpp.13229 Zhao X, Xu Y, Xu X, Zhou H, Shi J, Yang C, Zhou X, Yang X (2025) Comprehensive sampling and detection strategies for the field surveillance of tomato brown rugose fruit virus. Agronomy 15(2):318. https://doi.org/10.3390/agronomy15020318 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7986207","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":539784253,"identity":"ce59f72a-ac8d-49d7-b1e0-3274a09a3a15","order_by":0,"name":"Khadeeja Mucheth Arshad","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABP0lEQVRIie3Pv0rDQBzA8TsKNzV2vXBin0AwFFIKlj6IS0qgXRoXlwyxBIS4FFwPrPUV7HJzwsF1ibge2KEumRTqIgH/4CXokjbiKJgvuUv4cZ+QAFBV9QfDWC0AUPacbaFadXW56l6r+b8g1jeJMwJ/IqBAtCAbbCf65dmDXLs7zX1qJ6vndNlsX9xG66fZ6VHjXJHUZUVCdkWrQ2NkMDloG9RKjKk8tvUrtnAohz6cxPdFsoctk2gBgkyOEKlbHFJcPyAaE46vSA0GW8jwhbx/oF5O3izeo4249apNhXNdQggemQT6qJ8TYPE+BWqi+Z5zU0J0OjrpTASyWZyY+mTAbape0pmK0JkrEm35FyyHc5l6ossWdoLTQ97NPkw+emNndsejVepukK/ExoTne1hyXuVtTMblh6uqqqr+W59Y4HvcgXhNeAAAAABJRU5ErkJggg==","orcid":"","institution":"Newcastle University","correspondingAuthor":true,"prefix":"","firstName":"Khadeeja","middleName":"Mucheth","lastName":"Arshad","suffix":""}],"badges":[],"createdAt":"2025-10-30 07:23:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7986207/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7986207/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":95157749,"identity":"9414c825-5769-45fc-9161-a673e434a5c2","added_by":"auto","created_at":"2025-11-05 02:15:48","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":10089313,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic representation of the Tomato brown rugose fruit virus (ToBRFV).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eReference genome (GenBank accession KT383474; 6397 nt) showing annotated coding sequences (CDSs). The Cas12a target site (24 bp, including PAM) located within the coat protein gene is highlighted. Genome schematic generated using Benchling (\u003ca href=\"http://www.benchling.com/?utm_source=chatgpt.com\" target=\"_new\"\u003ewww.benchling.com\u003c/a\u003e; accessed July 2022).\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-7986207/v1/ea07ecf12bc9016b75b0ae7e.png"},{"id":95157744,"identity":"bd870d68-5080-40f9-9c06-1db312a1ac1f","added_by":"auto","created_at":"2025-11-05 02:15:47","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1607897,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eValidation of Cas12a trans-cleavage activity using synthetic oligonucleotides.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCas12a was incubated with target (TS) or non-target (NTS) synthetic DNA oligonucleotides\u003c/p\u003e\n\u003cp\u003ein the presence of M13mp18 ssDNA as a collateral substrate. Complete reactions containing\u003c/p\u003e\n\u003cp\u003eCas12a, crRNA, and TS resulted in full degradation of M13mp18 DNA, visible as smeared\u003c/p\u003e\n\u003cp\u003ebands on agarose gel electrophoresis. No degradation was observed in reactions lacking\u003c/p\u003e\n\u003cp\u003eCas12a, crRNA, or with the NTS control, confirming sequence-specific activation.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-7986207/v1/419a2f4e6b88422f3a2fdef7.png"},{"id":95157747,"identity":"0e8a8121-066f-4a27-87bb-c248f57040e6","added_by":"auto","created_at":"2025-11-05 02:15:47","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":5978633,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOptimisation of the Cas12a fluorescence assay.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Effect of increasing M13mp18 ssDNA substrate volume (0–9 µL) on fluorescence output.\u003c/p\u003e\n\u003cp\u003e(B) Optimised dilutions of LbCas12a (1:60) and crRNA (1:9) maintained strong cleavage\u003c/p\u003e\n\u003cp\u003ewhile conserving reagents. (C) Control reactions lacking Cas12a, crRNA, or target DNA\u003c/p\u003e\n\u003cp\u003eproduced no fluorescence, confirming reaction specificity.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-7986207/v1/a53aaf272572b9d735a14576.png"},{"id":95157748,"identity":"be1ec261-362d-4172-87e5-527ec3e5f07e","added_by":"auto","created_at":"2025-11-05 02:15:47","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2110472,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFluorophore–quencher (FQ) probe–based fluorescence detection of Cas12a\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eactivity.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCas12a reactions containing crRNA and the target strand (TS) generated a strong fluorescent\u003c/p\u003e\n\u003cp\u003esignal under blue/UV illumination, whereas reactions with the non-target strand (NTS) or\u003c/p\u003e\n\u003cp\u003elacking activator DNA produced no detectable fluorescence. The assay enables rapid, visual\u003c/p\u003e\n\u003cp\u003eidentification of positive samples within 30 min without specialised instrumentation.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-7986207/v1/71f25bac3b965316ab1d8a56.png"},{"id":95157745,"identity":"deb34445-2ec8-48b8-91e4-36017a0ad1a4","added_by":"auto","created_at":"2025-11-05 02:15:47","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3905580,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDetection of ToBRFV PCR amplicons using the CRISPR-Cas12a fluorescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eassay.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePCR products generated from the synthetic ToBRFV gBlock fragment activated Cas12a-\u003c/p\u003e\n\u003cp\u003emediated trans-cleavage, producing bright fluorescence in complete reactions containing\u003c/p\u003e\n\u003cp\u003eCas12a, crRNA, and FQ reporter. Negative controls lacking any one component showed only\u003c/p\u003e\n\u003cp\u003ebackground levels, confirming assay specificity and compatibility with PCR-amplified viral\u003c/p\u003e\n\u003cp\u003etargets.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-7986207/v1/c0af77428ef555cf7f5030d2.png"},{"id":95225894,"identity":"b12ee199-d89a-43fc-b0f1-7111cae3a11c","added_by":"auto","created_at":"2025-11-05 16:25:43","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1817245,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGel-based validation of Cas12a activation by ToBRFV PCR amplicons.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM13mp18 ssDNA degradation was observed in Cas12a–crRNA reactions containing\u003c/p\u003e\n\u003cp\u003eToBRFV PCR amplicons, whereas control reactions lacking Cas12a, crRNA, or target DNA\u003c/p\u003e\n\u003cp\u003eshowed intact substrate. These results confirm sequence-specific activation of Cas12a by\u003c/p\u003e\n\u003cp\u003ePCR-derived ToBRFV fragments.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-7986207/v1/583e36a9b971d00d8db14e81.png"},{"id":95230579,"identity":"7ca3ba99-8036-426d-a3ed-e868e89b8827","added_by":"auto","created_at":"2025-11-05 16:38:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":24770288,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7986207/v1/b80df6e3-6024-44a9-ad22-baa6eb4f137a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Rapid detection of Tomato brown rugose fruit virus (ToBRFV) using a CRISPR-Cas12a trans-cleavage fluorescence assay","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eGlobal food security is increasingly challenged by a rapidly growing population, with many people suffering from malnutrition and hidden hunger. While there is an urgent need to increase crop production, plant pathogens pose a major threat to yields. Plant diseases cause an estimated 10% loss in global crop production each year (Venkataraman et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), with plant viruses alone accounting for approximately US\u003cspan\u003e$\u003c/span\u003e30\u0026nbsp;billion in annual losses. When combined with other pathogens and pests, the total impact reaches nearly US\u003cspan\u003e$\u003c/span\u003e220\u0026nbsp;billion worldwide (Salem et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Several factors contribute to the emergence of new plant viruses, including monoculture practices that reduce genetic diversity, global trade of plant material that facilitates the spread of viruses and vectors, climate change altering host and vector distributions, and the inherent ability of viruses to rapidly evolve and adapt (Rubio et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). These challenges demonstrate the need for improved crop protection to maintain global food production.\u003c/p\u003e\u003cp\u003eViruses have a high genetic diversity and reproduce quickly, forming large populations (Rubio et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Many agricultural and horticultural crops are infected by positive-sense, single-stranded RNA viruses, which exhibit high mutation rates that produce haplotypes or variants around a dominant master sequence (Choudhary et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). As a result, diverse populations of closely related viruses and viroids often coexist in plants, facilitating their adaptability and emergence (Rubio et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eTomatoes \u003cem\u003e(Solanum lycopersicum)\u003c/em\u003e and peppers \u003cem\u003e(Capsicum annuum)\u003c/em\u003e are two of the most widely grown vegetables in the world (Baenas et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Viruses such as begomoviruses, tospoviruses, cucumoviruses, potyviruses, and tobamoviruses pose a threat to these crops, and they are increasingly affected by new pathogens. Among the most serious is Tomato brown rugose fruit virus (ToBRFV), a newly discovered tobamovirus that is now considered a major global threat to tomato cultivation (Zhang et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In Florida, yield losses of 30\u0026ndash;70% have been reported, resulting in annual economic losses of approximately US\u003cspan\u003e$\u003c/span\u003e262\u0026nbsp;million (Salem et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Previously tomato resistance genes \u003cem\u003eTm-2\u003c/em\u003e and \u003cem\u003eTm-2\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e were used to control tobamoviruses, but ToBRFV has overcome this resistance, causing major outbreaks in Asia, Europe, and North America (Chanda et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In peppers, ToBRFV overcomes resistance in \u003cem\u003eL1\u003c/em\u003e and \u003cem\u003eL2\u003c/em\u003e genotypes and causes hypersensitive responses in L3 and L4 cultivars (Salem et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The potential of ToBRFV to overcome genetic resistance, along with inadequate conventional control techniques, poses a significant threat to tomato and pepper production (Zhang et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe rapid spread of ToBRFV highlights the importance of early detection to enable effective control measures. The viral genome is a positive-sense, single-stranded RNA encoding replication proteins such as p126 (helicase/methyltransferase) and p183 (RNA-dependent RNA polymerase), both of which are needed for infection (Besati et al., 2024). Conventional techniques such as RT-PCR and ELISA are widely used for ToBRFV detection. RT-PCR offers high sensitivity and specificity but requires specialised equipment, trained personnel, and long processing times and may also produce false-positive or false-negative results (Cao et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Salem et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Loop-mediated isothermal amplification (LAMP) and RT-LAMP have become increasingly popular in detecting plant viruses, as they are simpler, faster, and low-cost alternatives that do not require a thermocycler (Wang et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). However, these techniques are prone to non-specific amplification, potentially leading to false-positive outcomes, and they still require prior nucleic acid extraction, multiple primer sets and careful temperature control, limiting their field application (Aman et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Cao et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Rizzo et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Other diagnostic platforms, such as transmission electron microscopy (TEM) and serological assays, face limitations, including poor differentiation among tobamoviruses and antibody cross-reactivity (Alfaro-Fern\u0026aacute;ndez et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Next-generation sequencing (NGS) can provide extensive genome information and track viral evolution but is impractical for routine diagnosis due to its high cost, technical complexity, and long turnaround times. More recent advances, such as seed extract\u0026ndash;qPCR (SE-qPCR), identify both infectious and non-infectious viral particles, necessitating additional bioassays that are still required to confirm infectivity (Zhang et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eToBRFV can be detected using several methods, but each has limitations in terms of specificity, cost, infrastructure, processing time, or the need for additional confirmatory steps, especially at low viral concentrations or when distinguishing related viruses. These limitations show how important it is to have innovative platforms such as CRISPR-Cas-based diagnostics, which combine high sensitivity and specificity with faster, simpler procedures ideal for field use. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated (Cas) nucleases detect viral targets by forming a ribonucleoprotein (RNP) complex with a complementary CRISPR RNA (crRNA), enabling specific recognition and cleavage (Alon et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Recent research has demonstrated the application of CRISPR-Cas12a for detecting both RNA and DNA plant viruses, highlighting its strong potential for plant disease diagnostics (Bernab\u0026eacute;-Orts et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The CRISPR-Cas12a system improves pathogen detection accuracy, offers high specificity, and expands possible opportunities for accurate genomic analysis (Besati et al., 2024). A well-established example of CRISPR-based diagnostics is the DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR) assay, which was developed by Chen et al. (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) based on the CRISPR-Cas12a system. DETECTR uses a reporter molecule consisting of single-stranded DNA (ssDNA) labelled with a fluorophore and quencher at opposite ends by using Cas12a trans-cleavage activity (Yin et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Upon identifying a specific target sequence guided by a crRNA, Cas12a becomes activated and indiscriminately cleaves nearby ssDNA reporters, releasing the fluorophore and producing a visible fluorescence signal. In the absence of target recognition, the reporter remains intact, and fluorescence is suppressed (Shashikala et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2025\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThis study presents an in vitro PCR-Cas12a trans-cleavage fluorescence assay for the detection of ToBRFV. Instead of using RT-PCR and other techniques that require RNA extraction and reverse transcription from infected plant material, target regions of the viral genome were identified in silico, and the corresponding DNA templates, crRNAs, and primers were chemically synthesised. The assay was subsequently developed and optimised, offering a safer, reproducible, and time-efficient strategy that can be adapted for future field applications.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Synthetic Cas12a CRISPR RNAs (crRNAs)\u003c/h2\u003e\u003cp\u003eCas12a crRNAs were chemically synthesised by Integrated DNA Technologies (IDT) at a 10 nmol scale. Target sequences (20\u0026ndash;24 nt) were selected from ToBRFV reference genome (GenBank accession KT383474) by identifying Cas12a PAM sites (TTTN) using Benchling (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"http://www.benchling.com\" target=\"_blank\"\u003ewww.benchling.com\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.benchling.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e, accessed July 2022). These sites were further screened for GC content and potential off-target interactions. IDT synthesised the crRNAs by incorporating the selected sequences into the standard Cas12a crRNA scaffold. For this study, a control crRNA described by Li et al. (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) was used (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The crRNAs were resuspended in nuclease-free water to a working concentration of 330 nM.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Synthetic DNA Oligonucleotides\u003c/h2\u003e\u003cp\u003eSynthetic DNA oligonucleotides corresponding to the ToBRFV target region were purchased from IDT. Two ssDNA oligonucleotides were synthesised, a target strand (TS) containing the protospacer complementary to the crRNA spacer, and a non-target strand (NTS), the reverse complement of the TS. In this assay, ssDNA oligos were tested individually as TS or NTS substrates, or annealed to generate dsDNA templates. Each oligo was resuspended separately in nuclease-free water to prepare individual 100 \u0026micro;M stock solutions. The stocks were diluted 1:10 by mixing 10 \u0026micro;L of the 100 \u0026micro;M solution with 90 \u0026micro;L of nuclease-free water to obtain 10 \u0026micro;M working solutions. These were further diluted 1:30 by mixing 10 \u0026micro;L of the 10 \u0026micro;M solution with 290 \u0026micro;L of nuclease-free water to yield final concentrations of 330 nM. Separate 330 nM working solutions were thus prepared for both TS and NTS.\u003c/p\u003e\u003cp\u003eFor dsDNA assembly, equimolar TS and NTS (10 \u0026micro;M each in 1\u0026times; annealing buffer: 10 mM Tris-HCl, pH 7.5\u0026ndash;8.0; 50 mM NaCl; 1 mM EDTA) were heated to 95\u0026deg;C for 3 min, then cooled slowly to room temperature (30\u0026ndash;45 min) and held at 4\u0026deg;C; the duplex was subsequently diluted to 330 nM for assays. For single-stranded assays, TS or NTS working solutions (330 nM) were used directly.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of crRNAs, primers, and oligonucleotides used in this study\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eName\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"1\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSequence (5\u0026prime; \u0026rarr; 3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ecrRNA (spacer)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cspan fontcategory=\"NonProportional\" class=\"\" name=\"Emphasis\"\u003eTTATCGCAACTTTCTACTGAATTC\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA template TS\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cspan fontcategory=\"NonProportional\" class=\"\" name=\"Emphasis\"\u003eGGATCCTTTCTCCTCTTTCTAGAGTAAAGCTTGAATTCAGTAGAAAGTTG\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cspan fontcategory=\"NonProportional\" class=\"\" name=\"Emphasis\"\u003eCGATAACAAACAGAAA\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA template NTS\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cspan fontcategory=\"NonProportional\" class=\"\" name=\"Emphasis\"\u003eTTTCTGTTTGTTATCGCAACTTTCTACTGAATTCAAGCTTTACTCTAGA\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cspan fontcategory=\"NonProportional\" class=\"\" name=\"Emphasis\"\u003eAAGAGGAGAAAGGATCC\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eToBRFV-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cspan fontcategory=\"NonProportional\" class=\"\" name=\"Emphasis\"\u003eACGAGCGTCACGGATGGAGGGC\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eToBRFV-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cspan fontcategory=\"NonProportional\" class=\"\" name=\"Emphasis\"\u003eACACATTTGTCCCGCGCGCTCC\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003essDNA-FQ reporter\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cspan fontcategory=\"NonProportional\" class=\"\" name=\"Emphasis\"\u003e/5\u0026prime;6-FAM/TTATT/3\u0026prime;IABkFQ/\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 Design of gBlocks and PCR primers\u003c/h2\u003e\u003cp\u003eSynthetic dsDNA fragments (gBlocks) purchased from IDT, were designed to generate longer DNA templates mimicking a realistic portion of the ToBRFV genome. This gBlock fragment included the Cas12a target site and its flanking regions. The gBlock provided a continuous DNA segment that served as the template for PCR amplification, generating dsDNA amplicons for subsequent Cas12a assays.\u003c/p\u003e\u003cp\u003eTarget sequences were designed using the Benchling (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"http://www.benchling.com\" target=\"_blank\"\u003ewww.benchling.com\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.benchling.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e, accessed July 2022), which identifies Cas12a PAM sites (TTTN) and predicts potential off-target interactions. A 24 bp target site containing a PAM sequence was selected from the ToBRFV genome (GenBank accession: KT383474; nt 5714\u0026ndash;6193), located within the coat protein gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) and synthesised within the gBlock fragment.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eA forward primer (ToBRFV-F) and reverse primer (ToBRFV-R) were designed using Benchling based on the gBlock sequence. Each primer was 22 nt in length with a melting temperature of 77.3\u0026deg;C. Short synthetic oligonucleotides (Section \u003cspan refid=\"Sec4\" class=\"InternalRef\"\u003e2.2\u003c/span\u003e) were used as substrates to validate Cas12a cleavage specificity, whereas gBlocks served as viral templates enabling PCR amplification and subsequent assay development.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 PCR Amplification of gBlock ToBRFV Fragment\u003c/h2\u003e\u003cp\u003eThe gBlock was supplied at a concentration of 1000 ng (1682 fmol). It was resuspended in nuclease-free water to prepare a stock concentration of 10 ng/\u0026micro;L. The forward (ToBRFV-F) and reverse (ToBRFV-R) primers were purchased from IDT at 100 \u0026micro;M stock concentration. The primers were diluted 1:10 in nuclease-free water to a working concentration of 10 \u0026micro;M. PCR amplification was carried out in 25 \u0026micro;L reactions containing 12.5 \u0026micro;L of MyFiMix, 1 \u0026micro;L of forward primer (10 \u0026micro;M), 1 \u0026micro;L of reverse primer (10 \u0026micro;M), 100 ng of gBlock template, and nuclease-free water to final volume. Thermocycling program (MyFiMix, 25 \u0026micro;L): 95\u0026deg;C for 2 min; 30 cycles of 95\u0026deg;C for 15 s, 62\u0026deg;C for 20 s, and 72\u0026deg;C for 20 s; final extension 72\u0026deg;C for 5 min; hold 4\u0026deg;C.\u003c/p\u003e\u003cp\u003eThe resulting PCR amplicons generated from the gBlock were used as dsDNA templates for downstream CRISPR-Cas12a fluorescence detection assays.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 CRISPR-Cas12a PCR Fluorescence Detection Assay\u003c/h2\u003e\u003cp\u003eFor Cas12a detection, \u003cem\u003eLachnospiraceae bacterium\u003c/em\u003e Cas12a (LbCas12a; New England Biolabs) was supplied at a stock concentration of 1 \u0026micro;M and pre-incubated with the corresponding crRNA to form a ribonucleoprotein (RNP) complex. Each 30 \u0026micro;L Cas12a reaction contained 17.2 \u0026micro;L nuclease-free water, 3 \u0026micro;L of 10\u0026times; NEBuffer r2.1 (diluted to a final concentration of 1\u0026times;), 3 \u0026micro;L crRNA (330 nM), 1 \u0026micro;L LbCas12a (1 \u0026micro;M), and 3 \u0026micro;L of PCR amplicon generated from the gBlock template (Section \u003cspan refid=\"Sec6\" class=\"InternalRef\"\u003e2.4\u003c/span\u003e). The Cas12a\u0026ndash;crRNA (RNP) complex was assembled by incubating the reaction mixture at 37\u0026deg;C for 10 min in PCR microtubes. Subsequently, 2.8 \u0026micro;l of fluorophore\u0026ndash;quencher (FQ) ssDNA reporter (/5\u0026prime;6-FAM/TTATT/3\u0026prime;IABkFQ/; Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) was added to initiate trans-cleavage assay. This reporter design followed the principle described by Li et al. (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), where Cas12a-mediated trans-cleavage of ssDNA separates the FAM dye from the quencher, resulting in a measurable fluorescence signal. Reactions were incubated at 37\u0026deg;C for 30 min to allow trans-cleavage and fluorescence development.\u003c/p\u003e\u003cp\u003eFluorescence signals were visualised under a portable blue light transilluminator equipped with a transparent orange acrylic filter to block background light and enhance signal contrast. A photo hood was placed over the setup to minimise stray light, and images were captured using a smartphone camera.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6 Establishing Cas12a Detection Assay Using M13mp18 ssDNA\u003c/h2\u003e\u003cp\u003eThe crRNA used in this assay was the same sequence described in Section \u003cspan refid=\"Sec3\" class=\"InternalRef\"\u003e2.1\u003c/span\u003e. DNA templates for the reactions were prepared as described in Section \u003cspan refid=\"Sec4\" class=\"InternalRef\"\u003e2.2\u003c/span\u003e. Single-stranded M13mp18 DNA purchased from New England Biolabs was used as a reporter substrate to assess trans-cleavage activity of the Cas12a\u0026ndash;crRNA complex.\u003c/p\u003e\u003cp\u003eEach 30 \u0026micro;L Cas12a reaction contained 17.2 \u0026micro;L nuclease-free water, 3 \u0026micro;L of 10\u0026times; NEBuffer r2.1 (final concentration of 1\u0026times;), 3 \u0026micro;L crRNA (330 nM), 1 \u0026micro;L LbCas12a (1 \u0026micro;M), and 3 \u0026micro;L of either TS or NTS oligonucleotides (Section \u003cspan refid=\"Sec4\" class=\"InternalRef\"\u003e2.2\u003c/span\u003e). Reactions were pre-incubated for 10 minutes at 37\u0026deg;C to allow RNP complex formation. Subsequently, 2.8 \u0026micro;L of M13mp18 ssDNA reporter substrate was added, and reactions were incubated for 15 min at 37\u0026deg;C to allow trans-cleavage.\u003c/p\u003e\u003cp\u003eReaction products were mixed with 10 \u0026micro;L of E-Gel loading dye, and 20 \u0026micro;L of each sample was loaded onto an Invitrogen 1% precast agarose E-Gel. Electrophoresis was performed for 30 min, and DNA cleavage patterns were visualised using the Invitrogen E-Gel imaging system.\u003c/p\u003e\u003cp\u003eM13mp18 ssDNA was used as a generic trans-cleavage substrate, as Cas12a has been reported to trans-cleave circular ssDNA like M13mp18 (Li et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). This approach is widely used to validate nonspecific ssDNA degradation by Cas12a (Nguyen et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2020\u003c/span\u003e)\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7 Optimisation and Visualisation of Cas12a Assays\u003c/h2\u003e\u003cp\u003eTo optimise Cas12a trans-cleavage activity, different volumes of the M13mp18 ssDNA substrate (0\u0026ndash;9 \u0026micro;L) were tested in reactions containing LbCas12a, crRNA, and either target strand (TS) or non-target (NTS) oligonucleotides (Section \u003cspan refid=\"Sec4\" class=\"InternalRef\"\u003e2.2\u003c/span\u003e). LbCas12a was diluted to a working concentration of 1:60, and crRNA was diluted to 1:9 prior to use. Substrate volumes were varied systematically to evaluate the effect on cleavage efficiency and fluorescence intensity. Control reactions were performed without one or more assay components (LbCas12a, crRNA, or DNA template) to evaluate background cleavage.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e3.1 Validation of Cas12a activity with synthetic oligos\u003c/h2\u003e\u003cp\u003eLbCas12a was assembled with crRNA and tested for trans-cleavage activity using circular M13mp18 ssDNA as the reporter substrate (Section \u003cspan refid=\"Sec8\" class=\"InternalRef\"\u003e2.6\u003c/span\u003e). Synthetic oligonucleotides (Section \u003cspan refid=\"Sec4\" class=\"InternalRef\"\u003e2.2\u003c/span\u003e) were used as activators. In reactions containing the target strand (TS), the M13mp18 DNA was fully degraded, visible as smeared bands on agarose gel electrophoresis. In contrast, reactions with the non-target strand (NTS) or lacking either crRNA or Cas12a showed intact M13mp18 bands (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e3.2 Optimisation of the Cas12a assay\u003c/h2\u003e\u003cp\u003eTo improve the assay performance, the key reaction components were optimised to maximise on-target signal while minimising background activity\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eSubstrate titrations\u003c/strong\u003e\u003cp\u003eDifferent volumes of M13mp18 ssDNA (0, 5, 7, and 9 \u0026micro;L per reaction) were tested in complete reactions containing both LbCas12a and crRNA, as well as in control mixtures lacking one of these components (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Strong cleavage activity was observed in complete reactions, whereas controls showed only background signal indicating absence of significant cleavage activity.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEnzyme and crRNA dilution\u003c/b\u003e: LbCas12a was diluted 1:60 (1 \u0026micro;L enzyme in 60 \u0026micro;L of 1\u0026times; NEBuffer r2.1), and crRNA was diluted 1:9 (1 \u0026micro;L crRNA in 9 \u0026micro;L of 1\u0026times; NEBuffer r2.1). From these diluted stocks, 1 \u0026micro;L of enzyme and 3 \u0026micro;L of crRNA were added per 30 \u0026micro;L reaction. These conditions produced strong cleavage activity on the M13mp18 substrate, showing that lower amounts of enzyme and crRNA were sufficient for robust assay performance while reducing reagent use (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eSpecificity controls\u003c/strong\u003e\u003cp\u003eTo confirm reaction specificity, Cas12a assays were performed either without crRNA, without Cas12a, without the target DNA, or by substituting with non-target DNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). No detectable degradation of M13mp18 was observed in these controls, indicating that cleavage activity required the presence of both Cas12a and a sequence-matched activator.\u003c/p\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e3.3 Visual fluorescence readout with FQ reporter\u003c/h2\u003e\u003cp\u003eTo enable direct visual detection, the M13mp18 substrate was replaced with the fluorophore\u0026ndash;quencher (FQ) ssDNA probe described in Section \u003cspan refid=\"Sec7\" class=\"InternalRef\"\u003e2.5\u003c/span\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Complete reactions containing LbCas12a, crRNA, and the complementary target strand (TS) produced a clear fluorescent signal under blue/UV illumination. In contrast, reactions containing the non-target strand (NTS) or lacking activator DNA showed no detectable fluorescence. This result demonstrates that Cas12a-mediated recognition of the target strand is sufficient to activate trans-cleavage of the FQ probe, generating a visible fluorescence signal suitable for rapid visual readout (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e3.4 Integration with PCR amplicons from ToBRFV\u003c/h2\u003e\u003cp\u003eTo evaluate assay applicability for viral sequence detection, a gBlock-derived fragment of the ToBRFV genome (Section \u003cspan refid=\"Sec6\" class=\"InternalRef\"\u003e2.4\u003c/span\u003e) was PCR amplified and introduced as an activator in Cas12a reactions.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eVisual fluorescence detection\u003c/strong\u003e\u003cp\u003eWhen PCR amplicons were added to Cas12a\u0026ndash;crRNA reactions containing the FQ probe, a clear fluorescence signal was observed. Partial reactions lacking either crRNA or Cas12a showed weak background fluorescence, and reactions without the reporter showed no signal (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eGel-based detection of trans-cleavage activity\u003c/strong\u003e\u003cp\u003eGel- based detection was performed using M13mp18 ssDNA as the substrate, Cas12a\u0026ndash;crRNA reactions with ToBRFV amplicons exhibited extensive degradation of ssDNA, visible as diffuse or smeared bands on agarose gels, whereas omitting crRNA or Cas12a retained intact ssDNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/p\u003e\u003cp\u003eTogether, these results demonstrate that PCR-generated ToBRFV fragments specifically activated Cas12a trans-cleavage, confirming detection by both fluorescence-based and gel-based assays.\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eToBRFV is a highly destructive virus for tomato crops, posing a serious threat to tomato production due to the lack of effective resistant varieties, its high stability, and ease of transmission (Zhao et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). A key aspect of disease control is identifying the pathogen and preventing its spread. CRISPR-based diagnostics hold the potential to bring the sensitivity and specificity of genetic testing into field applications, enabling faster decision-making at a lower cost. Our findings address the urgent demand for rapid and reliable detection of ToBRFV in field settings. By combining PCR amplification with Cas12a-mediated trans-cleavage, we developed a fluorescence assay that is both rapid and cost-efficient.\u003c/p\u003e\u003cp\u003eThis experiment validated the target-activated trans-cleavage activity of LbCas12a, which is consistent with previous reports of Cas12a-mediated indiscriminate ssDNA degradation following target recognition (Li et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In this assay, Cas12a completely degraded M13mp18 ssDNA in complete reactions when a cognate activator was present, while non-target controls showed no cleavage, demonstrating a clear distinction between specific and non-specific sequences. This sequence-dependent activation underlies the diagnostic specificity of the platform.\u003c/p\u003e\u003cp\u003eOptimisation studies showed that both enzyme and crRNA concentrations significantly affect assay performance. Dilution experiments showed that even at reduced levels, Cas12a (1:60) and crRNA (1:9) maintained strong cleavage activity, showing that the assay is robust while minimising reagent use. Substrate titration further confirmed that trans-cleavage is concentration dependent, allowing the reaction to be tuned for sensitivity. Specificity controls, in which one or more components were omitted, produced no detectable degradation, confirming that cleavage requires both Cas12a and a sequence-matched activator. Together, these results emphasise that careful optimisation maximises sensitivity while preventing background signal.\u003c/p\u003e\u003cp\u003eTo simplify detection, we used a fluorophore\u0026ndash;quencher (FQ) probe as an alternative reporter substrate. Complete reactions containing Cas12a, crRNA, and target DNA produced strong fluorescence under handheld UV illumination. This simple visual readout eliminates the need for specialised instruments and highlights the potential for on-site use in agricultural settings. Importantly, integrating PCR-amplified ToBRFV fragments into Cas12a reactions yielded clear tube-level fluorescence and significant ssDNA degradation when M13mp18 was used as the collateral cleavage substrate, whereas partial mixes lacking crRNA or Cas12a showed weak background fluorescence.\u003c/p\u003e\u003cp\u003eCas12a is the first Cas nuclease shown to exhibit trans-ssDNA cleavage activity within its ternary complex (Li et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Li et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). This property may reflect its evolutionary role in defence against ssDNA viruses and provides a powerful basis for nucleic acid diagnostics. The Lachnospiraceae bacterium Cas12a (LbCas12a) enzyme used in this study is advantageous due to its robust cleavage efficiency and tolerance to reduced reaction temperatures (Marqu\u0026eacute;s et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eConventional diagnostics for ToBRFV and related tobamoviruses rely heavily on RT-qPCR and ELISA. While RT-qPCR provides high sensitivity and specificity, it requires purified RNA, costly reagents, and trained personnel, and endpoint assays can be unreliable with crude extracts (Panno et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ota et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Serological tests such as immunostrips are portable but generally less sensitive (Bernab\u0026eacute;-Orts et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Advanced tools like droplet digital PCR and high-throughput sequencing offer accuracy but remain impractical for field use (Hak et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e\u003cp\u003ePortable nucleic acid detection platforms with high sensitivity and single-base resolution offer great promise for diagnostics and surveillance. However, existing methods vary in sensitivity, cost, and turnaround time (Gootenberg et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). CRISPR-based diagnostics overcome many of these limitations by combining sequence-specific recognition with trans-cleavage of reporter probes, producing clear signals that can be detected visually. CRISPR/Cas systems address many of these challenges, with Cas12a for dsDNA/ssDNA, Cas13a for RNA, and Cas14 for ssDNA, demonstrating broad versatility (Curti et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Hillary and Ceasar, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In particular, Cas12a efficiently cleaves fluorophore\u0026ndash;quencher (FQ) reporters, releasing a strong fluorescent signal upon target recognition (Shashikala et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). This feature underpins our assay and supports its potential as a sensitive, simple, and field-deployable diagnostic tool for ToBRFV.\u003c/p\u003e\u003cp\u003eThis study developed a CRISPR-Cas12a fluorescence assay for ToBRFV detection using synthetic DNA templates along with designed crRNAs and primers, facilitating a controlled and reproducible platform without the need for direct viral extraction. Incorporating PCR amplification into the workflow ensured high sensitivity and specificity, enabling reliable detection even at low template concentrations. Most importantly, the visual fluorescence readout with the naked eye under a simple UV lamp eliminates the need for advanced instrumentation, supporting potential field applicability.\u003c/p\u003e\u003cp\u003eToBRFV clinical specimens were not used in this study. The assay was developed using synthetic DNA templates and a single ToBRFV strain, and therefore further study with virus-infected plant material and multiple strains is required to confirm robustness and broader applicability. Despite these constraints, the assay produces results that are sensitive and rapidly visible to the naked eye. While not yet demonstrated under field conditions, this study establishes a foundation for developing simple, rapid, and effective CRISPR-based diagnostics for ToBRFV and potentially other plant viruses.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eConflict of interest\u003c/h2\u003e\u003cp\u003eThe author declares that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceptualization: Khadeeja Mucheth Arshad; Methodology: Khadeeja Mucheth Arshad; Investigation: Khadeeja Mucheth Arshad; Data curation: Khadeeja Mucheth Arshad; Writing \u0026ndash; original draft: Khadeeja Mucheth Arshad; Writing \u0026ndash; review \u0026amp; editing: Khadeeja Mucheth Arshad\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe author gratefully acknowledges the supervision and guidance of Dr. James Stach during the MSc dissertation project, and thanks Newcastle University for providing facilities and support.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e\u003cp\u003eThe data supporting the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAlfaro-Fern\u0026aacute;ndez A, Castillo P, Sanahuja E, Carmen D, Font MI (2021) First report of tomato brown rugose fruit virus in tomato in Spain. Plant Dis 105(2):515. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/pdis-06-20-1251-pdn\u003c/span\u003e\u003cspan address=\"10.1094/pdis-06-20-1251-pdn\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlon DM, Hak H, Bornstein M, Pines G, Spiegelman Z (2021) Differential detection of the tobamoviruses tomato mosaic virus (ToMV) and tomato brown rugose fruit virus (ToBRFV) using CRISPR-Cas12a. Plants 10(6):1256. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/plants10061256\u003c/span\u003e\u003cspan address=\"10.3390/plants10061256\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAman R, Mahas A, Marsic T, Hassan N, Mahfouz MM (2020) Efficient, rapid, and sensitive detection of plant RNA viruses with one-pot RT-RPA\u0026ndash;CRISPR/Cas12a assay. Front Microbiol 11:610872. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2020.610872\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2020.610872\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBaenas N, Belović M, Ilic N, Moreno DA, Garc\u0026iacute;a-Viguera C (2019) Industrial use of pepper (\u003cem\u003eCapsicum annuum\u003c/em\u003e L.) derived products: Technological benefits and biological advantages. Food Chem 274:872\u0026ndash;885. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.foodchem.2018.09.047\u003c/span\u003e\u003cspan address=\"10.1016/j.foodchem.2018.09.047\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBenchling (2022) Benchling: Cloud-based life sciences R\u0026amp;D platform. Available at: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.benchling.com\u003c/span\u003e\u003cspan address=\"https://www.benchling.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (accessed 20 July 2022)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBernab\u0026eacute;-Orts JM, Hernando Y, Aranda MA (2022) Toward a CRISPR-based point-of-care test for tomato brown rugose fruit virus detection. \u003cem\u003ePhytoFrontiers\u003c/em\u003e 2(2), 92\u0026ndash;100. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/phytofr-08-21-0053-ta\u003c/span\u003e\u003cspan address=\"10.1094/phytofr-08-21-0053-ta\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBernab\u0026eacute;-Orts JM, Torre C, M\u0026eacute;ndez-L\u0026oacute;pez E, Hernando Y, Aranda MA (2021) New resources for the specific and sensitive detection of the emerging tomato brown rugose fruit virus. Viruses 13(9):1680. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/v13091680\u003c/span\u003e\u003cspan address=\"10.3390/v13091680\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCao Y, Weng H, Rao S, Li J, Yan F, Song X (2023) Rapid and visual field diagnosis of tomato brown rugose fruit virus using reverse transcription recombinase aided amplification (RT-RAA) combined with lateral flow strips. Crop Prot 173:106355. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cropro.2023.106355\u003c/span\u003e\u003cspan address=\"10.1016/j.cropro.2023.106355\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChanda B, Gilliard A, Jaiswal N, Ling KS (2021) Comparative analysis of host range, ability to infect tomato cultivars with \u003cem\u003eTm-22\u003c/em\u003e gene, and real-time reverse transcription PCR detection of tomato brown rugose fruit virus. Plant Dis 105(11):3643\u0026ndash;3652. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/pdis-05-20-1070-re\u003c/span\u003e\u003cspan address=\"10.1094/pdis-05-20-1070-re\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen JS, Ma E, Harrington LB, Da Costa M, Tian X, Palefsky JM, Doudna JA (2018) CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 360(6387):436\u0026ndash;439. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.aar6245\u003c/span\u003e\u003cspan address=\"10.1126/science.aar6245\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChoudhary N, Kumari P, Panda S (2020) RNA plant viruses: Biochemistry, replication and molecular genetics. Appl Plant Virol 183\u0026ndash;195. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/b978-0-12-818654-1.00014-1\u003c/span\u003e\u003cspan address=\"10.1016/b978-0-12-818654-1.00014-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCurti LA, Pereyra-Bonnet F, Repizo GD, Fay JV, Salvatierra K, Blariza MJ, Iba\u0026ntilde;ez-Alegre D, Rinflerch AR, Miretti M, Gimenez CA (2020) CRISPR-based platform for carbapenemases and emerging viruses detection using Cas12a (Cpf1) effector nuclease. Emerg Microbes Infect 9(1):1140\u0026ndash;1148. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/22221751.2020.1763857\u003c/span\u003e\u003cspan address=\"10.1080/22221751.2020.1763857\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGootenberg JS, Abudayyeh OO, Lee JW, Essletzbichler P, Dy AJ, Joung J, Verdine V, Donghia N, Daringer NM, Freije CA, Myhrvold C, Bhattacharyya RP, Livny J, Regev A, Koonin EV, Hung DT, Sabeti PC, Collins JJ, Zhang F (2017) Nucleic acid detection with CRISPR-Cas13a/C2c2. Science 356(6336):438\u0026ndash;442. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.aam9321\u003c/span\u003e\u003cspan address=\"10.1126/science.aam9321\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHak H, Ostendorp S, Reza A, Greenberg SI, Pines G, Kehr J, Spiegelman Z (2024) Rapid on-site detection of crop RNA viruses using CRISPR/Cas13a. J Exp Bot. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jxb/erae495\u003c/span\u003e\u003cspan address=\"10.1093/jxb/erae495\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHillary VE, Ceasar SA (2022) A review on the mechanism and applications of CRISPR/Cas9/Cas12/Cas13/Cas14 proteins utilized for genome engineering. Mol Biotechnol 65(3):567\u0026ndash;580. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12033-022-00567-0\u003c/span\u003e\u003cspan address=\"10.1007/s12033-022-00567-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi SY, Cheng QX, Liu JK, Nie XQ, Zhao GP, Wang J (2018) CRISPR-Cas12a has both cis- and trans-cleavage activities on single-stranded DNA. Cell Res 28(4):491\u0026ndash;493. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41422-018-0022-x\u003c/span\u003e\u003cspan address=\"10.1038/s41422-018-0022-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi Y, Liu Y, Tang X, Qiao J, Kou J, Man S, Zhu L, Ma L (2023) CRISPR/Cas-powered amplification-free detection of nucleic acids: Current state of the art, challenges, and futuristic perspectives. ACS Sens 8(12):4420\u0026ndash;4441. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acssensors.3c01463\u003c/span\u003e\u003cspan address=\"10.1021/acssensors.3c01463\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarqu\u0026eacute;s MC, S\u0026aacute;nchez-Vicente J, Ruiz R, Montagud-Mart\u0026iacute;nez R, M\u0026aacute;rquez-Costa R, G\u0026oacute;mez G, Carbonell A, Dar\u0026ograve;s JA, Rodrigo G (2022) Diagnostics of infections produced by the plant viruses TMV, TEV, and PVX with CRISPR-Cas12 and CRISPR-Cas13. ACS Synth Biol 11(7):2384\u0026ndash;2393. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acssynbio.2c00090\u003c/span\u003e\u003cspan address=\"10.1021/acssynbio.2c00090\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMasoud Besati A, Safarnejad MR, Aliahmadi A, Farzaneh M, Rafati H (2024) Enhanced diagnosis of tomato brown rugose fruit virus (ToBRFV) infections through CRISPR-Cas12 and CRISPR-Cas9 technologies. Research Square [preprint]. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.21203/rs.3.rs-4734515/v1\u003c/span\u003e\u003cspan address=\"10.21203/rs.3.rs-4734515/v1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNguyen LT, Smith BM, Jain PK (2020) Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection. Nat Commun 11(1):4906. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-020-18615-1\u003c/span\u003e\u003cspan address=\"10.1038/s41467-020-18615-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOta E, Shinosaka H, Ishibashi K, Takeyama S, Matsuyama M, Tomitaka Y, Matsushita Y, Osaki K, Kubota K (2025) Development and evaluation of a SYBR Green-based RT-qPCR assay with a specific primer set for tomato seed testing against tomato brown rugose fruit virus. J Gen Plant Pathol. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10327-025-01222-7\u003c/span\u003e\u003cspan address=\"10.1007/s10327-025-01222-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePanno S, Ruiz-Ruiz S, Caruso AG, Alfaro-Fernandez A, Ambrosio MIFS, Davino S (2019) Real-time reverse transcription polymerase chain reaction development for rapid detection of tomato brown rugose fruit virus and comparison with other techniques. PeerJ 7:e7928. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7717/peerj.7928\u003c/span\u003e\u003cspan address=\"10.7717/peerj.7928\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRizzo D, Lio D, Panattoni D, Salemi A, Cappellini C, Bartolini G, Parrella L, G (2021) Rapid and sensitive detection of tomato brown rugose fruit virus in tomato and pepper seeds by reverse transcription loop-mediated isothermal amplification assays (real time and visual) and comparison with RT-PCR end-point and RT-qPCR methods. Front Microbiol 12:640932. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2021.640932\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2021.640932\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRubio L, Galipienso L, Ferriol I (2020) Detection of plant viruses and disease management: Relevance of genetic diversity and evolution. Front Plant Sci 11:1092. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2020.01092\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2020.01092\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSalem NM, Abumuslem M, Turina M, Samarah N, Sulaiman A, Abu-Irmaileh B, Ata Y (2022) New weed hosts for tomato brown rugose fruit virus in wild Mediterranean vegetation. Plants 11(17):2287. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/plants11172287\u003c/span\u003e\u003cspan address=\"10.3390/plants11172287\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSalem NM, Jewehan A, Aranda MA, Fox A (2023) Tomato brown rugose fruit virus pandemic. Annu Rev Phytopathol 61:1\u0026ndash;23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev-phyto-021622-120703\u003c/span\u003e\u003cspan address=\"10.1146/annurev-phyto-021622-120703\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShashikala T, Yogi D, Akshay K, Ashok K, Nagesha SN, Manamohan M, Jha GK, Asokan R (2025) CRISPR/Cas12a mediated rapid and efficient detection of tomato leaf curl Karnataka virus without amplification. Biocatal Agric Biotechnol 64:103528. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bcab.2025.103528\u003c/span\u003e\u003cspan address=\"10.1016/j.bcab.2025.103528\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVenkataraman S, Shahgolzari M, Hefferon K, Atri E, De Steur H (2024) Economic impacts of viroids. Preprints [preprint]. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.20944/preprints202405.2134.v1\u003c/span\u003e\u003cspan address=\"10.20944/preprints202405.2134.v1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang YM, Ostendorf B, Gautam D, Habili N, Pagay V (2022) Plant viral disease detection: From molecular diagnosis to optical sensing technology\u0026mdash;A multidisciplinary review. Remote Sens 14(7):1542. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/rs14071542\u003c/span\u003e\u003cspan address=\"10.3390/rs14071542\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYin L, Man S, Ye S, Liu G, Ma L (2021) CRISPR-Cas based virus detection: Recent advances and perspectives. Biosens Bioelectron 193:113541. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bios.2021.113541\u003c/span\u003e\u003cspan address=\"10.1016/j.bios.2021.113541\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang S, Griffiths JS, Marchand G, Bernards MA, Wang A (2022) Tomato brown rugose fruit virus: An emerging and rapidly spreading plant RNA virus that threatens tomato production worldwide. Mol Plant Pathol 23(9):1262\u0026ndash;1277. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/mpp.13229\u003c/span\u003e\u003cspan address=\"10.1111/mpp.13229\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao X, Xu Y, Xu X, Zhou H, Shi J, Yang C, Zhou X, Yang X (2025) Comprehensive sampling and detection strategies for the field surveillance of tomato brown rugose fruit virus. Agronomy 15(2):318. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/agronomy15020318\u003c/span\u003e\u003cspan address=\"10.3390/agronomy15020318\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Tomato brown rugose fruit virus (ToBRFV), CRISPR, Cas12a, plant diagnostics, PCR, fluorescence assay","lastPublishedDoi":"10.21203/rs.3.rs-7986207/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7986207/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTomato brown rugose fruit virus (ToBRFV) has emerged as a significant threat to global tomato cultivation. While current diagnostic tools can detect ToBRFV, they are often expensive, technically demanding, and not easily adapted for use outside the laboratory. In this study, we developed a CRISPR-Cas12a trans-cleavage fluorescence assay integrated with PCR amplification for sensitive and specific detection of ToBRFV. The assay was developed using in silico-designed and chemically synthesised viral DNA templates, primers and CRISPR RNA (crRNA), enabling precise validation of Cas12a-mediated trans-cleavage activity. The use of a fluorophore-quencher (FQ) reporter allowed the direct visualisation of results under a portable blue/UV transilluminator. This PCR-Cas12a method demonstrated high sensitivity under the tested conditions and a faster turnaround, with visible detection possible in 30 min of Cas12a assay incubation following PCR amplification without the need for advanced equipment. This study highlights the advantages of Cas12a-based diagnostics and provides a foundation for developing rapid, efficient, and field-friendly assays for ToBRFV and other plant viruses.\u003c/p\u003e","manuscriptTitle":"Rapid detection of Tomato brown rugose fruit virus (ToBRFV) using a CRISPR-Cas12a trans-cleavage fluorescence assay","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-05 02:15:43","doi":"10.21203/rs.3.rs-7986207/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1e4d408b-df9b-4ac2-8a04-51d29801af18","owner":[],"postedDate":"November 5th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-11-05T02:15:43+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-05 02:15:43","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7986207","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7986207","identity":"rs-7986207","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.