Tm-1 back in business: an allele from Solanum pennellii accessions plays a major role in ToBRFV resistance.

preprint OA: closed
Full text JSON View at publisher
Full text 167,243 characters · extracted from preprint-html · click to expand
Tm-1 back in business: an allele from Solanum pennellii accessions plays a major role in ToBRFV resistance. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Tm-1 back in business: an allele from Solanum pennellii accessions plays a major role in ToBRFV resistance. Romanos Zois, Mireille van Damme, Martin Verbeek, Yuling Bai, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6221483/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 12 Sep, 2025 Read the published version in Theoretical and Applied Genetics → Version 1 posted 4 You are reading this latest preprint version Abstract The Tobamovirus Tomato Brown Rugose Fruit Virus (ToBRFV) poses a significant threat to global tomato production. ToBRFV is a mechanically transmitted virus containing a single-stranded positive sense RNA genome. Disease symptoms include brown, rough patches on fruit surfaces, leaf mosaicism and shape abnormalities, and, in advanced stages, total collapse of infected plants. ToBRFV was first detected in the Middle East in 2014 and has rapidly spread to multiple countries across Asia, Europe, and America. In recent years, numerous studies have focused on the identification of ToBRFV resistance traits that are suitable for tomato breeding programs. In this study, we identified five ToBRFV-resistant accessions of Solanum pennellii , a wild relative of cultivated tomato. We confirmed that the major gene controlling this resistance trait is the S. pennellii allele of Tm-1 . Tm-1 was previously identified in S. habrochaites as a semidominant Tomato Mosaic Virus (ToMV) resistance gene. Our results show that full resistance to ToBRFV disease requires an additional undescribed locus. These results show the potential of S. pennellii as a novel source of resistance against ToBRFV. Tomato brown rugose fruit virus Tobamovirus resistance Solanum lycopersicum wild Solanum accessions Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Key message The Tm-1 allele from S. pennellii accessions together with an additional, likely recessive, locus are required for complete ToBRFV resistance. Introduction Tomato ( Solanum lycopersicum ) is among the most widely cultivated vegetable crops globally, playing a critical role in both commercial agriculture and local economies (FAO 2022 ). However, tomato production is frequently threatened by viral diseases, which can lead to devastating losses (Rivarez et al. 2021 ). International trade and movement of people, along with the widespread use of single resistance genes in large-scale monocultures, accelerate the spread and evolution of viruses (Jones 2021 ). Among these threats, Tomato brown rugose fruit virus (ToBRFV) has emerged as one of the most severe, posing significant challenges to growers worldwide (van Damme et al. 2023 ). First reported in 2014, ToBRFV belongs to the Tobamovirus genus and has rapidly spread across major tomato-growing regions, including Europe, the Middle East, and the Americas (Zhang et al. 2022 ). The virus is highly contagious and spreads mechanically via infected tools, human contact, insect pollinators, contaminated soil, and plant material (Caruso et al. 2022 ). ToBRFV induces severe symptoms like leaf mosaic patterns, yellowing, and wrinkled (rugose) patches on the fruit (González-Concha et al. 2023 ) which reduces the marketable yield. Although agronomic and hygiene measures can help prevent spreading, no chemical treatments can cure infected plants, making resistance breeding the most sustainable and efficient control strategy (Gómez et al. 2009 ; Jones 2006 ). Historically, tomato resistance to tobamoviruses has relied on well-characterized genes like Tm-1 and Tm-2 / Tm-2 2 , which confer protection against strains of tobacco mosaic virus (TMV) and tomato mosaic virus (ToMV) (Hall 1980 ; Ishibashi et al. 2007 ). Tm-2 and its allelic variant Tm-2 2 are dominant resistance genes encoding coiled-coil, nucleotide-binding leucine-rich repeat (CC-NLR) proteins. These proteins recognize the TMV and ToMV movement protein, triggering a hypersensitive response (HR) to halt infection. Found in S. peruvianum accessions and located on chromosome 9, Tm-2 2 is preferred in breeding programs due to its durability over Tm-2 (Lanfermeijer et al. 2003 ; Meshi et al. 1989 ; Strasser and Pfitzner 2007 ; Weber et al. 2004 ). Tm-1 is a semidominant gene introgressed from S. habrochaites PI126445 (Pelham 1966 ) that encodes a 754-amino acid (aa) protein. Tm-1 inhibits tobamovirus replication by binding to the helicase domain of the viral replication protein. This binding restricts the ability of the viral replicase to interact with host factors that facilitate viral replication (Ishibashi 2010 ; Ishibashi et al. 2012 ; Ishibashi and Ishikawa 2014 ). The Tm-1 protein contains two conserved domains: an uncharacterized N-terminal domain and a C-terminal TIM barrel-like domain (Ishibashi et al. 2007 ). Only the N-terminal domain is necessary for Tm-1’s inhibitory activity, as a C-terminal-truncated Tm-1 protein was still able to inhibit viral replication (Ishibashi et al. 2014 ; Kato et al. 2013 ). Furthermore, in S. habrochaites accessions a small region of the Tm-1 N-terminal domain has been found to be positively selected in response to TMV strains able to overcome the initial Tm-1 based resistance, underscoring its importance in the coevolution of tobamoviruses and Solanum species (Ishibashi et al. 2012 ). Interestingly, different allelic variants of Tm-1 show differential resistance responses against various tobamoviruses (Ishibashi et al. 2009 ). For instance, the S. lycopersicum tm-1 allele is not functional against ToMV and TMV but can inhibit the replication of other tobamoviruses, such as Tobacco Mild Green Mosaic Virus (TMGMV) and Pepper Mild Mottle Virus (PMMoV). Additionally, the functionality of Tm-1 against TMV has been shown to be temperature-dependent, exhibiting effective resistance at or below 25°C while losing its effectiveness at 33°C and above (Fraser and Loughlin 1982 ). When ToBRFV emerged, all commercial tomato varieties were susceptible, even those that were resistant to other tobamoviruses such as ToMV, with the primary resistance gene being Tm-2/Tm-2 2 (Hak and Spiegelman 2021 ; Jaiswal et al. 2024 ; Luria et al. 2018 ; Zinger et al. 2021 ). This has propelled the search for novel resistance traits that can withstand ToBRFV infection. Although initially Tm-1 and Tm-2 have been reported as ineffective against ToBRFV, recent studies indicate that they can play a role in novel resistance traits against the virus. Specifically, the Tm-1 locus from certain tomato cultivars, when combined with loci on chromosome 11 and/or chromosome 9, provides resistance (Ashkenazi et al. 2020 ; Zinger et al. 2021 , 2025 ). Regarding Tm-2 , specific artificial amino acid changes can lead to a gain of function providing resistance against ToBRFV (Lindbo 2022 ). However, no naturally occurring variants of Tm-2 have been reported to confer resistance to ToBRFV. Recent research has highlighted wild Solanum species as valuable sources of resistance to ToBRFV. Several accessions from S. pimpinellifolium , S. chilense , S. corneliomulleri , S. habrochaites , S. peruvianum , and S. ochranthum have shown resistance to ToBRFV (Jaiswal et al. 2024 ; Jewehan et al. 2022a , 2022b ; Kabas et al. 2022 ; Topcu et al. 2025 ). These findings emphasize the potential of diverse germplasm to contribute to the development of cultivars with durable, multilayered resistance. Notably, a resistance trait conferred by a dominant NBS-LRR gene on chromosome 8 has been introgressed from S. habrochaites (Ykema et al. 2020). However, ToBRFV isolates capable of overcoming this resistance have already emerged (Zisi et al. 2024 ). In our study, we identified robust resistance in several S. pennellii accessions and confirmed the essential role of the Tm-1 allele in this resistance trait. We also pinpointed the nine most relevant Tm-1 amino acids involved in ToBRFV resistance. Furthermore, we demonstrated that full resistance requires an additional locus from the resistant S. pennellii accessions, which is likely inherited recessively and distinct from those reported in other studies (Ashkenazi et al. 2020 ; Zinger et al. 2021 , 2025 ). These findings provide valuable insights for breeders aiming to mitigate the impact of ToBRFV and offer tomato growers a sustainable solution to this viral threat. Materials and Methods Plant material Ten accessions of S. pennellii , LA 0716, LA 0750, G1.1559, G1.1608, G1.1610, LA 1356, LA 1656, LA 1724, LA 2177 and LA 2580 and the S. lycopersicum cv. Moneymaker (MM) were used in this study (in-house collection of Plant Breeding, Wageningen University and Research (WUR)). F1 plants were obtained from ToBRFV disease-resistant individuals from accessions LA 0716 and LA 0750 that were crossed with susceptible MM. Individual F1 plants were selfed to obtain F2 populations, F2 (LA 0716) and F2 (LA 0750). Plant growth conditions For germination, the seeds were soaked in half-strength household bleach (ca. 2.7% sodium hypochlorite) for 30-60 mins, then rinsed in running water for several minutes. Subsequently, the seeds were put on Whatman® cellulose filter paper in petri dishes containing 1/2x Murashige and Skoog Basal Medium powder (MS) medium without sucrose. The petri dishes were placed in dark at 25°C for two days. Then, the petri dishes were moved into a growing chamber with artificial light and 25°C until the seedlings reached cotyledon stage. The seedlings were transferred into individual pots and moved into the quarantine greenhouse compartment free of pathogens and insects. The growing conditions were stable and controlled throughout the experiments (21°C/19°C (day/night) with 60% relative humidity and day length of 16 hours with the light power of 250 watt. ToBRFV inoculation A Dutch isolate of tomato brown rugose fruit virus (ToBRFV-NVWA, genus Tobamovirus , species Tobamovirus fructirugosum ; NVWA 33610411, NCBI accession code MN882011) was propagated in tomato cv. Moneymaker. Inoculum was prepared by grinding infected tomato leaves displaying clear ToBRFV symptoms in 0.03 M Na-K-phosphate buffer (pH 7.7). The optimal inoculum dilution (1:40–1:50) in inoculation buffer was determined through empirical testing using serial dilutions in Nicotiana glutinosa . Plant inoculation was conducted by dusting cotyledons and the first true leaves with Carborundum (500 mesh) and gently rubbing the leaves with gloved fingers dipped in the inoculum. The climate was set at a 20% relative humidity, a 16/8 hours day night cycle at 20 °C/18 °C (day/night) regime throughout the disease assay. Phenotyping: disease severity index (DSI) and ToBRFV test Symptoms were assessed at 3 to 4 weeks post ToBRFV inoculation. A disease severity index (DSI) was developed and used for scoring F2 generations derived from crosses of S. pennellii accessions with MM plants (Figure 1). The DSI ranged from 0 to 3, where 0 is scored as asymptomatic, 1 for mild symptoms of leaf mosaic, 2 for medium symptoms with strong leaf mosaicism, mild leaf abnormalities and wrinkling, and 3 for severe symptoms of leaf mosaicism, abnormalities and wrinkling. A commercial ToBRFV ImmunoStrip® assay from Agdia was used to determine the systemic spread and presence of ToBRFV, based on ToBRFV coat protein detection, in uninoculated plant parts. Detection of ToBRFV with the immunostrip assay was scored with a (+), while if ToBRFV was not detected a (-) score was given. Quantification of ToBRFV Coat protein levels Stain-free protein gel assays were used to quantify the presence of ToBRFV coat protein in leaf samples. Proteins were extracted from single leaflets in Bioreba bags with 2 ml protein extraction buffer (SEB1 from Agdia). 30 μl of extracted protein was mixed with 10 μl of 4x Laemmli buffer with beta-mercaptoethanol (b-ME). The mixture was heated for five minutes at 95°C. 10 μl of the samples were loaded in Mini-PROTEAN TGX Stain-Free precast gels from BIO-RAD. Gel pictures were taken with GelDoc Go Gel Imaging System Bio-Rad. Development of Cleaved Amplified Polymorphic Sequence (CAPS) markers CAPS markers were used for the genetic analysis of important tobamovirus resistance loci. The primers for the CAPS markers were designed based on the tomato Heinz genome (SL4.0 version) and the S. pennellii LA 0716 genome (Bolger et al. 2014) retrieved from Sol genomics database (https://solgenomics.net; for Tm-1 : S. lycopersicum Solyc02g062560 , S. pennellii Sopen02g013570 , and for Tm-2 : S. lycopersicum Solyc09g018220 , S. pennellii Sopen09g035210 ). The primers for the QTL11 marker were designed to amplify a region on chromosome 11, while the primers for the QTL9 marker target a region on chromosome 9, as described by Zinger et al. (2021) and Ashkenazi et al. (2020), respectively. Genomic DNA was extracted from the youngest leaf of each F2 individual using a modified cetyltrimethylammonium bromide (CTAB) protocol as described by Schenk et al. (2023). These genomic DNA samples were used as template for PCRs with the CAPS marker primers. The PCR products were digested with appropriate restriction enzymes. The products of digestion were separated on a 1.5% agarose gel and visualized with GelDoc Go Gel Imaging System by Bio-Rad. Used primers and restriction enzymes are indicated in Table 1. Table 1 PCR primers and conditions for CAPS markers and the restriction enzymes used. Name Primer sequence (5'→3') Chromosomal location PCR product size Restriction enzyme Digestion products Tm-1 marker Fw: TCTCACCATTCTCACACTGAGTTAC Spenn-ch02: 36968554-36967408 S. pennellii: 1147 bp BamHI S. pennellii: ~500, 650 bp Rv: ACTGAAGGAAACAATACCAAGTCTG SL4.0ch02: 32289329-32290472 S. lycopersicum: 1144 bp S. lycopersicum: ~430, 720 bp Tm-2 marker Fw: CCTTTTTCATTAATGTGCAGCTGCC Spenn-ch09: 18228467-18227445 S. pennellii: 1023 bp EcoRV S. pennellii: ~1023 bp Rv: GAGACGTGATTATCATTCTACTGCCG SL4.0ch09: 13658610-3659650 S. lycopersicum: 1041 bp S. lycopersicum: ~297, 744 bp QTL11 marker Fw: GGTACCCTCTCAATCTCAAGGTC Spenn-ch11: 9645767-9646451 S. pennellii: 685 bp TaqI S. pennellii: ~ 230, 450 bp Rv: GAATTTACACGCCACCTTCCTC SL4.0ch11: 8971865-8972550 S. lycopersicum: 686 bp S. lycopersicum: ~190, 490 bp QTL9 marker Fw: TTCTTCCTTTGCCTGTTCTATTTG Spenn-ch9: 74872135-74872729 S. pennellii: 649 bp TaqI S. pennellii: ~170, 480 bp Rv: GACTCATTACATTGTTCCTCCC SL4.0ch9: 59672886-59673482 S. lycopersicum: 597 bp S. lycopersicum: ~170, 420 bp Statistical analysis Chi-squared (χ²) tests of independence were conducted in Microsoft Excel to assess the association between CAPS genetic markers and phenotypic results based on the disease severity index (DSI). The analysis evaluated whether the genotypic distribution of individuals in the F₂ (LA 0716) population differed significantly across phenotypic groups. Virus-induced gene silencing (VIGS) The target sequences for silencing S. pennellii Tm-1 and Tm-2 alleles were selected using the Sol genomics VIGS tool (Fernandez-Pozo et al. 2015). The selected target regions for S. pennellii and S. lycopersicum Tm-1 alleles (Solyc02g062560 and Sopen02g013570) and Tm-2 alleles (Solyc09g018220 and Sopen09g035210) shared high levels of sequence homology , and therefore the same construct can be used to silence the respective Tm genes in both Solanum species. Amplified PCR fragments of the target region (300 bp) of Tm-1 and Tm-2 genes were directionally cloned in pENTR™ by TOPO® Cloning strategy. The Tm-1 fragment was amplified with primers Tm-1_ VIGS_Fw (5’-GTAGGAGTGACAGTTGTTGATGTC-3’) and Tm-1_ VIGS_Rv (5’-AACTTTTGGGATTCCAATTGGAAG-3’), while the Tm-2 fragment was amplified with primers Tm-2_ VIGS_Fw (5’-TAGAAGGGTTGTTGACATTGACCGA-3’) and Tm-2_ VIGS_Rv (5’-GAAACGTAGACCAGTCCAGAACACT-3’). S. pennellii (LA 0716) cDNA was used as template and a high fidelity Taq polymerase (Phusion) was used as enzyme. Correctness of the sequence was confirmed by Sanger sequencing of the plasmids. The target regions were cloned into the TRV2 vector (Liu et al. 2002) by using Gateway cloning strategy. TRV2 vectors with Tm-1 and Tm-2 targeting regions were transformed into Agrobacterium tumefaciens strain GV3101. As a negative control, a TRV2 vector carrying a 396-bp fragment of the b -glucuronidase ( GUS ) gene, which has no homology with endogenous Solanum genes, was used. Agrobacterium cells carrying the constructs were grown overnight in LB media with appropriate antibiotics. When OD 600 reached ~0.7, the cultures were centrifuged. The pellets were diluted in infiltration buffer (pH 5.7) containing 200 µM acetosyringone, 10 mM 2-(N-morpholino) ethane sulfonic acid (MES) and 10 mM MgCl2, and the OD 600 of each construct was adjusted to 2. TRV1 and TRV2 cultures were mixed in 1:1 ratio resulting in OD 600 equal to 1 of each. Before inoculation, Silwett L-77 (0.02%) was added to the inoculum. Seedlings were submerged in the Agrobacterium suspension and both surfaces of the cotyledons, as well as the hypocotyl and the roots of the seedlings were brush-inoculated (Cox et al. 2019). Agro-brush-inoculation was performed on 10-15 days-old seedlings (cotyledon stage) by using sterilized paint brushes. Inoculated plants were individually transplanted into plastic pots with potting soil. Two weeks after TRV agro-brush-inoculation the plants were mechanically inoculated with ToBRFV. Cloning and sequencing of Tm-1 alleles Young leaf samples were collected from all tested S. pennellii accessions and cv. MM plants. Total RNA was extracted using the RNeasy Mini Kit (QIAGEN), and RNA concentrations were measured with a NanoDrop™ One Spectrophotometer (Thermo Fisher Scientific). cDNA synthesis was performed using SuperScript™ III Reverse Transcriptase (Thermo Fisher Scientific) following the manufacturer's protocol. Tm-1 primers were designed based on the tomato Heinz genome (SL4.0 version) and the S. pennellii LA 0716 genome retrieved from the Sol Genomics database (Bolger et al. 2014). The primer set amplifies Tm-1 alleles from both cv. MM and S. pennellii accessions. The forward primer ( Tm-1_ Fw: 5’-ATGGCAACTGCACAGAGT-3’) begins from the start codon, while the reverse primer ( Tm-1_ Rv: 5’-TCACTCCATAGATATAGACTTGTAC-3’) starts from the stop codon. PCR was performed using cDNA from the different S. pennellii accessions and cv. MM as templates, Tm-1 primers, and Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). PCR products were cloned into a vector using the Zero Blunt™ PCR Cloning Kit (Thermo Fisher Scientific), and subsequently transformed into E. coli Top10 cells. Transformed cells were selected, and the correctness of their plasmids was confirmed by PCR and Sanger sequencing. Plasmids carrying the Tm-1 allele from each S. pennellii accession and cv. MM were further analysed by whole-plasmid sequencing. The amino acid sequences of Tm-1 variants were compared using the online alignment tool T-Coffee (Di Tommaso et al. 2011) and pictures were created by using the Boxshade tool (Hofmann and Baron 1996) available at https://junli.netlify.app/ apps/boxshade/. Results Responses of S. pennellii accessions to ToBRFV inoculation Wild Solanum accessions were screened for ToBRFV resistance, resulting in the identification of multiple S. pennellii accessions highly resistant to ToBRFV, as well as susceptible S. pennellii accessions (Figure 2). For each S. pennellii accession and the tomato cv. MM, ten plants were challenged with ToBRFV, while five underwent mock treatment. Three weeks post-inoculation, all ToBRFV-inoculated plants of cv. MM and five susceptible S. pennellii accessions (LA 1356, LA 1656, LA 1724, LA 2177, and LA 2580) displayed severe viral symptoms, including leaf shape abnormalities and stunted growth, indicating high ToBRFV inoculation efficiency. Additionally, ToBRFV Immunostick testing confirmed the presence of viral coat protein (CP), indicating viral accumulation. In contrast, none of the inoculated plants from five resistant S. pennellii accessions (LA 0716, LA 0750, G1.1559, G1.1608 and G1.1610) exhibited symptoms, and ToBRFV Immunostick testing did not detect the CP, implying low or non-existent viral accumulation. As expected, all mock-treated plants remained symptomless, with negative ToBRFV Immunostick test results. The ToBRFV inoculation was repeated using new seedlings of the aforementioned accessions, yielding results consistent with the first inoculation. Inheritance of ToBRFV resistance derived from LA 0716 and LA 0750 To study the inheritance of ToBRFV resistance, F1 and F2 plants derived from the crosses of cv. MM with LA 0716 and LA 0750 were tested. From each F1, five plants were inoculated with ToBRFV, while another five were mock-treated and retained for F2 generation production. Three weeks post-inoculation, all mock plants remained symptomless and tested negative with the ToBRFV Immunostick test, as expected. The ToBRFV-challenged F1 individuals from both crosses exhibited none to mild viral disease symptoms, such as mild mosaic and wrinkling of leaves when compared to mock plants (Figure 3). Notably, the symptoms observed in the F1 plants were less severe than those in their susceptible parent MM. Additionally, in contrast to their resistant parents (LA 0750 and LA 0716 individuals), these plants tested positive for presence of CP with the ToBRFV Immunostick. To estimate the CP accumulation of ToBRFV, protein samples extracted from F1 plants and their parental lines, inoculated with either ToBRFV or mock treatments, were visualized using protein gel electrophoresis. As expected, in none of the mock-treated plants CP was detectable. CP was also not detected in the ToBRFV-challenged individuals from the LA 0716 and LA 0750 accessions. Both MM and F1 plants challenged with ToBRFV exhibited CP accumulation. However, CP accumulation in MM plants was higher than in the individuals of both F1 populations (Figure 3). These results align with the ToBRFV symptoms observed in F1 plants compared to their parental lines. Both symptoms and CP accumulation of F1 plants were at an intermediate level compared to the resistant and susceptible parents, indicating that the resistance identified in these S. pennellii accessions is not controlled by a single typical dominant or recessive gene. Subsequently, 255 F2 (LA 0716) individuals were challenged with ToBRFV. Three weeks post-inoculation, the plants were phenotypically assessed using the Disease Severity Index (DSI) outlined in Figure 1, and the asymptomatic plants were tested for presence of CP with a ToBRFV immunostick test. The F2 (LA 0716) individuals can be categorized in three distinct phenotypic groups: susceptible (S) plants displaying severe symptoms (DSI: 2,3) and detectable CP; intermediate (I) phenotype plants showing either no or mild symptoms (DSI: 0,1) and detectable CP; and resistant (R) plants exhibiting no symptoms (DSI: 0) and no detectable CP (Figure 4). The phenotypic segregation ratio in the F2 (LA 0716) population was 15 resistant (R): 119 intermediate (I): 121 susceptible (S). This ratio does not align with the expected 3 (R):1 (S) or 1 (R):3 (S) segregation ratios, which would be anticipated if the resistance were controlled by a single dominant or recessive gene, respectively. Therefore, the deviation from the expected segregation ratios observed in the F2 (LA 0716) supports the results obtained from the F1 plants regarding the genetic inheritance of the resistance trait. Both sets of results indicate that the resistance trait is not controlled by a single typical dominant or recessive gene. Similar to F2 (LA 0716), 100 individuals from the F2 (LA 0750) were inoculated with ToBRFV and phenotypically assessed (Figure S1). The results were similar to those obtained with the F2 (LA 0716) population, showing a phenotypic segregation ratio in the F2 (LA 0750) population of 6 resistant (R): 47 intermediate (I): 47 susceptible (S). Association analysis between genetic markers for Tm-1 , Tm-2 and QTL11 and ToBRFV resistance trait Previous studies have reported three crucial loci associated with resistance to ToBRFV and other tobamoviruses: the Tm-1 and Tm-2 genes, a locus on chromosome 11 (QTL11) and a locus on chromosome 9 (QTL9) (Ashkenazi et al. 2020; Lindbo 2022; Zinger et al. 2021). To test whether the resistance found in S. pennellii LA 0716 is associated with any of these loci, cleaved amplified polymorphic sequence (CAPS) markers were developed distinguishing between MM and S. pennellii alleles (Table 1). Two in-gene markers were developed, one for the Tm-1 gene ( Tm-1 marker) and a second for the Tm-2 gene ( Tm-2 marker), and two more for the locus on chromosome 11 (QTL11 marker) and the locus on chromosome 9 (QTL9 marker). Based on polymorphisms between S. lycopersicum and S. pennellii amplicons of each marker, appropriate restriction enzymes were chosen to distinguish MM and S. pennellii alleles (Figure S2). The Tm-1 , Tm-2 and QTL11 markers were used for the genetic analysis of the 255 F2 (LA 0716) individuals. Additionally, the same markers were tested in 100 F2 (LA 0750) individuals, yielding similar results (Figure S3). The QTL9 marker was used to genetically analyse only a subset of 55 F2 (LA 0716) plants. All the F2 (LA 0716) individuals of the resistant group (DSI:0, no detectable CP) contained the Tm-1 allele from the S. pennellii resistant parent in a homozygous state ( Tm-1 S.p. ) (Figure 5) . Additionally, the majority of plants exhibiting the most susceptible phenotype (DSI:3, detectable CP) were homozygous for the Tm-1 allele from the susceptible parent ( Tm-1 MM ), suggesting the involvement of the Tm-1 locus from S. pennellii in conferring resistance. Notably, we found that the frequency of plants carrying the Tm-1 S.p . allele decreased as the severity of symptoms increased among the phenotypic groups. Furthermore, we observed that the majority of plants with intermediate phenotypes (DSI: 0,1,2, detectable CP) carried the Tm-1 allele in a heterozygous state. This could be explained by assuming a semidominant nature of the Tm-1 allele from S. pennellii . Overall, the Tm-1 marker is significantly related with the resistance trait, X 2 (Tm-1) ( df =8, N =255)=169.9, p =0.00. However, plants carrying Tm-1 S.p. in homozygous state are present not only in the resistant phenotypic group but also across other phenotypic groups in different frequencies. Thus, our findings suggest that fully ToBRFV-resistant plants require the presence of the Tm-1 S.p . locus in combination with an additional gene. Considering only the plants with Tm-1 S.p. in homozygous state and categorizing them in plants with detectable CP (S) or non-detectable CP (R), the segregation ration is 45S:15R plants, which fits perfectly to a 3:1 segregation. This result is a strong indication that the additional gene or locus required in combination with Tm-1 S.p. for full ToBRFV resistance is inherited recessively. The Tm-2 and QTL11 markers did not exhibit significant association with the resistance trait ( X 2 (Tm-2) ( df =8, N =255)=5.86, p =0.66; X 2 (QTL11) ( df =8, N =255)=7.19, p =0.51). Individuals from the F2 (LA 0716) generation, whether homozygous for the allele from S. pennellii , homozygous for MM, or heterozygous, were distributed across phenotypic groups without significant differences (Figure 5). The QTL9 and Tm-2 markers are both located on chromosome 9 but on opposite chromosomal arms. The results of the QTL9 marker analysis in the 55 tested F2 (LA 0716) plants showed a high co-segregation frequency between the Tm-2 and QTL9 markers, with 50 out of 55 plants displaying the same genotype for both markers. This suggests that chromosome 9 is a recombination cold spot and that, like the Tm-2 marker, the QTL9 marker is not linked to the ToBRFV resistance trait. VIGS-mediated functional analysis of Tm genes in S. pennellii accessions in relation to ToBRFV resistance To establish that Tm-1 , and not another gene linked to the Tm-1 locus, is involved in resistance to ToBRFV from S. pennellii , we employed VIGS to silence Tm-1 in plants from all five identified resistant S. pennellii accessions. Three distinct genes were silenced: Tm-1 , suspected as the candidate gene associated with resistance, while Tm-2 served as a negative control and the E. coli GUS gene, with no homolog in Solanum species, functioned as a second negative control. From each resistant S. pennellii accession five plants at the cotyledon stage were subjected to agro-inoculation with the VIGS constructs. Two weeks post-VIGS inoculation, the plants exhibiting silenced genes were challenged with ToBRFV. Additionally, non-VIGS-treated plants from the same accessions and at the same developmental stage as the VIGS-treated plants were inoculated with ToBRFV as controls. Finally, some plants from each S. pennellii accession were kept as mock, without VIGS treatment and no ToBRFV inoculation, to serve as additional controls. Three weeks post ToBRFV inoculation, plants from control treatments, Tm-2 and GUS silencing, showed no symptoms and exhibited normal growth, similar to non-VIGS-treated plants inoculated with ToBRFV, as well as mock-treated plants (without VIGS or ToBRFV inoculation) (Figure 6). Hence, the TRV VIGS system by itself seems not to influence ToBRFV resistance, and thus to be an appropriate tool for functional analysis of ToBRFV resistance genes. We observed that all Tm-1- silenced plants from the resistant S. pennellii accessions displayed severe ToBRFV symptoms. Furthermore, all the plants from the various treatments were tested with ToBRFV Immunostick for presence of CP. The CP was only detected in plants in which Tm-1 was silenced, while it was not detected in any of the other plants. Both, the presence of symptoms and the detection of CP in the Tm-1 silenced plants, confirm the involvement of the Tm-1 gene in conferring resistance to ToBRFV in the resistant S. pennellii accessions. Allelic variation between Tm-1 from Solanum accessions Tm-1 alleles were amplified by PCR using cDNA from all the tested S. pennellii accessions. Sequences were aligned together with the Tm-1 ( Sopen02g013570 ) sequence annotated in the S. pennellii (LA 0716) genome retrieved by Sol genomics database (Bolger et al. 2014). The Tm-1 alleles of all resistant S. pennellii accessions are 100% identical with the annotated Tm-1 ( Sopen02g013570 ) gene, therefore only one Tm-1 sequence from the resistant S. pennellii accessions was used to predict its protein sequence. All susceptible S. pennellii accessions carry an identical tm-1 allele which differs from the Tm-1 allele found in the resistant S. pennellii accessions. Moreover, the amino acid (aa) sequences of ToMV-resistance allele Tm-1 (GenBank: BAF75724; S.l. GCR237), the ToMV-susceptible allele tm-1 (GenBank: BAF75725; S.l. GCR26) from S. lycopersicum and the Tm-1 from the S. habrochaites accession PI126445 (NCBI: AB713135) were retrieved from the NCBI database. The accession PI126445 is the donor of the original ToMV resistant Tm-1 allele (Ishibashi et al. 2012). The aa sequences of all the above Tm-1 alleles were aligned and sequence differences were detected (Figure 7). Ishibashi et al. (2014) demonstrated that the first 201 amino acids (aa) of Tm-1 can bind the ToMV replication (REP) protein and inhibit replication in vitro (Figure 7, red-shaded region). Additionally, Ishibashi et al. (2012) identified the region spanning aa 78–112 as being under positive selection in S. habrochaites Tm-1 in response to resistance-breaking ToMV strains, highlighting its functional importance (Figure 7, boxed region). Notably, nine amino acids distinguish ToBRFV-resistant Tm-1 proteins from susceptible tm-1 variants, all within the first 201 aa, with eight located in the positively selected region for ToMV (aa 78–112) at positions 57, 78, 79, 80, 85, 87, 89, 94, and 100 (Figure 7, red-highlighted). Additionally, a unique amino acid at position 459 in the Tm-1 protein of ToBRFV-resistant S. pennellii distinguishes it from all other Tm-1 variants. Discussion ToBRFV: A global threat and its control challenges Tomato brown rugose fruit virus (ToBRFV) has rapidly become a significant concern for tomato production worldwide due to its devastating impact on crop yields (Caruso et al. 2022). The virus has been responsible for substantial economic losses across major tomato-growing regions, jeopardizing both large-scale agricultural operations and smallholder farms. Its rapid spread has exacerbated these challenges, making ToBRFV a global agricultural threat (Zhang et al. 2022). Compounding this issue, commonly used resistance genes in tomato which confer resistance to tobamoviruses, such as Tm-2/Tm-2 2 , have been proven ineffective against ToBRFV (Hak and Spiegelman 2021; Jaiswal et al. 2024; Luria et al. 2018; Zinger et al. 2021). As a result, the search for new resistance traits within the tomato germplasm has become a critical focus for researchers and breeders alike, aiming to mitigate the devastating effects of this pathogen on tomato production. These efforts have led to the identification and use of some ToBRFV resistance and tolerance traits in Solanum species. However, ToBRFV isolates that can overcome some of these resistance traits have already been reported. For instance, a single amino acid mutation in the movement protein (MP) of the ToBRFV_G78_RB isolate (NCBI: MZ438228.1) has been shown to break the resistance of a commercial tomato cultivar (Zisi et al. 2024), which is conferred by a dominant NBS-LRR gene located on chromosome 8 derived from S. habrochaites accession LYC4943 (Ykema et al. 2020). These findings illustrate the rapid resistance-breaking potential of RNA viruses like ToBRFV, as also described by Rubio et al. (2020), and emphasize the urgent need for continued efforts to discover additional resistance traits that can provide durable protection against this viral threat. Tm-2 is not involved in the S. pennellii resistance Several studies have shown that both alleles, Tm-2 and Tm-2 2 , originally derived from S. peruvianum accessions and known for conferring resistance to ToMV, are ineffective against ToBRFV (Hak and Spiegelman 2021; Yan et al 2021). However, Lindbo (2022) demonstrated that specific engineered amino acid substitutions can restore Tm-2 2 functionality against ToBRFV. Specifically, amino acid substitutions at position 822 from asparagine (S) to cysteine (C), phenylalanine (F), methionine (M), tyrosine (Y) or tryptophan (W); at position 825 from serine (G) to histidine (H), lysine (K) or threonine (T); and at position 848 from cysteine (F) to arginine (R). While the S. pennellii (LA 0716) Tm-2 2 orthologue (Sopen09g035210) protein shows significant differences from the traditional Tm-2 2 (NCBI: AAQ10736) (ID%: 74.15), these amino acid variations do not coincide with the substitutions conferring ToBRFV resistance (Figure S4). In our study, CAPS marker analysis of F2 (LA 0716) individuals confirmed that the Tm-2 locus is not linked to the resistance trait. Furthermore, silencing Tm-2 orthologues in all tested S. pennellii accessions did not alter their response to ToBRFV (Figure 6), reinforcing the conclusion that the Tm-2 alleles in S. pennellii do not play a role in ToBRFV resistance. The role of Tm-1 in S. pennellii resistance Although the original ToMV-resistance Tm-1 allele was initially reported as ineffective against ToBRFV, later studies identified its involvement in ToBRFV resistance (Hak and Spiegelman 2021; Jaiswal et al. 2024; Luria et al. 2018; Zinger et al. 2021, 2025) . The present study revealed that all resistant F2 (LA 0716) plants possessed the S. pennellii Tm-1 allele in a homozygous state, as confirmed by CAPS marker analysis, suggesting that for the resistant S. pennellii accessions LA 0716 and LA 0750, the Tm-1 locus plays a crucial role in ToBRFV resistance. VIGS assays further confirmed the involvement of the Tm-1 gene in ToBRFV resistance across all tested resistant S. pennellii accessions, as silencing Tm-1 rendered these plants susceptible to ToBRFV infection. Ishibashi (2010) demonstrated that allelic variants of Tm-1 can interact with different tobamoviruses and inhibit their proliferation; for instance, the ToMV-susceptible allele of Tm-1 ( S.l. tm-1 ) functions as an inhibitor of RNA replication for other tobamoviruses, such as tobacco mild green mosaic virus (TMGMV) and Pepper mild mottle virus (PMMoV). Based on our findings that S. pennellii Tm-1 (S.p. Tm-1) plays a major role in ToBRFV resistance and considering the broader interactions of Tm-1 alleles with various tobamoviruses, we speculate that the S.p. Tm-1 is an allelic variant of this gene capable of interacting with the ToBRFV REP protein, thereby halting its proliferation. After comparing the aa sequence of Tm-1 from the susceptible and resistant S. pennellii accessions identified in this study, along with other ToBRFV-resistant and -susceptible Tm-1 variants from the literature, we identified nine unique aa associated with resistance. Additionally, a unique aa specific to the ToBRFV-resistant S. pennellii accessions was identified at position 459. Notably, all nine ToBRFV resistance-associated aa are located within the first 201 aa, a region previously shown to be sufficient for inhibiting ToMV replication in vitro (Ishibashi et al. 2014). Eight of these nine aa reside within the Tm-1 region spanning aa 78–112, which was identified as a positively selected site against ToMV (Ishibashi et al. 2012). The exclusive presence of these aa in resistance-conferring Tm-1 variants and their location within functionally critical regions strongly suggest their key role in ToBRFV resistance. The unique aa at position 459 in the Tm-1 protein of ToBRFV-resistant S. pennellii is not located in a region previously described as important for its function against tobamoviruses. However, this does not rule out its potential contribution to improved affinity in the interaction between Tm-1 and ToBRFV REP. An additional locus from S. pennellii is required for full ToBRFV resistance Interestingly, some plants from the F2 (LA 0716) population displayed symptoms and/or CP accumulation despite having the S.p. Tm-1 allele in a homozygous state. This finding suggests that Tm-1 alone is not sufficient to confer complete resistance, indicating the involvement of an additional locus. The segregation ratio of only those F2 (LA 0716) individuals with the homozygous S.p. Tm-1 allele followed a 3 susceptible (S): 1 resistant (R) pattern, which is characteristic of traits inherited in a recessive manner. This observation implies that the additional locus, which works in conjunction with Tm-1 to confer ToBRFV resistance, is likely inherited recessively. Previous studies have also suggested the involvement of Tm-1 gene in combination with additional loci in ToBRFV resistance. Ashkenazi et al. (2020) reported that the ToBRFV resistance trait in a S. lycopersicum cultivar was due to the Tm-1 gene combined with a recessively inherited locus on chromosome 11 and/or chromosome 9. Similarly, Zinger et al. (2021) described a resistance trait in S. lycopersicum , conferred by the combination of Tm-1 locus with a recessive locus on chromosome 11. Another study pointed the recessive gene SICCA1 ( Solyc11g018770 ), located within the chromosome 11 loci mentioned in the other two studies, as the additional resistance contributor alongside Tm-1 (Kalisvaart et al. 2021). To explore this further, we used a CAPS marker located within the chromosome 11 loci described by Zinger et al. (2021) and Ashkenazi at al. (2020) in the F2 (LA 0716) individuals. Our results showed that this marker is not linked with the resistance trait found in the S. pennellii LA 0716 accession, demonstrating that the resistance in S. pennellii is governed by a different additional locus. Since the SICCA1 gene is located near the CAPS marker on chromosome 11, and our results show that this marker is not linked to the resistance in S. pennellii , we could conclude that SICCA1 is not the additional resistance contributor in resistant S. pennellii plants. Furthermore, the Tm-2 gene, located on chromosome 9, lies within a region known to be a cold spot for recombination (Fuentes et al. 2024). We tested the QTL9 CAPS marker positioned at the end of the opposite arm of chromosome 9, far from the Tm-2 region, in a subset of F2 (LA 0716) individuals. This marker showed co-segregation with the Tm-2 marker, reinforcing the idea that chromosome 9 is a recombination cold spot. However, both markers did not show co-segregation with the resistance trait. Consequently, we can conclude that these loci on chromosome 9 are not linked to the resistance found in S. pennellii LA 0716. These observations suggest that the locus in S. pennellii LA 0716, which works alongside Tm-1 to confer ToBRFV resistance, does not overlap with the loci described in the two key studies that identified ToBRFV resistance involving Tm-1 . This indicates the potential novelty of the additional gene in S. pennellii LA 0716, which, in combination with S.p. Tm-1 , confers robust ToBRFV resistance. Topcu et al. (2025) identified 14 QTL for ToBRFV tolerance by GWAS involving S. lycopersicum var. lycopersicum , S. lycopersicum var. cerasiforme and S. pimpinellifolium accessions. In addition to QTLs on chromosome 11 they observed QTLs on chromosomes 1, 2, 3, 6, 7, 10 and 12. Our results do not clarify whether the additional gene works synergistically with Tm-1 to inhibit virus proliferation or if it functions through an independent resistance or tolerance mechanism. This independent mechanism combined with Tm-1 inhibition of viral replication, may collectively confer complete resistance to ToBRFV. Interestingly, Ishibashi (2010) demonstrated that tomato is a nonhost for the tobamovirus TMGMV due to the presence of a naturally occurring Tm-1 allele ( S.l. tm-1 ). A TMGMV strain later emerged with reduced interaction with S.l. tm-1 , allowing it to replicate in tomato protoplasts as efficiently as ToMV. However, in tomato leaves the proliferation of this TMGMV strain was significantly lower, suggesting the presence of an additional inhibitory mechanism that prevents the virus from spreading intercellularly. In this case, Tm-1 and the secondary mechanism appeared to act independently against TMGMV. A similar scenario could explain the ToBRFV resistance observed in S. pennellii accessions, where the S.p. Tm-1 allele and the additional locus might function independently or in combination. However, additional studies are needed to elucidate the mechanisms behind S.p. Tm-1 and the additional locus in conferring ToBRFV resistance. Discrepancies in S. pennellii LA 0716 ToBRFV resistance in different studies In this study, we found that five Solanum pennellii accessions exhibited high resistance to ToBRFV. However, previous studies have reported conflicting results regarding the resistance of S. pennellii , specifically the LA 0716 accession, to ToBRFV. Jewehan et al. (2022b) classified S. pennellii as completely susceptible to ToBRFV while Kabas et al. (2022) characterized the LA 0716 accession as ToBRFV-tolerant, observing mild symptoms. Topcu et al. (2025) mentioned that LA 0716 did not exhibit any ToBRFV symptoms, but was considered highly tolerant as ToBRFV virus could be detected by RT-qPCR. These divergences could be attributed to genetic variation within the tested S. pennellii accessions, differences in the ToBRFV isolates used, or varying environmental conditions. Most of the S. pennellii accessions, including LA 0716, are self-compatible and predominantly self-pollinated (Flores-Hernández et al. 2018), making them genetically homogeneous, with limited variation (Mercer and Perales 2010; Rick and Tanksley 1981). Thus, genetic differences within the LA 0716 accession are unlikely to explain the observed differences in ToBRFV infectivity. Another potential factor is the use of different ToBRFV isolates. Jewehan et al. (2022b) used the ToBRFV-Tom2-Jo isolate (GenBank Accession No. MZ323110), while Kabas et al. (2022) and Topcu et al. (2025) used the ToBRFV-Ant-Tom isolate (GenBank Accession No. MT107885). In our study, we used the ToBRFV-NVWA isolate (GenBank Accession No. MN882011). The CP amino acid sequence is identical across the three ToBRFV isolates (Figure S5), indicating that CP is unlikely to contribute to the observed differences in infectivity. A comparison of REP protein sequences showed that ToBRFV-NVWA differs from Ant-Tom and Tom2-Jo by two aa at positions 1206 and 1363, while NVWA and Ant-Tom differ from Tom2-Jo by one aa at position 984 (Figure S6). The helicase domain (aa 801–1116) is the most crucial region of REP for interaction with Tm-1 (Ishibashi 2010; Ishibashi et al. 2012; Ishibashi and Ishikawa 2014). The differences at positions 1206 and 1363 are outside this domain, whereas the difference at position 984, found in Tom2-Jo, is within the helicase domain. This aa difference in Tom2-Jo may be responsible for breaking S. pennellii Tm-1 -mediated resistance. This hypothesis is supported by a recent study (Kubota et al. 2024), which identified several aa substitutions, including one at position 984, in the helicase domain of ToBRFV isolates capable of breaking the resistance conferred by the GCR237 Tm-1 allele. Hence, this observation can not only explain the differences in ToBRFV response of plants from the same S. pennellii accession (LA 0716) among the different studies, but also suggests that the aa substitution at position 984 of ToBRFV REP alone may be sufficient to break the resistance conferred by Tm-1 alleles. Moreover, ToBRFV-Ant-Tom lacks the first 26 aa of the small subunit of the REP protein. While this missing segment is not part of the helicase domain, it may influence the protein’s secondary structure and potentially affect its function. Furthermore, two aa differences were observed between the movement protein (MP) of Tom2-Jo and NVWA, and Ant-Tom (Figure S7). Our findings suggest that the S. pennellii resistance trait involves Tm-1 in combination with an additional locus. The two amino acid differences in the MP between these isolates might interfere with the contribution of this additional locus. That could be another explanation why Jewehan et al. (2022b) found the LA 0716 accession susceptible. Environmental factors may also contribute to the discrepancies in ToBRFV infectivity. Jewehan et al. (2022a) demonstrated that S. habrochaites and S. peruvianum accessions, resistant to ToBRFV at 24°C, displayed severe symptoms when inoculated at 33°C. Similarly, the resistance conferred by Tm-1 against ToMV is temperature-dependent (Fraser and Loughlin 1982). Tm-1 plants inhibited TMV proliferation at 25°C but lost this ability at 33°C. In our study, plants were inoculated at 20°C, whereas Kabas et al. (2022) conducted their inoculations and 28°C, respectively. The higher temperature used in their study may have reduced the efficacy of S.p. Tm-1 against ToBRFV, contributing to the differences in the plant’s response to the viral infection. It would be valuable to further investigate the impact of elevated temperatures on ToBRFV resistance in S. pennellii accessions, particularly those tested in our study. Conclusion Tomato brown rugose fruit virus (ToBRFV) threatens global tomato production, with emerging new isolates that overcome resistance genes. This highlights the urgent need for continued research not only to identify and exploit individual resistance genes but to discover multiple genes with diverse resistance mechanisms. By combining these genes, we can develop multilayered, durable resistance to counter this viral threat more effectively. Our study identified S. pennellii accessions as a valuable source of ToBRFV resistance, with the S. pennellii Tm-1 allele playing a key role. Moreover, we identified nine aa in Tm-1 variants that are associated with the ToBRFV resistance. Additionally, we demonstrated that complete resistance requires a secondary locus, likely inherited recessively. Notably, this locus does not overlap with those previously reported from other studies to act alongside Tm-1 , suggesting its potential as a novel factor in ToBRFV resistance. Our findings can be of great value for breeding programs focused on developing tomato cultivars with strong, durable resistance to ToBRFV. Declarations Acknowledgements The authors thank all partners of the EU project “VIRTIGATION” and the members of the Plant Breeding group at Wageningen University & Research (WUR) for their valuable discussions and insights on this study. Special thanks to Mr. Run Li and Mr. Joshua Akinola for their contribution as part of their MSc theses and to Fien Meijer-Dekens for maintaining and propagating the Solanum accessions collection of Plant Breeding group. Author contribution statement MV performed the ToBRFV inoculations. RZ conducted the phenotyping, genotyping, and crosses between S. pennellii accessions and tomato cv. Moneymaker, generating the F₁ and F₂ populations. RZ also developed a DSI for ToBRFV symptoms, created VIGS constructs and performed the assays, and cloned and sequenced Tm-1 alleles. A-MAW, MvD, and YB contributed to the experimental design and provided critical feedback on the manuscript. Funding This publication has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No 101000570. Data availability The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request. Conflict of interest The authors declare no competing financial or non-financial interests in relation to the work described. References Ashkenazi V, Rotem Y, Ecker R, Nashilevitz S, Barom N (2020) Resistance in plants of Solanum lycopersicum to the Tobamovirus Tomato Brown Rugose Fruit Virus. Patent WO2020249996 Bolger A, Scossa F, Bolger ME, Lanz C, Maumus F, Tohge T, Quesneville H, Alseekh S, Sørensen I, Lichtenstein G, Fich EA, Conte M, Keller H, Schneeberger K, Schwacke R, Ofner I, Vrebalov J, Xu Y, Osorio S, … Fernie AR (2014) The genome of the stress-tolerant wild tomato species Solanum pennellii . Nature Genet 46:1034–1038. https://doi.org/10.1038/ng.3046 Caruso AG, Bertacca S, Parrella G, Rizzo R, Davino S, Panno S (2022) Tomato brown rugose fruit virus: A pathogen that is changing the tomato production worldwide. Annals Appl Biol 181:258–274. https://doi.org/10.1111/aab.12788 Cox DE, Dyer S, Weir R, Cheseto X, Sturrock M, Coyne D, Torto B, Maule AG, Dalzell JJ (2019) ABC transporter genes ABC-C6 and ABC-G33 alter plant-microbe-parasite interactions in the rhizosphere. Sci Rep 9:19899. https://doi.org/10.1038/s41598-019-56493-w Di Tommaso P, Moretti S, Xenarios I, Orobitg M, Montanyola A, Chang JM, Taly JF, Notredame C (2011) T-Coffee: a web server for the multiple sequence alignment of protein and RNA sequences using structural information and homology extension. Nucl Acids Res 39(suppl_2):W13–W17. https:// doi.org/10.1093/nar/gkr245 FAO (2022). World Food and Agriculture—Statistical Yearbook 2022; Food and Agriculture Organization of the United Nations. https://doi.org/10.4060/cc2211en Fernandez-Pozo N, Rosli HG, Martin GB, Mueller LA (2015) The SGN VIGS tool: User-friendly software to design virus-induced gene silencing (VIGS) constructs for functional genomics. Mol Plant 8:486–488. https://doi.org/10.1016/j.molp.2014.11.024 Flores-Hernández LA, Lobato-Ortiz R, Sangerman-Jarquín DM, García-Zavala JJ, Molina-Galán JD, Velasco-Alvarado MDJ, Marín-Montes IM (2018) Genetic diversity within wild species of Solanum . Revista Chapingo. Serie Horticultura 24:85-96. https://doi.org/10.5154/r.rchsh.2017.08.030 Fraser RSS, Loughlin SAR (1982) Effects of temperature on the Tm-1 gene for resistance to tobacco mosaic virus in tomato. Physiol Plant Pathol 20:109–117. https://doi.org/10.1016/0048-4059(82)90029-7 Fuentes RR, Nieuwenhuis R, Chouaref J, Hesselink T, van Dooijeweert W, van den Broeck HC, Schijlen E, Schouten HJ, Bai Y, Fransz P, Stam M, de Jong H, Trivino SD, de Ridder D, van Dijk ADJ, Peters SA (2024) A catalogue of recombination coldspots in interspecific tomato hybrids. PLOS Genet 20:e1011336. https://doi.org/10.1371/journal.pgen.1011336 Gómez P, Rodríguez-Hernández AM, Moury B, Aranda MA (2009) Genetic resistance for the sustainable control of plant virus diseases: breeding, mechanisms and durability. Eur J Plant Pathol 125:1–22. https://doi.org/10.1007/s10658-009-9468-5 González-Concha LF, Ramírez-Gil JG, Mora-Romero GA, García-Estrada RS, Carrillo-Fasio JA, Tovar-Pedraza JM (2023) Development of a scale for assessment of disease severity and impact of tomato brown rugose fruit virus on tomato yield. Eur J Plant Pathol 165:579-92. https://doi.org/10.1007/s10658-022-02629-0 Hak H, Spiegelman Z (2021) The Tomato brown rugose fruit virus movement protein overcomes Tm-2 2 resistance in tomato while attenuating viral transport. Mol Plant-Microbe Interact 34:1024–1032. https://doi.org/10.1094/MPMI-01-21-0023-R Hall TJ (1980) Resistance at the Tm-2 locus in the tomato to tomato mosaic virus. Euphytica 29:189–197. https://doi.org/10.1007/BF00037266 Hofmann K, Baron M (1996) Boxshade 3.21. Pretty printing and shading of multiple-alignment files. Kay Hofmann ISREC Bioinformatics Group, Lausanne, Switzerland. https://junli.netlify.app/apps/ boxshade/ Ishibashi K (2010) Studies on the Tm-1 gene of tomato and host specificity of tobamoviruses. J Gen Plant Pathol 76:417–418. https://doi.org/10.1007/s10327-010-0268-8 Ishibashi K, Ishikawa M (2014). Mechanisms of tomato mosaic virus RNA replication and its inhibition by the host resistance factor Tm-1. Curr Opin Virol 9:8–13. https://doi.org/10.1016/j.coviro.2014.08. 005 Ishibashi K, Kezuka Y, Kobayashi C, Kato M, Inoue T, Nonaka T, Ishikawa M, Matsumura H, Katoh E (2014) Structural basis for the recognition–evasion arms race between Tomato mosaic virus and the resistance gene Tm-1 . Proc Natl Acad Sci 111: E3486–E3495. https://doi.org/10.1073/pnas. 1407888111 Ishibashi K, Masuda K, Naito S, Meshi T, Ishikawa M (2007) An inhibitor of viral RNA replication is encoded by a plant resistance gene. Proc Natl Acad Sci 104:13833–13838. https://doi.org/10.1073/pnas. 0703203104 Ishibashi K, Mawatari N, Miyashita S, Kishino H, Meshi T, Ishikawa M (2012) Coevolution and hierarchical interactions of tomato mosaic virus and the resistance gene Tm-1 . PLoS Pathogens 8:e1002975. https://doi.org/10.1371/journal.ppat.1002975 Ishibashi K, Naito S, Meshi T, Ishikawa M (2009) An inhibitory interaction between viral and cellular proteins underlies the resistance of tomato to nonadapted tobamoviruses. Proc Natl Acad Sci 106:8778–8783. https://doi.org/10.1073/pnas.0809105106 Jaiswal N, Chanda B, Gilliard A, Shi A, Ling KS (2024) Evaluation of tomato germplasm against tomato brown rugose fruit virus and identification of resistance in Solanum pimpinellifolium . Plants 13:581. https://doi.org/10.3390/plants13050581 Jewehan A, Salem N, Tóth Z, Salamon P, Szabó Z (2022a) Evaluation of responses to tomato brown rugose fruit virus (ToBRFV) and selection of resistant lines in Solanum habrochaites and Solanum peruvianum germplasm. J Gen Plant Pathol 88:187–196. https://doi.org/10.1007/s10327-022-01055-8 Jewehan A, Salem N, Tóth Z, Salamon P, Szabó Z (2022b) Screening of Solanum (sections Lycopersicon and Juglandifolia ) germplasm for reactions to the tomato brown rugose fruit virus (ToBRFV). J Plant Dis Protect 129:117–123. https://doi.org/10.1007/s41348-021-00535-x Jones RAC (2006) Control of plant virus diseases. Adv Virus Res 67:205–244. https://doi.org/10.1016/ S0065-3527(06)67006-1 Jones RAC (2021) Global plant virus disease pandemics and epidemics. Plants 10:233. https:// doi.org/10.3390/plants10020233 Kabas A, Fidan H, Kucukaydin H, Atan HN (2022) Screening of wild tomato species and interspecific hybrids for resistance/tolerance to Tomato brown rugose fruit virus (ToBRFV). Chil J Agr Res 82:189–196. https://doi.org/10.4067/S0718-58392022000100189 Kalisvaart J, Frijters RJJM, Ludeking DJW, Roovers AJM (2021) CCA gene for virus resistance. Patent WO2021110855. Kato M, Ishibashi K, Kobayashi C, Ishikawa M, Katoh E (2013) Expression, purification, and functional characterization of an N-terminal fragment of the tomato mosaic virus resistance protein Tm-1. Protein Expres Purif 89:1–6. https://doi.org/10.1016/j.pep.2013.02.001 Kubota K, Takeyama S, Matsushita Y, Ishibashi K (2024) Isolation of spontaneous mutants of tomato brown rugose fruit virus that efficiently infect Tm-1 homozygote tomato plants. J Gen Plant Pathol 90:187-95. https://doi.org/10.1007/s10327-024-01176-2 Lanfermeijer FC, Dijkhuis J, Sturre MJG, de Haan P, Hille J (2003) Cloning and characterization of the durable tomato mosaic virus resistance gene Tm-2 2 from Lycopersicon esculentum . Plant Mol Biol 52:1039–1051. https://doi.org/10.1023/A:1025434519282 Lindbo J (2022) Tomato plants resistant to ToBRFV, TMV, ToMV and ToMMV and corresponding resistance genes. Patent WO2022117884. Liu Y, Schiff M, Dinesh‐Kumar SP (2002) Virus‐induced gene silencing in tomato. Plant J 31:777–786. https://doi.org/10.1046/j.1365-313X.2002.01394.x Luria N, Smith E, Sela N, Lachman O, Bekelman I, Koren A, Dombrovsky A (2018) A local strain of Paprika mild mottle virus breaks L3 resistance in peppers and is accelerated in Tomato brown rugose fruit virus-infected Tm-2 2 - resistant tomatoes. Virus Genes 54:280–289. https://doi.org/10.1007/s11262-018-1539-2 Mercer KL, Perale, HR (2010) Evolutionary response of landraces to climate change in centers of crop diversity. Evol Appl 3:480–493. https://doi.org/10.1111/j.1752-4571.2010.00137.x Meshi T, Motoyoshi F, Maeda T, Yoshiwoka S, Watanabe H, Okada Y (1989) Mutations in the tobacco mosaic virus 30-kD protein gene overcome Tm-2 resistance in tomato. Plant Cell 1:515–522. https://doi.org/10.1105/tpc.1.5.515 Pelham J (1966) Resistance in tomato to tobacco mosaic virus. Euphytica 15:258–267. https://doi.org/10.1007/BF00022331 Rick CM, Tanksley SD (1981) Genetic variation in Solanum pennellii : Comparisons with two other sympatric tomato species. Plant Syst Evol 139:11–45. https://doi.org/10.1007/BF00983920 Rivarez MPS, Vučurović A, Mehle N, Ravnikar M, Kutnjak D (2021) Global advances in tomato virome research: Current status and the impact of high-throughput sequencing. Front Microbiol 12:671925. https://doi.org/10.3389/fmicb.2021.671925 Rubio L, Galipienso L, Ferriol I (2020) Detection of plant viruses and disease management: Relevance of genetic diversity and evolution. Front Plant Sci 11:1092. https://doi.org/10.3389/fpls.2020.01092 Schenk JJ, Becklund LE, Carey SJ, Fabre PP (2023) What is the “modified” CTAB protocol? Characterizing modifications to the CTAB DNA extraction protocol. Appl Plant Sci 11:e11517. https://doi.org/10.1002/aps3.11517 Strasser M, Pfitzner AJP (2007) The double-resistance-breaking Tomato mosaic virus strain ToMV1-2 contains two independent single resistance-breaking domains. Arch Virol 152:903–914. https://doi.org/10.1007/s00705-006-0915-8 Topcu Y, Yildiz K, Kayikci HC, Aydin S, Feng Q, Sapkota M (2025) Deciphering resistance to Tomato brown rugose fruit virus (ToBRFV) using Genome-Wide Association Studies. Sci Hortic 341:113968. https://doi.org/10.1016/j.scienta.2025.113968 van Damme M, Zois R, Verbeek M, Bai Y, Wolters AMA (2023) Directions from nature: how to halt the tomato brown rugose fruit virus. Agronomy 13:1300. https://doi.org/10.3390/agronomy13051300 Weber H, Ohnesorge S, Silber MV, Pfitzner AJP (2004) The Tomato mosaic virus 30 kDa movement protein interacts differentially with the resistance genes Tm-2 and Tm-2 2 . Arch Virol 149:1499-1514. https://doi.org/10.1007/s00705-004-0312-0 Yan Z, Ma H, Wang L, Tettey C, Zhao M, Geng C, Tian Y, Li X (2021) Identification of genetic determinants of tomato brown rugose fruit virus that enable infection of plants harbouring the Tm‐2 2 resistance gene. Mol Plant Pathol 22:1347–1357. https://doi.org/10.1111/mpp.13115 Ykema M, Verweij WC, De la Fuente van Bentem S (2020) Tomato plant resistant to tomato brown rugose fruit virus. Patent WO2020147921 Zhang S, Griffiths JS, Marchand G, Bernards MA, Wang A (2022) Tomato brown rugose fruit virus : An emerging and rapidly spreading plant RNA virus that threatens tomato production worldwide. Mol Plant Pathol 23:1262–1277. https://doi.org/10.1111/mpp.13229 Zinger A, Doron-Faigenboim A, Gelbart D, Levin I, Lapidot M (2025) Contribution of the Tobamovirus resistance gene Tm-1 to control of ToBRFV resistance in tomato. bioRxiv 2025:2025-01 https://doi.org/10.1101/2025.01.20.633895 Zinger A, Lapidot M, Harel A, Doron-Faigenboim A, Gelbart D, Levin I (2021) Identification and mapping of tomato genome loci controlling tolerance and resistance to tomato brown rugose fruit virus. Plants 10:179. https://doi.org/10.3390/plants10010179 Zisi Z, Ghijselings L, Vogel E, Vos C, Matthijnssens J (2024) Single amino acid change in tomato brown rugose fruit virus breaks virus-specific resistance in new resistant tomato cultivar. Front Plant Sci 15:1382862. https://doi.org/10.3389/fpls.2024.1382862 Supplementary Files Supplementaryinformation.docx Cite Share Download PDF Status: Published Journal Publication published 12 Sep, 2025 Read the published version in Theoretical and Applied Genetics → Version 1 posted Reviewers agreed at journal 25 Mar, 2025 Reviewers invited by journal 25 Mar, 2025 Editor assigned by journal 14 Mar, 2025 First submitted to journal 13 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6221483","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":433660490,"identity":"0ea67285-c586-4a4f-be38-0b083e584165","order_by":0,"name":"Romanos Zois","email":"","orcid":"","institution":"Wageningen University and Research Wageningen Plant Research","correspondingAuthor":false,"prefix":"","firstName":"Romanos","middleName":"","lastName":"Zois","suffix":""},{"id":433660491,"identity":"329aa5db-78f2-4fbe-88d7-16151e7e8ee7","order_by":1,"name":"Mireille van Damme","email":"","orcid":"","institution":"Wageningen University and Research Wageningen Plant Research","correspondingAuthor":false,"prefix":"","firstName":"Mireille","middleName":"van","lastName":"Damme","suffix":""},{"id":433660492,"identity":"1e30a2f1-6a25-4205-8e71-7413716adeec","order_by":2,"name":"Martin Verbeek","email":"","orcid":"","institution":"Wageningen University and Research Wageningen Plant Research","correspondingAuthor":false,"prefix":"","firstName":"Martin","middleName":"","lastName":"Verbeek","suffix":""},{"id":433660493,"identity":"bff6b348-5532-49f9-83af-1e5f4a36c277","order_by":3,"name":"Yuling Bai","email":"","orcid":"","institution":"Wageningen University and Research Wageningen Plant Research","correspondingAuthor":false,"prefix":"","firstName":"Yuling","middleName":"","lastName":"Bai","suffix":""},{"id":433660494,"identity":"bb60e274-218e-4276-8cf0-b028f562fe6b","order_by":4,"name":"Anne-Marie A. Wolters","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/0lEQVRIiWNgGAWjYDADNjBZACKYD4DZfMRpMTAAMROQRAgCsBYeA7xa+Gf3HnzAmGOXz8fewCbxweCPnHn/mW/SvHsY8nBpkbhzLtmAcVuyZRvPATbJGQYGxjI3crdJ8zxjKMbpsBs5ZtJ/tzEbsEkksN3mMTBInCHBu+02zwGGxDYcOuRv5Jj/YNxWb8Am/wCspX4G/5lneLUYAG1hYNx2GGgLA1hLggRDDhteLYY3cowlGLcdN2DjSWz/OcPA2HCGRJr5zzkHJHBqkbuRY/iBcVu1gXz74cMGHyrk5CX4Dz82eHPAJrEfl/cRgLEBmSdBWMMoGAWjYBSMApwAAHmBTW3ewiNtAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0001-8537-5132","institution":"Wageningen Universiteit Plantenwetenschappen","correspondingAuthor":true,"prefix":"","firstName":"Anne-Marie","middleName":"A.","lastName":"Wolters","suffix":""}],"badges":[],"createdAt":"2025-03-13 15:39:39","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6221483/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6221483/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00122-025-05036-1","type":"published","date":"2025-09-12T15:57:31+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":79763364,"identity":"50bfa766-b8d4-4241-991c-3bebb58f93b1","added_by":"auto","created_at":"2025-04-02 11:47:37","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1031403,"visible":true,"origin":"","legend":"\u003cp\u003eDisease Severity Index (DSI) used for ToBRFV symptoms observed in the F2(LA 0716) population ranging from DSI 0 (no symptoms) to DSI 3 severe symptoms.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6221483/v1/121e8e8a4fc17cbce7481722.png"},{"id":79763365,"identity":"b9703223-af81-4318-8efc-e0dc22fb4a8d","added_by":"auto","created_at":"2025-04-02 11:47:37","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1670311,"visible":true,"origin":"","legend":"\u003cp\u003eResponse of S. pennelliiaccessions three weeks post-ToBRFV inoculation. Upper panel (R): Resistant accessions remained symptomless. Lower panel (S): Susceptible accessions developed severe symptoms. The top row in each panel shows leaves from mock-treated plants and the bottom row leaves from ToBRFV inoculated plants. CP (+): Coat protein detected by ToBRFV immunostick test; CP (-): Coat protein not detected.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6221483/v1/1ae08e81748eb7841f3b77c8.png"},{"id":79763026,"identity":"43fc2071-9b60-497a-8803-0e984cf244ad","added_by":"auto","created_at":"2025-04-02 11:39:38","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1184669,"visible":true,"origin":"","legend":"\u003cp\u003eResponse of F1 (LA 0716 x MM) and F1 (LA 0750 x MM) individuals four weeks post ToBRFV inoculation and protein gel showing ToBRFV coat protein (CP) accumulation. \u003cstrong\u003eA. \u003c/strong\u003eMock-treated and \u003cstrong\u003eB.\u003c/strong\u003e ToBRFV-inoculated F1 (LA 0750 x MM) plants. \u003cstrong\u003eC.\u003c/strong\u003e Mock-treated and \u003cstrong\u003eD.\u003c/strong\u003e ToBRFV-inoculated F1 (LA 0716 x MM) plants. Below each plant, the ToBRFV immunostick result is shown, with two red lines indicating presence of coat protein (CP) and one line indicating no detectable CP. \u003cstrong\u003eE.\u003c/strong\u003e Protein gel with samples from F1 (LA 0750 x MM) plants and their parental lines. \u003cstrong\u003eF.\u003c/strong\u003e Protein gel with samples from F1 (LA 0716 x MM) plants and their parental lines. (+): ToBRFV inoculated plants, (-): mock treated plants. The size of the ToBRFV CP protein is depicted with red arrow.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6221483/v1/34756cd7d4acc8726cce56e3.png"},{"id":79763018,"identity":"397fab76-e4fe-473a-8399-c87faafba887","added_by":"auto","created_at":"2025-04-02 11:39:37","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":551686,"visible":true,"origin":"","legend":"\u003cp\u003ePhenotypes observed in the F2 (LA 0716) four weeks post ToBRFV inoculation. One representative F2 plant of each phenotype [Susceptible (S), Intermediate (I) and Resistant (R)] after ToBRFV inoculation evaluated with disease severity index (DSI). At the top left of each picture, the ratio of the number of plants in the phenotypic group/total number of tested F2 (LA 0716) plants is depicted. Below each plant, the ToBRFV immunostick test result is shown, with two red lines indicating presence of ToBRFV coat protein, while one red line indicates absence of coat protein.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6221483/v1/69a87e53dddf3408c2836919.png"},{"id":79763367,"identity":"3f017847-da39-4848-8d31-ae20a9f6f4fd","added_by":"auto","created_at":"2025-04-02 11:47:38","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":116064,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of F2 (LA 0716) individuals with CAPS markers in homozygous state for the MM or the \u003cem\u003eS.p.\u003c/em\u003e allele or heterozygous in five different phenotypic groups, DSI 0/no CP ( 0/-); DSI 0/ detected CP (0/+); DSI 1/detected CP (1/+); DSI 2/detected CP (2/+); and DSI 3/detected CP (3/+). \u003cstrong\u003eA.\u003c/strong\u003e Distribution of F2 individuals with \u003cem\u003eTm-1\u003c/em\u003ealleles in the different phenotypic groups. \u003cstrong\u003eB.\u003c/strong\u003e Distribution of \u003cem\u003eTm-2\u003c/em\u003ealleles in the different phenotypic groups. \u003cstrong\u003eC.\u003c/strong\u003e Distribution of QTL11 marker in the different phenotypic groups.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6221483/v1/bba39ab8a1c0b02c453c4065.png"},{"id":79763032,"identity":"d97d5dcd-99d4-4360-81a8-569f8444096a","added_by":"auto","created_at":"2025-04-02 11:39:38","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1127850,"visible":true,"origin":"","legend":"\u003cp\u003eVIGS-mediated functional analysis of Tm genes in individuals of five ToBRFV-resistant S. pennellii accessions regarding ToBRFV symptom development. Each column represents plants from different S. pennellii accessions. The top row shows leaves from plants with no VIGS and no ToBRFV inoculation (Mock). The second row depicts leaves from plants inoculated with ToBRFV but not subjected to VIGS. The third row presents leaves from GUS-silenced plants inoculated with ToBRFV. The fourth row displays leaves from Tm-2silenced plants inoculated with ToBRFV. The last row shows leaves from Tm-1 silenced plants, also inoculated with ToBRFV. To the right of each column, results of the ToBRFV CP test from all the plants of the row are indicated, where (+) denotes detected CP and (−) denotes no detected CP. At the bottom right of each image, the ratio of plants showing the specific phenotype to the total number of S. pennelliiaccession plants with the corresponding treatment is provided.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6221483/v1/b2d7bb9f98b0e2479c83bd75.png"},{"id":79763368,"identity":"9bb97ac6-0365-4daa-be29-72a9312849a2","added_by":"auto","created_at":"2025-04-02 11:47:38","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":169035,"visible":true,"origin":"","legend":"\u003cp\u003eAlignment of the Tm-1 protein sequence from resistant S. pennellii LA 0716 [S.p. LA 0716 (R)], the original Tm-1 donor S. habrochaitesPI126445 [S.h. PI126445 (R)], the resistant S. lycopersicum GCR237 [S.l. GCR237 (R)], the susceptible S. pennellii LA1356 [S.p. LA1356 (S)] and the susceptible S. lycopersicum GCR26 [S.l. GCR26 (S)]. The red-shaded region represents the 201-aa peptide that binds ToMV replicase and inhibits viral replication in vitro. The boxed region highlights the region under positive selection for ToMV resistance in S. habrochaites accessions. Amino acids associated with the ToBRFV resistance, shared among resistant Tm-1 proteins and differ from susceptible variants, are highlighted in red.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-6221483/v1/a68fd4b976de0915d364341c.png"},{"id":91817658,"identity":"a99a60eb-79cb-4eb5-a698-e0ba2fb74be4","added_by":"auto","created_at":"2025-09-22 07:00:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7860111,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6221483/v1/f39bfcb1-40c0-43a5-a3de-19315075f0b3.pdf"},{"id":79764154,"identity":"57545b5a-00e3-42f5-a4f9-c9b3c7884f8c","added_by":"auto","created_at":"2025-04-02 11:55:38","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1248119,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryinformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-6221483/v1/e244cd39de9006d72703a22c.docx"}],"financialInterests":"","formattedTitle":"Tm-1 back in business: an allele from Solanum pennellii accessions plays a major role in ToBRFV resistance.","fulltext":[{"header":"Key message","content":"\u003cp\u003eThe \u003cem\u003eTm-1\u003c/em\u003e allele from \u003cem\u003eS. pennellii\u003c/em\u003e accessions together with an additional, likely recessive, locus are required for complete ToBRFV resistance.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eTomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e) is among the most widely cultivated vegetable crops globally, playing a critical role in both commercial agriculture and local economies (FAO \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). However, tomato production is frequently threatened by viral diseases, which can lead to devastating losses (Rivarez et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). International trade and movement of people, along with the widespread use of single resistance genes in large-scale monocultures, accelerate the spread and evolution of viruses (Jones \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Among these threats, Tomato brown rugose fruit virus (ToBRFV) has emerged as one of the most severe, posing significant challenges to growers worldwide (van Damme et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFirst reported in 2014, ToBRFV belongs to the \u003cem\u003eTobamovirus\u003c/em\u003e genus and has rapidly spread across major tomato-growing regions, including Europe, the Middle East, and the Americas (Zhang et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The virus is highly contagious and spreads mechanically via infected tools, human contact, insect pollinators, contaminated soil, and plant material (Caruso et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). ToBRFV induces severe symptoms like leaf mosaic patterns, yellowing, and wrinkled (rugose) patches on the fruit (Gonz\u0026aacute;lez-Concha et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) which reduces the marketable yield. Although agronomic and hygiene measures can help prevent spreading, no chemical treatments can cure infected plants, making resistance breeding the most sustainable and efficient control strategy (G\u0026oacute;mez et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Jones \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2006\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHistorically, tomato resistance to tobamoviruses has relied on well-characterized genes like \u003cem\u003eTm-1\u003c/em\u003e and \u003cem\u003eTm-2\u003c/em\u003e/\u003cem\u003eTm-2\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e, which confer protection against strains of tobacco mosaic virus (TMV) and tomato mosaic virus (ToMV) (Hall \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1980\u003c/span\u003e; Ishibashi et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). \u003cem\u003eTm-2\u003c/em\u003e and its allelic variant \u003cem\u003eTm-2\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e are dominant resistance genes encoding coiled-coil, nucleotide-binding leucine-rich repeat (CC-NLR) proteins. These proteins recognize the TMV and ToMV movement protein, triggering a hypersensitive response (HR) to halt infection. Found in \u003cem\u003eS. peruvianum\u003c/em\u003e accessions and located on chromosome 9, \u003cem\u003eTm-2\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e is preferred in breeding programs due to its durability over \u003cem\u003eTm-2\u003c/em\u003e (Lanfermeijer et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Meshi et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e1989\u003c/span\u003e; Strasser and Pfitzner \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Weber et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2004\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cem\u003eTm-1\u003c/em\u003e is a semidominant gene introgressed from \u003cem\u003eS. habrochaites\u003c/em\u003e PI126445 (Pelham \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e1966\u003c/span\u003e) that encodes a 754-amino acid (aa) protein. Tm-1 inhibits tobamovirus replication by binding to the helicase domain of the viral replication protein. This binding restricts the ability of the viral replicase to interact with host factors that facilitate viral replication (Ishibashi \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Ishibashi et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Ishibashi and Ishikawa \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The Tm-1 protein contains two conserved domains: an uncharacterized N-terminal domain and a C-terminal TIM barrel-like domain (Ishibashi et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Only the N-terminal domain is necessary for Tm-1\u0026rsquo;s inhibitory activity, as a C-terminal-truncated Tm-1 protein was still able to inhibit viral replication (Ishibashi et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Kato et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Furthermore, in \u003cem\u003eS. habrochaites\u003c/em\u003e accessions a small region of the Tm-1 N-terminal domain has been found to be positively selected in response to TMV strains able to overcome the initial \u003cem\u003eTm-1\u003c/em\u003e based resistance, underscoring its importance in the coevolution of tobamoviruses and \u003cem\u003eSolanum\u003c/em\u003e species (Ishibashi et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Interestingly, different allelic variants of \u003cem\u003eTm-1\u003c/em\u003e show differential resistance responses against various tobamoviruses (Ishibashi et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). For instance, the \u003cem\u003eS. lycopersicum tm-1\u003c/em\u003e allele is not functional against ToMV and TMV but can inhibit the replication of other tobamoviruses, such as Tobacco Mild Green Mosaic Virus (TMGMV) and Pepper Mild Mottle Virus (PMMoV). Additionally, the functionality of Tm-1 against TMV has been shown to be temperature-dependent, exhibiting effective resistance at or below 25\u0026deg;C while losing its effectiveness at 33\u0026deg;C and above (Fraser and Loughlin \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e1982\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWhen ToBRFV emerged, all commercial tomato varieties were susceptible, even those that were resistant to other tobamoviruses such as ToMV, with the primary resistance gene being \u003cem\u003eTm-2/Tm-2\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e (Hak and Spiegelman \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Jaiswal et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Luria et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Zinger et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). This has propelled the search for novel resistance traits that can withstand ToBRFV infection. Although initially \u003cem\u003eTm-1\u003c/em\u003e and \u003cem\u003eTm-2\u003c/em\u003e have been reported as ineffective against ToBRFV, recent studies indicate that they can play a role in novel resistance traits against the virus. Specifically, the \u003cem\u003eTm-1\u003c/em\u003e locus from certain tomato cultivars, when combined with loci on chromosome 11 and/or chromosome 9, provides resistance (Ashkenazi et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Zinger et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Regarding \u003cem\u003eTm-2\u003c/em\u003e, specific artificial amino acid changes can lead to a gain of function providing resistance against ToBRFV (Lindbo \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). However, no naturally occurring variants of \u003cem\u003eTm-2\u003c/em\u003e have been reported to confer resistance to ToBRFV.\u003c/p\u003e \u003cp\u003eRecent research has highlighted wild \u003cem\u003eSolanum\u003c/em\u003e species as valuable sources of resistance to ToBRFV. Several accessions from \u003cem\u003eS. pimpinellifolium\u003c/em\u003e, \u003cem\u003eS. chilense\u003c/em\u003e, \u003cem\u003eS. corneliomulleri\u003c/em\u003e, \u003cem\u003eS. habrochaites\u003c/em\u003e, \u003cem\u003eS. peruvianum\u003c/em\u003e, and \u003cem\u003eS. ochranthum\u003c/em\u003e have shown resistance to ToBRFV (Jaiswal et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Jewehan et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2022a\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022b\u003c/span\u003e; Kabas et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Topcu et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). These findings emphasize the potential of diverse germplasm to contribute to the development of cultivars with durable, multilayered resistance. Notably, a resistance trait conferred by a dominant NBS-LRR gene on chromosome 8 has been introgressed from \u003cem\u003eS. habrochaites\u003c/em\u003e (Ykema et al. 2020). However, ToBRFV isolates capable of overcoming this resistance have already emerged (Zisi et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn our study, we identified robust resistance in several \u003cem\u003eS. pennellii\u003c/em\u003e accessions and confirmed the essential role of the \u003cem\u003eTm-1\u003c/em\u003e allele in this resistance trait. We also pinpointed the nine most relevant Tm-1 amino acids involved in ToBRFV resistance. Furthermore, we demonstrated that full resistance requires an additional locus from the resistant \u003cem\u003eS. pennellii\u003c/em\u003e accessions, which is likely inherited recessively and distinct from those reported in other studies (Ashkenazi et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Zinger et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). These findings provide valuable insights for breeders aiming to mitigate the impact of ToBRFV and offer tomato growers a sustainable solution to this viral threat.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003ePlant material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTen accessions of \u003cem\u003eS. pennellii\u003c/em\u003e, LA 0716, LA 0750, G1.1559, G1.1608, G1.1610, LA 1356, LA 1656, LA 1724, LA 2177 and LA 2580 and the \u003cem\u003eS. lycopersicum\u0026nbsp;\u003c/em\u003ecv. Moneymaker (MM) were used in this study (in-house collection of Plant Breeding, Wageningen University and Research (WUR)). F1 plants were obtained from ToBRFV disease-resistant individuals from accessions LA 0716 and LA 0750 \u0026nbsp;that were crossed \u0026nbsp;with susceptible MM. Individual F1 plants were selfed to obtain F2 populations, F2 (LA 0716) and F2 (LA 0750).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePlant growth conditions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor germination, the seeds were soaked in half-strength household bleach (ca. 2.7% sodium hypochlorite) for 30-60 mins, then rinsed in running water for several minutes. Subsequently, the seeds were put on Whatman\u0026reg; cellulose filter paper in petri dishes containing 1/2x Murashige and Skoog Basal Medium powder (MS) medium without sucrose. The petri dishes were placed in dark at 25\u0026deg;C for two days. Then, the petri dishes were moved into a growing chamber with artificial light and 25\u0026deg;C until the seedlings reached cotyledon stage. The seedlings were transferred into individual pots and moved into the quarantine greenhouse compartment free of pathogens and insects. The growing conditions were stable and controlled throughout the experiments (21\u0026deg;C/19\u0026deg;C (day/night) with 60% relative humidity and day length of 16 hours with the light power of 250 watt.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eToBRFV inoculation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA Dutch isolate of tomato brown rugose fruit virus (ToBRFV-NVWA, genus \u003cem\u003eTobamovirus\u003c/em\u003e, species \u003cem\u003eTobamovirus\u003c/em\u003e \u003cem\u003efructirugosum\u003c/em\u003e; NVWA 33610411, NCBI accession code MN882011) was propagated in tomato cv. Moneymaker. Inoculum was prepared by grinding infected tomato leaves displaying clear ToBRFV symptoms in 0.03 M Na-K-phosphate buffer (pH 7.7). The optimal inoculum dilution (1:40\u0026ndash;1:50) in inoculation buffer was determined through empirical testing using serial dilutions in \u003cem\u003eNicotiana\u003c/em\u003e \u003cem\u003eglutinosa\u003c/em\u003e. Plant inoculation was conducted by dusting cotyledons and the first true leaves with Carborundum (500 mesh) and gently rubbing the leaves with gloved fingers dipped in the inoculum. The climate was set at a 20% relative humidity, a 16/8 hours day night cycle at 20 \u0026deg;C/18 \u0026deg;C (day/night) regime throughout the disease assay.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhenotyping: disease severity index (DSI) and ToBRFV test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSymptoms were assessed at 3 to 4 weeks post ToBRFV inoculation. A disease severity index (DSI) was developed and used for scoring F2 generations derived from crosses of \u003cem\u003eS. pennellii\u003c/em\u003e accessions with MM plants (Figure 1). The DSI ranged from 0 to 3, where 0 is scored as asymptomatic, 1 for mild symptoms of leaf mosaic, 2 for medium symptoms with strong leaf mosaicism, mild leaf abnormalities and wrinkling, and 3 for severe symptoms of leaf mosaicism, abnormalities and wrinkling. A commercial ToBRFV ImmunoStrip\u0026reg; assay from Agdia was used to determine the systemic spread and presence of ToBRFV, based on ToBRFV coat protein detection, in uninoculated plant parts. Detection of ToBRFV with the immunostrip assay was scored with a (+), while if ToBRFV was not detected a (-) score was given.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantification of ToBRFV Coat protein levels\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStain-free protein gel assays were used to quantify the presence of ToBRFV coat protein in leaf samples. Proteins were extracted from single leaflets in Bioreba bags with 2 ml protein extraction buffer (SEB1 from Agdia). 30 \u0026mu;l of extracted protein was mixed with 10 \u0026mu;l of 4x Laemmli buffer with\u0026nbsp;beta-mercaptoethanol\u0026nbsp;(b-ME). The mixture was heated for five minutes at 95\u0026deg;C. 10\u0026nbsp;\u0026mu;l of the samples were loaded in Mini-PROTEAN TGX Stain-Free precast gels from BIO-RAD. Gel pictures were taken with GelDoc Go Gel Imaging System Bio-Rad.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDevelopment of Cleaved Amplified Polymorphic Sequence (CAPS) markers\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCAPS markers were used for the genetic analysis of important tobamovirus resistance loci. The primers for the CAPS markers were designed based on the tomato Heinz genome (SL4.0 version) and the \u003cem\u003eS. pennellii\u003c/em\u003e LA 0716 genome (Bolger et al. 2014) retrieved from Sol genomics database (https://solgenomics.net; for\u003cem\u003e\u0026nbsp;Tm-1\u003c/em\u003e: \u003cem\u003eS. lycopersicum\u0026nbsp;\u003c/em\u003e\u003cem\u003eSolyc02g062560\u003c/em\u003e\u003cem\u003e, S. pennellii Sopen02g013570\u003c/em\u003e,\u003cem\u003e\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;\u003c/em\u003efor \u003cem\u003eTm-2\u003c/em\u003e: \u003cem\u003eS. lycopersicum Solyc09g018220\u003c/em\u003e,\u003cem\u003e\u0026nbsp;\u003c/em\u003e \u003cem\u003eS. pennellii Sopen09g035210\u003c/em\u003e). The primers for the QTL11 marker were designed to amplify a region on chromosome 11, while the primers for the QTL9 marker target a region on chromosome 9, as described by Zinger et al. (2021) and Ashkenazi et al. (2020), respectively. Genomic DNA was extracted from the youngest leaf of each F2 individual using a modified cetyltrimethylammonium bromide (CTAB) protocol as described by Schenk et al. (2023). These genomic DNA samples were used as template for PCRs with the CAPS marker primers. The PCR products were digested with appropriate restriction enzymes. The products of digestion were separated on a 1.5% agarose gel and visualized with GelDoc Go Gel Imaging System by Bio-Rad. Used primers and restriction enzymes are indicated in Table 1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e1\u003c/strong\u003e PCR primers and conditions for CAPS markers and the restriction enzymes used.\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"642\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 50px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eName\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 195px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer sequence (5\u0026apos;\u0026rarr;3\u0026apos;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eChromosomal location\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePCR product size\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRestriction enzyme\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eDigestion products\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u003cem\u003eTm-1\u003c/em\u003e marker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 195px;\"\u003e\n \u003cp\u003eFw: \u0026nbsp;TCTCACCATTCTCACACTGAGTTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eSpenn-ch02: 36968554-36967408\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. pennellii:\u003c/em\u003e 1147 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cem\u003eBamHI\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. pennellii:\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e~500, 650 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 195px;\"\u003e\n \u003cp\u003eRv: ACTGAAGGAAACAATACCAAGTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eSL4.0ch02:\u003c/p\u003e\n \u003cp\u003e32289329-32290472\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. lycopersicum:\u003c/em\u003e 1144 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. lycopersicum:\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e~430, 720 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u003cem\u003eTm-2\u0026nbsp;\u003c/em\u003emarker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 195px;\"\u003e\n \u003cp\u003eFw: \u0026nbsp;CCTTTTTCATTAATGTGCAGCTGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eSpenn-ch09: 18228467-18227445\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. pennellii:\u003c/em\u003e 1023 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cem\u003eEcoRV\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. pennellii:\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e~1023 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 195px;\"\u003e\n \u003cp\u003eRv: GAGACGTGATTATCATTCTACTGCCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eSL4.0ch09:\u003c/p\u003e\n \u003cp\u003e13658610-3659650\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. lycopersicum:\u003c/em\u003e 1041 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. lycopersicum:\u0026nbsp;\u003c/em\u003e~297, 744 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 50px;\"\u003e\n \u003cp\u003eQTL11 marker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 195px;\"\u003e\n \u003cp\u003eFw:\u003c/p\u003e\n \u003cp\u003eGGTACCCTCTCAATCTCAAGGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eSpenn-ch11: 9645767-9646451\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. pennellii:\u0026nbsp;\u003c/em\u003e685 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cem\u003eTaqI\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. pennellii:\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e~ 230, 450 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 195px;\"\u003e\n \u003cp\u003eRv:\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eGAATTTACACGCCACCTTCCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eSL4.0ch11:\u003c/p\u003e\n \u003cp\u003e8971865-8972550\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. lycopersicum:\u0026nbsp;\u003c/em\u003e686 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. lycopersicum:\u0026nbsp;\u003c/em\u003e~190, 490 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 50px;\"\u003e\n \u003cp\u003eQTL9\u0026nbsp;\u003c/p\u003e\n \u003cp\u003emarker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 195px;\"\u003e\n \u003cp\u003eFw:\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eTTCTTCCTTTGCCTGTTCTATTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eSpenn-ch9: 74872135-74872729\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. pennellii:\u0026nbsp;\u003c/em\u003e649 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cem\u003eTaqI\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. pennellii:\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e~170, \u0026nbsp;480 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 195px;\"\u003e\n \u003cp\u003eRv:\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eGACTCATTACATTGTTCCTCCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eSL4.0ch9:\u003c/p\u003e\n \u003cp\u003e59672886-59673482\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. lycopersicum:\u0026nbsp;\u003c/em\u003e597 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e\u003cem\u003eS. lycopersicum:\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e~170, \u0026nbsp;420 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChi-squared (\u0026chi;\u0026sup2;) tests of independence were conducted in Microsoft Excel to assess the association between CAPS genetic markers and phenotypic results based on the disease severity index (DSI). The analysis evaluated whether the genotypic distribution of individuals in the F₂ (LA 0716) population differed significantly across phenotypic groups.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVirus-induced gene silencing (VIGS)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe target sequences for silencing \u003cem\u003eS. pennellii Tm-1\u0026nbsp;\u003c/em\u003eand \u003cem\u003eTm-2\u0026nbsp;\u003c/em\u003ealleles were selected using the Sol genomics VIGS tool (Fernandez-Pozo et al. 2015). The selected target regions for \u003cem\u003eS. pennellii\u003c/em\u003e and \u003cem\u003eS. lycopersicum\u003c/em\u003e \u003cem\u003eTm-1\u0026nbsp;\u003c/em\u003ealleles (Solyc02g062560 and Sopen02g013570) and \u003cem\u003eTm-2\u003c/em\u003e alleles (Solyc09g018220 and Sopen09g035210) shared high levels of sequence homology\u003cem\u003e,\u0026nbsp;\u003c/em\u003eand therefore the same construct can be used to silence the respective \u003cem\u003eTm\u003c/em\u003e genes in both \u003cem\u003eSolanum\u003c/em\u003e species. Amplified PCR fragments of the target region (300 bp) of \u003cem\u003eTm-1\u0026nbsp;\u003c/em\u003eand \u003cem\u003eTm-2\u003c/em\u003e genes were directionally cloned in pENTR\u0026trade; by TOPO\u0026reg; Cloning strategy. \u0026nbsp;The \u003cem\u003eTm-1\u003c/em\u003e fragment was amplified with primers \u003cem\u003eTm-1_\u003c/em\u003eVIGS_Fw (5\u0026rsquo;-GTAGGAGTGACAGTTGTTGATGTC-3\u0026rsquo;) and \u0026nbsp;\u003cem\u003eTm-1_\u003c/em\u003eVIGS_Rv (5\u0026rsquo;-AACTTTTGGGATTCCAATTGGAAG-3\u0026rsquo;), while the \u003cem\u003eTm-2\u003c/em\u003e fragment was amplified with primers\u003cem\u003e\u0026nbsp;Tm-2_\u003c/em\u003eVIGS_Fw (5\u0026rsquo;-TAGAAGGGTTGTTGACATTGACCGA-3\u0026rsquo;) and \u003cem\u003eTm-2_\u003c/em\u003eVIGS_Rv (5\u0026rsquo;-GAAACGTAGACCAGTCCAGAACACT-3\u0026rsquo;). \u003cem\u003eS. pennellii\u0026nbsp;\u003c/em\u003e(LA 0716) cDNA was used as template and a high fidelity Taq polymerase (Phusion) was used as enzyme. Correctness of the sequence was confirmed by Sanger sequencing of the plasmids. The target regions were cloned into the TRV2 vector (Liu et al. 2002) by using Gateway cloning strategy. TRV2 vectors with \u003cem\u003eTm-1\u0026nbsp;\u003c/em\u003eand \u003cem\u003eTm-2\u0026nbsp;\u003c/em\u003etargeting regions were transformed into \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e strain GV3101. As a negative control, a TRV2 vector carrying a 396-bp fragment of the \u003cem\u003eb\u003c/em\u003e\u003cem\u003e-glucuronidase\u003c/em\u003e (\u003cem\u003eGUS\u003c/em\u003e) gene, which has no homology with endogenous \u003cem\u003eSolanum\u003c/em\u003e genes, was used. Agrobacterium cells carrying the constructs were grown overnight in LB media with appropriate antibiotics. When OD\u003csub\u003e600\u0026nbsp;\u003c/sub\u003ereached ~0.7, the cultures were centrifuged. The pellets were diluted in infiltration buffer (pH 5.7) containing 200 \u0026micro;M acetosyringone, 10 mM 2-(N-morpholino) ethane sulfonic acid (MES) and 10 mM MgCl2, and the OD\u003csub\u003e600\u003c/sub\u003e of each construct was adjusted to 2. TRV1 and TRV2 cultures were mixed in 1:1 ratio resulting in OD\u003csub\u003e600\u003c/sub\u003e equal to 1 of each. Before inoculation, Silwett L-77 (0.02%) was added to the inoculum. Seedlings were submerged in the \u003cem\u003eAgrobacterium\u003c/em\u003e suspension and both surfaces of the cotyledons, as well as the hypocotyl and the roots of the seedlings were brush-inoculated (Cox et al. 2019). Agro-brush-inoculation was performed on 10-15 days-old seedlings (cotyledon stage) by using sterilized paint brushes. Inoculated plants were individually transplanted into plastic pots with potting soil. Two weeks after TRV agro-brush-inoculation the plants were mechanically inoculated with ToBRFV.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCloning and sequencing of \u003cem\u003eTm-1\u003c/em\u003e alleles\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYoung leaf samples were collected from all tested \u003cem\u003eS. pennellii\u003c/em\u003e accessions and cv. MM plants. Total RNA was extracted using the RNeasy Mini Kit (QIAGEN), and RNA concentrations were measured with a NanoDrop\u0026trade; One Spectrophotometer (Thermo Fisher Scientific). cDNA synthesis was performed using SuperScript\u0026trade; III Reverse Transcriptase (Thermo Fisher Scientific) following the manufacturer\u0026apos;s protocol.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTm-1\u003c/em\u003e primers were designed based on the tomato Heinz genome (SL4.0 version) and the \u003cem\u003eS. pennellii\u003c/em\u003e LA 0716 genome retrieved from the Sol Genomics database (Bolger et al. 2014). The primer set amplifies \u003cem\u003eTm-1\u0026nbsp;\u003c/em\u003ealleles from both cv. MM and \u003cem\u003eS. pennellii\u003c/em\u003e accessions. The forward primer (\u003cem\u003eTm-1_\u003c/em\u003eFw: 5\u0026rsquo;-ATGGCAACTGCACAGAGT-3\u0026rsquo;) begins from the start codon, while the reverse primer (\u003cem\u003eTm-1_\u003c/em\u003eRv: 5\u0026rsquo;-TCACTCCATAGATATAGACTTGTAC-3\u0026rsquo;) starts from the stop codon. PCR was performed using cDNA from the different \u003cem\u003eS. pennellii\u003c/em\u003e accessions and cv. MM as templates, \u003cem\u003eTm-1\u003c/em\u003e primers, and Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). PCR products were cloned into a vector using the Zero Blunt\u0026trade; PCR Cloning Kit (Thermo Fisher Scientific), and subsequently transformed into \u003cem\u003eE. coli\u003c/em\u003e Top10 cells. Transformed cells were selected, and the correctness of their plasmids was confirmed by PCR and Sanger sequencing. Plasmids carrying the \u003cem\u003eTm-1\u003c/em\u003e allele from each \u003cem\u003eS. pennellii\u003c/em\u003e accession and cv. MM were further analysed by whole-plasmid sequencing. The amino acid sequences of Tm-1 variants were compared using the online alignment tool T-Coffee (Di Tommaso et al. 2011) and pictures were created by using the Boxshade tool (Hofmann and Baron 1996) available at https://junli.netlify.app/ apps/boxshade/.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eResponses of \u003cem\u003eS. pennellii\u0026nbsp;\u003c/em\u003e accessions to ToBRFV inoculation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWild \u003cem\u003eSolanum\u003c/em\u003e accessions were screened for ToBRFV resistance, resulting in the identification of multiple \u0026nbsp;\u003cem\u003eS. pennellii\u003c/em\u003e accessions highly resistant to ToBRFV, as well as susceptible \u003cem\u003eS. pennellii\u003c/em\u003e accessions (Figure 2). For each \u003cem\u003eS. pennellii\u003c/em\u003e accession and the tomato cv. MM, ten plants were challenged with ToBRFV, while five underwent mock treatment. Three weeks post-inoculation, all ToBRFV-inoculated plants of cv. MM and five susceptible \u003cem\u003eS. pennellii\u003c/em\u003e accessions (LA 1356, LA 1656, LA 1724, LA 2177, and LA 2580) displayed severe viral symptoms, including leaf shape abnormalities and stunted growth, indicating high ToBRFV inoculation efficiency. Additionally, ToBRFV Immunostick testing confirmed the presence of viral coat protein (CP), indicating viral accumulation. In contrast, none of the inoculated plants from five resistant \u003cem\u003eS. pennellii\u003c/em\u003e accessions (LA 0716, LA 0750, G1.1559, G1.1608 and G1.1610) exhibited symptoms, and ToBRFV Immunostick testing did not detect the CP, implying low or non-existent viral accumulation. As expected, all mock-treated plants remained symptomless, with negative ToBRFV Immunostick test results. The ToBRFV inoculation was repeated using new seedlings of the aforementioned accessions, yielding results consistent with the first inoculation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInheritance of ToBRFV resistance derived from LA 0716 and LA 0750\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo study the inheritance of ToBRFV resistance, F1 and F2 plants derived from the crosses of cv. MM with LA 0716 and LA 0750 were tested. From each F1, five plants were inoculated with ToBRFV, while another five were mock-treated and retained for F2 generation production. Three weeks post-inoculation, all mock plants remained symptomless and tested negative with the ToBRFV Immunostick test, as expected. The ToBRFV-challenged F1 individuals from both crosses exhibited none to mild viral disease symptoms, such as mild mosaic and wrinkling of leaves when compared to mock plants (Figure 3). Notably, the symptoms observed in the F1 plants were less severe than those in their susceptible parent MM. Additionally, in contrast to their resistant parents (LA 0750 and LA 0716 individuals), these plants tested positive for presence of CP with the ToBRFV Immunostick.\u003c/p\u003e\n\u003cp\u003eTo estimate the CP accumulation of ToBRFV, protein samples extracted from F1 plants and their parental lines, inoculated with either ToBRFV or mock treatments, were visualized using protein gel electrophoresis. As expected, in none of the mock-treated plants CP was detectable. CP was also not detected in the ToBRFV-challenged individuals from the LA 0716 and LA 0750 accessions. Both MM and F1 plants challenged with ToBRFV exhibited CP accumulation. However, CP accumulation in MM plants was higher than in the individuals of both F1 populations (Figure 3). These results align with the ToBRFV symptoms observed in F1 plants compared to their parental lines. Both symptoms and CP accumulation of F1 plants were at an intermediate level compared to the resistant and susceptible parents, indicating that the resistance identified in these \u003cem\u003eS. pennellii\u003c/em\u003e accessions is not controlled by a single typical dominant or recessive gene.\u003c/p\u003e\n\u003cp\u003eSubsequently, 255 F2 (LA 0716) individuals were challenged with ToBRFV. Three weeks post-inoculation, the plants were phenotypically assessed using the Disease Severity Index (DSI) outlined in Figure 1, and the asymptomatic plants were tested for presence of CP with a ToBRFV immunostick test. The F2 (LA 0716) individuals can be categorized in three distinct phenotypic groups: susceptible (S) plants displaying severe symptoms (DSI: 2,3) and detectable CP; intermediate (I) phenotype plants showing either no or mild symptoms (DSI: 0,1) and detectable CP; and resistant (R) plants exhibiting no symptoms (DSI: 0) and no detectable CP (Figure 4). The phenotypic segregation ratio in the F2 (LA 0716) population was 15 resistant (R): 119 intermediate (I): 121 susceptible (S). This ratio does not align with the expected 3 (R):1 (S) or 1 (R):3 (S) segregation ratios, which would be anticipated if the resistance were controlled by a single dominant or recessive gene, respectively. Therefore, the deviation from the expected segregation ratios observed in the F2 (LA 0716) supports the results obtained from the F1 plants regarding the genetic inheritance of the resistance trait. Both sets of results indicate that the resistance trait is not controlled by a single typical dominant or recessive gene.\u003c/p\u003e\n\u003cp\u003eSimilar to F2 (LA 0716), 100 individuals from the F2 (LA 0750) were inoculated with ToBRFV and phenotypically assessed (Figure S1). The results were similar to those obtained with the F2 (LA 0716) population, showing a phenotypic segregation ratio in the F2 (LA 0750) population of 6 resistant (R): 47 intermediate (I): 47 susceptible (S).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAssociation analysis between genetic markers for \u003cem\u003eTm-1\u003c/em\u003e, \u003cem\u003eTm-2\u0026nbsp;\u003c/em\u003eand QTL11\u003c/strong\u003e \u003cstrong\u003eand ToBRFV resistance trait\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrevious studies have reported three crucial loci associated with resistance to ToBRFV and other tobamoviruses: the \u003cem\u003eTm-1\u003c/em\u003e and \u003cem\u003eTm-2\u003c/em\u003e genes, a locus on chromosome 11 (QTL11) and a locus on chromosome 9 (QTL9)\u0026nbsp;(Ashkenazi et al. 2020; Lindbo 2022; Zinger et al. 2021). To test whether the resistance found in \u003cem\u003eS. pennellii\u0026nbsp;\u003c/em\u003eLA 0716 is associated with any of these loci, cleaved amplified polymorphic sequence (CAPS) markers\u0026nbsp;were developed distinguishing between MM and \u003cem\u003eS. pennellii\u003c/em\u003e alleles (Table 1). Two in-gene markers were developed, one for the \u003cem\u003eTm-1\u0026nbsp;\u003c/em\u003egene (\u003cem\u003eTm-1\u003c/em\u003e marker) and a second for the \u003cem\u003eTm-2\u003c/em\u003e gene\u003cem\u003e\u0026nbsp;\u003c/em\u003e(\u003cem\u003eTm-2\u0026nbsp;\u003c/em\u003emarker),\u003cem\u003e\u0026nbsp;\u003c/em\u003eand two more for the locus on chromosome 11 (QTL11 marker) and the locus on chromosome 9 (QTL9 marker). Based on polymorphisms between \u003cem\u003eS. lycopersicum\u003c/em\u003e and \u003cem\u003eS. pennellii\u003c/em\u003e amplicons of each marker, appropriate restriction enzymes were chosen to distinguish MM and \u003cem\u003eS. pennellii\u003c/em\u003e alleles (Figure S2). The \u003cem\u003eTm-1\u003c/em\u003e, \u003cem\u003eTm-2\u0026nbsp;\u003c/em\u003eand QTL11 markers were used for the genetic analysis of the 255 F2 (LA 0716) individuals. Additionally, the same markers were tested in 100 F2 (LA 0750) individuals, yielding similar results (Figure S3). The QTL9 marker was used to genetically analyse only a subset of 55 F2 (LA 0716) plants.\u003c/p\u003e\n\u003cp\u003eAll the F2 (LA 0716) individuals of the resistant group (DSI:0, no detectable CP) contained the \u003cem\u003eTm-1\u003c/em\u003e allele from the \u003cem\u003eS. pennellii\u003c/em\u003e resistant parent in a homozygous state (\u003cem\u003eTm-1 S.p.\u003c/em\u003e) (Figure 5)\u003cem\u003e.\u0026nbsp;\u003c/em\u003eAdditionally, the majority of plants exhibiting the most susceptible phenotype (DSI:3, detectable CP) were homozygous for the \u003cem\u003eTm-1\u003c/em\u003e allele from the susceptible parent (\u003cem\u003eTm-1 MM\u003c/em\u003e), suggesting the involvement of the \u003cem\u003eTm-1\u003c/em\u003e locus from \u003cem\u003eS. pennellii\u003c/em\u003e in conferring resistance. Notably, we found that the frequency of plants carrying the \u003cem\u003eTm-1 S.p\u003c/em\u003e. allele decreased as the severity of symptoms increased among the phenotypic groups. Furthermore, we observed that the majority of plants with intermediate phenotypes (DSI: 0,1,2, detectable CP) carried the \u003cem\u003eTm-1\u003c/em\u003e allele in a heterozygous state. This could be explained by assuming a semidominant nature of the \u003cem\u003eTm-1\u0026nbsp;\u003c/em\u003eallele from \u003cem\u003eS. pennellii\u003c/em\u003e. Overall, the \u003cem\u003eTm-1\u0026nbsp;\u003c/em\u003emarker is significantly related with the resistance trait, \u003cem\u003eX\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e(Tm-1)\u0026nbsp;\u003c/sub\u003e\u003c/em\u003e(\u003cem\u003edf\u003c/em\u003e=8, \u003cem\u003eN\u003c/em\u003e=255)=169.9, \u003cem\u003ep\u003c/em\u003e=0.00.\u003c/p\u003e\n\u003cp\u003eHowever, plants carrying \u003cem\u003eTm-1 S.p.\u003c/em\u003e in homozygous state are present not only in the resistant phenotypic group but also across other phenotypic groups in different frequencies. Thus, our findings suggest that fully ToBRFV-resistant plants require the presence of the \u003cem\u003eTm-1 S.p\u003c/em\u003e. locus in combination with an additional gene. Considering only the plants with \u003cem\u003eTm-1 S.p.\u003c/em\u003e in homozygous state and categorizing them in plants with detectable CP (S) or non-detectable CP (R), the segregation ration is 45S:15R plants, which fits perfectly to a 3:1 segregation. This result is a strong indication that the additional gene or locus required in combination with \u003cem\u003eTm-1 S.p.\u0026nbsp;\u003c/em\u003efor full ToBRFV resistance is inherited recessively.\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003eTm-2\u003c/em\u003e and \u003cem\u003eQTL11\u003c/em\u003e markers did not exhibit significant association with the resistance trait (\u003cem\u003eX\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e(Tm-2)\u003c/sub\u003e\u003c/em\u003e(\u003cem\u003edf\u003c/em\u003e=8, \u003cem\u003eN\u003c/em\u003e=255)=5.86, \u003cem\u003ep\u003c/em\u003e=0.66; \u003cem\u003eX\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e(QTL11)\u003c/sub\u003e\u003c/em\u003e(\u003cem\u003edf\u003c/em\u003e=8, \u003cem\u003eN\u003c/em\u003e=255)=7.19, \u003cem\u003ep\u003c/em\u003e=0.51). Individuals from the F2 (LA 0716) generation, whether homozygous for the allele from \u003cem\u003eS. pennellii\u003c/em\u003e, homozygous for MM, or heterozygous, were distributed across phenotypic groups without significant differences (Figure 5). The QTL9 and \u003cem\u003eTm-2\u003c/em\u003e markers are both located on chromosome 9 but on opposite chromosomal arms. The results of the QTL9 marker analysis in the 55 tested F2 (LA 0716) plants showed a high co-segregation frequency between the \u003cem\u003eTm-2\u003c/em\u003e and QTL9 markers, with 50 out of 55 plants displaying the same genotype for both markers. This suggests that chromosome 9 is a recombination cold spot and that, like the \u003cem\u003eTm-2\u003c/em\u003e marker, the QTL9 marker is not linked to the ToBRFV resistance trait.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVIGS-mediated functional analysis of \u003cem\u003eTm\u003c/em\u003e genes in \u003cem\u003eS. pennellii\u003c/em\u003e accessions in relation to ToBRFV resistance\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo establish that \u003cem\u003eTm-1\u003c/em\u003e, and not another gene linked to the \u003cem\u003eTm-1\u003c/em\u003e locus, is involved in resistance to ToBRFV from \u003cem\u003eS. pennellii\u003c/em\u003e, we employed VIGS to silence \u003cem\u003eTm-1\u003c/em\u003e in plants from all five identified resistant \u003cem\u003eS. pennellii\u003c/em\u003e accessions. Three distinct genes were silenced: \u003cem\u003eTm-1\u003c/em\u003e, suspected as the candidate gene associated with resistance, while \u003cem\u003eTm-2\u0026nbsp;\u003c/em\u003eserved as a negative control and the \u003cem\u003eE. coli GUS\u003c/em\u003e gene, with no homolog in \u003cem\u003eSolanum\u003c/em\u003e species, functioned as a second negative control. From each resistant \u003cem\u003eS. pennellii\u003c/em\u003e accession five plants at the cotyledon stage were subjected to agro-inoculation with the VIGS constructs. Two weeks post-VIGS inoculation, the plants exhibiting silenced genes were challenged with ToBRFV. Additionally, non-VIGS-treated plants from the same accessions and at the same developmental stage as the VIGS-treated plants were inoculated with ToBRFV as controls. Finally, some plants from each \u003cem\u003eS. pennellii\u003c/em\u003e accession were kept as mock, without VIGS treatment and no ToBRFV inoculation, to serve as additional controls.\u003c/p\u003e\n\u003cp\u003eThree weeks post ToBRFV inoculation, plants from control treatments,\u003cem\u003e\u0026nbsp;Tm-2\u003c/em\u003e and \u003cem\u003eGUS\u003c/em\u003e silencing, showed no symptoms and exhibited normal growth, similar to non-VIGS-treated plants inoculated with ToBRFV, as well as mock-treated plants (without VIGS or ToBRFV inoculation) (Figure 6). Hence, the TRV VIGS system by itself seems not to influence ToBRFV resistance, and thus to be an appropriate tool for functional analysis of ToBRFV resistance genes. We observed that all \u003cem\u003eTm-1-\u003c/em\u003esilenced plants from the resistant \u003cem\u003eS. pennellii\u003c/em\u003e accessions displayed severe ToBRFV symptoms. Furthermore, all the plants from the various treatments were tested with ToBRFV Immunostick for presence of CP. The CP was only detected in plants in which \u003cem\u003eTm-1\u003c/em\u003e was silenced, while it was not detected in any of the other plants. Both, the presence \u0026nbsp;of symptoms and the detection of CP in the \u003cem\u003eTm-1\u003c/em\u003e silenced plants, confirm the involvement of the \u003cem\u003eTm-1\u003c/em\u003e gene in conferring resistance to ToBRFV in the resistant \u003cem\u003eS. pennellii\u0026nbsp;\u003c/em\u003eaccessions. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAllelic variation between\u003cem\u003e\u0026nbsp;Tm-1\u0026nbsp;\u003c/em\u003efrom \u003cem\u003eSolanum\u0026nbsp;\u003c/em\u003eaccessions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTm-1\u0026nbsp;\u003c/em\u003ealleles were amplified by PCR using cDNA from all the tested \u003cem\u003eS. pennellii\u0026nbsp;\u003c/em\u003eaccessions. Sequences were aligned together with the \u003cem\u003eTm-1\u0026nbsp;\u003c/em\u003e(\u003cem\u003eSopen02g013570\u003c/em\u003e) sequence annotated in the \u003cem\u003eS. pennellii\u0026nbsp;\u003c/em\u003e(LA 0716) genome retrieved by Sol genomics database (Bolger et al. 2014). The \u003cem\u003eTm-1\u003c/em\u003e alleles of all resistant \u003cem\u003eS. pennellii\u0026nbsp;\u003c/em\u003eaccessions\u003cem\u003e\u0026nbsp;\u003c/em\u003eare 100% identical with the annotated \u003cem\u003eTm-1\u0026nbsp;\u003c/em\u003e(\u003cem\u003eSopen02g013570\u003c/em\u003e)\u003cem\u003e\u0026nbsp;\u003c/em\u003egene, therefore only one \u003cem\u003eTm-1\u0026nbsp;\u003c/em\u003esequence from the resistant \u003cem\u003eS. pennellii\u0026nbsp;\u003c/em\u003eaccessions was used to predict its protein sequence. All susceptible \u003cem\u003eS. pennellii\u0026nbsp;\u003c/em\u003eaccessions carry an identical \u003cem\u003etm-1\u003c/em\u003e allele which differs from the \u003cem\u003eTm-1\u003c/em\u003e allele found in the resistant \u003cem\u003eS. pennellii\u0026nbsp;\u003c/em\u003eaccessions. Moreover, the amino acid (aa) sequences of \u0026nbsp;ToMV-resistance allele \u003cem\u003eTm-1\u0026nbsp;\u003c/em\u003e(GenBank: BAF75724; S.l. GCR237), the ToMV-susceptible allele \u003cem\u003etm-1\u0026nbsp;\u003c/em\u003e(GenBank: BAF75725; S.l. GCR26) from \u003cem\u003eS. lycopersicum\u0026nbsp;\u003c/em\u003eand the Tm-1 from the \u003cem\u003eS. habrochaites\u0026nbsp;\u003c/em\u003eaccession PI126445 (NCBI: AB713135) \u003cem\u003e\u0026nbsp;\u003c/em\u003ewere retrieved from the NCBI database. The accession PI126445 is the donor of the original ToMV resistant \u003cem\u003eTm-1\u003c/em\u003e allele (Ishibashi et al. 2012). The aa sequences of all the above \u003cem\u003eTm-1\u003c/em\u003e alleles were aligned and sequence differences were detected (Figure 7).\u003c/p\u003e\n\u003cp\u003eIshibashi et al. (2014) demonstrated that the first 201 amino acids (aa) of Tm-1 can bind the ToMV replication (REP) protein and inhibit replication in vitro (Figure 7, red-shaded region). Additionally, Ishibashi et al. (2012) identified the region spanning aa 78\u0026ndash;112 as being under positive selection in \u003cem\u003eS. habrochaites\u003c/em\u003e Tm-1 in response to resistance-breaking ToMV strains, highlighting its functional importance (Figure 7, boxed region). Notably, nine amino acids distinguish ToBRFV-resistant Tm-1 proteins from susceptible tm-1 variants, all within the first 201 aa, with eight located in the positively selected region for ToMV (aa 78\u0026ndash;112) at positions 57, 78, 79, 80, 85, 87, 89, 94, and 100 (Figure 7, red-highlighted). Additionally, a unique amino acid at position 459 in the Tm-1 protein of ToBRFV-resistant\u003cem\u003e\u0026nbsp;S. pennellii\u0026nbsp;\u003c/em\u003edistinguishes it from all other Tm-1 variants.\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e\u003cstrong\u003eToBRFV: A global threat and its control challenges\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTomato brown rugose fruit virus (ToBRFV) has rapidly become a significant concern for tomato production worldwide due to its devastating impact on crop yields (Caruso et al. 2022). The virus has been responsible for substantial economic losses across major tomato-growing regions, jeopardizing both large-scale agricultural operations and smallholder farms. Its rapid spread has exacerbated these challenges, making ToBRFV a global agricultural threat (Zhang et al. 2022). Compounding this issue, commonly used resistance genes in tomato which confer resistance to tobamoviruses, such as \u003cem\u003eTm-2/Tm-2\u003csup\u003e2\u003c/sup\u003e\u003c/em\u003e, have been proven ineffective against ToBRFV (Hak and Spiegelman 2021; Jaiswal et al. 2024; Luria et al. 2018; Zinger et al. 2021). As a result, the search for new resistance traits within the tomato germplasm has become a critical focus for researchers and breeders alike, aiming to mitigate the devastating effects of this pathogen on tomato production. These efforts have led to the identification and use of some ToBRFV resistance and tolerance traits in \u003cem\u003eSolanum\u003c/em\u003e species. However, ToBRFV isolates that can overcome some of these resistance traits have already been reported. For instance, a single amino acid mutation in the movement protein (MP) of the ToBRFV_G78_RB isolate (NCBI: MZ438228.1) has been shown to break the resistance of a commercial tomato cultivar (Zisi et al. 2024), which is conferred by a dominant NBS-LRR gene located on chromosome 8 derived from \u003cem\u003eS. habrochaites\u003c/em\u003e accession LYC4943 (Ykema et al. 2020). These findings illustrate the rapid resistance-breaking potential of RNA viruses like ToBRFV, as also described by Rubio et al. (2020), and emphasize the urgent need for continued efforts to discover additional resistance traits that can provide durable protection against this viral threat.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eTm-2\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003eis not involved in the \u003cem\u003eS. pennellii\u003c/em\u003e resistance\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSeveral studies have shown that both alleles, \u003cem\u003eTm-2\u003c/em\u003e and \u003cem\u003eTm-2\u003csup\u003e2\u003c/sup\u003e\u003c/em\u003e, originally derived from \u003cem\u003eS. peruvianum\u003c/em\u003e accessions and known for conferring resistance to ToMV, are ineffective against ToBRFV (Hak and Spiegelman 2021; Yan et al 2021). However, Lindbo (2022) demonstrated that specific engineered amino acid substitutions can restore \u003cem\u003eTm-2\u003csup\u003e2\u003c/sup\u003e\u003c/em\u003e functionality against ToBRFV. Specifically, amino acid substitutions at position 822 from asparagine (S) to cysteine (C), phenylalanine (F), methionine (M), tyrosine (Y) or tryptophan (W); at position 825 from serine (G) to histidine (H), lysine (K) or threonine (T); and at position 848 from cysteine (F) to arginine (R). While the \u003cem\u003eS. pennellii\u003c/em\u003e (LA 0716) Tm-2\u003csup\u003e2\u003c/sup\u003e orthologue (Sopen09g035210) protein shows significant differences from the traditional Tm-2\u003csup\u003e2\u003c/sup\u003e (NCBI: AAQ10736) (ID%: 74.15), these amino acid variations do not coincide with the substitutions conferring ToBRFV resistance (Figure S4). In our study, CAPS marker analysis of F2 (LA 0716) individuals confirmed that the \u003cem\u003eTm-2\u003c/em\u003e locus is not linked to the resistance trait. Furthermore, silencing \u003cem\u003eTm-2\u003c/em\u003e orthologues in all tested \u003cem\u003eS. pennellii\u003c/em\u003e accessions did not alter their response to ToBRFV (Figure 6), reinforcing the conclusion that the \u003cem\u003eTm-2\u003c/em\u003e alleles in \u003cem\u003eS. pennellii\u003c/em\u003e do not play a role in ToBRFV resistance.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe role of \u003cem\u003eTm-1\u003c/em\u003e in \u003cem\u003eS. pennellii\u0026nbsp;\u003c/em\u003eresistance\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAlthough the original ToMV-resistance \u003cem\u003eTm-1\u003c/em\u003e allele was initially reported as ineffective against ToBRFV, later studies identified its involvement in ToBRFV resistance \u003cspan lang=\"EN-US\"\u003e(Hak and Spiegelman 2021; Jaiswal et al. 2024; Luria et al. 2018; Zinger et al. 2021, 2025)\u003c/span\u003e. The present study revealed that all resistant F2 (LA 0716) plants possessed the \u003cem\u003eS. pennellii\u003c/em\u003e \u003cem\u003eTm-1\u003c/em\u003e allele in a homozygous state, as confirmed by CAPS marker analysis, suggesting that for the resistant \u003cem\u003eS. pennellii\u0026nbsp;\u003c/em\u003eaccessions LA 0716 and LA 0750, the \u003cem\u003eTm-1\u003c/em\u003e locus plays a crucial role in ToBRFV resistance. VIGS assays further confirmed the involvement of the \u003cem\u003eTm-1\u003c/em\u003e gene in ToBRFV resistance across all tested resistant \u003cem\u003eS. pennellii\u003c/em\u003e accessions, as silencing \u003cem\u003eTm-1\u003c/em\u003e rendered these plants susceptible to ToBRFV infection.\u003c/p\u003e\n\u003cp\u003eIshibashi (2010) demonstrated that allelic variants of \u003cem\u003eTm-1\u003c/em\u003e can interact with different tobamoviruses and inhibit their proliferation; for instance, the ToMV-susceptible allele of \u003cem\u003eTm-1\u003c/em\u003e (\u003cem\u003eS.l. tm-1\u003c/em\u003e) functions as an inhibitor of RNA replication for other tobamoviruses, such as tobacco mild green mosaic virus (TMGMV) and Pepper mild mottle virus (PMMoV). Based on our findings that \u003cem\u003eS. pennellii\u003c/em\u003e \u003cem\u003eTm-1 (S.p. Tm-1)\u003c/em\u003e plays a major role in ToBRFV resistance and considering the broader interactions of \u003cem\u003eTm-1\u003c/em\u003e alleles with various tobamoviruses, we speculate that the \u003cem\u003eS.p.\u003c/em\u003e \u003cem\u003eTm-1\u003c/em\u003e is an allelic variant of this gene capable of interacting with the ToBRFV REP protein, thereby halting its proliferation.\u003c/p\u003e\n\u003cp\u003eAfter comparing the aa sequence of Tm-1 from the susceptible and resistant \u003cem\u003eS. pennellii\u003c/em\u003e accessions identified in this study, along with other ToBRFV-resistant and -susceptible Tm-1 variants from the literature, we identified nine unique aa associated with resistance. Additionally, a unique aa specific to the ToBRFV-resistant \u003cem\u003eS. pennellii\u003c/em\u003e accessions was identified at position 459. Notably, all nine ToBRFV resistance-associated aa are located within the first 201 aa, a region previously shown to be sufficient for inhibiting ToMV replication in vitro (Ishibashi et al. 2014). Eight of these nine aa reside within the \u003cem\u003eTm-1\u003c/em\u003e region spanning aa 78\u0026ndash;112, which was identified as a positively selected site against ToMV (Ishibashi et al. 2012). The exclusive presence of these aa in resistance-conferring Tm-1 variants and their location within functionally critical regions strongly suggest their key role in ToBRFV resistance. The unique aa at position 459 in the Tm-1 protein of ToBRFV-resistant \u003cem\u003eS. pennellii\u003c/em\u003e is not located in a region previously described as important for its function against tobamoviruses. However, this does not rule out its potential contribution to improved affinity in the interaction between Tm-1 and ToBRFV REP.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAn additional locus from \u003cem\u003eS. pennellii\u003c/em\u003e is required for full ToBRFV resistance\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInterestingly, some plants from the F2 (LA 0716) population displayed symptoms and/or CP accumulation despite having the \u003cem\u003eS.p.\u003c/em\u003e \u003cem\u003eTm-1\u003c/em\u003e allele in a homozygous state. This finding suggests that \u003cem\u003eTm-1\u003c/em\u003e alone is not sufficient to confer complete resistance, indicating the involvement of an additional locus. The segregation ratio of only those F2 (LA 0716) individuals with the homozygous \u003cem\u003eS.p.\u003c/em\u003e \u003cem\u003eTm-1\u003c/em\u003e allele followed a 3 susceptible (S): 1 resistant (R) pattern, which is characteristic of traits inherited in a recessive manner. This observation implies that the additional locus, which works in conjunction with \u003cem\u003eTm-1\u003c/em\u003e to confer ToBRFV resistance, is likely inherited recessively.\u003c/p\u003e\n\u003cp\u003ePrevious studies have also suggested the involvement of \u003cem\u003eTm-1\u003c/em\u003e gene in combination with additional loci in ToBRFV resistance. Ashkenazi et al. (2020) reported that the ToBRFV resistance trait in a \u003cem\u003eS. lycopersicum\u003c/em\u003e cultivar was due to the \u003cem\u003eTm-1\u003c/em\u003e gene combined with a recessively inherited locus on chromosome 11 and/or chromosome 9. Similarly, Zinger et al. (2021) described a resistance trait in \u003cem\u003eS. \u0026nbsp;lycopersicum\u003c/em\u003e, conferred by the combination of \u003cem\u003eTm-1\u003c/em\u003e locus with a recessive locus on chromosome 11. Another study pointed the recessive gene \u003cem\u003eSICCA1\u003c/em\u003e (\u003cem\u003eSolyc11g018770\u003c/em\u003e), located within the chromosome 11 loci mentioned in the other two studies, as the additional resistance contributor alongside \u003cem\u003eTm-1\u0026nbsp;\u003c/em\u003e(Kalisvaart et al. 2021).\u003c/p\u003e\n\u003cp\u003eTo explore this further, we used a CAPS marker located within the chromosome 11 loci described by Zinger et al. (2021) and Ashkenazi at al. (2020) in the F2 (LA 0716) individuals. Our results showed that this marker is not linked with the resistance trait found in the \u003cem\u003eS. pennellii\u003c/em\u003e LA 0716 accession, demonstrating that the resistance in \u003cem\u003eS. pennellii\u003c/em\u003e is governed by a different additional locus. Since the \u003cem\u003eSICCA1\u003c/em\u003e gene is located near the CAPS marker on chromosome 11, and our results show that this marker is not linked to the resistance in \u003cem\u003eS. pennellii\u003c/em\u003e, we could conclude that \u003cem\u003eSICCA1\u003c/em\u003e is not the additional resistance contributor in resistant \u003cem\u003eS. pennellii\u0026nbsp;\u003c/em\u003eplants.\u003c/p\u003e\n\u003cp\u003eFurthermore, the \u003cem\u003eTm-2\u003c/em\u003e gene, located on chromosome 9, lies within a region known to be a cold spot for recombination (Fuentes et al. 2024). We tested the QTL9 CAPS marker positioned at the end of the opposite arm of chromosome 9, far from the \u003cem\u003eTm-2\u003c/em\u003e region, in a subset of F2 (LA 0716) individuals. This marker showed co-segregation with the \u003cem\u003eTm-2\u003c/em\u003e marker, reinforcing the idea that chromosome 9 is a recombination cold spot. However, both markers did not show co-segregation with the resistance trait. Consequently, we can conclude that these loci on chromosome 9 are not linked to the resistance found in \u003cem\u003eS. pennellii\u003c/em\u003e LA 0716.\u003c/p\u003e\n\u003cp\u003eThese observations suggest that the locus in \u003cem\u003eS. pennellii\u003c/em\u003e LA 0716, which works alongside \u003cem\u003eTm-1\u003c/em\u003e to confer ToBRFV resistance, does not overlap with the loci described in the two key studies that identified ToBRFV resistance involving \u003cem\u003eTm-1\u003c/em\u003e. This indicates the potential novelty of the additional gene in \u003cem\u003eS. pennellii\u003c/em\u003e LA 0716, which, in combination with \u003cem\u003eS.p.\u0026nbsp;\u003c/em\u003e\u003cem\u003eTm-1\u003c/em\u003e, confers robust ToBRFV resistance. Topcu et al. (2025) identified 14 QTL for ToBRFV tolerance by GWAS involving \u003cem\u003eS. lycopersicum\u003c/em\u003e var. \u003cem\u003elycopersicum\u003c/em\u003e, \u003cem\u003eS. lycopersicum\u003c/em\u003e var. \u003cem\u003ecerasiforme\u003c/em\u003e and \u003cem\u003eS. pimpinellifolium\u003c/em\u003e accessions. In addition to QTLs on chromosome 11 they observed \u0026nbsp;QTLs on chromosomes 1, 2, 3, 6, 7, 10 and 12.\u003c/p\u003e\n\u003cp\u003eOur results do not clarify whether the additional gene works synergistically with \u003cem\u003eTm-1\u003c/em\u003e to inhibit virus proliferation or if it functions through an independent resistance or tolerance mechanism. This independent mechanism combined with \u003cem\u003eTm-1\u003c/em\u003e inhibition of viral replication, may collectively confer complete resistance to ToBRFV. Interestingly, Ishibashi (2010) demonstrated that tomato is a nonhost for the tobamovirus TMGMV due to the presence of a naturally occurring \u003cem\u003eTm-1\u003c/em\u003e allele (\u003cem\u003eS.l. tm-1\u003c/em\u003e). A TMGMV strain later emerged with reduced interaction with \u003cem\u003eS.l. tm-1\u003c/em\u003e, allowing it to replicate in tomato protoplasts as efficiently as ToMV. However, in tomato leaves the proliferation of this TMGMV strain was significantly lower, suggesting the presence of an additional inhibitory mechanism that prevents the virus from spreading intercellularly. In this case, \u003cem\u003eTm-1\u003c/em\u003e and the secondary mechanism appeared to act independently against TMGMV. A similar scenario could explain the ToBRFV resistance observed in \u003cem\u003eS. pennellii\u003c/em\u003e accessions, where the \u003cem\u003eS.p.\u003c/em\u003e \u003cem\u003eTm-1\u003c/em\u003e allele and the additional locus might function independently or in combination. However, additional studies are needed to elucidate the mechanisms behind \u003cem\u003eS.p.\u003c/em\u003e \u003cem\u003eTm-1\u003c/em\u003e and the additional locus in conferring ToBRFV resistance.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDiscrepancies in \u003cem\u003eS. pennellii\u003c/em\u003e LA 0716 ToBRFV resistance in different studies\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, we found that five \u003cem\u003eSolanum pennellii\u003c/em\u003e accessions exhibited high resistance to ToBRFV. However, previous studies have reported conflicting results regarding the resistance of \u003cem\u003eS. pennellii\u003c/em\u003e, specifically the LA 0716 accession, to ToBRFV. Jewehan et al. (2022b)\u0026nbsp;classified \u003cem\u003eS. pennellii\u003c/em\u003e as completely susceptible to ToBRFV while Kabas et al. (2022) characterized the LA 0716 accession as ToBRFV-tolerant, observing mild symptoms. Topcu et al. (2025) mentioned that LA 0716 did not exhibit any ToBRFV symptoms, but was considered highly tolerant as ToBRFV virus could be detected by RT-qPCR. These divergences could be attributed to genetic variation within the tested \u003cem\u003eS. pennellii\u003c/em\u003e accessions, differences in the ToBRFV isolates used, or varying environmental conditions. Most of the \u003cem\u003eS. pennellii\u003c/em\u003e accessions, including LA 0716, are self-compatible and predominantly self-pollinated (Flores-Hern\u0026aacute;ndez et al. 2018), making them genetically homogeneous, with limited variation (Mercer and Perales 2010; Rick and Tanksley 1981). Thus, genetic differences within the LA 0716 accession are unlikely to explain the observed differences in ToBRFV infectivity.\u003c/p\u003e\n\u003cp\u003eAnother potential factor is the use of different ToBRFV isolates. Jewehan et al. (2022b) used the ToBRFV-Tom2-Jo isolate (GenBank Accession No.\u0026nbsp;MZ323110), while Kabas et al. (2022) and Topcu et al. (2025) used the ToBRFV-Ant-Tom isolate (GenBank Accession No. MT107885). In our study, we used the ToBRFV-NVWA isolate (GenBank Accession No. MN882011). The CP amino acid sequence is identical across the three ToBRFV isolates (Figure S5), indicating that CP is unlikely to contribute to the observed differences in infectivity.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA comparison of REP protein sequences showed that ToBRFV-NVWA differs from Ant-Tom and Tom2-Jo by two aa at positions 1206 and 1363, while NVWA and Ant-Tom differ from Tom2-Jo by one aa at position 984 (Figure S6). The helicase domain (aa 801\u0026ndash;1116) is the most crucial region of REP for interaction with Tm-1 (Ishibashi 2010; Ishibashi et al. 2012; Ishibashi and Ishikawa 2014). The differences at positions 1206 and 1363 are outside this domain, whereas the difference at position 984, found in Tom2-Jo, is within the helicase domain. This aa difference in Tom2-Jo may be responsible for breaking \u003cem\u003eS. pennellii Tm-1\u003c/em\u003e-mediated resistance. This hypothesis is supported by a recent study (Kubota et al. 2024), which identified several aa substitutions, including one at position 984, in the helicase domain of ToBRFV isolates capable of breaking the resistance conferred by the GCR237 \u003cem\u003eTm-1\u003c/em\u003e allele.\u0026nbsp;Hence, this observation can not only explain the differences in ToBRFV response of plants from the same \u003cem\u003eS. pennellii\u003c/em\u003e accession (LA 0716) among the different studies, but also suggests that the aa substitution at position 984 of ToBRFV REP alone may be sufficient to break the resistance conferred by \u003cem\u003eTm-1\u003c/em\u003e alleles.\u003c/p\u003e\n\u003cp\u003eMoreover, ToBRFV-Ant-Tom lacks the first 26 aa of the small subunit of the REP protein. While this missing segment is not part of the helicase domain, it may influence the protein\u0026rsquo;s secondary structure and potentially affect its function. Furthermore, two aa differences were observed between the movement protein (MP) of Tom2-Jo and NVWA, and Ant-Tom (Figure S7). Our findings suggest that the \u003cem\u003eS. pennellii\u003c/em\u003e resistance trait involves \u003cem\u003eTm-1\u003c/em\u003e in combination with an additional locus. The two amino acid differences in the MP between these isolates might interfere with the contribution of this additional locus. That could be another explanation why Jewehan et al. (2022b) found the LA 0716 accession susceptible.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEnvironmental factors may also contribute to the discrepancies in ToBRFV infectivity. Jewehan et al. (2022a) demonstrated that \u003cem\u003eS. habrochaites\u003c/em\u003e and \u003cem\u003eS. peruvianum\u003c/em\u003e accessions, resistant to ToBRFV at 24\u0026deg;C, displayed severe symptoms when inoculated at 33\u0026deg;C. Similarly, the resistance conferred by \u003cem\u003eTm-1\u003c/em\u003e against ToMV is temperature-dependent (Fraser and Loughlin 1982).\u0026nbsp;\u003cem\u003eTm-1\u003c/em\u003e plants inhibited TMV proliferation at 25\u0026deg;C but lost this ability at 33\u0026deg;C. In our study, plants were inoculated at 20\u0026deg;C, whereas Kabas et al. (2022) conducted their inoculations and 28\u0026deg;C, respectively. The higher temperature used in their study may have reduced the efficacy of \u003cem\u003eS.p.\u0026nbsp;\u003c/em\u003e\u003cem\u003eTm-1\u003c/em\u003e against ToBRFV, contributing to the differences in the plant\u0026rsquo;s response to the viral infection. It would be valuable to further investigate the impact of elevated temperatures on ToBRFV resistance in \u003cem\u003eS. pennellii\u003c/em\u003e accessions, particularly those tested in our study.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eTomato brown rugose fruit virus (ToBRFV) threatens global tomato production, with emerging new isolates that overcome resistance genes. This highlights the urgent need for continued research not only to identify and exploit individual resistance genes but to discover multiple genes with diverse resistance mechanisms. By combining these genes, we can develop multilayered, durable resistance to counter this viral threat more effectively. Our study identified \u003cem\u003eS. pennellii\u003c/em\u003e accessions as a valuable source of ToBRFV resistance, with the \u003cem\u003eS. pennellii Tm-1\u003c/em\u003e allele playing a key role. Moreover, we identified nine aa in Tm-1 variants that are associated with the ToBRFV resistance. Additionally, we demonstrated that complete resistance requires a secondary locus, likely inherited recessively. Notably, this locus does not overlap with those previously reported from other studies to act alongside \u003cem\u003eTm-1\u003c/em\u003e, suggesting its potential as a novel factor in ToBRFV resistance. Our findings can be of great value for breeding programs focused on developing tomato cultivars with strong, durable resistance to ToBRFV.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank all partners of the EU project \u0026ldquo;VIRTIGATION\u0026rdquo; and the members of the Plant Breeding group at Wageningen University \u0026amp; Research (WUR) for their valuable discussions and insights on this study. Special thanks to Mr. Run Li and Mr. Joshua Akinola for their contribution as part of their MSc theses and to Fien Meijer-Dekens for maintaining and propagating the \u003cem\u003eSolanum\u003c/em\u003e accessions collection of Plant Breeding group.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMV performed the ToBRFV inoculations. RZ conducted the phenotyping, genotyping, and crosses between \u003cem\u003eS. pennellii\u003c/em\u003e accessions and tomato cv. Moneymaker, generating the F₁ and F₂ populations. RZ also developed a DSI for ToBRFV symptoms, created VIGS constructs and performed the assays, and cloned and sequenced \u003cem\u003eTm-1\u003c/em\u003e alleles. A-MAW, MvD, and YB contributed to the experimental design and provided critical feedback on the manuscript.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis publication has received funding from the European Union\u0026rsquo;s Horizon 2020 research and innovation programme under grant agreement No 101000570. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing financial or non-financial interests in relation to the work described.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAshkenazi V, Rotem Y, Ecker R, Nashilevitz S, Barom N (2020) Resistance in plants of \u003cem\u003eSolanum lycopersicum\u003c/em\u003e to the \u003cem\u003eTobamovirus\u0026nbsp;\u003c/em\u003eTomato Brown Rugose Fruit Virus. Patent WO2020249996\u003c/li\u003e\n \u003cli\u003eBolger A, Scossa F, Bolger ME, Lanz C, Maumus F, Tohge T, Quesneville H, Alseekh S, S\u0026oslash;rensen I, Lichtenstein G, Fich EA, Conte M, Keller H, Schneeberger K, Schwacke R, Ofner I, Vrebalov J, Xu Y, Osorio S, \u0026hellip; Fernie AR (2014) The genome of the stress-tolerant wild tomato species \u003cem\u003eSolanum pennellii\u003c/em\u003e. Nature Genet 46:1034\u0026ndash;1038. https://doi.org/10.1038/ng.3046\u003c/li\u003e\n \u003cli\u003eCaruso AG, Bertacca S, Parrella G, Rizzo R, Davino S, Panno S (2022) Tomato brown rugose fruit virus: A pathogen that is changing the tomato production worldwide. Annals Appl Biol 181:258\u0026ndash;274. https://doi.org/10.1111/aab.12788\u003c/li\u003e\n \u003cli\u003eCox DE, Dyer S, Weir R, Cheseto X, Sturrock M, Coyne D, Torto B, Maule AG, Dalzell JJ (2019) ABC transporter genes \u003cem\u003eABC-C6\u003c/em\u003e and \u003cem\u003eABC-G33\u003c/em\u003e alter plant-microbe-parasite interactions in the rhizosphere. Sci Rep 9:19899. https://doi.org/10.1038/s41598-019-56493-w\u003c/li\u003e\n \u003cli\u003eDi Tommaso P, Moretti S, Xenarios I, Orobitg M, Montanyola A, Chang JM, Taly JF, Notredame C (2011) T-Coffee: a web server for the multiple sequence alignment of protein and RNA sequences using structural information and homology extension. Nucl Acids Res 39(suppl_2):W13\u0026ndash;W17. https:// doi.org/10.1093/nar/gkr245\u003c/li\u003e\n \u003cli\u003eFAO (2022). World Food and Agriculture\u0026mdash;Statistical Yearbook 2022; Food and Agriculture Organization of the United Nations. https://doi.org/10.4060/cc2211en\u003c/li\u003e\n \u003cli\u003eFernandez-Pozo N, Rosli HG, Martin GB, Mueller LA (2015) The SGN VIGS tool: User-friendly software to design virus-induced gene silencing (VIGS) constructs for functional genomics. Mol Plant 8:486\u0026ndash;488. https://doi.org/10.1016/j.molp.2014.11.024\u003c/li\u003e\n \u003cli\u003eFlores-Hern\u0026aacute;ndez LA, Lobato-Ortiz R, Sangerman-Jarqu\u0026iacute;n DM, Garc\u0026iacute;a-Zavala JJ, Molina-Gal\u0026aacute;n JD, Velasco-Alvarado MDJ, Mar\u0026iacute;n-Montes IM (2018) Genetic diversity within wild species of \u003cem\u003eSolanum\u003c/em\u003e. Revista Chapingo. Serie Horticultura 24:85-96. https://doi.org/10.5154/r.rchsh.2017.08.030\u003c/li\u003e\n \u003cli\u003eFraser RSS, Loughlin SAR (1982) Effects of temperature on the \u003cem\u003eTm-1\u003c/em\u003e gene for resistance to tobacco mosaic virus in tomato. Physiol Plant Pathol 20:109\u0026ndash;117. https://doi.org/10.1016/0048-4059(82)90029-7\u003c/li\u003e\n \u003cli\u003eFuentes RR, Nieuwenhuis R, Chouaref J, Hesselink T, van Dooijeweert W, van den Broeck HC, Schijlen E, Schouten HJ, Bai Y, Fransz P, Stam M, de Jong H, Trivino SD, de Ridder D, van Dijk ADJ, Peters SA (2024) A catalogue of recombination coldspots in interspecific tomato hybrids. PLOS Genet 20:e1011336. https://doi.org/10.1371/journal.pgen.1011336\u003c/li\u003e\n \u003cli\u003eG\u0026oacute;mez P, Rodr\u0026iacute;guez-Hern\u0026aacute;ndez AM, Moury B, Aranda MA (2009) Genetic resistance for the sustainable control of plant virus diseases: breeding, mechanisms and durability. Eur J Plant Pathol 125:1\u0026ndash;22. https://doi.org/10.1007/s10658-009-9468-5\u003c/li\u003e\n \u003cli\u003eGonz\u0026aacute;lez-Concha LF, Ram\u0026iacute;rez-Gil JG, Mora-Romero GA, Garc\u0026iacute;a-Estrada RS, Carrillo-Fasio JA, Tovar-Pedraza JM (2023) Development of a scale for assessment of disease severity and impact of tomato brown rugose fruit virus on tomato yield. Eur J Plant Pathol 165:579-92. https://doi.org/10.1007/s10658-022-02629-0\u003c/li\u003e\n \u003cli\u003eHak H, Spiegelman Z (2021) The Tomato brown rugose fruit virus movement protein overcomes \u003cem\u003eTm-2\u003csup\u003e\u0026nbsp;2\u003c/sup\u003e\u0026nbsp;\u003c/em\u003eresistance in tomato while attenuating viral transport. Mol Plant-Microbe Interact 34:1024\u0026ndash;1032. https://doi.org/10.1094/MPMI-01-21-0023-R\u003c/li\u003e\n \u003cli\u003eHall TJ (1980) Resistance at the \u003cem\u003eTm-2\u003c/em\u003e locus in the tomato to tomato mosaic virus. Euphytica 29:189\u0026ndash;197. https://doi.org/10.1007/BF00037266\u003c/li\u003e\n \u003cli\u003eHofmann K, Baron M (1996) Boxshade 3.21. Pretty printing and shading of multiple-alignment files. Kay Hofmann ISREC Bioinformatics Group, Lausanne, Switzerland. https://junli.netlify.app/apps/ boxshade/\u003c/li\u003e\n \u003cli\u003eIshibashi K (2010) Studies on the \u003cem\u003eTm-1\u003c/em\u003e gene of tomato and host specificity of tobamoviruses. J Gen Plant Pathol 76:417\u0026ndash;418. https://doi.org/10.1007/s10327-010-0268-8\u003c/li\u003e\n \u003cli\u003eIshibashi K, Ishikawa M (2014). Mechanisms of tomato mosaic virus RNA replication and its inhibition by the host resistance factor Tm-1. Curr Opin Virol 9:8\u0026ndash;13.\u0026nbsp;https://doi.org/10.1016/j.coviro.2014.08. 005\u003c/li\u003e\n \u003cli\u003eIshibashi K, Kezuka Y, Kobayashi C, Kato M, Inoue T, Nonaka T, Ishikawa M, Matsumura H, Katoh E (2014) Structural basis for the recognition\u0026ndash;evasion arms race between \u003cem\u003eTomato mosaic virus\u003c/em\u003e and the resistance gene \u003cem\u003eTm-1\u003c/em\u003e. Proc Natl Acad Sci 111: E3486\u0026ndash;E3495.\u0026nbsp;https://doi.org/10.1073/pnas. 1407888111\u003c/li\u003e\n \u003cli\u003eIshibashi K, Masuda K, Naito S, Meshi T, Ishikawa M (2007) An inhibitor of viral RNA replication is encoded by a plant resistance gene. Proc Natl Acad Sci 104:13833\u0026ndash;13838.\u0026nbsp;https://doi.org/10.1073/pnas. 0703203104\u003c/li\u003e\n \u003cli\u003eIshibashi K, Mawatari N, Miyashita S, Kishino H, Meshi T, Ishikawa M (2012) Coevolution and hierarchical interactions of tomato mosaic virus and the resistance gene \u003cem\u003eTm-1\u003c/em\u003e. PLoS Pathogens 8:e1002975. https://doi.org/10.1371/journal.ppat.1002975\u003c/li\u003e\n \u003cli\u003eIshibashi K, Naito S, Meshi T, Ishikawa M (2009) An inhibitory interaction between viral and cellular proteins underlies the resistance of tomato to nonadapted tobamoviruses. Proc Natl Acad Sci 106:8778\u0026ndash;8783. https://doi.org/10.1073/pnas.0809105106\u003c/li\u003e\n \u003cli\u003eJaiswal N, Chanda B, Gilliard A, Shi A, Ling KS (2024) Evaluation of tomato germplasm against tomato brown rugose fruit virus and identification of resistance in \u003cem\u003eSolanum pimpinellifolium\u003c/em\u003e. Plants 13:581. https://doi.org/10.3390/plants13050581\u003c/li\u003e\n \u003cli\u003eJewehan A, Salem N, T\u0026oacute;th Z, Salamon P, Szab\u0026oacute; Z (2022a) Evaluation of responses to tomato brown rugose fruit virus (ToBRFV) and selection of resistant lines in \u003cem\u003eSolanum habrochaites\u003c/em\u003e and \u003cem\u003eSolanum peruvianum\u003c/em\u003e germplasm. J Gen Plant Pathol 88:187\u0026ndash;196. https://doi.org/10.1007/s10327-022-01055-8\u003c/li\u003e\n \u003cli\u003eJewehan A, Salem N, T\u0026oacute;th Z, Salamon P, Szab\u0026oacute; Z (2022b) Screening of \u003cem\u003eSolanum\u003c/em\u003e (sections \u003cem\u003eLycopersicon\u003c/em\u003e and \u003cem\u003eJuglandifolia\u003c/em\u003e) germplasm for reactions to the tomato brown rugose fruit virus (ToBRFV). J Plant Dis Protect 129:117\u0026ndash;123. https://doi.org/10.1007/s41348-021-00535-x\u003c/li\u003e\n \u003cli\u003eJones RAC (2006) Control of plant virus diseases. Adv Virus Res 67:205\u0026ndash;244.\u0026nbsp;https://doi.org/10.1016/ S0065-3527(06)67006-1\u003c/li\u003e\n \u003cli\u003eJones RAC (2021) Global plant virus disease pandemics and epidemics. Plants 10:233. https:// doi.org/10.3390/plants10020233\u003c/li\u003e\n \u003cli\u003eKabas A, Fidan H, Kucukaydin H, Atan HN (2022) Screening of wild tomato species and interspecific hybrids for resistance/tolerance to Tomato brown rugose fruit virus (ToBRFV). Chil J Agr Res 82:189\u0026ndash;196. https://doi.org/10.4067/S0718-58392022000100189\u003c/li\u003e\n \u003cli\u003eKalisvaart J, Frijters RJJM, Ludeking DJW, Roovers AJM (2021)\u0026nbsp;\u003cem\u003eCCA\u003c/em\u003e gene for virus resistance. Patent WO2021110855.\u003c/li\u003e\n \u003cli\u003eKato M, Ishibashi K, Kobayashi C, Ishikawa M, Katoh E (2013) Expression, purification, and functional characterization of an N-terminal fragment of the \u003cem\u003etomato mosaic virus\u003c/em\u003e resistance protein Tm-1. Protein Expres Purif 89:1\u0026ndash;6. https://doi.org/10.1016/j.pep.2013.02.001\u003c/li\u003e\n \u003cli\u003eKubota K, Takeyama S, Matsushita Y, Ishibashi K (2024) Isolation of spontaneous mutants of tomato brown rugose fruit virus that efficiently infect \u003cem\u003eTm-1\u003c/em\u003e homozygote tomato plants. J Gen Plant Pathol 90:187-95. https://doi.org/10.1007/s10327-024-01176-2\u003c/li\u003e\n \u003cli\u003eLanfermeijer FC, Dijkhuis J, Sturre MJG, de Haan P, Hille J (2003) Cloning and characterization of the durable tomato mosaic virus resistance gene \u003cem\u003eTm-2\u003csup\u003e2\u003c/sup\u003e\u003c/em\u003e from \u003cem\u003eLycopersicon esculentum\u003c/em\u003e. Plant Mol Biol 52:1039\u0026ndash;1051. https://doi.org/10.1023/A:1025434519282\u003c/li\u003e\n \u003cli\u003eLindbo J (2022) Tomato plants resistant to ToBRFV, TMV, ToMV and ToMMV and corresponding resistance genes. Patent WO2022117884.\u003c/li\u003e\n \u003cli\u003eLiu Y, Schiff M, Dinesh‐Kumar SP (2002) Virus‐induced gene silencing in tomato. Plant J 31:777\u0026ndash;786. https://doi.org/10.1046/j.1365-313X.2002.01394.x\u003c/li\u003e\n \u003cli\u003eLuria N, Smith E, Sela N, Lachman O, Bekelman I, Koren A, Dombrovsky A (2018) A local strain of Paprika mild mottle virus breaks \u003cem\u003eL3\u003c/em\u003e resistance in peppers and is accelerated in Tomato brown rugose fruit virus-infected \u003cem\u003eTm-2\u003csup\u003e2\u003c/sup\u003e-\u003c/em\u003eresistant tomatoes. Virus Genes 54:280\u0026ndash;289. https://doi.org/10.1007/s11262-018-1539-2\u003c/li\u003e\n \u003cli\u003eMercer KL, Perale, HR (2010) Evolutionary response of landraces to climate change in centers of crop diversity. Evol Appl 3:480\u0026ndash;493. https://doi.org/10.1111/j.1752-4571.2010.00137.x\u003c/li\u003e\n \u003cli\u003eMeshi T, Motoyoshi F, Maeda T, Yoshiwoka S, Watanabe H, Okada Y (1989) Mutations in the tobacco mosaic virus 30-kD protein gene overcome \u003cem\u003eTm-2\u003c/em\u003e resistance in tomato. Plant Cell 1:515\u0026ndash;522. https://doi.org/10.1105/tpc.1.5.515\u003c/li\u003e\n \u003cli\u003ePelham J (1966) Resistance in tomato to tobacco mosaic virus. Euphytica 15:258\u0026ndash;267. https://doi.org/10.1007/BF00022331\u003c/li\u003e\n \u003cli\u003eRick CM, Tanksley SD (1981) Genetic variation in \u003cem\u003eSolanum pennellii\u003c/em\u003e: Comparisons with two other sympatric tomato species. Plant Syst Evol 139:11\u0026ndash;45. https://doi.org/10.1007/BF00983920\u003c/li\u003e\n \u003cli\u003eRivarez MPS, Vučurović A, Mehle N, Ravnikar M, Kutnjak D (2021) Global advances in tomato virome research: Current status and the impact of high-throughput sequencing. Front Microbiol 12:671925. https://doi.org/10.3389/fmicb.2021.671925\u003c/li\u003e\n \u003cli\u003eRubio L, Galipienso L, Ferriol I (2020) Detection of plant viruses and disease management: Relevance of genetic diversity and evolution. Front Plant Sci 11:1092. https://doi.org/10.3389/fpls.2020.01092\u003c/li\u003e\n \u003cli\u003eSchenk JJ, Becklund LE, Carey SJ, Fabre PP (2023) What is the \u0026ldquo;modified\u0026rdquo; CTAB protocol? Characterizing modifications to the CTAB DNA extraction protocol. Appl Plant Sci 11:e11517. https://doi.org/10.1002/aps3.11517\u003c/li\u003e\n \u003cli\u003eStrasser M, Pfitzner AJP (2007) The double-resistance-breaking Tomato mosaic virus strain ToMV1-2 contains two independent single resistance-breaking domains. Arch Virol 152:903\u0026ndash;914. https://doi.org/10.1007/s00705-006-0915-8\u003c/li\u003e\n \u003cli\u003eTopcu Y, Yildiz K, Kayikci HC, Aydin S, Feng Q, Sapkota M (2025) Deciphering resistance to Tomato brown rugose fruit virus (ToBRFV) using Genome-Wide Association Studies. Sci Hortic 341:113968. https://doi.org/10.1016/j.scienta.2025.113968\u003c/li\u003e\n \u003cli\u003evan Damme M, Zois R, Verbeek M, Bai Y, Wolters AMA (2023) Directions from nature: how to halt the tomato brown rugose fruit virus. Agronomy 13:1300. https://doi.org/10.3390/agronomy13051300\u003c/li\u003e\n \u003cli\u003eWeber H, Ohnesorge S, Silber MV, Pfitzner AJP (2004) The \u003cem\u003eTomato mosaic virus\u003c/em\u003e 30 kDa movement protein interacts differentially with the resistance genes\u003cem\u003e\u0026nbsp;Tm-2\u003c/em\u003e and \u003cem\u003eTm-2\u003csup\u003e2\u003c/sup\u003e\u003c/em\u003e. Arch Virol 149:1499-1514. https://doi.org/10.1007/s00705-004-0312-0\u003c/li\u003e\n \u003cli\u003eYan Z, Ma H, Wang L, Tettey C, Zhao M, Geng C, Tian Y, Li X (2021) Identification of genetic determinants of tomato brown rugose fruit virus that enable infection of plants harbouring the \u003cem\u003eTm‐2\u003csup\u003e\u0026nbsp;2\u003c/sup\u003e\u0026nbsp;\u003c/em\u003eresistance gene. Mol Plant Pathol 22:1347\u0026ndash;1357. https://doi.org/10.1111/mpp.13115\u003c/li\u003e\n \u003cli\u003eYkema M, Verweij WC, De la Fuente van Bentem S (2020) Tomato plant resistant to tomato brown rugose fruit virus. Patent WO2020147921\u003c/li\u003e\n \u003cli\u003eZhang S, Griffiths JS, Marchand G, Bernards MA, Wang A (2022) \u003cem\u003eTomato brown rugose fruit virus\u003c/em\u003e: An emerging and rapidly spreading plant RNA virus that threatens tomato production worldwide. Mol Plant Pathol 23:1262\u0026ndash;1277. https://doi.org/10.1111/mpp.13229\u003c/li\u003e\n \u003cli\u003eZinger A, Doron-Faigenboim A, Gelbart D, Levin I, Lapidot M (2025) Contribution of the \u003cem\u003eTobamovirus\u003c/em\u003e resistance gene \u003cem\u003eTm-1\u003c/em\u003e to control of ToBRFV resistance in tomato. bioRxiv 2025:2025-01\u0026nbsp;https://doi.org/10.1101/2025.01.20.633895\u003c/li\u003e\n \u003cli\u003eZinger A, Lapidot M, Harel A, Doron-Faigenboim A, Gelbart D, Levin I (2021) Identification and mapping of tomato genome loci controlling tolerance and resistance to tomato brown rugose fruit virus. Plants 10:179. https://doi.org/10.3390/plants10010179\u003c/li\u003e\n \u003cli\u003eZisi Z, Ghijselings L, Vogel E, Vos C, Matthijnssens J (2024) Single amino acid change in tomato brown rugose fruit virus breaks virus-specific resistance in new resistant tomato cultivar. Front Plant Sci 15:1382862. https://doi.org/10.3389/fpls.2024.1382862\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"theoretical-and-applied-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"taag","sideBox":"Learn more about [Theoretical and Applied Genetics](https://www.springer.com/journal/122)","snPcode":"122","submissionUrl":"https://submission.nature.com/new-submission/122/3","title":"Theoretical and Applied Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Tomato brown rugose fruit virus, Tobamovirus, resistance, Solanum lycopersicum, wild Solanum accessions","lastPublishedDoi":"10.21203/rs.3.rs-6221483/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6221483/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe \u003cem\u003eTobamovirus \u003c/em\u003eTomato Brown Rugose Fruit Virus (ToBRFV) poses a significant threat to global tomato production. ToBRFV is a mechanically transmitted virus containing a single-stranded positive sense RNA genome. Disease symptoms include brown, rough patches on fruit surfaces, leaf mosaicism and shape abnormalities, and, in advanced stages, total collapse of infected plants. ToBRFV was first detected in the Middle East in 2014 and has rapidly spread to multiple countries across Asia, Europe, and America. In recent years, numerous studies have focused on the identification of ToBRFV resistance traits that are suitable for tomato breeding programs. In this study, we identified five ToBRFV-resistant accessions of \u003cem\u003eSolanum pennellii\u003c/em\u003e, a wild relative of cultivated tomato. We confirmed that the major gene controlling this resistance trait is the \u003cem\u003eS. pennellii\u003c/em\u003e allele of \u003cem\u003eTm-1\u003c/em\u003e. \u003cem\u003eTm-1\u003c/em\u003e was previously identified in \u003cem\u003eS. habrochaites\u003c/em\u003e as a semidominant Tomato Mosaic Virus (ToMV) resistance gene. Our results show that full resistance to ToBRFV disease requires an additional undescribed locus. These results show the potential of \u003cem\u003eS. pennellii \u003c/em\u003eas a novel source of resistance against ToBRFV.\u003c/p\u003e","manuscriptTitle":"Tm-1 back in business: an allele from Solanum pennellii accessions plays a major role in ToBRFV resistance.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-02 11:39:33","doi":"10.21203/rs.3.rs-6221483/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-03-25T09:53:07+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-03-25T09:49:55+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-03-14T05:56:35+00:00","index":"","fulltext":""},{"type":"submitted","content":"Theoretical and Applied Genetics","date":"2025-03-13T11:38:38+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"theoretical-and-applied-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"taag","sideBox":"Learn more about [Theoretical and Applied Genetics](https://www.springer.com/journal/122)","snPcode":"122","submissionUrl":"https://submission.nature.com/new-submission/122/3","title":"Theoretical and Applied Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"1f20e7af-0552-497b-bc72-96e2a46b09bd","owner":[],"postedDate":"April 2nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-09-22T06:51:26+00:00","versionOfRecord":{"articleIdentity":"rs-6221483","link":"https://doi.org/10.1007/s00122-025-05036-1","journal":{"identity":"theoretical-and-applied-genetics","isVorOnly":false,"title":"Theoretical and Applied Genetics"},"publishedOn":"2025-09-12 15:57:31","publishedOnDateReadable":"September 12th, 2025"},"versionCreatedAt":"2025-04-02 11:39:33","video":"","vorDoi":"10.1007/s00122-025-05036-1","vorDoiUrl":"https://doi.org/10.1007/s00122-025-05036-1","workflowStages":[]},"version":"v1","identity":"rs-6221483","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6221483","identity":"rs-6221483","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00