Microbes suppress genetic disorders of hyper-activated Ras by inhibiting iron-mediated growth factor modulation in C. elegans

Microbes suppress genetic disorders of hyper-activated Ras by inhibiting iron-mediated growth factor modulation in C. elegans | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Microbes suppress genetic disorders of hyper-activated Ras by inhibiting iron-mediated growth factor modulation in C. elegans Minghui Du , Yangyang Wu , Guanqun Li , Hongyun Tang doi: https://doi.org/10.1101/2025.09.30.679430 Minghui Du 1 College of Life Sciences, Zhejiang University , Hangzhou, 310058, China 2 Westlake Laboratory of Life Sciences and Biomedicine , Hangzhou 310024, China 3 Key Laboratory of Growth Regulation and Translational Research of Zhejiang Province, School of Life Sciences, Westlake University , Hangzhou 310024, China 4 Institute of Biology, Westlake Institute for Advanced Study , Hangzhou 310024, Zhejiang, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yangyang Wu 1 College of Life Sciences, Zhejiang University , Hangzhou, 310058, China 2 Westlake Laboratory of Life Sciences and Biomedicine , Hangzhou 310024, China 3 Key Laboratory of Growth Regulation and Translational Research of Zhejiang Province, School of Life Sciences, Westlake University , Hangzhou 310024, China 4 Institute of Biology, Westlake Institute for Advanced Study , Hangzhou 310024, Zhejiang, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Guanqun Li 2 Westlake Laboratory of Life Sciences and Biomedicine , Hangzhou 310024, China 3 Key Laboratory of Growth Regulation and Translational Research of Zhejiang Province, School of Life Sciences, Westlake University , Hangzhou 310024, China 4 Institute of Biology, Westlake Institute for Advanced Study , Hangzhou 310024, Zhejiang, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Hongyun Tang 1 College of Life Sciences, Zhejiang University , Hangzhou, 310058, China 2 Westlake Laboratory of Life Sciences and Biomedicine , Hangzhou 310024, China 3 Key Laboratory of Growth Regulation and Translational Research of Zhejiang Province, School of Life Sciences, Westlake University , Hangzhou 310024, China 4 Institute of Biology, Westlake Institute for Advanced Study , Hangzhou 310024, Zhejiang, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: tanghongyun{at}westlake.edu.cn Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Gut bacteria play crucial roles in promoting host health, but their ability to suppress the effects of genetic defects remains unclear. Ras(gain-of-function, gf) mutations are involved in various developmental disorders, thus identifying bacterial-activity changes capable of repressing the effects of hyper-activated Ras is important. Here, we screened mutations of all non-essential E. coli genes and identified 151 E. coli mutants that mitigate let-60/Ras(gf)- induced vulval developmental abnormalities in C. elegans . Interestingly, bacteria with mutations in genes involved in iron acquisition suppress host Ras(gf) -induced vulval defects through elevating 2,3-dihydroxybenzoic acid, a bacterial siderophore that sequesters iron. Consequently, host mitochondrial iron availability is decreased, which prompts the nuclear accumulation of the chromatin modifier LIN-65 and then downregulates lin-3/EGF transcription to repress Ras(gf) -induced vulval defects. Our findings identify a mechanism for coordinating Ras growth signaling with iron availability, through which gut bacteria suppress host Ras(gf) -induced defects and exemplify the potential of modifying gut bacterial activity to improve genetic diseases. Introduction Throughout an animal’s life, the activity of gut bacteria changes, as do the composition and structure of the microbial community, all of which can impact the host’s physiology. Emerging evidence highlights the crucial roles of gut microbes in promoting animal health; the effects of these microbes range from the prevention of metabolic disorders such as diabetes to protection against infections [ 1 – 5 ]. The diversity of the gut microbiota represents an intriguing avenue for exploring potential therapies for various disorders. However, it remains unclear whether these microorganisms can override the effects of genetic mutations to suppress host developmental defects. Identifying microbes capable of suppressing the genetic mutation-caused developmental abnormalities holds potential for the treatment of genetic diseases. One particularly impactful type of gene mutation is RAS hyperactivation, known as RAS gain-of-function (gf) mutations. Germline RAS(gf) mutations are known to cause severe developmental disorders like Costello syndrome affecting multiple organs, while somatic RAS(gf) mutations are present in approximately 30% of all human cancers [ 6 , 7 ]. Therefore, developing effective strategies to inhibit RAS signaling is crucial. Identifying microbes that can suppress the phenotype of RAS(gf) mutations could provide a new perspective for developing approaches to target RAS signaling and serve as a ‘proof of concept’ for using microbes to alleviate genetic diseases. The RAS signaling pathway is a critical therapeutic target due to its involvement in various disorders [ 6 , 8 , 9 ], thus comprehensive understanding the regulation of Ras is important. In particular, it has long been speculated that RAS signaling activity may be coordinated with nutrient levels to support the role of RAS signaling in promoting cell proliferation and differentiation [ 6 ]. However, how nutrient levels are transduced into Ras signaling activity remains underexplored. For example, while iron is a crucial nutrient for cell viability, it is not yet known whether RAS signaling activity is coordinated with iron levels, and the mechanism by which the host perceives and translates iron levels to affect RAS signaling remains unclear. Gut microbes have a significant impact on host nutrient levels [ 10 – 13 ]; thus, exploring the potential roles of these microorganisms in shaping RAS signaling offers an exciting perspective to address the molecular basis underlying the transduction of nutrient levels into Ras signaling and their implications for animal health. C. elegans has emerged as an exceptional system for studying the interactions between hosts and microbes due to its well-established genetics and the ease with which it can be rendered germ-free [ 14 , 15 ]. Moreover, C. elegans is an excellent model for studying the regulation of Ras signaling, and previous studies on the developmental role of let-60 /Ras in vulval precursor cell (VPC) specification have led to the discovery of highly conserved components and mechanisms of Ras signaling [ 16 ]. Specifically, the RTK-Ras-ERK pathway responds to extracellular LIN-3/EGF signals to determine whether VPCs, including six polarized epithelial cells designated P3.p to P8.p, undergo vulval or epidermal differentiation [ 17 ]. In wild-type worms, only three VPCs (P5.p, P6.p, and P7.p) are induced and form a single invagination, eventually developing into a normal vulva; however, gain-of-function (gf) mutations in let-60/RAS , such as the let-60(n1046, G13E) that mimics a Ras codon 13 mutations and often occurs in human cancers [ 8 , 18 ], induce more than three VPCs, leading to the development of multiple invaginations and eventually the formation of the multiple vulva (Muv) [ 18 , 19 ]. The strong conservation of LET-60/Ras signaling in C. elegans suggests that elucidating how bacteria regulate Ras in this organism could reveal previously unknown mechanisms of Ras signaling modulation and provide insights into the use of bacteria to suppress RAS (gf) -related disorders in mammals. In this study, we aimed to uncover alterations in bacterial activities capable of repressing host hyperactivated Ras signaling. Given that inactivating bacterial genes can alter bacterial activity, the Keio library contains 3985, the all nonessential single-gene deletions in E. coli which represents a vast collection of bacteria with diverse types of activity changes [ 20 ]. Therefore, we employed the Keio library to identify bacterial mutants that can suppress the Muv phenotype caused by let-60(gf) in C. elegans . We identified 151 E. coli mutants that suppressed the Muv phenotype in let-60(gf) worms. These bacterial mutants included those with mutations in genes involved in various biological processes, including bacterial iron absorption. Mechanistically, microbial mutants lacking genes associated with iron absorption could enhance the production of a specific type of siderophore and then reduce the availability of mitochondrial ferrous iron in the host. The epigenetic factor Lin-65 can respond to this mitochondrial iron reduction by translocating into the nucleus, which downregulates lin-3/EGF expression and then inhibits Ras signaling. Therefore, our study identifies the mechanism underlying the coordination between iron levels and RAS growth signaling. Importantly, our findings provide a comprehensive understanding of suppressing the phenotype of hyperactivated Ras mutants by modulating bacterial activity, shedding light on the potential use of microbes in managing RAS(gf) -related disorders. Results A genome-wide screen identifies E. coli genes, whose inactivation suppresses the Muv phenotype in host C. elegans with a hyperactive let-60/RAS mutation Overactivated Ras signaling results in Muv phenotype, displaying two or more ventral protrusions in each adult hermaphrodite worm [ 21 ]. To systematically investigate whether modulating bacterial activity could suppress the effects of genetic defects caused by Ras(gf) , we conducted a genome-wide screen using the Keio library to identify E. coli genes whose inactivation could suppress the Muv phenotype in let-60(n1046, gf) worms ( Figure 1A ). When administered the Keio library parental wild-type E. coli strain (BW25113) or OP50 E. coli , which is commonly used in the laboratory to feed C. elegans , approximately 90% of the let-60(n1046) animals displayed the Muv phenotype ( Figure S1A ), consistent with previously reported findings [ 18 , 22 ]. In contrast, the wild-type N2 control worms displayed a smooth ventral surface and did not exhibit the Muv phenotype ( Figure S1A ). Remarkably, our screen revealed a total of 151 E. coli gene deletions that significantly suppressed the Muv phenotype in let-60(n1046) worms ( Figure 1B and Table 1 ). Download figure Open in new tab Figure 1. Bacterial activity changes, including the inactivation of E. coli iron-acquisition genes, suppressed the Muv phenotype in let-60(n1046) worms. (A) Schematic depiction of the process used to screen for bacteria that suppress the Muv phenotype in let-60(n1046) worms. The E. coli Keio Collection, consisting of 3985 single-gene knockouts, was used, and the percentage of worms with the Muv phenotype was scored on day 1 adulthood. (B) A total of 151 E. coli mutants, including those carrying mutations in the fiu , fepC , and fepG genes, which are involved in iron-siderophore uptake, reduced let-60(n1046) -induced Muv to different degrees. BW25113, the parental strain of the E. coli mutants, served as the control. Each dot represents the Muv rate in day-1 adult let-60(n1046) worms treated with the specified E. coli mutants, detailed in Table 1 . The screening was conducted independently three times. (C) Diagram showing the Fe-siderophore uptake process in E. coli and the proteins that are involved. (D) Bar graph showing that bacterial mutations in other Fe-siderophore transport genes including fepB , fepD and fes suppress let-60(n1046) -induced Muv. The data are presented as the mean ± SEM. p < 0.0001 by one-way ANOVA. (E-F) Representative images and bar graph showing the repression of invagination formation by Δfiu bacteria treatment. (E) The arTi85 [lin-31p::ERK::KTR::mClover::T2A::mCherry::his-11::unc-54 3’UTR + rps-27p::NeoR::unc-54 3’UTR] reporter was used for evaluating the number of invagination, as indicated by the red line. (F) Bar graph shows the percentage of worms with the indicated number of invaginations represented using color blocking. (G) Bar graph showing that the let-60(n1046)- induced VPCs were suppressed by the Δfiu E. coli . The worms treated with the BW25113 parental strain were used as the control. The data are presented as the means ± SEM. p < 0.0001 was calculated by one-way ANOVA. View this table: View inline View popup Table 1 151 mutant E. coli were identified from the screen for the ability of 3,985 E. coli non-essential gene mutants to suppress the Muv phenotype of let-60(n1046) worms. To gain insight into the functions of the bacterial genes identified in the screen, we performed Gene Ontology analyses. The E. coli genes, deleted in the bacterial clones capable of suppressing the Muv phenotype, were enriched in various processes, including electron transport, DNA repair, and iron homeostasis ( Figure S1B and S1C ). The screen results indicate that inactivating a variety of bacterial processes can suppress the Muv phenotype caused by hyperactivated Ras in the host C. elegans , thus providing an indication of the specific bacterial activities that can be targeted to mitigate the effects of Ras hyperactivation in the host animal. Inactivating the bacterial iron acquisition process renders the ability of bacteria to suppress let-60(gf) -induced Muv in the host To decipher how changes in bacterial activity suppress Ras(gf)-induced Muv, we focus on understanding how inhibition of bacterial iron acquisition genes, such as fiu , fepC , and fepG ( Figure 1B and 1C ), affects host Ras signaling, given the evident enrichment of these genes in our screen. E. coli secretes siderophores, such as the catecholate dihydroxybenzoylserine (DBS), which form complexes with ferrous iron that are transported into the periplasm by Fiu [ 23 ]. Then, these complexes are imported into the cytoplasm through an ABC transporter [ 24 , 25 ]. Once in the cytoplasm, Fes hydrolyzes ferric-DBS, releasing iron for bacterial utilization ( Figure 1C ). To further investigate the effect of this iron-siderophore transport process on host Ras signaling, we tested mutations in all bacterial genes in this iron acquisition process. Strikingly, we found that inactivating the other three genes involved in the Fe-DBS transport process could also significantly suppress Muv in let-60(n1046) worms ( Figure 1D ). Given its strong Muv-suppression effect, the E. coli with a fiu gene deletion (Δ fiu ) was used to further investigate the mechanism by which inhibiting the E. coli Fe-DBS transportation process suppresses let-60(gf) -induced Muv in the C. elegans host. Ras signaling determines which VPCs adopt a vulval fate at the L2-L3 stage, after which these cells undergo cell division and morphogenesis, including invagination, to form the vulva; thus, we assessed the induction of VPCs to a vulval fate and the number of invaginations to further evaluate the influence of these bacterial mutations on host Ras signaling. The arTi85 transgene that expressed a mCherry::HIS-11 specifically in the VPCs was employed to visualize invagination [ 17 ]. We found that when arTi85 worms were treated with wild-type BW25113 bacteria, one invagination ( Figure 1E and 1F ) and three induced VPCs were observed ( Figure 1G ), consistent with previous observations in N2 wild-type worms [ 26 ]. However, when let-60(n1046);arTi85 worms were treated with BW25113 bacteria, more than 90% of exhibited more than one invagination ( Figure 1E and 1F ), and the average number of VPCs that adopted a vulval fate (induced VPCs) per worm was nearly five ( Figure 1G ). Strikingly, upon treatment with the Δ fiu mutant bacteria, the number of let-60(n1046);arTi85 worms with more than one invagination decreased to less than 10% ( Figure 1E and 1F ), and the number of induced VPCs decreased to approximately three ( Figure 1G ). Notably, the Δfiu strain repressed only the pseudovulvas and not the normal vulva ( Figure 1E-G ). Together, these results indicate that the Δfiu E. coli can repress the let-60(n1046) -mediated induction of extra VPCs to a vulval fate. Next, we investigated whether treatment with the Δ fiu E. coli could downregulate Ras signaling pathway activity in the let-60(n1046) worm host, by examining the activity of MPK-1/ERK that acts downstream of Ras [ 27 ]. MPK-1 activity in the VPCs was assessed using a previously established kinase translocation reporter, the ERK-nKTR sensor expressing arTi85[lin-31p::ERK-KTR-mClover::T2A::mCherry-H2B] , by calculating the nuclear Red/Green Ratio [ 17 ]. When MPK-1 kinase is inactive, the KTR remains unphosphorylated and predominantly nuclear; upon activation of the MPK-1 kinase, phosphorylation of the KTR leads to its cytoplasmic translocation, thus the nuclear Red/Green Ratio positively relates to the activity of MPK-1. The nuclear Red/Green ratio in every single VPC was scored at the L2-L3 stage when the VPCs vulva cell fate is induced. We found that Δ fiu E. coli treatment is able to suppress the ERK activity in the VPCs of let-60(n1046) worms, compared to the BW25113 treatment ( Figure S1D ). These results support that the Δ fiu bacteria treatment decreases Ras signaling pathway activity to block the extra vulva fate induction and to suppress Muv. Moreover, we observed that Δfiu E. coli also suppressed the Muv phenotype induced by two other Ras gain-of-function alleles, let-60(n1700) ( Figure S1E ) and let-60(ga89) ( Figure S1F ). These results together indicate that the Muv-suppressive effect of the Δfiu E. coli strain is not allele specific, thus further supporting the contention that the Δfiu E. coli strain inhibits the Ras signaling pathway. In summary, inactivating bacterial genes involved in siderophore-iron import suppresses the developmental abnormalities caused by hyperactivated Ras signaling. Δ fiu E. coli promotes 2,3-DHBA siderophore production to reduce host iron availability, thereby suppressing Muv induced by the hyperactivated Ras Next, we aimed to investigate the mechanism through which the Δfiu E. coli strain suppressed the let-60(n1046) -induced Muv phenotype. As the siderophore transportation is the main process for bacteria iron acquisition [ 25 ], we postulated that inactivating the Fe-(DBS) n transport process in bacteria may boost the production of siderophore for reestablishing bacteria’s ability to acquire iron, which may thus lead to reduced Ras signaling in the host. Indeed, we found that compared with BW25113, Δ fiu bacteria secreted more 2,3-DHBA, a DBS siderophore, as evidenced by its higher abundance in the Δ fiu bacteria culture medium ( Figure 2A ). Importantly, we revealed that supplementation with 2,3-DHBA is able to dramatically repress Ras(gf)- induced Muv, evidenced by the Muv phenotype in let-60(n1046) worms grown on BW25133 strain reduced from approximately 90% to 10% ( Figure 2B ). These results support the role of increased production of 2,3-DHBA by Δ fiu bacteria in suppressing Ras(gf) -induced Muv. Download figure Open in new tab Figure 2. Δ fiu E. coli generates increased 2,3-DHBA siderophore to reduce iron availability, thereby suppressing let-60(n1046) -induced Muv. (A) A bar graph showing the percentage of 2,3-DHBA secreted by Δ fiu E. coli relative to that produced by BW25113. The 2,3-DHBA in the bacterial supernatant was quantified using mass spectrometry. The data are presented as the mean ± SEM by unpaired t test. (B) A bar graph illustrating the potent suppressive effect of 2,3-DHBA on the Muv rate in let-60(n1046) mutants. Worms were treated with either 18 mg/mL 2,3-DHBA or solvent, and Muv phenotypes were assessed at the adult day 1 stage. Data are presented as the mean ± SEM, determined by an unpaired t-test. (C-D) Representative images and a bar graph illustrate the decrease in ferrous iron, stained with FerroOrange, in let-60(n1046) worms treated with 2,3-DHBA. Worms treated with DMSO or 18 mg/mL 2,3-DHBA were assessed at the 1-day adult stage. Data are presented as the mean ± SEM, analyzed by unpaired t-test. (E-F) Images and bar graphs illustrating the decrease of ferrous iron, stained with FerroOrange, in the let-60(n1046) worms treated with Δ fiu E. coli . Intensity of FerroOrange was analyzed in the worms treated with BW25113 or Δ fiu bacteria at the day-1 adult stage. The data are presented as the means ± SEM by unpaired t test. (G) Bar graphs illustrating that iron supplementation reverses the suppressive effect of Δ fiu bacteria on let-60(n1046) -induced Muv. The Muv rate in let-60(n1046) worms treated with Δ fiu or control BW25113 strains, with or without 4 mM FeCl 3 supplementation, was analyzed. Data are presented as means ± SEM and analyzed by one-way ANOVA. (H-I) Representative images and corresponding bar graphs illustrate the reduction in ferrous iron, stained with FerroOrange, in worms treated with the iron chelator reagent 2-BP. The intensity of FerroOrgane in let-60(n1046) worms, treated with either 2-BP or solvent, were analyzed at day-1 adult stage. Data are presented as the mean ± SEM by unpaired t test. (J) A bar graph showing the decrease in Muv rate in let-60(n1046) worms treated with 2-BP. The Muv rate of let-60(n1046) worms, treated with either 2-BP or solvent, was analyzed at the day-1 adult stage. Data are presented as the mean ± SEM by unpaired t test. (K-L) Images and bar graphs showing that ferrous iron, stained with FerroOrange, is decreased in the let-60(n1046) worms under smf-3(lf);smf-1(RNAi) . The intensity of FerroOrange in smf-3(lf);let-60(n1046) worms treated with smf-1 (RNAi), smf-2(RNAi) or pl4440 RNAi control was analyzed at the day-1 adult stage. The data are presented as the mean ± SEM by one-way ANOVA. (M) Bar graphs showing that smf-3(lf);smf-1(RNAi) partially suppresses the let-60(n1046)- induced Muv rate. The Muv rate in smf-3(lf);let-60(n1046) worms treated with smf-1 (RNAi), smf-2(RNAi) or pl4440 RNAi control was analyzed at the day-1 adult stage. The data are presented as the mean ± SEM by one-way ANOVA. Then, we tested whether increased generation of 2,3-DHBA from Δ fiu bacteria may reduce host iron availability to downregulate Ras signaling, given that siderophore sequesters iron [ 28 ]. Firstly, we evaluated the labile ferrous iron levels using the dye FerroOrange, which reacts with free ferrous iron to produce a fluorescent signal [ 29 ], and found that the intracellular iron availability in let-60(n1046) worms treated with the BW25113 bacteria supplemented with 2,3-DHBA ( Figure 2C and 2D ) or treated with Δfiu mutant E. coli ( Figure 2E and 2F ) were obviously decreased, as indicated by the reduced FerroOrange fluorescence intensity following treatment with 2,3-DHBA or Δfiu mutant E. coli . Subsequently, we tested the potential reversal of Δfiu-mediated Muv suppression by restoring iron levels in the let-60(n1046) worms. During iron absorption, ferric ions undergo reduction and are imported for utilization, so we used FeCl 3 for iron supplementation [ 30 ]. After FeCl 3 supplementation, the Muv percentage increased from approximately 10% to approximately 90%, indicating that restoring iron completely reverses the Δfiu E. coli -mediated Muv suppression ( Figure 2G ). Therefore, Δfiu E. coli suppresses let-60(n1046) -induced Muv through downregulating host iron availability. Furthermore, we found that treatment with iron-chelator 2,2-bipyridyl (2-BP), that sequesters iron in the let-60(n1046) worms ( Figure 2H and 2I ), can also suppress let-60(n1046) -induced Muv. The percentage of let-60 (n1046) worms with Muv decreased from 90% to 12% following 2-BP-mediated iron chelation ( Figure 2J ). This result further demonstrates that the suppressive effect of Δfiu E. coli on let-60(gf) -induced Muv is mediated by a reduction in labile iron. Notably, 2-BP treatment decreased FerroOrange fluorescence intensity ( Figure 2H and 2I ), confirming that FerroOrange can indicates free ferrous iron levels in worms. Moreover, FeCl 3 supplementation also reverses the Muv suppression mediated by treatment with other bacterial mutants lacking Fe-(DBS) n transportation-related genes ( Figure S2A ). Taken together, these results demonstrate that inactivation of bacterial Fe-(DBS) n transport decreases available iron levels in the host, which leads to the suppression of Ras(gf) -induced Muv. To confirm the role of host iron insufficiency in the inhibition of Ras(gf)-induced Muv, we experimentally decreased the ability of the worms to absorb iron and then assessed any potential suppression of Muv in let-60(gf) worms. smf-1/-2/-3 encode iron transport proteins responsible for iron absorption in C. elegans [ 30 ]. smf-3 deletion ( smf-3(lf) ) ( Figure S2B ) or RNAi against the smf-1 or smf-2 genes ( Figure S2C ) did not reduce iron absorption, as indicated by unchanged FerroOrange fluorescence intensity in the worms; accordingly, let-60(gf) -induced Muv was not suppressed by these treatments ( Figure S2D and S2E ), which suggests functional redundancy in iron transport among these genes. We next performed RNAi against smf-1 or smf-2 in the smf-3(lf) background to overcome this redundancy. Strikingly, we found that smf-1 RNAi, but not smf-2 RNAi, decreased labile iron levels in smf-3(lf);let-60(n1046) worms ( Figure 2K and 2L ). Consistent with the role of decreased labile iron in suppressing let-60(n1046) -induced Muv, partial suppression of Muv was observed in smf-3(lf);let-60(n1046) worms treated with smf-1 RNAi but not in those treated with smf-2 RNAi ( Figure 2M ). Taken together, the findings indicate that Δ fiu bacteria produces increased levels of 2,3-DHBA that reduce iron availability in C. elegans, thereby suppressing the hyperactivated Ras-induced Muv phenotype. Moreover, to assess whether this effect was restricted to E. coli , we examined whether Bacillus subtilis , another naturally existed gut bacterium capable of scavenging inorganic iron from the environment [ 31 ], could also suppress the let-60(gf) -induced Muv phenotype through decreasing the available iron levels. Compared to the OP50 E. coli control, treatment with B. subtilis markedly suppressed Muv in adult let-60(gf) worms ( Figure S2F ). Importantly, this suppression was completely reversed by iron supplementation ( Figure S2F ). Thus, both E. coli gene mutant strains and B. subtilis can suppress the effects of hyperactivated Ras by decreasing the amount of labile iron in the host. Decreased labile ferrous iron in the mitochondria accounts for the Δ fiu E. coli -mediated suppression of let-60(gf) -induced Muv Given that mitochondria are major organelles that consume iron for various vital biological processes [ 32 ], we investigated whether iron decline in the mitochondria may be responsible for the suppression of let-60(n1046) -induced Muv by Δ fiu E. coli . Thus, we investigated whether Δ fiu E. coli reduces available iron levels in host mitochondria using Mito-FerroGreen, which specifically detects labile ferrous iron in mitochondria [ 33 ]. First, we validated the specificity of Mito-FerroGreen for labeling mitochondrial ferrous ions in worms by confirming the colocalization of Mito-FerroGreen staining with MitoTracker Deep Red, a mitochondria-specific dye ( Figure S3A ). Furthermore, we observed that the Mito-FerroGreen fluorescence intensity was lower in let-60(n1046) worms treated with Δfiu than in those treated with BW25113 and that this effect was reversed through iron supplementation ( Figure 3A and 3B ). This result, combined with our data showing that iron supplementation can counteract the ability of Δfiu to suppress Muv in let-60(gf) worms ( Figure 2G ), supports the notion that mitochondrial iron decrease is involved in the Δfiu-mediated suppression of let-60(n1046) -induced Muv. Moreover, we also observed a reduction in mitochondrial iron levels upon supplementation with the iron chelator 2-BP ( Figure 3C and 3D ), consistent with the role of 2-BP in suppressing let-60(n1046) -induced Muv ( Figure 2J ). Taken together, these results indicate that the presence of Δfiu E. coli leads to a reduction in the amount of available iron in mitochondria in C. elegans . Download figure Open in new tab Figure 3. Δ fiu E. coli causes decreased mitochondrial iron availability, which suppresses Muv in let-60(n1046) worms. ( A-B ) Images and bar graphs demonstrate that mitochondrial ferrous iron, stained with Mito-FerroGreen, is reduced in let-60(n1046) worms treated with Δ fiu mutant bacteria, which is reversed by iron supplementation. The fluorescence intensity of Mito-FerroGreen in worms treated with the specified bacteria, with or without FeCl 3 supplementation, was analyzed at the adult day-1 stage. The data are presented as the mean ± SEM by one-way ANOVA. (C-D) Images and bar graphs indicating that 2-BP treatment causes the decrease in mitochondrial ferrous iron, stained with Mito-FerroGreen, in let-60(n1046) worms. The intensity of Mito-FerroGreen is evaluated in the let-60(n1046) worms with 2-BP treatment at the day-1 adult stage. The data are presented as the mean ± SEM by unpaired t test. (E-F) Images and bar graphs showing that the levels of mitochondrial ferrous iron, stained with Mito-FerroGreen, are decreased in let-60(n1046);smf-3(ok1035) with mfn-1(RNAi) treatment. The fluorescence intensity of Mito-FerroGreen is evaluated in the let-60(n1046);smf-3(ok1035) worms with indicated RNAi treatment at the day-1 adult stage. The data are presented as the mean ± SEM by unpaired t test. (G) Bar graphs showing that the Muv rate is decreased in let-60(n1046);smf-3(ok1035) after mfn-1(RNAi) treatment. The Muv rate was evaluated in the let-60(n1046);smf-3(ok1035) worms with indicated RNAi treatment at the day-1 adult stage. The data are presented as the mean ± SEM by unpaired t test. Next, we inhibited iron import into mitochondria to test the potential role of mitochondrial iron insufficiency in suppressing Ras(gf) -induced Muv. MFN-1 was previously implicated in mitochondrial iron import [ 34 ]; however, we observed no reduction labile iron levels in the mitochondria of worms following mfn-1 (RNAi) treatment ( Figure S3B and S3C ). This result is consistent with the observation that let-60(gf) -induced Muv was not suppressed following mfn-1(RNAi) treatment ( Figure S3D ). Then, we attempted to decrease mitochondrial iron levels by performing mfn-1 (RNAi) in the smf-3 (ok1035) background, which slightly compromises worms’ ability to absorb extracellular iron. Interestingly, compared with the mfn-1(RNAi) control worms and smf-3(ok1035) control animals, the mfn-1(RNAi);smf-3(ok1035) group exhibited a noticeable reduction in labile iron within the mitochondria ( Figure 3E and 3F , Figure S3B and S3C ). Strikingly, compared to the control, mfn-1(RNAi);smf-3(ok1035) strongly repressed the let-60(n1046) -induced Muv phenotype, with the Muv rate decreasing in these worms from 90% to approximately 24% ( Figure 3G ). Taken together, these findings indicate that the presence of the Δfiu E. coli leads to a reduction in the available iron in mitochondria, which is responsible for the suppression of let-60(gf)- induced Muv. LIN-65, a mitochondrial stress response mediator, responds to Δ fiu E. coli- induced decrease in labile ferrous iron, which partially suppresses let-60(gf) -induced Muv Given that Δ fiu E. coli affects host mitochondrial iron homeostasis, which is crucial for maintaining normal mitochondrial function, we next tested whether a mitochondrial stress response may be triggered by Δ fiu E. coli , potentially leading to the suppression of let-60(gf)- induced Muv. We first examined whether a host mitochondrial stress response was induced in let-60(n1046) worms treated with Δfiu E. coli by evaluating the expression of hsp-6p::GFP , which has been previously shown to be activated during mitochondrial stress [ 35 ], and assessing its responsiveness to changes in iron levels. Indeed, treatment with Δfiu E. coli induced hsp-6p::GFP expression, and this activation could be reversed by iron supplementation ( Figure S4A and S4B ). Additionally, treatment with the iron chelator 2-BP also mimicked the impact of Δfiu E. coli on activating hsp-6p::GFP expression ( Figure S4C and S4D ). These findings indicated that the Δfiu-induced reduction in available iron activated the mitochondrial stress response. Next, we explored whether activation of the mitochondria response mediated the suppression of the let-60(gf) -induced Muv phenotype by the Δ fiu strain. Initially, we investigated the potential involvement of ATFS-1, a master regulator required for activating the mitochondrial unfolded protein response (UPR mito ) [ 35 ]. We found that an atfs-1(et15, gf) mutation, that activated the UPR mito [ 36 ], was unable to suppress the let-60(n1046) -induced Muv phenotype ( Figure S4E ). Conversely, an atfs-1(gk3094, lf) mutation, that repressed the UPR mito [ 37 ], did not reverse the suppressive effect of the Δ fiu E. coli on the let-60(n1046) -induced Muv ( Figure S4F ). Thus, ATFS-1 unlikely involves in the suppression of let-60(n1046) -induced Muv phenotype by Δ fiu E. coli . Then, we investigated the potential involvement of lin-65 , which encodes a nuclear cofactor and responds to mitochondrial stress independent of atfs-1 [ 38 ]. We found that the percentage of Δfiu E. coli -treated let-60(n1046) worms with Muv increased from approximately 12% to 60% in the presence of the lin-65(lf) mutation ( Figure 4A ), indicating that loss of lin-65 function partially reversed the suppressive effect of Δfiu bacteria on the let-60(n1046) -induced Muv phenotype. Similarly, the suppressive effect of 2-BP on let-60(n1046) -induced Muv was largely reversed by lin-65(lf) ( Figure 4A ). These results support that LIN-65 activation mediates the suppressive impact of Δfiu bacteria and iron decrease on let-60(gf) -induced Muv. Download figure Open in new tab Figure 4 LIN-65 exhibits increased nuclear localization in response to bacteria-induced iron deficiency, partially mediating the suppressive effect of Δ fiu E. coli on the Muv phenotype of let-60(n1046) worms. (A) Bar graphs illustrating that the suppressive effect of Δ fiu bacteria and 2-BP on let-60(n1046) -induced Muv partially relies on lin-65 . The Muv rate in let-60(n1046) and let-60(n1046);lin-65(n3441) worms, with specified treatments, was analyzed at the day-1 adult stage. The data are presented as the mean ± SEM by one-way ANOVA. (B) Bar graphs indicate the Muv rate of let-60(n1046);lin-65(n3441) worms carrying the specified extra-chromosomal array transgenes and treated with the designated bacteria and 2-BP. The promoters rpl-28p , nhx-2p , and lin-31p were used to express lin-65 cDNA in ubiquitous tissues, the intestine, and VPCs, respectively. The data are presented as the mean ± SEM by one-way ANOVA. (C-D) Representative images and bar graphs demonstrate the increase in LIN-65::mCherry fluorescence in the intestinal nuclei of worms treated with Δ fiu E. coli , an effect reversed by iron supplementation. The mCherry signal was analyzed in let-60(n1046);Is[lin-65p::LIN-65::mCherry] worms exposed to the indicated bacteria, with or without FeCl 3 supplementation. The percentage is determined by normalized to the worms treated with both BW25113 control bacteria and solvent. The dotted line delineating the intestine. The data are presented as the mean ± SEM by one-way ANOVA. (E-F) Representative images and bar graphs showing that iron chelator 2-BP treatment increases the nuclear localization of LIN-65::mCherry. The mCherry signal was analyzed in let-60(n1046);Is[lin-65p::LIN-65::mCherry] worms subjected to the indicated treatments. The dotted line depicts the intestine. The data are presented as the mean ± SEM by one-way ANOVA. To determine the tissue in which LIN-65 expression mediates Muv suppression, transgenes expressing lin-65 in different tissues were constructed. When LIN-65 was expressed via the ubiquitous rpl-28 promoter in let-60(n1046);lin-65(lf) worms, the percentage of worms with the Muv phenotype decreased from approximately 56% to below 20% upon Δfiu and 2-BP treatment ( Figure 4B and S4G). This decrease was almost equal to that observed in let-60(gf) worms treated with Δfiu or 2-BP ( Figure 4B and S4G). This result further demonstrated that the effects of Δfiu bacteria and iron insufficiency in suppressing let-60(gf) -induced Muv are mediated by LIN-65. We then constructed transgenes to specifically express LIN-65 in the intestine and VPCs in let-60(gf);lin-65(lf) worms via the nhx-2p and lin-31p promoters, respectively. Transgenes expressing lin-65 in either the intestine or VPCs partially inhibited the ability of lin-65(lf) to reverse the Δfiu and 2-BP-mediated suppression of let-60(gf) -induced Muv ( Figure 4B and S4G). The stronger reversal effect observed following ubiquitous lin-65 expression than observed following tissue-specific expression suggests that lin-65 functions in multiple tissues to suppress Ras signaling in VPCs. We further investigated whether LIN-65 responds to the presence of Δfiu E. coli and to 2-BP-mediated iron reduction. To detect the subcellular localization of LIN-65, a previously established transgene, Is[lin-65p::LIN-65::mCherry] [ 38 ], was used. We found that LIN-65 was expressed in the intestine ( Figure 4C and 4E ). Interestingly, compared to treatment with the control bacteria BW25113 or the solvent control, treatment with Δfiu bacteria or 2-BP increased LIN-65::mCherry levels in the intestinal nuclei of let-60 (n1046) worms ( Figure 4C - 4F ). Importantly, this increase of LIN-65 in the intestinal nuclei was reversed by iron supplementation ( Figure 4C - 4D ). Thus, LIN-65 responds to reductions in available iron, including those induced by bacteria. Notably, LIN-65 was also known as a synMuv B gene required for normal vulval development [ 39 ], further supporting the role of LIN-65 activation in suppressing Ras signaling. In summary, our findings indicate that the LIN-65 crucially mediates the role of Δfiu bacteria-mediated decrease in available iron levels in the suppression of Ras(gf) -induced Muv. In response to presence of Δ fiu E. coli , LIN-65 represses lin-3/EGF transcription to decrease let-60(n1046) -induced Muv Next, we aimed to understand how lin-65 represses Ras(gf) -induced Muv. Interestingly, previous studies have found that the upstream EGF receptor is necessary for certain Ras(gf) mutations to activate downstream signaling cascades [ 40 , 41 ]. Our data, shown above, indicate that intestinal LIN-65 can counteract Ras signaling in VPCs ( Figure 4B and S4G), suggesting the potential involvement of a cell non-autonomous regulation by the ligand LIN-3/EGF. Therefore, we postulated that a decrease in LIN-3 may mediate LIN-65-mediated suppression of Ras(gf) signaling in VPCs. To test this, we examined the potential of lin-3 repression in suppressing Muv induced by downstream hyperactivated Ras by performing lin-3 (RNAi) in let-60(gf) worms, as loss-of-function mutations in lin-3 cause severe defects. Indeed, downregulating lin-3 by RNAi knockdown resulted in partial suppression of the let-60(n1046) -induced Muv phenotype, as indicated by a decrease in the Muv percentage from 90% to 68% ( Figure 5A ). This ligand-dependent effect of Ras(gf) aligns with previous studies showing that the activity of certain Ras(gf) mutations is at least partially dependent on the upstream EGFR activity [ 40 , 41 ]. Download figure Open in new tab Figure 5 The decrease in lin-3 transcription partially mediates LIN-65’s role in mediating the impact of Δ fiu E. coli on mitigating the let-60(n1046) -induced Muv phenotype. (A) A bar graph showing that lin-3(RNAi) partially inhibits the let-60(n1046) -induced Muv phenotype compared to the RNAi control group. The Muv rate is analyzed in worms subjected to the indicated treatments at the day-1 adult stage. The data are presented as the mean ± SEM by unpaired t test. (B) Bar graphs illustrating the decrease in lin-3 mRNA in let-60(n1046) worms treated with Δ fiu E. coli compared to the BW25113 control group. qPCR analyses of lin-3 mRNA were conducted at the L2-L3 stage in let-60(n1046) worms subjected to the specified treatments. The data are presented as the mean ± SEM by unpaired t test. (C) Bar graphs showing that Δ fiu E. coli treatment does not repress lin-3 transcription in the absence of lin-65 . qPCR analyses of lin-3 mRNA were performed at the L2-L3 stage in let-60(n1046);lin-65(n3441) worms subjected to the specified treatments. The data are presented as the mean ± SEM by unpaired t test. (D) Bar graphs illustrating the significant decrease in lin-3 mRNA in the intestines of let-60(n1046) worms treated with Δ fiu E. coli , compared to the BW25113 control. mRNA from the dissected intestines of worms with specified genotypes and treatments was isolated and analyzed using qPCR. The data are presented as the mean ± SEM by unpaired t test. (E) Bar graphs indicating that the suppressive effects of Δ fiu E. coli and 2-BP treatment on Muv are reversed by lin-3 overexpression. The Muv rate in let-60(n1046) with the indicated extra-chromosomal array transgenes and treatments was assessed at the day-1 adult stage. The rpl-28p and nhx-2p promoters were utilized to overexpress lin-3 in ubiquitous tissues and the intestine, respectively. The data are presented as the mean ± SEM by unpaired t test. Then, we tested the potential downregulation of lin-3 by LIN-65 in response to Δ fiu bacteria. Given that LIN-65 is involved in chromatin remodeling and gene silencing [ 38 ], we hypothesized that LIN-65 activation in Δ fiu bacteria-treated worms may suppress Ras(gf) effects by downregulating lin-3 transcription. To test this hypothesis, we measured lin-3 mRNA levels by qPCR in let-60(gf) worms treated with Δ fiu E. coli or the control BW25113 at the L2-L3 stage, during which Ras signaling is activated to specify the vulval fate of VPCs [ 26 ]. As expected, treatment with Δ fiu bacteria led to a decrease in lin-3 mRNA levels in let-60(n1046) worms ( Figure 5B ). Moreover, lin-65 is required for Δ fiu -induced repression of lin-3 transcription, as evidenced by the failure of Δ fiu bacteria to repress lin-3 mRNA levels in let-60(n1046);lin-65(n3441) worms ( Figure 5C ). Taken together, these results indicate that the repression of lin-3 transcription by Δ fiu bacteria is dependent on lin-65 . Our qPCR analyses of lin-3 transcription from the entire worm indicate approximately a 30% reduction ( Figure 5B ), prompting us to explore whether repression of lin-3 transcription by Δ fiu bacteria treatment primarily occurs in certain tissues. Given that LIN-65 levels predominantly increased in intestinal nuclei, we investigated whether lin-3 transcription in the intestine is significantly decreased. Using a previously established transgene, Is[lin-3p::GFP] [ 42 ], to analyze lin-3 expression in let-60(n1046) worms at the L2-L3 stage, we found that the GFP signal was undetectable in the gut, possibly due to its diffusion in the cytoplasm of large intestinal cells. However, the GFP signal was primarily observed in anchor cells and did not decrease following Δ fiu E. coli treatment ( Figures S5A and S5B ). To quantify lin-3 mRNA in the intestine, we dissected let-60(n1046) worms treated with Δ fiu or control BW25113 E. coli at the L2-L3 stage to isolate the intestine for qPCR analyses. Notably, lin-3 transcription in the intestine was reduced by 50% ( Figure 5D ), in contrast to the unchanged levels in anchor cells. To further support the critical role of intestinal lin-3 repression in mediating the effects of Δ fiu E. coli and iron reduction on suppressing let-60(n1046) -induced Muv, we analyzed the potential of intestine-specific overexpression of lin-3 in reversing the function of Δ fiu E. coli in repressing let-60(gf) -caused Muv. We observed that nhx-2p promoter-driven intestinal lin-3 overexpression significantly reversed the suppressive effects of Δ fiu E. coli and 2-BP treatments on Muv in let-60(n1046) worms, as evidenced by the Muv rate increasing from approximately 20% to over 70% ( Figure 5E and S5C). Additionally, lin-3 overexpression using the ubiquitous promoter rpl-28p effectively restored the Muv phenotype in let-60(n1046) worms treated with either the Δ fiu strain or the 2-BP chelator, as indicated by an increase in the percentage of worms with the Muv phenotype from approximately 20% to 60% upon lin-3 overexpression ( Figure 5E and S5C). This similar reversing effect observed with both intestinal and ubiquitous overexpression of lin-3 further confirms that LIN-65-mediated repression of lin-3 transcription in the intestine is a significant contributor to the suppressive effects of Δ fiu bacteria on let-60(n1046) -induced Muv. In summary, treatment with Δ fiu bacteria reduces host iron availability in the mitochondria, leading to increased LIN-65 in the nuclei, which subsequently decreases lin-3 transcription and represses let-60(n1046) -induced Muv. Discussion Investigating whether microbes can alleviate developmental defects caused by genetic mutations and how bacterial activity can be modulated to enhance host health are important research endeavors. We conducted a comprehensive analysis and identified 151 E. coli genes that, when inactivated, can reverse the developmental defect, Muv, caused by a hyperactivated Ras mutation in C. elegans . These bacterial genes are involved in a variety of biological processes, indicating that the modulation of various microbial processes can inhibit host Ras signaling. Strikingly, we found that inactivation of bacterial iron-siderophore transport genes suppressed hyperactivated Ras signaling by repressing LIN-3/EGF transcription. Mechanistically, bacteria reduce the labile ferrous iron levels in the host, leading to lin-3 transcription downregulation through an iron-perceiving mechanism involving the translocation LIN-65 to the nucleus ( Figure 6 ). In summary, our findings describe what changes in bacterial activity can suppress Ras(gf) disorders and provide mechanistic insights into the modulation of Ras signaling by microbes, supporting the application of microbial activity modulation to improve host genetic defects. Download figure Open in new tab Figure 6 Model for the mechanism of Δ fiu E. coli in suppressing Muv phenotypes of let-60(n1046) worms. E. coli mutants lacking specific genes involved in iron acquisition, such as fiu , effectively mitigate the Muv phenotype in let-60(n1046) C. elegans , which carries a gain-of-function mutation in Ras. These Δ fiu E. coli secrete higher levels of the 2,3-DHBA siderophore compared to the wild-type strain, leading to a reduction in host mitochondrial iron levels. In response to the decreased iron availability induced by the bacteria, the host chromatin modifier LIN-65 translocates to the nucleus to suppress lin-3/EGF transcription, thereby repressing hyperactive let-60/ Ras(gf) -induced Muv development. How cells perceive the level of essential iron and then orchestrate the growth signaling state to adapt to iron availability is not examined. Our results revealed a mechanism of iron-perceiving, which transduces iron levels into Ras signaling through EGF modulation and involves both mitochondria and the Lin-65. Our study thus elucidates a novel function of the SynMuv gene lin-65 in mediating the role of iron in regulating Ras signaling. This newly discovered mechanism likely ensures that Ras signaling is downregulated to inhibit cell proliferation in response to low iron levels. Interestingly, Ras signaling can also modulate iron levels by regulating iron metabolism genes [ 43 ], thus indicating that reciprocal regulation between iron and Ras signaling occurs. These mechanisms may enable precise coordination between iron availability and growth-related signaling pathways. Our discovery that gut microbes can suppress the overactivation of Ras signaling in the host organism by decreasing iron availability offers novel perspectives on the prevention of Ras(gf) -induced disorders, such as tumors. A few studies have suggested that high iron levels are significantly associated with the occurrence and progression of cancer [ 44 ], such as colorectal cancer and pancreatic cancer. These observations suggest that sufficient iron is important for Ras(gf) -mediated activation of downstream signaling, suggesting that decreasing iron levels could inhibit tumorigenesis. Indeed, clinical studies have shown that certain cancer patients respond to iron chelating agent treatment [ 44 ], but the mechanism through which the iron reduction suppresses tumor growth remains relatively unexplored. Therefore, our study on iron insufficiency-mediated suppression of Ras signaling may provide a mechanistic understanding of how tumor growth can be inhibited by reducing iron levels, supporting the potential of developing iron-targeting therapies. The identification of microbe mutants that suppress hyperactivated Ras signaling opens up potential avenues for treating Ras(gf) -associated defects through modulating bacterial activities. The microbiota have been suggested to play critical roles in tumor initiation and development, with certain microbes exerting anticancer effects [ 45 ]; however, the precise molecular pathways involved are poorly understood. Our study provides mechanistic understanding of the anti-Ras oncogenic signaling effect of the microbiota, which sheds light on the development of microbial-based approaches for cancer therapy. For example, targeting bacterial iron acquisition systems with antibiotics may hold promise for suppressing Ras(gf) -induced tumors. Moreover, our genome-wide screen revealed 151 E. coli gene mutations that can suppress hyperactivated Ras signaling, thus providing a valuable resource for further investigation of the mechanisms underlying microbe-mediated suppression of oncogenic Ras. In summary, our findings demonstrate that microbes can suppress the effects of host genetic defects, which expands our understanding of the role of microbes in promoting host health and offers valuable insights for the development of effective approaches to manage Ras(gf) -induced defects using microbial interventions. Author contributions H.T. conceptualized and supervised the study. M.D. conceived, designed, and performed most of the experiments as well as analyzed the data. Y.W. performed part of the iron determination assays and analyses. G.L. provided technical support for the iron determination with staining. M.D. and H.T. wrote the manuscript. Declaration of interests The authors declare no competing interests. Supplemental figure legends Download figure Open in new tab Figure S1 Inactivation of various bacterial processes suppresses let-60(gf) -induced Muv and Δ fiu E. coli treatment represses Ras signaling. (A) Bar graph showing the percentage of Muv in N2 and let-60 (n1046) worms with indicated bacterial treatment. The L1-staged worms grown on either OP50 or BW25113 were scored for Muv when reaching day-1 adulthood. The data are presented as the mean ± SEM. ns, p = 0.9355 as determined by two-way ANOVA. (B-C) Gene Ontology analyses. Analyses of biological processes and molecular function of the 151 E. coli genes identified in the screen in Figure 1B revealed that these genes widely participate in different processes, including bacterial iron transportation. (D) Graphs indicating that MPK-1/ERK activity is decreased in the VPCs. MPK-1 activity is assessed using a previously established kinase translocation reporter that expresses arTi85[lin-31p::ERK-KTR-mClover::T2A::mCherry-H2B] , by calculating the nuclear Red/Green Ratio. The nuclear Red/Green Ratio was scored at the L2-L3 stage in let-60(n1046) treated with the indicated bacteria. Each dot represents the ratio of Red/Green fluorescence intensity. n=21 for BW25113 treatment and n=18 for Δ fiu E. coli treatment. (E-F) Bar graphs illustrate that Δ fiu E. coli treatment suppresses the Muv phenotypes induced by two additional let-60(gf) alleles, let-60(n1700) and let-60(ga89) . The Muv rate of let-60(n1700) and let-60(ga89) worms treated with BW25113 and Δ fiu E. coli was scored. Data are presented as the mean ± SEM. p < 0.0001 by unpaired t-test. Download figure Open in new tab Figure S2 Bacteria, including E. coli with mutation in iron acquisition and B. subtilis , that decrease host iron availability, can suppress let-60(gf) -induced Muv. (A) Bar graphs demonstrate that iron supplementation reverses the suppressive effect of bacteria with mutations in genes involved in Fe-siderophore transport on the let-60(n1046) -induced Muv phenotype. The Muv rate is analyzed in let-60(n1046) worms treated with the specified E. coli mutants, with or without FeCl 3 supplementation, at the day-1 adult stage. The data are presented as the mean ± SEM determined by two-way ANOVA. (B) Bar graphs illustrate that the levels of ferrous iron, as stained with FerroOrange, remain unchanged between let-60(n1046) and let-60(n1046);smf-3(ok1035) worms. FerroOrange intensity was analyzed in the specified worms grown on OP50 at the day-1 adult stage. The data are presented as the mean ± SEM according to the unpaired t test. (C) Bar graphs demonstrate that the levels of ferrous iron, stained with FerroOrange, remain unchanged in worms treated with smf-1(RNAi) or smf-2(RNAi) . The fluorescence intensity of FerroOrange was analyzed in let-60(n1046) worms treated with the specified RNAi at the day-1 adult stage. The data are presented as the mean ± SEM by one-way ANOVA. (D) Bar graphs showing that the Muv rate remains unchanged in the let-60(n1046) and let-60(n1046);smf-3(ok1035) worms. The Muv phenotype was scored in the indicated worms grown on OP50 at day-1 adult stage. The data are presented as the mean ± SEM, determined by unpaired t test. (E) Bar graphs indicating that the Muv rate in the let-60(n1046) worms were not changed after smf-1(RNAi) or smf-2(RNAi) treatment. The Muv rate was analyzed in let-60(n1046) worms treated with the specified RNAi at the day-1 adult stage. The data are presented as the mean ± SEM by one-way ANOVA. (F) Bar graphs illustrate that B. subtilis treatment suppresses let-60(gf) -induced Muv phenotype, which can be reversed by iron supplementation. The Muv rate was analyzed in let-60(n1046) worms treated with B. subtilis or OP50, with or without FeCl 3 supplementation. The data are presented as the mean ± SEM determined by two-way ANOVA. Download figure Open in new tab Figure S3 Mito-FerroGreen stains mitochondrial ferrous iron and the mfn-1(RNAi) is not sufficient to decrease mitochondrial iron and suppress Muv. (A) Microscopic images showing the mitochondrial localization of Mito-FerroGreen staining, as indicated by its colocalization with MitoTracker Deep Red. (B-C) Images and bar graphs showing that mfn-1(RNAi) alone is not sufficient to decrease the mitochondrial ferrous iron level. Intensity of Mito-FerroGreen in let-60(n1046) worms with indicated RNAi treatment was analyzed. The data are presented as the mean ± SEM by unpaired t test. (D) Bar graphs indicating the Muv rate of let-60(n1046) worms remained unchanged after mfn-1 RNAi treatment. The Muv rate is analyzed at day-1 adult stage. The data are presented as the mean ± SEM by unpaired t test. Download figure Open in new tab Figure S4 Δ fiu bacteria-induced reduction of iron availability triggers the mitochondrial unfolded protein response (mito UPR ), and the mito UPR regulator LIN-65 mediates the role of Δ fiu bacteria in suppressing let-60(lf) -caused Muv. (A-B) Images and bar graphs illustrate the induction of the mitochondrial stress reporter, hsp-6p::GFP , and its reversal by iron (FeCl 3 ) supplementation. The GFP signal was analyzed in let-60(n1046);Is[hsp-6p::GFP] worms subjected to specified treatments. The data are presented as the mean ± SEM by one-way ANOVA. (C-D) Images and bar graphs illustrate the induction of the mitochondrial stress reporter, hsp-6p::GFP , by iron chelator 2-BP treatment. The GFP signal in let-60(n1046);hsp-6p::GFP worms treated with 2-BP or solvent was analyzed. The data are presented as the mean ± SEM by unpaired t test. (E) Bar graphs illustrate that the Muv rate remained unchanged in let-60(n1046) worms upon introducing the atfs-1(et115, gf) allele. The Muv rate was analyzed in worms with the indicated genotypes grown on OP50 at the adult day-1 stage. The data are presented as the mean ± SEM by unpaired t test. (F) Bar graphs showing that the suppressive effect of Δ fiu bacteria on let-60(n1046)- induced Muv is independent of atfs-1 . The Muv rate in let-60(n1046);atfs-1(gk3094) worms, following specified bacterial treatments, was analyzed. The data are presented as the mean ± SEM by unpaired t test. (G) Bar graphs indicating the Muv rate of let-60(n1046);lin-65(n3441) worms carrying the specified transgenes and treated with designated bacteria and 2-BP. Consistent with the results in Figure 4B , two other independent extra-chromosomal array transgenic lines expressing lin-65 driven by the promoters rpl-28p , nhx-2p , and lin-31p were able to partially recover the suppressive effect of Δ fiu E. coli and 2-BP on let-60(n1046)- induced Muv in lin-65(lf) mutant worms. The data are presented as the mean ± SEM by one-way ANOVA. Download figure Open in new tab Figure S5 Intestine-specific over-expression of lin-3 reverses the impact of Δ fiu bacteria and iron insufficiency on repressing let-60(gf) -induced Muv. (A-B) Microscopic images and bar graphs demonstrate that Δ fiu E. coli treatment does not decrease LIN-3 levels in the anchor cell. At the L2-L3 stage, the LIN-3::GFP signal intensity in the anchor cell was analyzed in the let-60(n1046);syIs107 [lin-3(delta pes-10)::GFP + unc-119(+)] worms treated with the specified bacteria. The data are presented as the mean ± SEM by unpaired t test. (C) Bar graphs depict the Muv rate of let-60(n1046) worms overexpressing lin-3 in various tissues following treatment with designated bacteria and 2-BP. Consistent with the findings in Figure 5E , two additional independent extrachromosomal array transgenic lines, expressing lin-3 under the control of the rpl-28p and nhx-2p promoters, partially reversed the suppressive effects of Δ fiu E. coli and 2-BP on let-60(n1046) -induced Muv. The data are presented as the mean ± SEM by unpaired t test. STAR Methods Key Resources Table C. elegans strains and maintenance C. elegans strains, listed in the key resource table, were maintained on nematode growth medium (NGM) plates with OP50 bacteria at 20°C. The uthIs401 strain was provided by the Ye Tian laboratory [ 38 ]. All the other strains were obtained from the Caenorhabditis Genetics Center (CGC). Microbial strains and maintenance The E. coli Keio mutant strains were cultured overnight at 37°C in Luria–Bertani (LB) medium supplemented with 25 μg/mL kanamycin. Subsequently, they were spread on NGM plates supplemented with 25 μg/mL kanamycin for further use. B. subtilis bacteria were cultured overnight at 30°C in LB medium and spread on NGM plates for further use. Screening the E. coli Keio knockout collection for Muv suppression in C. elegans Synchronized L1 let-60(n1046) worms were added to the prepared E. coli Keio mutant bacteria plates and cultured at 20°C. The percentage of worms with the Muv phenotype, displaying as extra vulva, was scored on day 1 adulthood. The entire knockout library containing 3985 E. coli mutation was used in the primary screen to identify potential bacterial mutants that can repress the Muv phenotype of in let-60(n1046) worms, and 350 positive hits were obtained. Then, these 350 candidates were screened three more times to further confirm their ability to suppress Muv. Scoring Vulval induction VPCs induction, characterized by invagination, were scored at the L4 stage through using the transgene lin-31p:::mCherry::H2B that highlights the nucleus of the VPCs. In wild-type worms, P5.p, P6.p, and P7.p VPCs adopt vulva fate, thus counting as 3 VPCs with induction [ 26 ]. If the P3.p, P4.p, and P8.p VPCs overdifferentiate and undergo invagination, their cell type changes, and each differentiation is counted as 1 induced VPC. If P5.p and P7.p undergo overdifferentiation and invagination, each cell of this differentiation is considered a 0.5-fold increase in the VPC [ 46 ]. Analysis of MPK-1/ERK activity with a kinase translocation reporter The ERK activity in the VPCs was analyzed with a previously-established kinase translocation reporter, lin-31p::ERK-KTR-mClover::T2A::mCherry-H2B , which converts phosphorylation state into a nucleocytoplasmic localization within the cell [ 17 ]. Specifically, L2-L3 stage larvae with indicated genotypes and treatments were mounted on the 2% agarose pad, Z-stacks of mClover and mCherry fluorescence were captured simultaneously using the confocal microscope (Olympus). The same photograph settings were adopted for all the images, the images were analyzed with the Imaris, in which under 3D view conditions, surfaces were created for the image and mCherry signal was chosen for the source channel to render the image, the mean intensity of the mCherry (Red) and mClover (Green) signal for the six VPCs were recorded to calculate the nuclear Red/Green Ratio that represents the MPK-1/ERK activity. Quantification of 2,3-DHBA generated by the bacteria Bacteria secret siderophores to the extracellular space for acquiring iron, thus 2,3-DHBA siderophore in the culture medium were analyzed. Specifically, BW25113 and Δfiu bacterial clones were inoculated and cultured in LB medium over night at 37°C. After centrifugation of 1 mL bacterial culture, 100 μL of the supernatant was collected and then 900 μL of methanol was added, and the mixture was kept at −80°C for 24 hours to allow the extraction of 2,3-DHBA. Subsequently, the samples were dried at 4°C with a vacuum centrifugal concentrator (Christ, China) and dissolved in 50 μL of methanol. 2,3-DHBA was quantified via mass spectrometry (Agilent, USA), and commercially obtained 2,3-DHBA was used as the standard sample. The amount of 2,3-DHBA was normalized to the bacterial content, which was determined by counting the number of clones produced by 2 μL of the bacterial culture medium. Chemical supplementation The 2,3-dihydroxybenzoic acid (2,3-DHBA), 2,2′-bipyridyl (2-BP), and FeCl 3 were supplemented to manipulate the iron levels in the worms. These chemicals were dissolved in water or DMSO to generate the stock solutions, which were added to the NGM plates with the final concentration at 18 mg/mL for 2,3-DHBA, 50 μM for 2-BP, and 4 mM for FeCl 3 . Iron determination in worms FerroOrange and Mito–FerroGreen were used, respectively, to detect total Fe 2+ in worms and total Fe 2+ in the mitochondria of the worms. These Fe 2+ indicators were freshly prepared according to the manufacturer’s instructions. About 30 day-1 adult worms with indicated treatments were stained with FerroOrange (10 μM) and Mito–FerroGreen (100 μM) for 2 hours in M9 buffer. For the Mito-Tracker DeepRed and Mito-FerroGreen co-staining, the worms were stained with Mito-FerroGreen as previously described, washed with M9 buffer, dissected, and subsequently stained with Mito-Tracker Deep Red for 30 minutes. These worms were randomly collected for fluorescence imaging. Transgene construction These transgenes were generated in this study: let-60(n1046);lin-65(n3441);Ex[rpl-28p::lin-65cDNA::3×Flag::unc-54 3’UTR] let-60(n1046);lin-65(n3441);Ex[nhx-2p::lin-65cDNA::3×Flag::unc-54 3’UTR] let-60(n1046);lin-65(n3441);Ex[lin-31p::lin-65cDNA::3×Flag::unc-54 3’UTR] let-60(n1046);Ex[rpl-28p::lin-3cDNA::unc-54 3’UTR] let-60(n1046);Ex[nhx-2p::lin-3cDNA::unc-54 3’UTR] To achieve tissue-specific expression of lin-65 in let-60(n1046); lin-65(n3441) worms, the lin-65 cDNA (2184 bp), fused with a 3×Flag tag at the C-terminus, was amplified via PCR using primers that correspond to the lin-65 regions and incorporate the 3×Flag sequence. The obtained sequence was inserted into pBluescript SK (pBSK), to produce the lin-65 cDNA ::3×Flag::unc-54 3’UTR plasmid. Then, the rpl-28 promoter (1437 bp), nhx-2 promoter (1971 bp), and lin-31 promoter (4544 bp) sequences were amplified via PCR and subcloned into the upstream of lin-65 cDNA::3×Flag::unc-54 3’UTR, to create the rpl-28p::lin-65 cDNA::3×Flag::unc-54 3’UTR , nhx-2p::lin-65 cDNA::3×Flag::unc-54 3’UTR , and lin-31p::lin-65 cDNA::3×Flag::unc-54 3’UTR plasmids. lin-3 cDNA was used for tissue-specific overexpression in let-60 (n1046) worms . lin-3 cDNA (1272 bp) was amplified via PCR and subcloned into the pBSK plasmid to obtain the lin-3cDNA::unc-54 3’UTR plasmid. Then, the rpl-28 promoter (1437 bp) and nhx-2 promoter (1971 bp) were inserted into the upstream of lin-3cDNA::unc-54 3’UTR , respectively, to obtain the rpl-28p::lin-3cDNA::unc-54 3’UTR and nhx-2p::lin-3cDNA::unc-54 3’UTR plasmids. These obtained plasmids were used to generate extra-chromosomal array transgenic strains as previously described [ 47 ]. Specifically, the DNA mixture containing target constructs (50 ng/μL) and the co-injection marker (20 ng/μL) were microinjected into the indicated worms to generate the corresponding transgenic worms and three independent lines were obtained. hsp-6p::GFP intensity analysis Synchronized L1-staged worms carrying hsp-6p::GFP were added to the plates with indicated treatment. When reaching day 1 adulthood, worms were randomly collected, and their GFP fluorescence was captured with the stereo microscope (Nikon). RNA isolation and real-time PCR Worms at L2-L3 stage were harvested for analyzing the lin-3 mRNA level. Specifically, the let-60(n1046) worms with indicated bacterial treatment were collected at L2-L3 stage, which, after wash with M9 buffer, were resuspended in TRIzol reagent (Invitrogen) and homogenized. Total RNA was isolated by chloroform extraction and ethanol precipitation. For extracting mRNA from the intestine, the worms with indicated treatment were dissected to release the intestine, which were collected and then used for RNA extraction by using the micro total RNA kit (Omega). The cDNA was synthesized by reverse transcription (TransGen, One-Step gDNA Removal and cDNA Synthesis SuperMix). The primers used for lin-3 qPCR were 5’-CGCATTTCTCATTGTCATGC-3’ and 5’-CTGGTGGGCACATATGACTC-3’. Real-time PCR was performed using Universal qPCR Master Mix (NEB). The values were normalized to those of rpl-26 (forward primer: ATGAAGGTCAATCCGTTCGT; reverse primer: AGGACACGTCCAGTGTTTCC) as the internal controls for gene expression. RNAi treatment Worms were subjected to RNAi by feeding. Specifically, the bacteria for the worm gene RNAi experiments were selected from the ORF RNAi collection or the Ahringer RNAi library, which were then cultured in LB medium supplemented with 100 μg/mL ampicillin and 25 μg/mL tetracycline at 37°C overnight and spotted on NGM plates supplemented with 100 μg/mL ampicillin and 2 mM isopropyl-beta-D-1-thiogalactopyranoside (IPTG). These plates were incubated overnight at room temperature to allow IPTG-mediated induction of dsRNA expression. L1s were raised on designated RNAi bacterial plates, and when reaching day-1 adulthood, the Muv phenotype or the iron levels were scored as mentioned above. Quantification and statistical analysis To reduce potential bias, worms were randomly picked under a dissection microscope for further analyzing indicated phenotypes. A minimum of three independent biological experiments were performed to ensure robustness and reliability, and the data are presented as means ± standard errors of the mean (SEMs) to illustrate the level of variation. The unpaired t-test for two groups, one-way ANOVA for more than two groups, and two-way ANOVA for more than two groups within multiple subgroups were conducted using GraphPad Prism to assess statistical significance. In all cases, p values < 0.05 were considered significant. Acknowledgments We thank the CGC (funded by NIH [P40OD010440]) for strains, Ye Tian’s laboratory (IGDB, CAS) for strains, and all the members of the Tang lab for comments and suggestions. This work was supported by the National Natural Science Foundation of China (No. 32350015, No. 32070565, and No. 31871465), the National Key Research and Development Program of China (No. 2019YFA0802900), the HRHI program (No. 202209003 and No. 202109007) of the Westlake Laboratory of Life Sciences and Biomedicine, the Zhejiang Provincial Natural Science Foundation of China (XHD24C0701 and No. LQ23C040002), the Westlake Education Foundation of Westlake University and the Zhejiang Provincial Key Laboratory Construction Project. References 1. ↵ Bäckhed , F. , et al. , Host-bacterial mutualism in the human intestine . Science , 2005 . 307 ( 5717 ): p. 1915 – 20 . OpenUrl Abstract / FREE Full Text 2. Cho , I. and M.J. Blaser , The human microbiome: at the interface of health and disease . Nat Rev Genet , 2012 . 13 ( 4 ): p. 260 – 70 . OpenUrl CrossRef PubMed 3. Bäumler , A.J. and V. Sperandio , Interactions between the microbiota and pathogenic bacteria in the gut . Nature , 2016 . 535 ( 7610 ): p. 85 – 93 . OpenUrl CrossRef PubMed 4. de Vos , W.M. , et al. , Gut microbiome and health: mechanistic insights . Gut , 2022 . 71 ( 5 ): p. 1020 – 1032 . OpenUrl Abstract / FREE Full Text 5. ↵ Clemente , J.C. , et al. , The impact of the gut microbiota on human health: an integrative view . Cell , 2012 . 148 ( 6 ): p. 1258 – 70 . OpenUrl CrossRef PubMed Web of Science 6. ↵ Schubbert , S. , K. Shannon , and G. Bollag , Hyperactive Ras in developmental disorders and cancer . Nat Rev Cancer , 2007 . 7 ( 4 ): p. 295 – 308 . OpenUrl CrossRef PubMed Web of Science 7. ↵ Simanshu , D.K. , D.V. Nissley , and F. McCormick , RAS Proteins and Their Regulators in Human Disease . Cell , 2017 . 170 ( 1 ): p. 17 – 33 . OpenUrl CrossRef PubMed 8. ↵ Ryan , M.B. and R.B. Corcoran , Therapeutic strategies to target RAS-mutant cancers . Nat Rev Clin Oncol , 2018 . 15 ( 11 ): p. 709 – 720 . OpenUrl CrossRef PubMed 9. ↵ Chin , L. , et al. , Essential role for oncogenic Ras in tumour maintenance . Nature , 1999 . 400 ( 6743 ): p. 468 – 72 . OpenUrl CrossRef PubMed Web of Science 10. ↵ Das , N.K. , et al. , Microbial Metabolite Signaling Is Required for Systemic Iron Homeostasis . Cell Metab , 2020 . 31 ( 1 ): p. 115 – 130 .e6. OpenUrl CrossRef PubMed 11. Ley , R.E. , D.A. Peterson , and J.I. Gordon , Ecological and evolutionary forces shaping microbial diversity in the human intestine . Cell , 2006 . 124 ( 4 ): p. 837 – 48 . OpenUrl CrossRef PubMed Web of Science 12. Zhang , J. , et al. , A Delicate Balance between Bacterial Iron and Reactive Oxygen Species Supports Optimal C. elegans Development . Cell Host Microbe , 2019 . 26 ( 3 ): p. 400 – 411 .e3. OpenUrl CrossRef PubMed 13. ↵ Qi , B. and M. Han , Microbial Siderophore Enterobactin Promotes Mitochondrial Iron Uptake and Development of the Host via Interaction with ATP Synthase . Cell , 2018 . 175 ( 2 ): p. 571 – 582 .e11. OpenUrl CrossRef PubMed 14. ↵ Han , B. , et al. , Microbial Genetic Composition Tunes Host Longevity . Cell , 2017 . 169 ( 7 ): p. 1249 – 1262 .e13. OpenUrl CrossRef PubMed 15. ↵ Meisel , J.D. , et al. , Chemosensation of bacterial secondary metabolites modulates neuroendocrine signaling and behavior of C. elegans . Cell , 2014 . 159 ( 2 ): p. 267 – 80 . OpenUrl CrossRef PubMed 16. ↵ Sternberg , P.W. and M. Han , Genetics of RAS signaling in C. elegans . Trends Genet , 1998 . 14 ( 11 ): p. 466 – 72 . OpenUrl CrossRef PubMed Web of Science 17. ↵ de la Cova , C. , et al. , A Real-Time Biosensor for ERK Activity Reveals Signaling Dynamics during C. elegans Cell Fate Specification . Dev Cell , 2017 . 42 ( 5 ): p. 542 – 553 .e4. OpenUrl CrossRef PubMed 18. ↵ Beitel , G.J. , S.G. Clark , and H.R. Horvitz , Caenorhabditis elegans ras gene let-60 acts as a switch in the pathway of vulval induction . Nature , 1990 . 348 ( 6301 ): p. 503 – 9 . OpenUrl CrossRef PubMed 19. ↵ Han , M. and P.W. Sternberg, let-60, a gene that specifies cell fates during C. elegans vulval induction, encodes a ras protein . Cell , 1990 . 63 ( 5 ): p. 921 – 31 . OpenUrl CrossRef PubMed Web of Science 20. ↵ Baba , T. , et al. , Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection . Mol Syst Biol , 2006 . 2 : p. 2006 . 0008 . OpenUrl 21. ↵ Ferguson , E.L. and H.R. Horvitz , Identification and characterization of 22 genes that affect the vulval cell lineages of the nematode Caenorhabditis elegans . Genetics , 1985 . 110 ( 1 ): p. 17 – 72 . OpenUrl Abstract / FREE Full Text 22. ↵ Wu , Y. and M. Han , Suppression of activated Let-60 ras protein defines a role of Caenorhabditis elegans Sur-1 MAP kinase in vulval differentiation . Genes Dev , 1994 . 8 ( 2 ): p. 147 – 59 . OpenUrl Abstract / FREE Full Text 23. ↵ Grinter , R. and T. Lithgow , The structure of the bacterial iron-catecholate transporter Fiu suggests that it imports substrates via a two-step mechanism . J Biol Chem , 2019 . 294 ( 51 ): p. 19523 – 19534 . OpenUrl Abstract / FREE Full Text 24. ↵ Neumann , W. , et al. , Esterase-Catalyzed Siderophore Hydrolysis Activates an Enterobactin-Ciprofloxacin Conjugate and Confers Targeted Antibacterial Activity . J Am Chem Soc , 2018 . 140 ( 15 ): p. 5193 – 5201 . OpenUrl CrossRef PubMed 25. ↵ Andrews , S.C. , A.K. Robinson , and F. Rodríguez-Quiñones , Bacterial iron homeostasis. FEMS Microbiology Reviews , 2003 . 27 ( 2-3 ): p. 215 – 237 . OpenUrl PubMed 26. ↵ Sternberg , P.W. , Vulval development . WormBook , 2005 : p. 1 – 28 . 27. ↵ Sundaram , M.V ., Canonical RTK-Ras-ERK signaling and related alternative pathways . WormBook , 2013 : p. 1 – 38 . 28. ↵ Miethke , M. and M.A. Marahiel , Siderophore-based iron acquisition and pathogen control . Microbiol Mol Biol Rev , 2007 . 71 ( 3 ): p. 413 – 51 . OpenUrl Abstract / FREE Full Text 29. ↵ Takashi , Y. , et al. , Mitochondrial dysfunction promotes aquaporin expression that controls hydrogen peroxide permeability and ferroptosis . Free Radic Biol Med , 2020 . 161 : p. 60 – 70 . OpenUrl PubMed 30. ↵ Anderson , C.P. and E.A. Leibold , Mechanisms of iron metabolism in Caenorhabditis elegans . Front Pharmacol , 2014 . 5 : p. 113 . OpenUrl CrossRef PubMed 31. ↵ Neilands , J.B ., Siderophores: structure and function of microbial iron transport compounds . J Biol Chem , 1995 . 270 ( 45 ): p. 26723 – 6 . OpenUrl FREE Full Text 32. ↵ Lill , R. and S.A. Freibert , Mechanisms of Mitochondrial Iron-Sulfur Protein Biogenesis . Annu Rev Biochem , 2020 . 89 : p. 471 – 499 . OpenUrl CrossRef PubMed 33. ↵ Hirayama , T. , et al. , A mitochondria-targeted fluorescent probe for selective detection of mitochondrial labile Fe(ii) . Metallomics , 2018 . 10 ( 6 ): p. 794 – 801 . OpenUrl CrossRef PubMed 34. ↵ Paradkar , P.N. , et al. , Regulation of mitochondrial iron import through differential turnover of mitoferrin 1 and mitoferrin 2 . Mol Cell Biol , 2009 . 29 ( 4 ): p. 1007 – 16 . OpenUrl Abstract / FREE Full Text 35. ↵ Nargund , A.M. , et al. , Mitochondrial and nuclear accumulation of the transcription factor ATFS-1 promotes OXPHOS recovery during the UPR(mt) . Mol Cell , 2015 . 58 ( 1 ): p. 123 – 33 . OpenUrl CrossRef PubMed 36. ↵ Rauthan , M. , et al. , The mitochondrial unfolded protein response activator ATFS-1 protects cells from inhibition of the mevalonate pathway . Proc Natl Acad Sci U S A , 2013 . 110 ( 15 ): p. 5981 – 6 . OpenUrl Abstract / FREE Full Text 37. ↵ Nargund , A.M. , et al. , Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation . Science , 2012 . 337 ( 6094 ): p. 587 – 90 . OpenUrl Abstract / FREE Full Text 38. ↵ Tian , Y. , et al. , Mitochondrial Stress Induces Chromatin Reorganization to Promote Longevity and UPR(mt) . Cell , 2016 . 165 ( 5 ): p. 1197 – 1208 . OpenUrl CrossRef PubMed 39. ↵ Ceol , C.J. , et al. , Identification and classification of genes that act antagonistically to let-60 Ras signaling in Caenorhabditis elegans vulval development . Genetics , 2006 . 173 ( 2 ): p. 709 – 26 . OpenUrl Abstract / FREE Full Text 40. ↵ Ardito , C.M. , et al. , EGF receptor is required for KRAS-induced pancreatic tumorigenesis . Cancer Cell , 2012 . 22 ( 3 ): p. 304 – 17 . OpenUrl CrossRef PubMed Web of Science 41. ↵ McFall , T. and E.C. Stites , Identification of RAS mutant biomarkers for EGFR inhibitor sensitivity using a systems biochemical approach . Cell Rep , 2021 . 37 ( 11 ): p. 110096 . OpenUrl PubMed 42. ↵ Hwang , B.J. and P.W. Sternberg , A cell-specific enhancer that specifies lin-3 expression in the C. elegans anchor cell for vulval development . Development , 2004 . 131 ( 1 ): p. 143 – 51 . OpenUrl Abstract / FREE Full Text 43. ↵ Jiang , H. , et al. , Ferrous iron-activatable drug conjugate achieves potent MAPK blockade in KRAS-driven tumors . J Exp Med , 2022 . 219 ( 4 ). 44. ↵ Torti , S.V. and F.M. Torti , Iron and cancer: more ore to be mined . Nat Rev Cancer , 2013 . 13 ( 5 ): p. 342 – 55 . OpenUrl CrossRef PubMed Web of Science 45. ↵ Bagheri , Z. , L. Moeinzadeh , and M. Razmkhah , Roles of Microbiota in Cancer: From Tumor Development to Treatment . J Oncol , 2022 . 2022: p. 3845104 . 46. ↵ Cui , M. , et al. , SynMuv genes redundantly inhibit lin-3/EGF expression to prevent inappropriate vulval induction in C. elegans . Dev Cell , 2006 . 10 ( 5 ): p. 667 – 72 . OpenUrl CrossRef PubMed Web of Science 47. ↵ Evans , T ., Transformation and microinjection . WormBook , 2006 . View the discussion thread. Back to top Previous Next Posted October 01, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Microbes suppress genetic disorders of hyper-activated Ras by inhibiting iron-mediated growth factor modulation in C. elegans Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Microbes suppress genetic disorders of hyper-activated Ras by inhibiting iron-mediated growth factor modulation in C. elegans Minghui Du , Yangyang Wu , Guanqun Li , Hongyun Tang bioRxiv 2025.09.30.679430; doi: https://doi.org/10.1101/2025.09.30.679430 Share This Article: Copy Citation Tools Microbes suppress genetic disorders of hyper-activated Ras by inhibiting iron-mediated growth factor modulation in C. elegans Minghui Du , Yangyang Wu , Guanqun Li , Hongyun Tang bioRxiv 2025.09.30.679430; doi: https://doi.org/10.1101/2025.09.30.679430 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Developmental Biology Subject Areas All Articles Animal Behavior and Cognition (7629) Biochemistry (17660) Bioengineering (13881) Bioinformatics (41911) Biophysics (21436) Cancer Biology (18578) Cell Biology (25482) Clinical Trials (138) Developmental Biology (13371) Ecology (19887) Epidemiology (2067) Evolutionary Biology (24302) Genetics (15599) Genomics (22483) Immunology (17728) Microbiology (40364) Molecular Biology (17163) Neuroscience (88537) Paleontology (666) Pathology (2830) Pharmacology and Toxicology (4821) Physiology (7637) Plant Biology (15129) Scientific Communication and Education (2045) Synthetic Biology (4290) Systems Biology (9817) Zoology (2269)