Full text
156,568 characters
· extracted from
preprint-html
· click to expand
Decellularized ovarian bioscaffolds and resveratrol-loaded polymeric nanoparticles improve in vitro development of bovine preantral follicles | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Decellularized ovarian bioscaffolds and resveratrol-loaded polymeric nanoparticles improve in vitro development of bovine preantral follicles Francisco Chagas Costa, Ernando Igo Teixeira Assis, Danisvânia Ripardo Nascimento, and 9 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7760007/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 11 You are reading this latest preprint version Abstract This study evaluated the effects of decellularized ovarian bioscaffolds and resveratrol-loaded polymeric nanoparticles (RLPN) on the in vitro development of bovine secondary follicles. Decellularized extracellular matrix (dECM) from cortical fragments was obtained by freeze–thaw cycles and sequential incubation in Triton X-100 and sodium dodecyl sulfate. Decellularization efficiency and extracellular matrix integrity were assessed by hematoxylin-eosin, Hoechst staining, scanning electron microscopy, and quantification of collagen and glycosaminoglycans. Bovine secondary follicles were isolated and cultured for 12 days in either a two-dimensional (2D) system or in dECM scaffolds in medium supplemented with 0.02, 0.2, or 2.0µM RLNP, blank nanoparticles, or unencapsulated resveratrol. Follicular viability and ultrastructure were evaluated by calcein-AM/ethidium homodimer-1 staining and transmission electron microscopy. Expression of mRNA for catalase, superoxide dismutase, glutathione peroxidase 1, peroxiredoxin 6, and nuclear factor erythroid 2-related factor 2 was assessed by qRT-PCR. Quantitative data were analyzed by unpaired t-tests or one-way ANOVA, followed by Tukey’s test (P < 0.05). Hematoxylin-eosin and Hoechst staining confirmed effective cell removal, while collagen, glycosaminoglycans, and ECM ultrastructure were preserved. Follicles cultured in the three-dimensional (3D) system showed increased viability, further enhanced by 0.02 or 2.00 µM RLPN. Follicles cultured with 0.02 µM RLPN exhibited well-preserved morphology, including intact zona pellucida, oocyte membrane, and organelles. RLPN downregulated the expression of antioxidant genes. In conclusion, the decellularization protocol effectively removed cellular content and preserved ECM structure and ultrastructure. 3D culture system in combination with medium supplemented with 0.02 µM RLPN supported follicular development and ultrastructure, as well as downregulated antioxidant gene expression. Decellularization Ovarian follicles Nanotechnology Resveratrol Antioxidant Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1 Introduction Most of the ovarian follicles are lost due to atresia, which is significantly increased beyond the secondary follicular stage in bovine species (Dey et al., 2024 a; Dey et al., 2024 b). This physiological follicular depletion reinforces the need for improvement of reproductive biotechnologies capable of utilizing the pool of early follicles. The in vitro culture (IVC) of secondary follicles isolated from bovine ovaries is a key tool to elucidate their specific requirements for development up to maturation stages and to improve the use of ovarian reserve by assisted reproductive technologies (Ebrahime et al ., 2025). Despite efforts to establish a suitable IVC system for secondary follicles (Cheng et al., 2024 ; Jachter et al., 2022 ), obtaining matured oocytes from isolated bovine secondary follicles cultured in vitro remains unsuccessful (Azevedo et al., 2022 ; Nascimento et al., 2022 ; Paulino et al., 2018 ), underscoring the challenge of reproducing the physiological conditions required for complete follicular development. Recent evidences have shown that follicles are highly responsive to biomechanical signals originating from the ovarian stroma that act during folliculogenesis (Wang et al. , 2025). The coordinated activity of these mechanical cues, along with endocrine and paracrine signaling, shapes individual cells, oocytes, and the entire follicle (Zhao et al., 2023 ). Thus, after isolation, secondary follicles are challenging to in vitro culture without the supporting structure of the ovary (Alshaikh et al., 2020 ). Therefore, biocompatible scaffolds to encapsulate isolated follicles can provide a suitable environment for their in vitro development (Dadashzadeh et al., 2023 ). Ovarian follicles have been cultured in a three-dimensional culture system using different biomaterials, such as alginate (Zheng et al., 2023 ), collagen (Joo et al., 2016 ), fibrin (Chiti et al., 2016 ), and polyethylene glycol (Ahn et al., 2015 ). However, none of these materials have demonstrated the ability to fully replicate all the functions of the native ovarian ECM, including cellular support and regulatory roles (León-Félix et al., 2024 ). Several studies have proposed the use of decellularized ovarian extracellular matrix (dECM) as a natural scaffold that closely mimics the native ovarian extracellular matrix (ECM) (Francés-Herrero et al., 2024 ; Almeida et al., 2023 ). For instance, Laronda et al. ( 2015 ) showed that bovine ovarian dECM positively influenced murine primary ovarian cells and stimulated the formation of follicle-like structures in vitro . However, the effect of dECM on the in vitro development of isolated follicles in bovine species remains unexplored. In vitro redox dysregulation is also correlated with poor follicular quality after culturing (He et al., 2025 ; Bezerra et al., 2024 ; Azevedo et al., 2022 ). During in vitro culture of follicles, various factors, such as ischemia, ovarian fragmentation, manipulation, and light exposure can increase the generation of reactive oxygen species (ROS) that leads to oxidative stress (Costa et al., 2025 ). Elevated ROS levels are linked with a reduction in follicular viability, lipid peroxidation leading to changes in membrane permeability and selectivity (Gashler et al. , 2017), vacuolization and degeneration of mitochondrial cristae and matrix (Wang et al., 2023 ), endoplasmic reticulum stress (Harada et al., 2021 ), and zona pellucida (ZP) damage (Wang et al., 2021 ). Consequently, antioxidant supplementation of the culture medium has been proposed to maintain the redox balance during in vitro ovarian follicles culture (Silva et al., 2023 ). Moreover, the expression levels of enzymatic antioxidants such as catalase ( CAT ), superoxide dismutase ( SOD ), glutathione peroxidase ( GPX ), peroxiredoxin ( PRDX ), and nuclear factor erythroid 2-related factor 2 ( NRF2 ) are frequently used as indicators of the antioxidant capacity of in vitro culture systems. Among the natural phenolic compounds, resveratrol is known for improving follicular development in vitro through its anti-apoptotic and antioxidant properties (Costa et al., 2025 ; Macedo et al., 2017 ; Bezerra et al., 2018 ). Although promising results have been reported, its low water solubility (~ 3 mg/100 mL) and rapid metabolism can impact its bioavailability, limiting the extent to which its free form exerts its effects (Freitas et al. , 2023; Moreira-Pinto et al., 2021 ). In this context, encapsulating resveratrol within polymeric nanoparticles is a promising strategy, as it can enhance the effectiveness of its action. The advantages of polymeric nanoparticles include superior biocompatibility compared to other materials, minimal toxicity, capable of sustained drug release, and biodegradability (Freitas et al. , 2023). This study aimed to decellularize and characterize bovine ovarian tissue and to evaluate its effect on the follicle viability and ultrastructure, and expression of mRNA for CAT, SOD, GPX1, PRDX6 , and NRF2 in bovine secondary follicles cultured in medium supplemented with different concentration of in vitro resveratrol-loaded polymeric nanoparticles. 2 Material e methods 2.1 Chemicals Culture media and other chemicals used in the present study were purchased from Sigma-Aldrich (St. Louis, MO, USA), unless otherwise specified in the text. 2.2 Synthesis and physicochemical characterization of resveratrol-loaded polymeric nanoparticles Polymeric nanoparticles were prepared using the nanoprecipitation method, as described by de Freitas et al. (2023). The mean particle size, polydispersity index (PDI), and zeta potential were evaluated to characterize the physicochemical properties of the formulations. For this purpose, the hydrodynamic size distribution, polydispersity index (PDI), and zeta potential of the nanoparticles were analyzed at 25°C by dynamic light scattering (DLS). Measurements were conducted with a Malvern Zetasizer Nano ZS (Malvern Instruments, Malvern, UK), equipped with a 4 mW He-Ne laser at a wavelength of 633 nm at an angle of 90°. Prior to analysis, samples were diluted 1:10 in ultrapure water and vortexed to ensure proper dispersion. All measurements were performed in triplicate, and results were expressed as mean ± standard deviation (SD). 2.3 Bovine ovaries and ethical approval Ovaries from 50 healthy mixed-breed cows of reproductive age were collected at local slaughterhouses and assigned to two distinct experiments, as detailed below. All procedures performed in this study were approved by the Ethics and Animal Welfare Committee of the xxxxx under approval number 04/22. Immediately after collection, the ovaries were washed once with 70% alcohol and twice with PBS buffered with 20 mM HEPES and supplemented with 100 µg/ml penicillin and 100 µg/ml streptomycin, then designated for decellularization. The ovaries to be used for follicular isolation were washed twice in TCM199 buffered with 20 mM HEPES and supplemented with the same antibiotics. Then, they were transported to the laboratory within 1 h in the respective washing solution at 4°C. 2.4 Bovine ovarian tissue decellularization Upon arrival at the laboratory, the ovaries (n = 10 pairs) were rinsed in PBS solution and stored at -80 ºC for 24–48 h. Before use, they were thawed in water bath at 37 ºC for 1 hour. After thawing, antral follicles were punctured with a needle, and cortical slices (2 mm x 2 mm x 1 mm) were taken using a scalpel. Random samples from each ovarian pair were fixed in 4% paraformaldehyde prepared in PBS (pH 7.4) for 24 hours at room temperature for evaluation as native tissue. Two decellularization solutions (DS) were prepared 24 hours prior to use: (DS1) − 1% Triton-X100 (v/v) (T8787-100 ML, Sigma-Aldrich, USA) in distilled water; (DS2) − 0.5% SDS (w/v) (L3771-100 G, Sigma-Aldrich, USA). Initially, samples were immersed in 20 mL DS1 for 9 hours under constant agitation (150 rpm) in an orbital shaker at 37 ºC, followed by 9 hours in 20 mL DS2 under the same conditions. After decellularization, the samples were washed 10 times in 50 mL PBS at 37 ºC with hourly solution changes. The resulting samples were either used to assess the decellularization efficiency or stored at -80°C. 2.5 Histological analysis and DNA staining Native bovine ovarian tissue and decellularized extracellular matrix (dECM) morphology were analyzed using classical light microscopy. Samples were fixed for 24 hours at room temperature and processed for histological. Sections (6 µm thick) were mounted on glass slides and stained with hematoxylin-eosin (H&E) to assess the remaining cell content after decellularization. Some sections were stained with 20 µM Hoechst 33342 (B2261-100MG, Sigma-Aldrich, USA) for 1 min for DNA fluorescence labeling. For cell counting, random fields from sections were analyzed at 400× magnification using a Nikon Eclipse TS 100 microscope and the ImageJ software (Version 1.54f, 2023). Cells were manually counted in a 100 µm² area, following Silva et al. ( 2024 ), with all measurements performed by a single operator. Images of sections stained with Hoechst 33342 under constant exposure settings and analyzed with ImageJ. Residual nuclear content was considered proportional to the fluorescence intensity after subtraction of tissue auto fluorescence (Alshaikh et al., 2020 ). 2.6 Histochemical evaluation for collagen and glycosaminoglycans For collagen assessment, 6 µm-thick sections from both native and decellularized bovine ovarian samples were dewaxed using xylene and stained with 0.1% Sirius Red solution for 1 hour at room temperature, according to the protocol described by Rittié et al. (2017). The excess stain was eliminated with a 0.5% acetic acid solution, followed by dehydration of the sections and subsequent mounting on slides. For glycosaminoglycan (GAG) evaluation, the sections were stained with Alcian Blue for 5 minutes at room temperature, following the manufacturer's protocol. After staining, the sections were dehydrated and mounted on slides for analysis. For both collagen and GAG assessments, images from 50 fields (5 per animal) were captured using a DS Cooled DS-Ri1 camera attached to a Nikon Eclipse TS 100 microscope (Tokyo, Japan) at 400x magnification. Quantification of collagen and GAG content was performed using Fiji-ImageJ software (Version 1.54f, 2023). 2.7 Scanning electron microscopy (SEM) For SEM, both native bovine ovaries and dECM samples were fixed in Karnovsky's solution at 4°C for 24 hours, followed by post-fixation with 2% osmium tetroxide for 1 hour. After washing with distilled water, the samples underwent gradual dehydration through a graded acetone series (30%, 50%, 70%, 90%, and 100%), with each step lasting 15 minutes. Subsequently, the specimens were dried using a critical point dryer, mounted on stubs, coated with colloidal gold, and observed using a scanning electron microscope (Inspect S50-FEI). 2.8 Follicle isolation and in vitro culture A total of 40 bovine ovaries were collected following the previously described procedures. The ovarian cortex was sectioned into 1–2 mm fragments using a sterile scalpel blade and transferred to TCM-199 medium supplemented with 100 µg/ml penicillin, 100 µg/ml streptomycin, and HEPES buffer. Secondary follicles measuring approximately 150–200 µm in diameter were manually dissected from the cortical strips using 26-gauge needles under a stereomicroscope (SMZ 645 Nikon, Tokyo, Japan). Follicles selected for culture exhibited an intact basement membrane, two or more granulosa cell layers, absence of an antral cavity, and a morphologically healthy, round oocyte centrally located within the follicle. To culture the follicles, the decellularized scaffolds were removed from the − 80ºC freezer and thawed for 1 hour in a water bath containing distilled water. Subsequently, the structures were sterilized in a PBS solution with penicillin and streptomycin, then placed in TCM-199 medium supplemented with penicillin (100 µg/ml), streptomycin (100 µg/ml) and HEPES solution, and stored in an incubator at 38.5 ºC with 5% CO2 for 4 hours prior to use. The base medium used for follicle culture was TCM-199 (pH 7.2–7.4), enriched with 3.0 mg/ml bovine serum albumin (BSA), 2 mM glutamine, 2 mM hypoxanthine, 100 IU/ml penicillin-streptomycin, 10 µg/ml insulin, 5.5 µg/ml transferrin, 5 ng/ml selenium (ITS), 50 µg/ml ascorbic acid, and 100 ng/ml equine chorionic gonadotropin (eCG) (TCM-199 + ). Isolated secondary follicles were randomly distributed and cultured in two systems: (I) two-dimensional (2D) system, i.e., the follicles were cultured in Petri dishes (60 ×15 mm; Corning, USA) in drops of 100 µL TCM-199 + (TCM199 + 2D); (II) three-dimensional (3D) system, i.e., the follicles were inserted in dECM scaffolds and cultured in 24-well culture dishes (2 scaffolds per well) in 500 µL TCM-199 + alone (TCM199 + 3D) or supplemented with 0.02, 0.2, or 2.0 µM resveratrol-loaded polymeric nanoparticles (RLNP-3D groups), 2.0 µM blank nanoparticles BLNP (2µM-3D); or 2.0µM non-encapsulated resveratrol RSV (2µM-3D). Follicles were cultured for 12 days in a humidified incubator at 38.5°C with 5% CO₂ in air. Half of the culture medium was refreshed every second day of culture. 2.9 Assessment of follicular viability by fluorescence microscopy Following the culture period, follicles (n = 30 per treatment) were manually retrieved from the dECM scaffolds using 26-gauge needles. They were then incubated for 15 minutes at 37°C with 5% CO₂ in 100 µL droplets of TCM-199 medium containing 4 µM calcein-AM and 2 µM ethidium homodimer-1 (EthD-1) (Molecular Probes - L3224, Invitrogen, Karlsruhe, Germany) to assess esterase activity in the cytoplasm and the labeling of nucleic acids in non-viable cells following membrane disruption. After staining, follicles were washed three times in TCM-199 medium and analyzed under a fluorescence microscope (Nikon, Eclipse TS100, Japan) as described by Paulino et al. ( 2018 ). Oocytes and granulosa cells with preserved viability displayed green fluorescence from calcein-AM, whereas non-viable cells exhibited red fluorescence due to EthD-1 staining. Fluorescence intensity was quantified using ImageJ software (Version 1.54f, 2023). The mean pixel intensity within the follicular region was measured after background correction to determine staining levels. Non-cultured follicles were used as the reference for relative fluorescence quantification, following the approach described by Rocha-Frigoni et al. ( 2016 ). 2.10 Morphological and ultrastructural assessments of dECM, and cultured follicles To assess the structural stability of collagen and glycosaminoglycan (GAG) networks throughout the culture period, dECM scaffolds were stained with Picrosirius red and Alcian blue, respectively, on days 0, 2, 4, 6, 8, 10, 12, and 14. Additionally, scaffold ultrastructure was examined by scanning electron microscopy (SEM) on day 12 of culture. Histochemical and SEM processing were performed using standard methods already described previously. To analyze cell morphology and organelle organization in oocytes and GCs, transmission electron microscopy (TEM) was performed on follicles cultured in the 2D system or in the 3D system in medium supplemented with 0.02, 0.2, or 2.0µM RLNP, Blank-NP, or RSV. After culture, scaffolds containing follicles (6–10 per treatment) were fixed in Karnovsky’s solution for 4 hours at room temperature (~ 25°C), embedded in 4% low-melting agarose droplets, and kept in sodium cacodylate buffer. As no significant differences in viability were found among different concentrations of RLNP, follicles treated with the lowest concentration (0.02 µM) were selected for ultrastructural analysis. The specimens were post-fixed with 1% osmium tetroxide, 0.8% potassium ferricyanide, and 5 mM calcium chloride. After dehydration in acetone, samples were embedded in epoxy resin (Epoxy Embedding Kit, Fluka Chemika). Semithin sections (2 µm) were stained with toluidine blue and examined under light microscopy at 400x magnification, while ultrathin sections (70 nm) were counterstained with uranyl acetate and lead citrate for examination under a Morgani-FEI transmission electron microscope. 2.11 Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) Real-time PCR was used to evaluate the levels of mRNAs for CAT, SOD, GPX1 , PRDX6 , and NRF2 in follicles cultured follicles 2D system or in 3D system in medium supplemented with 0.02 µM RLNP, Blank-NP or RSV, according to Azevedo et al. ( 2022 ). After culture, follicles were carefully removed from dECM scaffolds, and total mRNA was extracted using the Trizol purification kit (Invitrogen, São Paulo, Brazil), according to the manufacturer’s guidelines. The total mRNA concentration was measured using a nanodrop (Biodrop, Cambridge, England), and 50 ng/µL of mRNA was used for reverse transcription. Quantification of mRNA was conducted using SYBR Green on a StepOnePlus instrument (Applied Biosystems, Foster City, CA, USA). Each quantitative PCR reaction (15 µL total volume) was prepared with 7.5 µL of SYBR Green Master Mix (PE Applied Biosystems, Foster City, CA), 5.5 µL of ultrapure water, 1 µL of cDNA, and 0.5 µM of each primer (Table 1 ). The relative expression levels of all target genes were normalized to the endogenous control gene Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Kussano et al., 2024 ) calculated using the 2^-ΔΔCt method, as described by Cao et al. ( 2021 ). Table 1 Oligonucleotide primers used for polymerase chain reaction analysis Target gene Primer sequence (5′ ➔ 3′) Sense (S), anti-sense (As) GenBank accession no. GAPDH TGTTTGTGATGGGCGTGAACCA ATGGCGCGTGGACAGTGGTCATAA S As GI: 402744670 CAT AAGTTCTGCATCGCCACTCA GGGGCCCTACTGTCAGACTA S As GI: 402693375 SOD GTGAACAACCTCAACGTCGC GGGTTCTCCACCACCGTTAG S As GI: 31341527 GPX1 AACGTAGCATCGCTCTGAGG GATGCCCAAACTGGTTGCAG S As GI: 156602645 PRDX6 GCACCTCCTCTTACTTCCCG GATGCGGCCGATGGTAGTAT S As GI: 59858298 NRF2 GACCCAGTCCAACCTTTGTC GACCCGGACTTACAGGTACT S As GI: 0304941 2.12 Statistical analysis Statistical analyses were performed using GraphPad Prism version 9.0. An unpaired t-test was applied to compare cell remnants and the percentage of collagen and GAGs between native and decellularized tissues. For treatment group comparisons, data with normal distribution were evaluated using one-way ANOVA followed by Tukey’s post hoc test, while non-normally distributed variables were assessed with the Kruskal–Wallis test and Dunn’s multiple comparisons. Results are presented as mean ± standard error of the mean (SEM), unless otherwise specified. Differences were considered statistically significant when p < 0.05. 3 Results 3.1 Physicochemical characterization confirms successful synthesis of RLNP Table 2 shows the physicochemical characterization of resveratrol-loaded polymeric nanoparticles (RLNP) and blank nanoparticles (BLNP). The synthesis method employed is robust and effective in producing nanoparticles with sizes below 150 nm. RLNP showed a PDI of 0.26, while BLNP presented a PDI of 0.16, indicating moderate size distribution uniformity. Both formulations exhibited a negative surface charge, with zeta potential values close to -6 mV, reflecting low surface charge intensity. Table 2 Physicochemical properties of the formulations, including particle size, polydispersity index (PDI), and zeta potential. Size (nm) ± SD PDI ± SD Zeta potential (mV) ± SD RLNP 130.87 ± 36.36 0.26 ± 0.01 -5.80 ± 1.26 BLNP 142.23 ± 1.55 0.16 ± 0.01 -5.65 ± 1.85 3.2 Decellularization eliminates cells and maintains tissue macro- and microarchitecture Macroscopic analysis showed that decellularized tissues changed color from red to white and maintained their shape and homogeneity without any signs of deformation (Fig. 1 A, B). The SEM revealed that ECM fiber integrity was preserved after decellularization. The fiber appearance and organization in the dECM closely resembled those of the native ovarian tissue. The SEM also confirmed the preservation of both dense and thin collagen fibers, indicating that the resulting scaffolds retained their native three-dimensional architecture (Fig. 2 A-C). Histological analysis revealed that the resulting ECM-based scaffolds were devoid of cells and basophilic staining was absent in the decellularized scaffolds, whereas cell nuclei were distinctly visible in native tissues, which served as the control (Fig. 1 C, D). Cell density analysis demonstrated absence of nuclei in the ECM-based scaffolds compared to the untreated tissues (P < 0.05) (Fig. 1 G). Additionally, the existence of DNA was verified through Hoechst 33342 staining (Fig. 1 E, F) indicating absence of DNA in decellularized tissues (P < 0.05) (Fig. 1 H). 3.3 Decellularization preserves ovarian extracellular matrix components Histochemical analyses confirmed the preservation of key ECM components after tissue decellularization. Picrosirius red and Alcian blue staining revealed the persistence of collagen (Fig. 3 A, B) and GAGs (Fig. 3 C, D), displaying a comparable distribution between ECM-based scaffolds and native tissues. These morphological findings were confirmed by stereological quantifications, which demonstrated no differences in collagen (Fig. 3 E), and GAGs content (Fig. 3 F) between ECM-based scaffold and native tissues (P < 0.05). The mean of collagen and GAGs in the decellularized ovarian tissue was about 95% and 93%, respectively, compared with native tissue collagen and GAGs content prior to decellularization. 3.4 The dECM undergoes time-dependent structural changes in vitro Picrosirius red staining showed that the total collagen content remained stable until day 12 of in vitro culture, with no apparent disarray in the collagen fiber bundles of the decellularized scaffolds. However, by day 14, a greater degree of fiber disorganization became evident, characterized by the presence of gaps, increased fiber fragmentation, and a significant reduction in fiber density within the scaffolds (Fig. 4 A-G and O). Similarly, GAGs stained with Alcian blue remained quantitatively stable until day 10 of culture, although the GAG network appeared straighter at this stage. From day 12 onward, a significant decline in GAG density was observed, accompanied by a more dispersed network with an increased presence of gaps (Fig. 4 H-N, and P). The SEM analysis corroborated the histochemical findings, revealing alterations in the ultrastructural integrity of the dECM after 12 days in culture. The finer fibers present in the native tissue and immediately after decellularization were no longer observed. Additionally, the porous architecture present shortly after decellularization was no longer apparent after 12 days of culture (Fig. 2 C). 3.5 The dECM and RLNP enhance follicular viability After culture, follicles in all treatments and culture conditions exhibited a significant reduction in calcein-AM fluorescence intensity and an increase in EthD-1 fluorescence compared to the fresh control (Fig. 5 A-X). Follicles cultured in the 3D groups, except those supplemented with BLNP, exhibited higher calcein-AM fluorescence intensity compared to the 2D group. Meanwhile, lower EthD-1 fluorescence intensity was observed in all the 3D groups relative to the 2D group (P < 0.05), (Fig. 5 Y, Z). In follicles cultured in 3D system, supplementation of the culture medium with RLNP at all tested concentrations further increased calcein-AM fluorescence intensity compared to the other treatments (Fig. 5 Y). However, this supplementation did not significantly affect EthD-1 fluorescence intensity (P > 0.05) (Fig. 5 Z). 3.6 The dECM and RLNP improve follicular ultrastructure Follicles cultured in the 2D system exhibited a ruptured ZP, with the space originally occupied by the oocyte filled by granulosa cells. However, these cells were well preserved, displaying reticulum and mitochondria, although mitochondrial cristae were difficult to visualize (Fig. 6 A, B). In contrast, follicles cultured in the 3D system in medium supplemented with 0.02µM RLNP exhibited oocytes with an intact ZP and visible microvilli. Moreover, mitochondria with preserved cristae were observed. Although some granulosa cells showed gaps between them, they remained well preserved, with numerous mitochondria featuring clearly visible cristae, along with the presence of endoplasmic reticulum (Fig. 6 C, D). In follicles cultured in the 3D system in medium supplemented with 2.0 µM BLNP, although remnants of an irregular ZP were visible, no viable oocyte was identified. Granulosa cells of these follicles displayed intense vacuolization, an extremely heterochromatic nucleus, and heterogeneous nucleoli. Furthermore, an intact plasma membrane separating the cells was not observed (Fig. 6 E, F). Finally, in follicles cultured in the 3D system with 2.0 µM RSV, no intact oocyte was identified, with only fragments of the ZP remaining. However, granulosa cells had preserved morphology, with a well-defined nucleus, mitochondria with reasonably preserved cristae, and structurally intact endoplasmic reticulum (Fig. 6 G-H). 3.7 The RLNP downregulated mRNA expression of antioxidant enzymes After 12 days of culture, follicles cultured with 0.02 µM RLNP showed reduced mRNA expression of CAT (P < 0.01), SOD (P < 0.0001), PRDX6 (P < 0.0001), and NRF2 (P < 0.05) compared to the TCM199 + control group (P < 0.05), although SOD levels were similar to those observed in follicles cultured with unencapsulated resveratrol (Fig. 7 ). No significant differences in GPX1 expression were observed among treatments (P > 0.05). 4 Discussion This study demonstrated that culturing secondary follicles in dECM-based bioscaffolds associated with medium supplemented with RLNP represents a promising strategy for in vitro development of culture systems for bovine early follicles. Maintaining ECM integrity during the decellularization process is particularly crucial for functional ovarian tissue engineering, where ECM–follicle interactions play a key role (Wang et al. , 2025; Vasse et al. , 2024; Fiorentino et al., 2023 ; McInnes et al., 2022 ). In our study, freeze-thaw cycles followed by 9-hour incubations in Triton X-100 and SDS effectively removed cells and residual DNA, and yielded scaffolds with preserved macro- and microarchitecture, resembling native tissue. Alongside effective cell removal, the preservation of ovarian microstructures and ECM components is a critical determinant of bioscaffold quality following decellularization (Léon-Félix et al. , 2025). The GAGs and collagen levels remained comparable to controls and stable during in vitro culture for 10 and 12 days, respectively, despite minor microarchitectural changes. Moreover, follicle viability was maintained throughout the culture period, indicating no apparent cytotoxicity. Due to its preserved porous architecture, decellularized extracellular matrix scaffolds are considered suitable for in vitro culture, as it enables efficient diffusion of culture media and promotes nutrient exchange (Nikniaz et al., 2021 ). Follicles cultured in the 3D system exhibited greater intracellular esterase activity, and reduced membrane damage compared to those maintained in the 2D system under identical conditions. These findings indicate that the 3D system alone already provides improved conditions for follicular maintenance, irrespective of culture medium supplementation. Silva et al. ( 2024 ) demonstrated a correlation between non-specific esterase activity and both viability and growth of ovarian follicles in bovine. Accumulating evidence indicates that follicular development relies on dynamic and reciprocal interactions between the follicle and its surrounding microenvironment (Wang et al. , 2025). Thus, dECM scaffolds may offer a supportive mechanical microenvironment by conveying biomechanical cues essential for promoting follicular development (Alshaikh et al., 2020 ). Further, GAGs and other specific ECM domains have a strong binding affinity for growth factors that can be in vitro released and influence follicular development (Francés-Herrero et al., 2024 ; López-Martínez et al., 2021 ; Yan et al., 2018 ). The bioactivity of bovine ovarian dECM has already been demonstrated by Laronda et al. ( 2015 ), who reported estradiol secretion by primary mouse ovarian cells cultured on dECM scaffolds. Similarly, Alaee et al . (2020) showed that preantral follicles cultured in dECM scaffolds exhibited increased diameter, enhanced antral cavity formation, and higher estradiol and progesterone secretion after 12 days of in vitro culture compared to 2D systems. In addition, porcine ovarian cells seeded onto dECM scaffolds expressed key granulosa cell markers, including STAR, CYP11A1, CYP19A1, AMH, FSHR, and LHR (Pennarossa et al., 2021 ), indicating the ability of ECM-based scaffolds ability to drive follicular development in vitro . In this study, the physicochemical characterization of the nanoparticles demonstrated mean sizes below 150 nm for both formulations, a feature commonly associated with efficient cellular uptake (Foroozandeh and Aziz, 2018 ). The PDI values ranged from 0.16 for blank nanoparticles to 0.26 for resveratrol-loaded nanoparticles, indicating moderate size distribution uniformity, which is considered acceptable for drug delivery systems (Danaei et al., 2018 ). Both formulations exhibited negative surface charges, with zeta potential values close to -6 mV. Although low zeta potential magnitudes typically indicate reduced colloidal stability, Freitas et al. (2023) reported that these formulations maintained colloidal stability for up to 90 days. Notably, in our study, RLNP supplementation of culture medium in the 3D system enhanced follicular viability. Transmission electron microscopy revealed that oocytes from follicles cultured with RLNP had a well-preserved zona pellucida, while granulosa cells showed intact mitochondria and endoplasmic reticulum, with no evident ultrastructural damage. Several studies have reported that resveratrol enhances ATP production and mitochondrial biogenesis in mammalian granulosa cells, including those from aged cows, thereby improving mitochondrial function and supporting oocyte development in vitro (Nishigaki et al., 2021 ; Sugiyama et al., 2015 ). As a known Sirtuin-1 (SIRT1) activator, resveratrol upregulates SIRT1 expression and increases ATP levels in bovine oocytes, resulting in improved fertilization outcomes (Takeo et al., 2014 ). In rats, it also promotes TZP synthesis by increasing cytosolic calcium, activating Calcium/Calmodulin Dependent Protein Kinase II Beta (CaMKIIβ), and releasing actin monomers (Chen et al., 2022 ). In our study, the enhanced effect of resveratrol when encapsulated in polymeric nanoparticles strongly suggests that employing this drug delivery system is advantageous, since it can improve the aqueous solubility and bioavailability of resveratrol, enhance its physicochemical stability, and enable targeted and controlled drug release (Freitas et al. , 2023; Summerlin et al., 2015 ). Resveratrol has been widely reported in the literature as exhibiting a potent antioxidant effect in the ovary (Jiang et al., 2024 ; Saber et al., 2024 ). After 12 days of culture, follicles cultured with 0.02 µM RLNP showed reduced mRNA expression of CAT , SOD , PRDX6 , and NRF2 compared to follicles cultured in control medium, although SOD levels were similar to those follicles cultured with unencapsulated resveratrol. Overall, ROS generation modulates transcriptional antioxidant responses by activating signaling pathways and enzymes involved in redox homeostasis and ROS elimination (Ngo et al ., 2022). The NRF2 is a key regulator of antioxidant gene expression and, upon ROS exposure, translocates to the nucleus to induce the transcription of antioxidant enzymes (Espinosa-Diez et al., 2015 ). In our study, it is plausible that RLNP exerted a direct free radical-scavenging effect, contributing to a less oxidative microenvironment, reducing the activation of endogenous antioxidant defenses. As a direct antioxidant agent, resveratrol neutralizes various ROS through hydrogen atom transfer and sequential proton loss electron transfer mechanisms, thereby protecting cellular biomolecules from oxidative damage (Truong et al., 2018 ). The ROS-scavenging properties of resveratrol have been consistently demonstrated in recent studies. Cai et al. ( 2023 ) showed that resveratrol alleviates oxidative stress in rat granulosa cells (GCs) by decreasing intracellular ROS levels, which was accompanied by a reduction in malondialdehyde content. Similarly, Jiang et al. ( 2024 ) observed this antioxidative effect in Bos grunniens granulosa cells, along with a concomitant increase in intracellular glutathione levels. In conclusion, the decellularized bovine ovarian tissue exhibited minimal residual cellular content and well-preserved ECM ultrastructure. The 3D culture system provided a more favorable environment for follicular development compared to the 2D system, especially when supplemented with RLNP. At 0.02 µM, RLNP preserved follicular ultrastructure, maintained essential features such as the zona pellucida, granulosa cells, and intracellular organelles. Moreover, 0.02 µM, RLNP downregulated the expression of CAT, SOD, GPX1, PRDX6 , and NRF2. Declarations Ethical Approval Funding Availability of data and materials All data produced or analyzed during this study are included in this article and can be shared upon reasonable request to the corresponding author. Declaration of competing of interest The authors declare that they have no conflicts of interest. References Ahn JI, Kim GA, Kwon HS, Ahn JY, Hubbell JA, Song YS, Lee ST, Lim JM (2015) Culture of preantral follicles in poly(ethylene) glycol-based, three-dimensional hydrogel: a relationship between swelling ratio and follicular developments. J Tissue Eng Regen Med 9:319-23. https://doi.org/10.1002/term.1824 Alaee S, Asadollahpour R, Hosseinzadeh Colagar A, Talaei-Khozani T (2021) The decellularized ovary as a potential scaffold for maturation of preantral ovarian follicles of prepubertal mice. Syst Biol Reprod Med 67:413-427. https://doi.org/10.1080/19396368.2021.1968542 Almeida GHDR, da Silva-Júnior LN, Gibin MS, Dos Santos H, de Oliveira Horvath-Pereira B, Pinho LBM, Baesso ML, Sato F, Hernandes L, Long CR, Relly L, Miglino MA, Carreira ACO (2023) Perfusion and ultrasonication produce a decellularized porcine whole-ovary scaffold with a preserved microarchitecture. Cells 12:1864. https://doi.org/10.3390/cells12141864 Alshaikh AB, Padma AM, Dehlin M, Akouri R, Song MJ, Brännström M, Hellström M (2020) Decellularization and recellularization of the ovary for bioengineering applications; studies in the mouse. Reprod Biol Endocrinol 18:75. https://doi.org/10.1186/s12958-020-00630-y Azevedo VAN, Barroso PAA, Vasconcelos EM, Costa FC, Assis EIT, Silva BR, Paulino LRM, Silva AWB, Donato MMA, Peixoto CA, Silva JRV, Souza ALP (2022) Effects of Aloe vera extract on growth, viability, ultrastructure and expression of mRNA for antioxidant enzymes in bovine secondary follicles cultured in vitro . Anim Reprod Sci 247:107078. https://doi.org/10.1016/j.anireprosci.2022.107078 Bezerra VS, Costa FC, Caetano Filho FF, Costa JJN, de Lima Neto MF, Furtado CLM, Ceccatto VM, Araújo VR, Silva JRV (2024) Punicalagin increases follicular activation, development and activity of superoxide dismutase 1, catalase, and glutathione peroxidase 1 in cultured bovine ovarian tissues. Reprod Fertil Dev 36:RD24029. https://doi.org/10.1071/RD24029 Bezerra MÉS, Gouveia BB, Barberino RS, Menezes VG, Macedo TJS, Cavalcante AYP, Monte APO, Santos JMS, Matos MHT (2018) Resveratrol promotes in vitro activation of ovine primordial follicles by reducing DNA damage and enhancing granulosa cell proliferation via phosphatidylinositol 3-kinase pathway. Reprod Domest Anim 53:1298-1305. https://doi.org/10.1111/rda.13274 Cai M, Wang J, Sun H, Guo Q, Zhang C, Yao H, Zhao C, Jia Y, Zhu H (2023) Resveratrol attenuates hydrogen peroxide-induced injury of rat ovarian granulosa-lutein cells by resisting oxidative stress via the SIRT1/Nrf2/ARE signaling pathway. Curr Pharm Des 29:947-956. https://doi.org/10.2174/1381612829666230403133322 Cao L, Li S, Huang S, Shi D, Li X (2021) AQP8 participates in estrogen-mediated buffalo follicular development by regulating apoptosis of granulosa cells. Reprod Domest Anim 56: 812-820. https://doi.org/10.1111/rda.13921 Cavalcante de Freitas PG, Rodrigues Arruda B, Araújo Mendes MG, Barroso de Freitas JV, da Silva ME, Sampaio TL, Petrilli R, Eloy JO (2023) Resveratrol-loaded polymeric nanoparticles: the effects of d-α-tocopheryl polyethylene glycol 1000 succinate (TPGS) on physicochemical and biological properties against breast cancer in vitro and in vivo . Cancers (Basel) 15:2802. https://doi.org/10.3390/cancers15102802 Chen M, He C, Zhu K, Chen Z, Meng Z, Jiang X, Cai J, Yang C, Zuo Z (2022) Resveratrol ameliorates polycystic ovary syndrome via transzonal projections within oocyte-granulosa cell communication. Theranostics 12:782-795. https://doi.org/10.7150/thno.67167 Cheng H, Wei F, del Valle JS, Stolk THR, Huirne JA, Asseler JD, Pilgram GSK, van der Westerlaken LAJ, van Mello NM, Chuva de Sousa Lopes SM (2024) In vitro growth of secondary follicles from cryopreserved-thawed ovarian cortex. Hum Reprod 39:2743-2753. https://doi.org/10.1093/humrep/deae240 Chiti MC, Dolmans MM, Orellana O, Soares M, Paulini F, Donnez J, Amorim CA (2016) Influence of follicle stage on artificial ovary outcome using fibrin as a matrix. Hum Reprod 31:2898-2898. https://doi.org/10.1093/humrep/dew254 Costa FC, Silva BR, Filho FFC, Bezerra VS, Azevedo VAN, Silva AA, Silva JRV (2025) Ascorbic acid and resveratrol improve the structural integrity of the extracellular matrix and enhance follicular survival in cultured bovine ovarian tissue. Theriogenology 235:231-244. https://doi.org/10.1016/j.theriogenology.2025.01.020 Dadashzadeh A, Moghassemi S, Peaucelle A, Lucci CM, Amorim CA (2023) Mind the mechanical strength: tailoring a 3D matrix to encapsulate isolated human preantral follicles. Hum Reprod Open 2023:hoad004. https://doi.org/10.1093/hropen/hoad004 Danaei M, Dehghankhold M, Ataei S, Hasanzadeh Davarani F, Javanmard R, Dokhani A, Khorasani S, Mozafari MR (2018) Impact of particle size and polydispersity index on the clinical applications of lipidic nanocarrier systems. Pharmaceutics 10:57. https://doi.org/10.3390/pharmaceutics10020057 Dey P, Monferini N, Donadini L, Lodde V, Franciosi F, Luciano AM (2024) A spotlight on factors influencing the in vitro folliculogenesis of isolated preantral follicles. J Assist Reprod Genet 41:3287-3300. https://doi.org/10.1007/s10815-024-03277-5 Dey P, Monferini N, Donadini L, Lodde V, Franciosi F, Luciano AM (2024) Method of isolation and in vitro culture of primordial follicles in bovine animal model. Methods Mol Biol 2770:171-182. https://doi.org/10.1007/978-1-0716-3698-5_13 Ebrahimi M, Mara L, Succu S, Gadau SD, Palmerini MG, Chessa F, Dattena M, Sotgiu FD, Pasciu V, Mascitti IA, Macchiarelli G, Luciano AM, Berlinguer F (2025) The effect of single versus group culture on cumulus-oocyte complexes from early antral follicles. J Assist Reprod Genet 42:961-976. https://doi.org/10.1007/s10815-025-03404-w Espinosa-Diez C, Miguel V, Mennerich D, Kietzmann T, Sánchez-Pérez P, Cadenas S, Lamas S (2015) Antioxidant responses and cellular adjustments to oxidative stress. Redox Biol 6:183-197. https://doi.org/10.1016/j.redox.2015.07.008 Fiorentino G, Cimadomo D, Innocenti F, Soscia D, Vaiarelli A, Ubaldi FM, Gennarelli G, Garagna S, Rienzi L, Zuccotti M (2023) Biomechanical forces and signals operating in the ovary during folliculogenesis and their dysregulation: implications for fertility. Hum Reprod Update 29:1-23. https://doi.org/10.1093/humupd/dmac031 Foroozandeh P, Aziz AA (2018) Insight into cellular uptake and intracellular trafficking of nanoparticles. Nanoscale Res Lett 13:339. https://doi.org/10.1186/s11671-018-2728-6 Francés-Herrero E, Bueno-Fernandez C, Rodríguez-Eguren A, Gómez-Álvarez M, Faus A, Soto-Prado A, Buigues A, Herraiz S, Pellicer A, Cervelló I (2024) Growth factor-loaded ovarian extracellular matrix hydrogels promote in vivo ovarian niche regeneration and enhance fertility in premature ovarian insufficiency preclinical models. Acta Biomater 186:125-140. https://doi.org/10.1016/j.actbio.2024.07.056 Gaschler MM, Stockwell BR (2017) Lipid peroxidation in cell death. Biochem Biophys Res Commun 48:419-425. https://doi.org/10.1016/j.bbrc.2016.10.086 Harada M, Takahashi N, Azhary JM, Kunitomi C, Fujii T, Osuga Y (2021) Endoplasmic reticulum stress: a key regulator of the follicular microenvironment in the ovary. Mol Hum Reprod 27:gaaa088. https://doi.org/10.1093/molehr/gaaa088 He J, Zhong Y, Li Y, Liu S, Pan X (2025) Astaxanthin alleviates oxidative stress in mouse preantral follicles and enhances follicular development through the AMPK signaling pathway. Int J Mol Sci 26:2241. https://doi.org/10.3390/ijms26052241 Jachter SL, Simmons WP, Estill C, Xu J, Bishop CV (2022) Matrix-free three-dimensional culture of bovine secondary follicles to antral stage: Impact of media formulation and epidermal growth factor (EGF). Theriogenology 181:89-94. https://doi.org/10.1016/j.theriogenology.2022.01.013 Jiang X, Ma Y, Gong S, Zi X, Zhang D (2024) Resveratrol promotes proliferation, antioxidant properties, and progesterone production in yak (Bos grunniens) granulosa cells. Animals (Basel) 14:240. https://doi.org/10.3390/ani14020240 Joo S, Oh SH, Sittadjody S, Opara EC, Jackson JD, Lee SJ, Yoo JJ, Atala A (2016) The effect of collagen hydrogel on 3D culture of ovarian follicles. Biomed Mater 11:065009. https://doi.org/10.1088/1748-6041/11/6/065009 Kussano NR, Franco MM, Dode MAN (2024) Biochemical profiling of the follicular environment to predict oocyte competence in cattle. PLoS One 19:e0298316. https://doi.org/10.1371/journal.pone.0298316 Laronda MM, Jakus AE, Whelan KA, Wertheim JA, Shah RN, Woodruff TK (2015) Initiation of puberty in mice following decellularized ovary transplant. Biomaterials 50:20-29. https://doi.org/10.1016/j.biomaterials.2015.01.051 León-Félix CM, Ouni E, Herinckx G, Vertommen D, Amorim CA, Lucci CM (2025) Decellularized extracellular matrix from bovine ovarian tissue maintains the protein composition of the native matrisome. J Proteomics 311:105347. https://doi.org/10.1016/j.jprot.2024.105347 León-Félix CM, Maranhão AQ, Amorim CA, Lucci CM (2024) Optimizing decellularization of bovine ovarian tissue: toward a transplantable artificial ovary scaffold with minimized residual toxicity and preserved extracellular matrix morphology. Cells Tissues Organs 213:413-423. https://doi.org/10.1159/000537838 López-Martínez S, Rodríguez-Eguren A, de Miguel-Gómez L, Barceló H, Berenguer-Izquierdo A, Vinader-Capello F, García-Sancho C (2021) Bioengineered endometrial hydrogels with growth factors promote tissue regeneration and restore fertility in murine models. Acta Biomater 135:113-125. https://doi.org/10.1016/j.actbio.2021.08.025 Macedo TJS, Barros VRP, Monte APO, Alves VC, Gabriel CN, Wischral CA (2017) Resveratrol has dose-dependent effects on DNA fragmentation and mitochondrial activity of ovine secondary follicles cultured in vitro . Zygote 25:434-442. https://doi.org/10.1017/S0967199417000193 McInnes AD, Moser MAJ, Chen X, Wijeratne K, Hutson DA (2022) Preparation and use of decellularized extracellular matrix for tissue engineering. J Funct Biomater 13:240. https://doi.org/10.3390/jfb13040240 Moreira-Pinto B, Costa L, Felgueira E, Fonseca BM, Rebelo I (2021) Low doses of resveratrol protect human granulosa cells from induced-oxidative stress. Antioxidants (Basel) 10:561. https://doi.org/10.3390/antiox10040561 Nascimento DR, Azevedo VAN, Barroso PAA, Barrozo LG, Silva BR, Silva AWB, Donato MAM, Peixoto CA, Silva JRV (2022) Effects of n-acetylcysteine on growth, viability, and ultrastructure of in vitro cultured bovine secondary follicles. Animals (Basel) 12:3190. https://doi.org/10.3390/ani12223190 Ngo V, Duennwald ML (2022) Nrf2 and oxidative stress: a general overview of mechanisms and implications in human disease. Antioxidants (Basel) 11:2345. https://doi.org/10.3390/antiox11122345 Nishigaki A, Tsubokura H, Tsuzuki-Nakao T, Okada H (2021) Hypoxia: Role of SIRT1 and the protective effect of resveratrol in ovarian function. Reprod Med Biol 21:e12428. https://doi.org/10.1002/rmb2.12428 Nikniaz H, Zandieh Z, Nouri M, Daei-farshbaf N, Aflatoonian R, Gholipourmalekabadi M, Jameie SB (2021) Comparing various protocols of human and bovine ovarian tissue decellularization to prepare extracellular matrix-alginate scaffold for better follicle development in vitro . BMC Biotechnol 21:8. https://doi.org/10.1186/s12896-020-00658-3 Paulino LRFM, Cunha EV, Barbalho Silva AW, Souza GB, Lopes EPF, Donato MAM, Peixoto CA, Silva JRV (2018) Effects of tumour necrosis factor-alpha and interleukin-1 beta on in vitro development of bovine secondary follicles. Reprod Domest Anim 53:997-1005. https://doi.org/10.1111/rda.13199 Pennarossa G, De Iorio T, Gandolfi F, Brevini TAL (2021) Ovarian decellularized bioscaffolds provide an optimal microenvironment for cell growth and differentiation in vitro . Cells 10:2126. https://doi.org/10.3390/cells10082126 Rittié L (2017) Method for picrosirius red-polarization detection of collagen fibers in tissue sections. Methods Mol Biol 1627:395-407. https://doi.org/10.1007/978-1-4939-7113-8_26 Rocha-Frigoni NAS, Leão BCS, Dall’Acqua PC, Mingoti GZ (2016) Improving the cytoplasmic maturation of bovine oocytes matured in vitro with intracellular and/or extracellular antioxidants is not associated with increased rates of embryo development. Theriogenology 86:1897-1905. https://doi.org/10.1016/j.theriogenology.2016.06.009 Saber YHA, Ibrahim S, Mahmoud KGM, Ahmed WM, Ragab RSA, Seida AAM (2024) Expression profile of viability and stress response genes as a result of resveratrol supplementation in vitrified and in vitro produced cattle embryos. Mol Biol Rep 51:692. https://doi.org/10.1007/s11033-024-09614-2 Silva BR, Costa FC, De Lima Neto MF, Caetano Filho FF, de Assis EIT, Aguiar FLN, Silva AWB, Costa JJN, Silva J (2024) Melatonin acts through different mechanisms to control oxidative stress and primordial follicle activation and survival during in vitro culture of bovine ovarian tissue. Domest. Anim. Endocrinol. 86:106824. https://doi.org/10.1016/j.domaniend.2023.106824 Silva BR, Nascimento DR, Costa FC, Caetano Filho FF, de Assis EIT, Aguiar FLN, Silva AWB, Costa JJN, Silva JRV (2024) Melatonin improves the viability and ultrastructure of bovine oocyte-granulosa complexes of in vitro cultured early antral follicles. Reprod Domest Anim 59:e14543. https://doi.org/10.1111/rda.14543 Silva RLDS, de Sousa Barberino R, Tavares de Matos MHT (2023) Impact of antioxidant supplementation during in vitro culture of ovarian preantral follicles: a review. Theriogenology 207:110-122. https://doi.org/10.1016/j.theriogenology.2023.05.027 Summerlin N, Soo E, Thakur S, Qu Z, Jambhrunkar S, Popat A (2015) Resveratrol nanoformulations: challenges and opportunities. Int J Pharm 479:282-290. https://doi.org/10.1016/j.ijpharm.2015.01.003 Sugiyama M, Kawahara-Miki R, Kawana H, Shirasuna K, Kuwayama T, Iwata H (2015) Resveratrol-induced mitochondrial synthesis and autophagy in oocytes derived from early antral follicles of aged cows. J Reprod Dev 61:251-259. https://doi.org/10.1262/jrd.2015-001 Takeo S, Sato D, Kimura K, Monji Y, Kuwayama T, Kawahara-Miki R, Iwata H (2014) Resveratrol improves the mitochondrial function and fertilization outcome of bovine oocytes. J Reprod Dev 60:92-99. https://doi.org/10.1262/jrd.2013-102 Truong VL, Jun M, Jeong WS (2018) Role of resveratrol in regulation of cellular defense systems against oxidative stress. Biofactors 44:36–49. https://doi.org/10.1002/biof.1399 Vasse J, Fiscus J, Fraison E, Salle B, David L, Labrune E (2025) Biomechanical properties of ovarian tissue and their impact on the activation of follicular growth: a narrative review. Reprod. Biomed. Online 50:104450. https://doi.org/10.1016/j.rbmo.2024.104450 Wang H, Yang L (2025) Ovarian mechanobiology: understanding the interplay between mechanics and follicular development. Cells 14:355. https://doi.org/10.3390/cells14050355 Wang J, Du H, Ma L, Feng M, Li L, Zhao X, Dai Y (2023) MitoQ protects ovarian organoids against oxidative stress during oogenesis and folliculogenesis in vitro. Int. J. Mol. Sci. 24:924. https://doi.org/10.3390/ijms24020924 Wang L, Tang J, Wang L, Tan F, Song H, Zhou J, Li F (2021) Oxidative stress in oocyte aging and female reproduction. J. Cell. Physiol. 236:7966-7983. https://doi.org/10.1002/jcp.30468 Yan HJ, Casalini T, Hulsart-Billström G (2018) Synthetic design of growth factor sequestering extracellular matrix mimetic hydrogel for promoting in vivo bone formation. Biomaterials 161:190-202. https://doi.org/10.1016/j.biomaterials.2018.01.041 Zhao X, Zhang S, Gao S, Chang H-M, Leung PCK, Tan J (2023) A novel three-dimensional follicle culture system decreases oxidative stress and promotes the prolonged culture of human granulosa cells. ACS Appl Mater Interfaces 15:15084-15095. https://doi.org/10.1021/acsami.2c18734 Zheng M, Cadenas J, Pors SE, Esa T, Kristensen SG, Mamsen LS, Adrados CS, Andersen CY (2023) Reducing 3D hydrogel stiffness, addition of estradiol in a physiological concentration and increasing FSH concentration improve in vitro growth of murine preantral follicles. Int. J. Mol. Sci. 24:12499. https://doi.org/10.3390/ijms241512499 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 17 Nov, 2025 Reviews received at journal 03 Nov, 2025 Reviews received at journal 28 Oct, 2025 Reviewers agreed at journal 25 Oct, 2025 Reviewers agreed at journal 25 Oct, 2025 Reviewers agreed at journal 15 Oct, 2025 Reviewers agreed at journal 10 Oct, 2025 Reviewers invited by journal 05 Oct, 2025 Editor assigned by journal 02 Oct, 2025 Submission checks completed at journal 02 Oct, 2025 First submitted to journal 01 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7760007","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":530158076,"identity":"efd7b816-ccbc-4b6a-964c-c286a674d991","order_by":0,"name":"Francisco Chagas Costa","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/klEQVRIiWNgGAWjYBACA2YGhg8gGsKtOACmDjzAr4VxBlQLYwPDmQMMPCAtCfi0MCBrYWyDaGHAp8Wcnflgc0XNHWP+9vbnD37OuyNnL3b4IdAWOzndBuxaLJvZEhvPHHtmJnHmjGFj77ZnxjzSaQZALcnGZgdwOOwwj/nDBrbDNgYSOYwNvNsOJ/ZIJ4C0HEjchluLYWPDP5CW9IeNf+eAtKR/IKylse2wmYFEgmEzbwNISw5+W8B+aew7bAzyy2yZY4eNeW7nFBxIMMDtF3P+wwcbG74dNuxvb3/w8U3NYTn22embP3yosJPDpQUXMCBN+SgYBaNgFIwCVAAAovln07XEr2QAAAAASUVORK5CYII=","orcid":"","institution":"Federal University of Ceará","correspondingAuthor":true,"prefix":"","firstName":"Francisco","middleName":"Chagas","lastName":"Costa","suffix":""},{"id":530158077,"identity":"1672fcc0-55bb-48be-9bb1-f9127a2efa00","order_by":1,"name":"Ernando Igo Teixeira Assis","email":"","orcid":"","institution":"Federal University of Ceará","correspondingAuthor":false,"prefix":"","firstName":"Ernando","middleName":"Igo Teixeira","lastName":"Assis","suffix":""},{"id":530158078,"identity":"a0a8be0f-5641-4b65-8e5b-6defaff23e99","order_by":2,"name":"Danisvânia Ripardo Nascimento","email":"","orcid":"","institution":"Federal University of Ceará","correspondingAuthor":false,"prefix":"","firstName":"Danisvânia","middleName":"Ripardo","lastName":"Nascimento","suffix":""},{"id":530158079,"identity":"dab200da-856f-4995-999e-28086e398d11","order_by":3,"name":"Miguel Fernandes Lima Neto","email":"","orcid":"","institution":"Federal University of Ceará","correspondingAuthor":false,"prefix":"","firstName":"Miguel","middleName":"Fernandes Lima","lastName":"Neto","suffix":""},{"id":530158080,"identity":"4aa29263-f48d-431f-837a-82f8973bfcd5","order_by":4,"name":"Andreza Aguiar Silva","email":"","orcid":"","institution":"Federal University of Ceará","correspondingAuthor":false,"prefix":"","firstName":"Andreza","middleName":"Aguiar","lastName":"Silva","suffix":""},{"id":530158081,"identity":"1320ce35-23b9-4afd-8cfe-f51dcb32ef07","order_by":5,"name":"Venância Antônia Nunes Azevedo","email":"","orcid":"","institution":"Federal University of Ceará","correspondingAuthor":false,"prefix":"","firstName":"Venância","middleName":"Antônia Nunes","lastName":"Azevedo","suffix":""},{"id":530158082,"identity":"705a9a20-6c17-4a43-8e5b-71ac8226188c","order_by":6,"name":"Regislane Pinto Ribeiro","email":"","orcid":"","institution":"Federal University of Ceará","correspondingAuthor":false,"prefix":"","firstName":"Regislane","middleName":"Pinto","lastName":"Ribeiro","suffix":""},{"id":530158083,"identity":"12696133-c96b-4ce8-8dc4-87c2a5549197","order_by":7,"name":"Bianca Régia Silva","email":"","orcid":"","institution":"State University of Ceará - UECE","correspondingAuthor":false,"prefix":"","firstName":"Bianca","middleName":"Régia","lastName":"Silva","suffix":""},{"id":530158084,"identity":"88db9d00-d2a8-439a-be8c-0d979ea611e2","order_by":8,"name":"Mariana Aragão Matos Donato","email":"","orcid":"","institution":"Federal University of Pernambuco","correspondingAuthor":false,"prefix":"","firstName":"Mariana","middleName":"Aragão Matos","lastName":"Donato","suffix":""},{"id":530158085,"identity":"9b054b90-de12-4cc1-aac9-158ad5b0fa80","order_by":9,"name":"Alice Vitória Frota Reis","email":"","orcid":"","institution":"Universidade Federal do Ceará","correspondingAuthor":false,"prefix":"","firstName":"Alice","middleName":"Vitória Frota","lastName":"Reis","suffix":""},{"id":530158086,"identity":"c46248ba-f8c4-4c47-b6de-85971f91ce3a","order_by":10,"name":"Josimar Oliveira Eloy","email":"","orcid":"","institution":"Federal University of Ceará","correspondingAuthor":false,"prefix":"","firstName":"Josimar","middleName":"Oliveira","lastName":"Eloy","suffix":""},{"id":530158092,"identity":"2611be56-bb94-4aa6-9256-da7789e0a2d8","order_by":11,"name":"José Roberto Viana Silva","email":"","orcid":"","institution":"Federal University of Ceará","correspondingAuthor":false,"prefix":"","firstName":"José","middleName":"Roberto Viana","lastName":"Silva","suffix":""}],"badges":[],"createdAt":"2025-10-01 13:38:33","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7760007/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7760007/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":93679924,"identity":"a5080124-f8e6-452b-a5e2-facf1b1b47e5","added_by":"auto","created_at":"2025-10-16 11:56:10","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11767590,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1..tif","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/15abf382fb61d343bfb05088.tif"},{"id":93679918,"identity":"ac7818b8-83fc-4948-a010-0cd0ab2777cf","added_by":"auto","created_at":"2025-10-16 11:56:10","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":71092,"visible":true,"origin":"","legend":"","description":"","filename":"Anonymizedmanuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/01f2172a27d6674fcd91a542.docx"},{"id":93679919,"identity":"81f85d44-3888-4c17-af86-64daa4cfcf9c","added_by":"auto","created_at":"2025-10-16 11:56:10","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6684648,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2..tif","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/932ed3ad7fa06928dac2cf6e.tif"},{"id":93679940,"identity":"61a78f89-fd7f-47cf-b58b-20af404150a2","added_by":"auto","created_at":"2025-10-16 11:56:11","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12987996,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3..tif","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/d35489d3133c4b4ca4e5b059.tif"},{"id":93679943,"identity":"d5fdfcd6-3792-4787-84e4-7dd5bc072e03","added_by":"auto","created_at":"2025-10-16 11:56:11","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13104662,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4..tif","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/abe1f53e12052fdd42a12143.tif"},{"id":93681311,"identity":"e5bf2e8a-3073-4500-9b79-72674caf5ee1","added_by":"auto","created_at":"2025-10-16 12:12:10","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4325484,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.5..tif","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/acee411d0bfd4c470420df45.tif"},{"id":93679936,"identity":"368dac30-18cf-4513-ab77-9349cecf7d87","added_by":"auto","created_at":"2025-10-16 11:56:10","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9485262,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.6..tif","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/b9b837d5bb130a27b1977bb4.tif"},{"id":93680384,"identity":"bd767287-07a0-4bed-9690-1af26630da24","added_by":"auto","created_at":"2025-10-16 12:04:10","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":739764,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.7..tif","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/e0117efff08be59e33a0bc5b.tif"},{"id":93679922,"identity":"9838bbab-c902-452e-b6f9-6e9c190be6b2","added_by":"auto","created_at":"2025-10-16 11:56:10","extension":"json","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12842,"visible":true,"origin":"","legend":"","description":"","filename":"9748b8d1b8f647e1a56d897b10d746d9.json","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/07808c73b87f925fd2644824.json"},{"id":93679926,"identity":"86dd4e17-9a5d-4085-829f-837f9c1ae764","added_by":"auto","created_at":"2025-10-16 11:56:10","extension":"xml","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":166555,"visible":true,"origin":"","legend":"","description":"","filename":"9748b8d1b8f647e1a56d897b10d746d91enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/a3d5b2e33d87c6133a7ed944.xml"},{"id":93680388,"identity":"dc314931-acaf-4f8d-9aee-d6104d56b59c","added_by":"auto","created_at":"2025-10-16 12:04:10","extension":"tif","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11767590,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1..tif","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/695ed1e8da142a9bd27eda2d.tif"},{"id":93679935,"identity":"bfcaf6f9-a858-4fa2-a805-609642ebf780","added_by":"auto","created_at":"2025-10-16 11:56:10","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6684648,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2..tif","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/8faae60220bb4bcb4f577f42.tif"},{"id":93680390,"identity":"3684d974-7e30-4e97-bfc5-7bcb4944034f","added_by":"auto","created_at":"2025-10-16 12:04:11","extension":"tif","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12987996,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3..tif","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/62003f231efe2cf4f9a903d9.tif"},{"id":93679948,"identity":"e47f31e0-4c47-4b11-a2b7-b8ebc7277ca8","added_by":"auto","created_at":"2025-10-16 11:56:11","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13104662,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4..tif","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/fca9e93637c4a05103310723.tif"},{"id":93679938,"identity":"08a6158f-333b-4f40-93c5-3d7f7572b9ba","added_by":"auto","created_at":"2025-10-16 11:56:11","extension":"tif","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4325484,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.5..tif","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/5e7009a46689d4af5a3a1b4b.tif"},{"id":93679946,"identity":"7244e077-1872-49db-8c34-02fea3dee567","added_by":"auto","created_at":"2025-10-16 11:56:11","extension":"tif","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9485262,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.6..tif","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/ec817ab51a1bd67d65581c9b.tif"},{"id":93680389,"identity":"2b481d15-f31f-47f8-a06b-128011f6eab7","added_by":"auto","created_at":"2025-10-16 12:04:10","extension":"tif","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":739764,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.7..tif","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/bc1e5c3e4dbdd149c51fd771.tif"},{"id":93679937,"identity":"aaeadbbc-3c33-4c84-8ad2-2542c35a362e","added_by":"auto","created_at":"2025-10-16 11:56:10","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1211593,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.1..png","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/217e3edd79d66d05285417c6.png"},{"id":93680392,"identity":"7e2382c5-ceab-4a1b-a842-4bbc3d26bc96","added_by":"auto","created_at":"2025-10-16 12:04:11","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4343662,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.2..png","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/bf29a0c8e31138e0a9a15ce7.png"},{"id":93679942,"identity":"292a8742-3fdf-4327-bdd5-35c9249be95e","added_by":"auto","created_at":"2025-10-16 11:56:11","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1930060,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.3..png","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/621bb77b2fb5f5f31005dc77.png"},{"id":93681312,"identity":"5683c05f-9737-479d-81d3-d068a0fda611","added_by":"auto","created_at":"2025-10-16 12:12:11","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1729384,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.4..png","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/3c6401f62a12336d2ada93fd.png"},{"id":93679944,"identity":"5999bc63-9f17-48d5-bfdd-0ec234b991ce","added_by":"auto","created_at":"2025-10-16 11:56:11","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":371416,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.5..png","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/d62b4bdf78cd417945beea0e.png"},{"id":93679941,"identity":"af955cb3-b1a1-447c-843d-064e0508f786","added_by":"auto","created_at":"2025-10-16 11:56:11","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2584165,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.6..png","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/fe0c075c4bee37ee980ccf0a.png"},{"id":93679953,"identity":"2db1bc42-2717-4798-b263-504a7bd57802","added_by":"auto","created_at":"2025-10-16 11:56:11","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":137354,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.7..png","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/edca866ac29d059d6f90b046.png"},{"id":93679929,"identity":"35988e77-1d66-4f2b-bed6-f180781a38fe","added_by":"auto","created_at":"2025-10-16 11:56:10","extension":"xml","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":165307,"visible":true,"origin":"","legend":"","description":"","filename":"9748b8d1b8f647e1a56d897b10d746d91structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/176435d5f2cf73059979c4b7.xml"},{"id":93680393,"identity":"d40a9148-f5c8-416f-9a23-4a8e47ccaeaa","added_by":"auto","created_at":"2025-10-16 12:04:11","extension":"html","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":176289,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/7e29fca67160f20f914addd4.html"},{"id":93680383,"identity":"8cfd2720-c9f5-400e-b528-ac6d5dfb948c","added_by":"auto","created_at":"2025-10-16 12:04:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":19797142,"visible":true,"origin":"","legend":"\u003cp\u003eMacroscopic images of native (control group) and decellularized bovine ovarian tissue (dECM group) \u003cstrong\u003e(A, B)\u003c/strong\u003e (Magnification = 25×; scale bar = 1mm). Corresponding hematoxylin-eosin staining \u003cstrong\u003e(C, D)\u003c/strong\u003e, and\u003cstrong\u003e \u003c/strong\u003eHoechst staining \u003cstrong\u003e(E, F)\u003c/strong\u003e(Magnification = 400×; scale bar = 100 μm). Quantification of stromal cell density \u003cstrong\u003e(G)\u003c/strong\u003e, and Hoechst fluorescence intensity \u003cstrong\u003e(H)\u003c/strong\u003e in native and dECM ovarian tissues. a, b, c: Different lowercase letters indicate statistically significant differences between treatments (P \u0026lt; 0.05)\u003c/p\u003e","description":"","filename":"Fig.1..png","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/3b16132a4426b5512b216a8f.png"},{"id":93680385,"identity":"4f6b40be-4166-4213-b6f1-9a961ea7c9e9","added_by":"auto","created_at":"2025-10-16 12:04:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":9826686,"visible":true,"origin":"","legend":"\u003cp\u003eScanning electron micrographs showing the microarchitecture of native ovarian tissue \u003cstrong\u003e(A)\u003c/strong\u003e, dECM immediately after decellularization \u003cstrong\u003e(B)\u003c/strong\u003e, and after 12 days in culture \u003cstrong\u003e(C)\u003c/strong\u003e. Magnification = 5,000×; scale bar = 10 μm\u003c/p\u003e","description":"","filename":"Fig.2..png","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/e47bd16672767ff53ea22258.png"},{"id":93679928,"identity":"933ca61c-4272-4912-8b03-a75aa64156cb","added_by":"auto","created_at":"2025-10-16 11:56:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":21745794,"visible":true,"origin":"","legend":"\u003cp\u003eHistochemical staining of native (control group) and decellularized bovine ovarian tissue (dECM group). Picrosirius red staining for collagen \u003cstrong\u003e(A, B)\u003c/strong\u003e, and Alcian blue staining for glycosaminoglycans \u003cstrong\u003e(C, D)\u003c/strong\u003e (magnification: 400×; scale bar = 100 μm). Quantification of collagen content \u003cstrong\u003e(E)\u003c/strong\u003e, and glycosaminoglycans \u003cstrong\u003e(F)\u003c/strong\u003e. a, b, c: Different lowercase letters indicate statistically significant differences between treatments (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05)\u003c/p\u003e","description":"","filename":"Fig.3..png","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/f594a0445b24b32a2f75cf6c.png"},{"id":93680386,"identity":"9a7b2ae8-aca4-45c8-baaf-066f702c12cf","added_by":"auto","created_at":"2025-10-16 12:04:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":21107520,"visible":true,"origin":"","legend":"\u003cp\u003eStructural remodeling of collagen \u003cstrong\u003e(A–G)\u003c/strong\u003e and GAGs \u003cstrong\u003e(H–N)\u003c/strong\u003e in decellularized ovarian scaffolds over 14 days of \u003cem\u003ein vitro\u003c/em\u003e culture. Quantitative analysis of collagen \u003cstrong\u003e(O)\u003c/strong\u003e and GAG content \u003cstrong\u003e(P) \u003c/strong\u003ethroughout the culture period. Black arrowheads indicate collagen fiber disruption points on day 14. Magnification = 400×; scale bar = 100 μm. Asterisks indicate statistically significant differences between time points (P \u0026lt; 0.05)\u003c/p\u003e","description":"","filename":"Fig.4..png","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/bb449260d634980ba3da26e1.png"},{"id":93680382,"identity":"782b7a43-b07d-4e64-a54a-5f46d11bbfda","added_by":"auto","created_at":"2025-10-16 12:04:10","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":7289967,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative images of secondary follicles in bright field (left column), stained with calcein-AM (middle column), or EthD-1 (right column): fresh control \u003cstrong\u003e(A–C)\u003c/strong\u003e; 2D system with TCM-199 alone \u003cstrong\u003e(D–F)\u003c/strong\u003e; 3D system with TCM-199 alone \u003cstrong\u003e(G–I\u003c/strong\u003e); or supplemented with 0.02 \u003cstrong\u003e(J–L)\u003c/strong\u003e, 0.2 \u003cstrong\u003e(M–O)\u003c/strong\u003e, or 2 µM \u003cstrong\u003e(P–R)\u003c/strong\u003e resveratrol-loaded nanoparticles, blank nanoparticles \u003cstrong\u003e(S–U)\u003c/strong\u003e, or unencapsulated resveratrol \u003cstrong\u003e(V–X)\u003c/strong\u003e. Quantification of calcein-AM \u003cstrong\u003e(Y)\u003c/strong\u003e and EthD-1\u003cstrong\u003e (Z) \u003c/strong\u003efluorescence. Scale bar = 50 µm\u003c/p\u003e","description":"","filename":"Fig.5..png","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/5739a275a3de24fc7f44e1d9.png"},{"id":93679932,"identity":"540fafd5-6554-4b35-842c-b6dfa36d9372","added_by":"auto","created_at":"2025-10-16 11:56:10","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":15392386,"visible":true,"origin":"","legend":"\u003cp\u003eElectron micrograph of oocyte (left column), and granulosa cells (right column) from secondary follicles cultured in 2D system in TCM-199\u003csup\u003e+\u003c/sup\u003e \u003cstrong\u003e(A, B)\u003c/strong\u003e or in 3D system in TCM-199\u003csup\u003e+ \u003c/sup\u003esupplemented with resveratrol-loaded nanoparticles 0.02 μM \u003cstrong\u003e(C, D)\u003c/strong\u003e, blank nanoparticles \u003cstrong\u003e(E, F) \u003c/strong\u003eor nonencapsulated resveratrol \u003cstrong\u003e(G, H)\u003c/strong\u003e. Red arrowheads indicate gaps between adjacent granulosa cells. Scale bar = 5 μm (A, E, and G); 2 μm (B, C, D, F, and H). Symbols: ZP, zona pellucida; G, granulosa cells; N, nucleus; M, mitochondria; R, reticulum; V, vacuoles; n, nucleolus\u0026nbsp;\u0026nbsp;\u0026nbsp;\u003c/p\u003e","description":"","filename":"Fig.6..png","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/74ddfad3cb4fa375e4928ddd.png"},{"id":93679920,"identity":"b779223d-ac36-49b7-b12c-8f098eb8b051","added_by":"auto","created_at":"2025-10-16 11:56:10","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1646920,"visible":true,"origin":"","legend":"\u003cp\u003eRelative mRNA expression levels of \u003cem\u003eCAT \u003c/em\u003e\u003cstrong\u003e(A)\u003c/strong\u003e, \u003cem\u003eSOD \u003c/em\u003e\u003cstrong\u003e(B)\u003c/strong\u003e, \u003cem\u003eGPX1 \u003c/em\u003e\u003cstrong\u003e(C)\u003c/strong\u003e, \u003cem\u003ePRDX6 \u003c/em\u003e\u003cstrong\u003e(D)\u003c/strong\u003e, or \u003cem\u003eNRF2 \u003c/em\u003e\u003cstrong\u003e(E)\u003c/strong\u003e in secondary follicles cultured in dECM for 12 days in TCM199\u003csup\u003e+ \u003c/sup\u003ealone or supplemented with 0.02 mM resveratrol-loaded nanoparticles, 0.2 mM blank nanoparticles or 2 mM nonencapsulated resveratrol. a, b, c: Different lowercase letters indicate statistically significant differences between treatments (P \u0026lt; 0.05)\u003c/p\u003e","description":"","filename":"Fig.7..png","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/8d49d730b70b7fdf51d35e87.png"},{"id":93681527,"identity":"cb8a12aa-c3fc-4636-b374-dd267e8f7b89","added_by":"auto","created_at":"2025-10-16 12:20:50","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":92520262,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7760007/v1/0286eb4c-4117-43e0-830d-d0be5d07b32f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Decellularized ovarian bioscaffolds and resveratrol-loaded polymeric nanoparticles improve in vitro development of bovine preantral follicles","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eMost of the ovarian follicles are lost due to atresia, which is significantly increased beyond the secondary follicular stage in bovine species (Dey et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2024\u003c/span\u003ea; Dey et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2024\u003c/span\u003eb). This physiological follicular depletion reinforces the need for improvement of reproductive biotechnologies capable of utilizing the pool of early follicles. The \u003cem\u003ein vitro\u003c/em\u003e culture (IVC) of secondary follicles isolated from bovine ovaries is a key tool to elucidate their specific requirements for development up to maturation stages and to improve the use of ovarian reserve by assisted reproductive technologies (Ebrahime \u003cem\u003eet al\u003c/em\u003e., 2025). Despite efforts to establish a suitable IVC system for secondary follicles (Cheng et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Jachter et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), obtaining matured oocytes from isolated bovine secondary follicles cultured \u003cem\u003ein vitro\u003c/em\u003e remains unsuccessful (Azevedo et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Nascimento et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Paulino et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), underscoring the challenge of reproducing the physiological conditions required for complete follicular development.\u003c/p\u003e\u003cp\u003eRecent evidences have shown that follicles are highly responsive to biomechanical signals originating from the ovarian stroma that act during folliculogenesis (Wang \u003cem\u003eet al.\u003c/em\u003e, 2025). The coordinated activity of these mechanical cues, along with endocrine and paracrine signaling, shapes individual cells, oocytes, and the entire follicle (Zhao et al., \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Thus, after isolation, secondary follicles are challenging to \u003cem\u003ein vitro\u003c/em\u003e culture without the supporting structure of the ovary (Alshaikh et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Therefore, biocompatible scaffolds to encapsulate isolated follicles can provide a suitable environment for their \u003cem\u003ein vitro\u003c/em\u003e development (Dadashzadeh et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Ovarian follicles have been cultured in a three-dimensional culture system using different biomaterials, such as alginate (Zheng et al., \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), collagen (Joo et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), fibrin (Chiti et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), and polyethylene glycol (Ahn et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). However, none of these materials have demonstrated the ability to fully replicate all the functions of the native ovarian ECM, including cellular support and regulatory roles (Le\u0026oacute;n-F\u0026eacute;lix et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Several studies have proposed the use of decellularized ovarian extracellular matrix (dECM) as a natural scaffold that closely mimics the native ovarian extracellular matrix (ECM) (Franc\u0026eacute;s-Herrero et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Almeida et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). For instance, Laronda et al. (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) showed that bovine ovarian dECM positively influenced murine primary ovarian cells and stimulated the formation of follicle-like structures \u003cem\u003ein vitro\u003c/em\u003e. However, the effect of dECM on the \u003cem\u003ein vitro\u003c/em\u003e development of isolated follicles in bovine species remains unexplored.\u003c/p\u003e\u003cp\u003e\u003cem\u003eIn vitro\u003c/em\u003e redox dysregulation is also correlated with poor follicular quality after culturing (He et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Bezerra et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Azevedo et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). During \u003cem\u003ein vitro\u003c/em\u003e culture of follicles, various factors, such as ischemia, ovarian fragmentation, manipulation, and light exposure can increase the generation of reactive oxygen species (ROS) that leads to oxidative stress (Costa et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Elevated ROS levels are linked with a reduction in follicular viability, lipid peroxidation leading to changes in membrane permeability and selectivity (Gashler \u003cem\u003eet al.\u003c/em\u003e, 2017), vacuolization and degeneration of mitochondrial cristae and matrix (Wang et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), endoplasmic reticulum stress (Harada et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), and zona pellucida (ZP) damage (Wang et al., \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Consequently, antioxidant supplementation of the culture medium has been proposed to maintain the redox balance during \u003cem\u003ein vitro\u003c/em\u003e ovarian follicles culture (Silva et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Moreover, the expression levels of enzymatic antioxidants such as catalase (\u003cem\u003eCAT\u003c/em\u003e), superoxide dismutase (\u003cem\u003eSOD\u003c/em\u003e), glutathione peroxidase (\u003cem\u003eGPX\u003c/em\u003e), peroxiredoxin (\u003cem\u003ePRDX\u003c/em\u003e), and nuclear factor erythroid 2-related factor 2 (\u003cem\u003eNRF2\u003c/em\u003e) are frequently used as indicators of the antioxidant capacity of \u003cem\u003ein vitro\u003c/em\u003e culture systems.\u003c/p\u003e\u003cp\u003eAmong the natural phenolic compounds, resveratrol is known for improving follicular development \u003cem\u003ein vitro\u003c/em\u003e through its anti-apoptotic and antioxidant properties (Costa et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Macedo et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Bezerra et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Although promising results have been reported, its low water solubility (~\u0026thinsp;3 mg/100 mL) and rapid metabolism can impact its bioavailability, limiting the extent to which its free form exerts its effects (Freitas \u003cem\u003eet al.\u003c/em\u003e, 2023; Moreira-Pinto et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In this context, encapsulating resveratrol within polymeric nanoparticles is a promising strategy, as it can enhance the effectiveness of its action. The advantages of polymeric nanoparticles include superior biocompatibility compared to other materials, minimal toxicity, capable of sustained drug release, and biodegradability (Freitas \u003cem\u003eet al.\u003c/em\u003e, 2023).\u003c/p\u003e\u003cp\u003eThis study aimed to decellularize and characterize bovine ovarian tissue and to evaluate its effect on the follicle viability and ultrastructure, and expression of mRNA for \u003cem\u003eCAT, SOD, GPX1, PRDX6\u003c/em\u003e, and \u003cem\u003eNRF2\u003c/em\u003e in bovine secondary follicles cultured in medium supplemented with different concentration of \u003cem\u003ein vitro\u003c/em\u003e resveratrol-loaded polymeric nanoparticles.\u003c/p\u003e"},{"header":"2 Material e methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Chemicals\u003c/h2\u003e\u003cp\u003eCulture media and other chemicals used in the present study were purchased from Sigma-Aldrich (St. Louis, MO, USA), unless otherwise specified in the text.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Synthesis and physicochemical characterization of resveratrol-loaded polymeric nanoparticles\u003c/h2\u003e\u003cp\u003ePolymeric nanoparticles were prepared using the nanoprecipitation method, as described by de Freitas \u003cem\u003eet al.\u003c/em\u003e (2023). The mean particle size, polydispersity index (PDI), and zeta potential were evaluated to characterize the physicochemical properties of the formulations. For this purpose, the hydrodynamic size distribution, polydispersity index (PDI), and zeta potential of the nanoparticles were analyzed at 25\u0026deg;C by dynamic light scattering (DLS). Measurements were conducted with a Malvern Zetasizer Nano ZS (Malvern Instruments, Malvern, UK), equipped with a 4 mW He-Ne laser at a wavelength of 633 nm at an angle of 90\u0026deg;. Prior to analysis, samples were diluted 1:10 in ultrapure water and vortexed to ensure proper dispersion. All measurements were performed in triplicate, and results were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 Bovine ovaries and ethical approval\u003c/h2\u003e\u003cp\u003eOvaries from 50 healthy mixed-breed cows of reproductive age were collected at local slaughterhouses and assigned to two distinct experiments, as detailed below. All procedures performed in this study were approved by the Ethics and Animal Welfare Committee of the xxxxx under approval number 04/22. Immediately after collection, the ovaries were washed once with 70% alcohol and twice with PBS buffered with 20 mM HEPES and supplemented with 100 \u0026micro;g/ml penicillin and 100 \u0026micro;g/ml streptomycin, then designated for decellularization. The ovaries to be used for follicular isolation were washed twice in TCM199 buffered with 20 mM HEPES and supplemented with the same antibiotics. Then, they were transported to the laboratory within 1 h in the respective washing solution at 4\u0026deg;C.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 Bovine ovarian tissue decellularization\u003c/h2\u003e\u003cp\u003eUpon arrival at the laboratory, the ovaries (n\u0026thinsp;=\u0026thinsp;10 pairs) were rinsed in PBS solution and stored at -80 \u0026ordm;C for 24\u0026ndash;48 h. Before use, they were thawed in water bath at 37 \u0026ordm;C for 1 hour. After thawing, antral follicles were punctured with a needle, and cortical slices (2 mm x 2 mm x 1 mm) were taken using a scalpel. Random samples from each ovarian pair were fixed in 4% paraformaldehyde prepared in PBS (pH 7.4) for 24 hours at room temperature for evaluation as native tissue. Two decellularization solutions (DS) were prepared 24 hours prior to use: (DS1) \u0026minus;\u0026thinsp;1% Triton-X100 (v/v) (T8787-100 ML, Sigma-Aldrich, USA) in distilled water; (DS2) \u0026minus;\u0026thinsp;0.5% SDS (w/v) (L3771-100 G, Sigma-Aldrich, USA). Initially, samples were immersed in 20 mL DS1 for 9 hours under constant agitation (150 rpm) in an orbital shaker at 37 \u0026ordm;C, followed by 9 hours in 20 mL DS2 under the same conditions. After decellularization, the samples were washed 10 times in 50 mL PBS at 37 \u0026ordm;C with hourly solution changes. The resulting samples were either used to assess the decellularization efficiency or stored at -80\u0026deg;C.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 Histological analysis and DNA staining\u003c/h2\u003e\u003cp\u003eNative bovine ovarian tissue and decellularized extracellular matrix (dECM) morphology were analyzed using classical light microscopy. Samples were fixed for 24 hours at room temperature and processed for histological. Sections (6 \u0026micro;m thick) were mounted on glass slides and stained with hematoxylin-eosin (H\u0026amp;E) to assess the remaining cell content after decellularization. Some sections were stained with 20 \u0026micro;M Hoechst 33342 (B2261-100MG, Sigma-Aldrich, USA) for 1 min for DNA fluorescence labeling. For cell counting, random fields from sections were analyzed at 400\u0026times; magnification using a Nikon Eclipse TS 100 microscope and the ImageJ software (Version 1.54f, 2023). Cells were manually counted in a 100 \u0026micro;m\u0026sup2; area, following Silva et al. (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), with all measurements performed by a single operator. Images of sections stained with Hoechst 33342 under constant exposure settings and analyzed with ImageJ. Residual nuclear content was considered proportional to the fluorescence intensity after subtraction of tissue auto fluorescence (Alshaikh et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6 Histochemical evaluation for collagen and glycosaminoglycans\u003c/h2\u003e\u003cp\u003eFor collagen assessment, 6 \u0026micro;m-thick sections from both native and decellularized bovine ovarian samples were dewaxed using xylene and stained with 0.1% Sirius Red solution for 1 hour at room temperature, according to the protocol described by Ritti\u0026eacute; \u003cem\u003eet al.\u003c/em\u003e (2017). The excess stain was eliminated with a 0.5% acetic acid solution, followed by dehydration of the sections and subsequent mounting on slides. For glycosaminoglycan (GAG) evaluation, the sections were stained with Alcian Blue for 5 minutes at room temperature, following the manufacturer's protocol. After staining, the sections were dehydrated and mounted on slides for analysis. For both collagen and GAG assessments, images from 50 fields (5 per animal) were captured using a DS Cooled DS-Ri1 camera attached to a Nikon Eclipse TS 100 microscope (Tokyo, Japan) at 400x magnification. Quantification of collagen and GAG content was performed using Fiji-ImageJ software (Version 1.54f, 2023).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7 Scanning electron microscopy (SEM)\u003c/h2\u003e\u003cp\u003eFor SEM, both native bovine ovaries and dECM samples were fixed in Karnovsky's solution at 4\u0026deg;C for 24 hours, followed by post-fixation with 2% osmium tetroxide for 1 hour. After washing with distilled water, the samples underwent gradual dehydration through a graded acetone series (30%, 50%, 70%, 90%, and 100%), with each step lasting 15 minutes. Subsequently, the specimens were dried using a critical point dryer, mounted on stubs, coated with colloidal gold, and observed using a scanning electron microscope (Inspect S50-FEI).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8 Follicle isolation and \u003cem\u003ein vitro\u003c/em\u003e culture\u003c/h2\u003e\u003cp\u003eA total of 40 bovine ovaries were collected following the previously described procedures. The ovarian cortex was sectioned into 1\u0026ndash;2 mm fragments using a sterile scalpel blade and transferred to TCM-199 medium supplemented with 100 \u0026micro;g/ml penicillin, 100 \u0026micro;g/ml streptomycin, and HEPES buffer. Secondary follicles measuring approximately 150\u0026ndash;200 \u0026micro;m in diameter were manually dissected from the cortical strips using 26-gauge needles under a stereomicroscope (SMZ 645 Nikon, Tokyo, Japan). Follicles selected for culture exhibited an intact basement membrane, two or more granulosa cell layers, absence of an antral cavity, and a morphologically healthy, round oocyte centrally located within the follicle.\u003c/p\u003e\u003cp\u003eTo culture the follicles, the decellularized scaffolds were removed from the \u0026minus;\u0026thinsp;80\u0026ordm;C freezer and thawed for 1 hour in a water bath containing distilled water. Subsequently, the structures were sterilized in a PBS solution with penicillin and streptomycin, then placed in TCM-199 medium supplemented with penicillin (100 \u0026micro;g/ml), streptomycin (100 \u0026micro;g/ml) and HEPES solution, and stored in an incubator at 38.5 \u0026ordm;C with 5% CO2 for 4 hours prior to use. The base medium used for follicle culture was TCM-199 (pH 7.2\u0026ndash;7.4), enriched with 3.0 mg/ml bovine serum albumin (BSA), 2 mM glutamine, 2 mM hypoxanthine, 100 IU/ml penicillin-streptomycin, 10 \u0026micro;g/ml insulin, 5.5 \u0026micro;g/ml transferrin, 5 ng/ml selenium (ITS), 50 \u0026micro;g/ml ascorbic acid, and 100 ng/ml equine chorionic gonadotropin (eCG) (TCM-199\u003csup\u003e+\u003c/sup\u003e). Isolated secondary follicles were randomly distributed and cultured in two systems: (I) two-dimensional (2D) system, i.e., the follicles were cultured in Petri dishes (60 \u0026times;15 mm; Corning, USA) in drops of 100 \u0026micro;L TCM-199\u003csup\u003e+\u003c/sup\u003e (TCM199\u003csup\u003e+\u003c/sup\u003e2D); (II) three-dimensional (3D) system, i.e., the follicles were inserted in dECM scaffolds and cultured in 24-well culture dishes (2 scaffolds per well) in 500 \u0026micro;L TCM-199\u003csup\u003e+\u003c/sup\u003e alone (TCM199\u003csup\u003e+\u003c/sup\u003e3D) or supplemented with 0.02, 0.2, or 2.0 \u0026micro;M resveratrol-loaded polymeric nanoparticles (RLNP-3D groups), 2.0 \u0026micro;M blank nanoparticles BLNP (2\u0026micro;M-3D); or 2.0\u0026micro;M non-encapsulated resveratrol RSV (2\u0026micro;M-3D). Follicles were cultured for 12 days in a humidified incubator at 38.5\u0026deg;C with 5% CO₂ in air. Half of the culture medium was refreshed every second day of culture.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9 Assessment of follicular viability by fluorescence microscopy\u003c/h2\u003e\u003cp\u003eFollowing the culture period, follicles (n\u0026thinsp;=\u0026thinsp;30 per treatment) were manually retrieved from the dECM scaffolds using 26-gauge needles. They were then incubated for 15 minutes at 37\u0026deg;C with 5% CO₂ in 100 \u0026micro;L droplets of TCM-199 medium containing 4 \u0026micro;M calcein-AM and 2 \u0026micro;M ethidium homodimer-1 (EthD-1) (Molecular Probes - L3224, Invitrogen, Karlsruhe, Germany) to assess esterase activity in the cytoplasm and the labeling of nucleic acids in non-viable cells following membrane disruption. After staining, follicles were washed three times in TCM-199 medium and analyzed under a fluorescence microscope (Nikon, Eclipse TS100, Japan) as described by Paulino et al. (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Oocytes and granulosa cells with preserved viability displayed green fluorescence from calcein-AM, whereas non-viable cells exhibited red fluorescence due to EthD-1 staining. Fluorescence intensity was quantified using ImageJ software (Version 1.54f, 2023). The mean pixel intensity within the follicular region was measured after background correction to determine staining levels. Non-cultured follicles were used as the reference for relative fluorescence quantification, following the approach described by Rocha-Frigoni et al. (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.10 Morphological and ultrastructural assessments of dECM, and cultured follicles\u003c/h2\u003e\u003cp\u003eTo assess the structural stability of collagen and glycosaminoglycan (GAG) networks throughout the culture period, dECM scaffolds were stained with Picrosirius red and Alcian blue, respectively, on days 0, 2, 4, 6, 8, 10, 12, and 14. Additionally, scaffold ultrastructure was examined by scanning electron microscopy (SEM) on day 12 of culture. Histochemical and SEM processing were performed using standard methods already described previously. To analyze cell morphology and organelle organization in oocytes and GCs, transmission electron microscopy (TEM) was performed on follicles cultured in the 2D system or in the 3D system in medium supplemented with 0.02, 0.2, or 2.0\u0026micro;M RLNP, Blank-NP, or RSV. After culture, scaffolds containing follicles (6\u0026ndash;10 per treatment) were fixed in Karnovsky\u0026rsquo;s solution for 4 hours at room temperature (~\u0026thinsp;25\u0026deg;C), embedded in 4% low-melting agarose droplets, and kept in sodium cacodylate buffer. As no significant differences in viability were found among different concentrations of RLNP, follicles treated with the lowest concentration (0.02 \u0026micro;M) were selected for ultrastructural analysis. The specimens were post-fixed with 1% osmium tetroxide, 0.8% potassium ferricyanide, and 5 mM calcium chloride. After dehydration in acetone, samples were embedded in epoxy resin (Epoxy Embedding Kit, Fluka Chemika). Semithin sections (2 \u0026micro;m) were stained with toluidine blue and examined under light microscopy at 400x magnification, while ultrathin sections (70 nm) were counterstained with uranyl acetate and lead citrate for examination under a Morgani-FEI transmission electron microscope.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.11 Quantitative reverse transcription-polymerase chain reaction (qRT-PCR)\u003c/h2\u003e\u003cp\u003eReal-time PCR was used to evaluate the levels of mRNAs for \u003cem\u003eCAT, SOD, GPX1\u003c/em\u003e, \u003cem\u003ePRDX6\u003c/em\u003e, and \u003cem\u003eNRF2\u003c/em\u003e in follicles cultured follicles 2D system or in 3D system in medium supplemented with 0.02 \u0026micro;M RLNP, Blank-NP or RSV, according to Azevedo et al. (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). After culture, follicles were carefully removed from dECM scaffolds, and total mRNA was extracted using the Trizol purification kit (Invitrogen, S\u0026atilde;o Paulo, Brazil), according to the manufacturer\u0026rsquo;s guidelines. The total mRNA concentration was measured using a nanodrop (Biodrop, Cambridge, England), and 50 ng/\u0026micro;L of mRNA was used for reverse transcription. Quantification of mRNA was conducted using SYBR Green on a StepOnePlus instrument (Applied Biosystems, Foster City, CA, USA). Each quantitative PCR reaction (15 \u0026micro;L total volume) was prepared with 7.5 \u0026micro;L of SYBR Green Master Mix (PE Applied Biosystems, Foster City, CA), 5.5 \u0026micro;L of ultrapure water, 1 \u0026micro;L of cDNA, and 0.5 \u0026micro;M of each primer (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The relative expression levels of all target genes were normalized to the endogenous control gene Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Kussano et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) calculated using the 2^-ΔΔCt method, as described by Cao et al. (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eOligonucleotide primers used for polymerase chain reaction analysis\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTarget gene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer sequence (5\u0026prime; ➔ 3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSense (S), anti-sense (As)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGenBank accession no.\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGTTTGTGATGGGCGTGAACCA\u003c/p\u003e\u003cp\u003eATGGCGCGTGGACAGTGGTCATAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eS\u003c/p\u003e\u003cp\u003eAs\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGI: 402744670\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCAT\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAAGTTCTGCATCGCCACTCA\u003c/p\u003e\u003cp\u003eGGGGCCCTACTGTCAGACTA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eS\u003c/p\u003e\u003cp\u003eAs\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGI: 402693375\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSOD\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTGAACAACCTCAACGTCGC\u003c/p\u003e\u003cp\u003eGGGTTCTCCACCACCGTTAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eS\u003c/p\u003e\u003cp\u003eAs\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGI: 31341527\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eGPX1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAACGTAGCATCGCTCTGAGG\u003c/p\u003e\u003cp\u003eGATGCCCAAACTGGTTGCAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eS\u003c/p\u003e\u003cp\u003eAs\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGI: 156602645\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ePRDX6\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCACCTCCTCTTACTTCCCG\u003c/p\u003e\u003cp\u003eGATGCGGCCGATGGTAGTAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eS\u003c/p\u003e\u003cp\u003eAs\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGI: 59858298\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eNRF2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGACCCAGTCCAACCTTTGTC\u003c/p\u003e\u003cp\u003eGACCCGGACTTACAGGTACT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eS\u003c/p\u003e\u003cp\u003eAs\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGI: 0304941\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e2.12 Statistical analysis\u003c/h2\u003e\u003cp\u003eStatistical analyses were performed using GraphPad Prism version 9.0. An unpaired t-test was applied to compare cell remnants and the percentage of collagen and GAGs between native and decellularized tissues. For treatment group comparisons, data with normal distribution were evaluated using one-way ANOVA followed by Tukey\u0026rsquo;s post hoc test, while non-normally distributed variables were assessed with the Kruskal\u0026ndash;Wallis test and Dunn\u0026rsquo;s multiple comparisons. Results are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM), unless otherwise specified. Differences were considered statistically significant when p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e3.1 Physicochemical characterization confirms successful synthesis of RLNP\u003c/h2\u003e\u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e shows the physicochemical characterization of resveratrol-loaded polymeric nanoparticles (RLNP) and blank nanoparticles (BLNP). The synthesis method employed is robust and effective in producing nanoparticles with sizes below 150 nm. RLNP showed a PDI of 0.26, while BLNP presented a PDI of 0.16, indicating moderate size distribution uniformity. Both formulations exhibited a negative surface charge, with zeta potential values close to -6 mV, reflecting low surface charge intensity.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePhysicochemical properties of the formulations, including particle size, polydispersity index (PDI), and zeta potential.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSize (nm) \u0026plusmn; SD\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePDI \u0026plusmn; SD\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eZeta potential (mV) \u0026plusmn; SD\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eRLNP\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e130.87 \u0026plusmn; 36.36\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e0.26 \u0026plusmn; 0.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e-5.80 \u0026plusmn; 1.26\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eBLNP\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e142.23 \u0026plusmn; 1.55\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e0.16 \u0026plusmn; 0.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e-5.65 \u0026plusmn; 1.85\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e3.2 Decellularization eliminates cells and maintains tissue macro- and microarchitecture\u003c/h2\u003e\u003cp\u003eMacroscopic analysis showed that decellularized tissues changed color from red to white and maintained their shape and homogeneity without any signs of deformation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, B). The SEM revealed that ECM fiber integrity was preserved after decellularization. The fiber appearance and organization in the dECM closely resembled those of the native ovarian tissue. The SEM also confirmed the preservation of both dense and thin collagen fibers, indicating that the resulting scaffolds retained their native three-dimensional architecture (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-C). Histological analysis revealed that the resulting ECM-based scaffolds were devoid of cells and basophilic staining was absent in the decellularized scaffolds, whereas cell nuclei were distinctly visible in native tissues, which served as the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, D). Cell density analysis demonstrated absence of nuclei in the ECM-based scaffolds compared to the untreated tissues (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). Additionally, the existence of DNA was verified through Hoechst 33342 staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, F) indicating absence of DNA in decellularized tissues (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e3.3 Decellularization preserves ovarian extracellular matrix components\u003c/h2\u003e\u003cp\u003eHistochemical analyses confirmed the preservation of key ECM components after tissue decellularization. Picrosirius red and Alcian blue staining revealed the persistence of collagen (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B) and GAGs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, D), displaying a comparable distribution between ECM-based scaffolds and native tissues. These morphological findings were confirmed by stereological quantifications, which demonstrated no differences in collagen (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE), and GAGs content (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF) between ECM-based scaffold and native tissues (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The mean of collagen and GAGs in the decellularized ovarian tissue was about 95% and 93%, respectively, compared with native tissue collagen and GAGs content prior to decellularization.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e3.4 The dECM undergoes time-dependent structural changes \u003cem\u003ein vitro\u003c/em\u003e\u003c/h2\u003e\u003cp\u003ePicrosirius red staining showed that the total collagen content remained stable until day 12 of \u003cem\u003ein vitro\u003c/em\u003e culture, with no apparent disarray in the collagen fiber bundles of the decellularized scaffolds. However, by day 14, a greater degree of fiber disorganization became evident, characterized by the presence of gaps, increased fiber fragmentation, and a significant reduction in fiber density within the scaffolds (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-G and O). Similarly, GAGs stained with Alcian blue remained quantitatively stable until day 10 of culture, although the GAG network appeared straighter at this stage. From day 12 onward, a significant decline in GAG density was observed, accompanied by a more dispersed network with an increased presence of gaps (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH-N, and P). The SEM analysis corroborated the histochemical findings, revealing alterations in the ultrastructural integrity of the dECM after 12 days in culture. The finer fibers present in the native tissue and immediately after decellularization were no longer observed. Additionally, the porous architecture present shortly after decellularization was no longer apparent after 12 days of culture (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e3.5 The dECM and RLNP enhance follicular viability\u003c/h2\u003e\u003cp\u003eAfter culture, follicles in all treatments and culture conditions exhibited a significant reduction in calcein-AM fluorescence intensity and an increase in EthD-1 fluorescence compared to the fresh control (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-X). Follicles cultured in the 3D groups, except those supplemented with BLNP, exhibited higher calcein-AM fluorescence intensity compared to the 2D group. Meanwhile, lower EthD-1 fluorescence intensity was observed in all the 3D groups relative to the 2D group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eY, Z). In follicles cultured in 3D system, supplementation of the culture medium with RLNP at all tested concentrations further increased calcein-AM fluorescence intensity compared to the other treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eY). However, this supplementation did not significantly affect EthD-1 fluorescence intensity (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eZ).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003e3.6 The dECM and RLNP improve follicular ultrastructure\u003c/h2\u003e\u003cp\u003eFollicles cultured in the 2D system exhibited a ruptured ZP, with the space originally occupied by the oocyte filled by granulosa cells. However, these cells were well preserved, displaying reticulum and mitochondria, although mitochondrial cristae were difficult to visualize (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, B). In contrast, follicles cultured in the 3D system in medium supplemented with 0.02\u0026micro;M RLNP exhibited oocytes with an intact ZP and visible microvilli. Moreover, mitochondria with preserved cristae were observed. Although some granulosa cells showed gaps between them, they remained well preserved, with numerous mitochondria featuring clearly visible cristae, along with the presence of endoplasmic reticulum (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC, D). In follicles cultured in the 3D system in medium supplemented with 2.0 \u0026micro;M BLNP, although remnants of an irregular ZP were visible, no viable oocyte was identified. Granulosa cells of these follicles displayed intense vacuolization, an extremely heterochromatic nucleus, and heterogeneous nucleoli. Furthermore, an intact plasma membrane separating the cells was not observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE, F). Finally, in follicles cultured in the 3D system with 2.0 \u0026micro;M RSV, no intact oocyte was identified, with only fragments of the ZP remaining. However, granulosa cells had preserved morphology, with a well-defined nucleus, mitochondria with reasonably preserved cristae, and structurally intact endoplasmic reticulum (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG-H).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003e3.7 The RLNP downregulated mRNA expression of antioxidant enzymes\u003c/h2\u003e\u003cp\u003eAfter 12 days of culture, follicles cultured with 0.02 \u0026micro;M RLNP showed reduced mRNA expression of \u003cem\u003eCAT\u003c/em\u003e (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), \u003cem\u003eSOD\u003c/em\u003e (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), \u003cem\u003ePRDX6\u003c/em\u003e (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), and \u003cem\u003eNRF2\u003c/em\u003e (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) compared to the TCM199\u003csup\u003e+\u003c/sup\u003e control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), although \u003cem\u003eSOD\u003c/em\u003e levels were similar to those observed in follicles cultured with unencapsulated resveratrol (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). No significant differences in \u003cem\u003eGPX1\u003c/em\u003e expression were observed among treatments (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eThis study demonstrated that culturing secondary follicles in dECM-based bioscaffolds associated with medium supplemented with RLNP represents a promising strategy for \u003cem\u003ein vitro\u003c/em\u003e development of culture systems for bovine early follicles. Maintaining ECM integrity during the decellularization process is particularly crucial for functional ovarian tissue engineering, where ECM\u0026ndash;follicle interactions play a key role (Wang \u003cem\u003eet al.\u003c/em\u003e, 2025; Vasse \u003cem\u003eet al.\u003c/em\u003e, 2024; Fiorentino et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; McInnes et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In our study, freeze-thaw cycles followed by 9-hour incubations in Triton X-100 and SDS effectively removed cells and residual DNA, and yielded scaffolds with preserved macro- and microarchitecture, resembling native tissue. Alongside effective cell removal, the preservation of ovarian microstructures and ECM components is a critical determinant of bioscaffold quality following decellularization (L\u0026eacute;on-F\u0026eacute;lix \u003cem\u003eet al.\u003c/em\u003e, 2025). The GAGs and collagen levels remained comparable to controls and stable during \u003cem\u003ein vitro\u003c/em\u003e culture for 10 and 12 days, respectively, despite minor microarchitectural changes. Moreover, follicle viability was maintained throughout the culture period, indicating no apparent cytotoxicity.\u003c/p\u003e\u003cp\u003eDue to its preserved porous architecture, decellularized extracellular matrix scaffolds are considered suitable for \u003cem\u003ein vitro\u003c/em\u003e culture, as it enables efficient diffusion of culture media and promotes nutrient exchange (Nikniaz et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Follicles cultured in the 3D system exhibited greater intracellular esterase activity, and reduced membrane damage compared to those maintained in the 2D system under identical conditions. These findings indicate that the 3D system alone already provides improved conditions for follicular maintenance, irrespective of culture medium supplementation. Silva et al. (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) demonstrated a correlation between non-specific esterase activity and both viability and growth of ovarian follicles in bovine. Accumulating evidence indicates that follicular development relies on dynamic and reciprocal interactions between the follicle and its surrounding microenvironment (Wang \u003cem\u003eet al.\u003c/em\u003e, 2025). Thus, dECM scaffolds may offer a supportive mechanical microenvironment by conveying biomechanical cues essential for promoting follicular development (Alshaikh et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Further, GAGs and other specific ECM domains have a strong binding affinity for growth factors that can be \u003cem\u003ein vitro\u003c/em\u003e released and influence follicular development (Franc\u0026eacute;s-Herrero et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; L\u0026oacute;pez-Mart\u0026iacute;nez et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Yan et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The bioactivity of bovine ovarian dECM has already been demonstrated by Laronda et al. (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), who reported estradiol secretion by primary mouse ovarian cells cultured on dECM scaffolds. Similarly, Alaee \u003cem\u003eet al\u003c/em\u003e. (2020) showed that preantral follicles cultured in dECM scaffolds exhibited increased diameter, enhanced antral cavity formation, and higher estradiol and progesterone secretion after 12 days of \u003cem\u003ein vitro\u003c/em\u003e culture compared to 2D systems. In addition, porcine ovarian cells seeded onto dECM scaffolds expressed key granulosa cell markers, including STAR, CYP11A1, CYP19A1, AMH, FSHR, and LHR (Pennarossa et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), indicating the ability of ECM-based scaffolds ability to drive follicular development \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eIn this study, the physicochemical characterization of the nanoparticles demonstrated mean sizes below 150 nm for both formulations, a feature commonly associated with efficient cellular uptake (Foroozandeh and Aziz, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The PDI values ranged from 0.16 for blank nanoparticles to 0.26 for resveratrol-loaded nanoparticles, indicating moderate size distribution uniformity, which is considered acceptable for drug delivery systems (Danaei et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Both formulations exhibited negative surface charges, with zeta potential values close to -6 mV. Although low zeta potential magnitudes typically indicate reduced colloidal stability, Freitas \u003cem\u003eet al.\u003c/em\u003e (2023) reported that these formulations maintained colloidal stability for up to 90 days.\u003c/p\u003e\u003cp\u003eNotably, in our study, RLNP supplementation of culture medium in the 3D system enhanced follicular viability. Transmission electron microscopy revealed that oocytes from follicles cultured with RLNP had a well-preserved zona pellucida, while granulosa cells showed intact mitochondria and endoplasmic reticulum, with no evident ultrastructural damage. Several studies have reported that resveratrol enhances ATP production and mitochondrial biogenesis in mammalian granulosa cells, including those from aged cows, thereby improving mitochondrial function and supporting oocyte development \u003cem\u003ein vitro\u003c/em\u003e (Nishigaki et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Sugiyama et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). As a known Sirtuin-1 (SIRT1) activator, resveratrol upregulates SIRT1 expression and increases ATP levels in bovine oocytes, resulting in improved fertilization outcomes (Takeo et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). In rats, it also promotes TZP synthesis by increasing cytosolic calcium, activating Calcium/Calmodulin Dependent Protein Kinase II Beta (CaMKIIβ), and releasing actin monomers (Chen et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In our study, the enhanced effect of resveratrol when encapsulated in polymeric nanoparticles strongly suggests that employing this drug delivery system is advantageous, since it can improve the aqueous solubility and bioavailability of resveratrol, enhance its physicochemical stability, and enable targeted and controlled drug release (Freitas \u003cem\u003eet al.\u003c/em\u003e, 2023; Summerlin et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eResveratrol has been widely reported in the literature as exhibiting a potent antioxidant effect in the ovary (Jiang et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Saber et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). After 12 days of culture, follicles cultured with 0.02 \u0026micro;M RLNP showed reduced mRNA expression of \u003cem\u003eCAT\u003c/em\u003e, \u003cem\u003eSOD\u003c/em\u003e, \u003cem\u003ePRDX6\u003c/em\u003e, and \u003cem\u003eNRF2\u003c/em\u003e compared to follicles cultured in control medium, although \u003cem\u003eSOD\u003c/em\u003e levels were similar to those follicles cultured with unencapsulated resveratrol. Overall, ROS generation modulates transcriptional antioxidant responses by activating signaling pathways and enzymes involved in redox homeostasis and ROS elimination (Ngo \u003cem\u003eet al\u003c/em\u003e., 2022). The NRF2 is a key regulator of antioxidant gene expression and, upon ROS exposure, translocates to the nucleus to induce the transcription of antioxidant enzymes (Espinosa-Diez et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In our study, it is plausible that RLNP exerted a direct free radical-scavenging effect, contributing to a less oxidative microenvironment, reducing the activation of endogenous antioxidant defenses. As a direct antioxidant agent, resveratrol neutralizes various ROS through hydrogen atom transfer and sequential proton loss electron transfer mechanisms, thereby protecting cellular biomolecules from oxidative damage (Truong et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The ROS-scavenging properties of resveratrol have been consistently demonstrated in recent studies. Cai et al. (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) showed that resveratrol alleviates oxidative stress in rat granulosa cells (GCs) by decreasing intracellular ROS levels, which was accompanied by a reduction in malondialdehyde content. Similarly, Jiang et al. (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) observed this antioxidative effect in \u003cem\u003eBos grunniens\u003c/em\u003e granulosa cells, along with a concomitant increase in intracellular glutathione levels.\u003c/p\u003e\u003cp\u003eIn conclusion, the decellularized bovine ovarian tissue exhibited minimal residual cellular content and well-preserved ECM ultrastructure. The 3D culture system provided a more favorable environment for follicular development compared to the 2D system, especially when supplemented with RLNP. At 0.02 \u0026micro;M, RLNP preserved follicular ultrastructure, maintained essential features such as the zona pellucida, granulosa cells, and intracellular organelles. Moreover, 0.02 \u0026micro;M, RLNP downregulated the expression of \u003cem\u003eCAT, SOD, GPX1, PRDX6\u003c/em\u003e, and \u003cem\u003eNRF2.\u003c/em\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\n\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\n\u003cp\u003eAll data produced or analyzed during this study are included in this article and can be shared upon reasonable request to the corresponding author.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing of interest\u003c/strong\u003e\u003c/p\u003e\n\n\u003cp\u003eThe authors declare that they have no conflicts of interest.\u003c/p\u003e\n"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAhn JI, Kim GA, Kwon HS, Ahn JY, Hubbell JA, Song YS, Lee ST, Lim JM (2015) Culture of preantral follicles in poly(ethylene) glycol-based, three-dimensional hydrogel: a relationship between swelling ratio and follicular developments. J Tissue Eng Regen Med 9:319-23. https://doi.org/10.1002/term.1824\u003c/li\u003e\n\u003cli\u003eAlaee S, Asadollahpour R, Hosseinzadeh Colagar A, Talaei-Khozani T (2021) The decellularized ovary as a potential scaffold for maturation of preantral ovarian follicles of prepubertal mice. Syst Biol Reprod Med 67:413-427. https://doi.org/10.1080/19396368.2021.1968542\u003c/li\u003e\n\u003cli\u003eAlmeida GHDR, da Silva-J\u0026uacute;nior LN, Gibin MS, Dos Santos H, de Oliveira Horvath-Pereira B, Pinho LBM, Baesso ML, Sato F, Hernandes L, Long CR, Relly L, Miglino MA, Carreira ACO (2023) Perfusion and ultrasonication produce a decellularized porcine whole-ovary scaffold with a preserved microarchitecture. Cells 12:1864. https://doi.org/10.3390/cells12141864\u003c/li\u003e\n\u003cli\u003eAlshaikh AB, Padma AM, Dehlin M, Akouri R, Song MJ, Br\u0026auml;nnstr\u0026ouml;m M, Hellstr\u0026ouml;m M (2020) Decellularization and recellularization of the ovary for bioengineering applications; studies in the mouse. Reprod Biol Endocrinol 18:75. https://doi.org/10.1186/s12958-020-00630-y\u003c/li\u003e\n\u003cli\u003eAzevedo VAN, Barroso PAA, Vasconcelos EM, Costa FC, Assis EIT, Silva BR, Paulino LRM, Silva AWB, Donato MMA, Peixoto CA, Silva JRV, Souza ALP (2022) Effects of Aloe vera extract on growth, viability, ultrastructure and expression of mRNA for antioxidant enzymes in bovine secondary follicles cultured \u003cem\u003ein vitro\u003c/em\u003e. Anim Reprod Sci 247:107078. https://doi.org/10.1016/j.anireprosci.2022.107078\u003c/li\u003e\n\u003cli\u003eBezerra VS, Costa FC, Caetano Filho FF, Costa JJN, de Lima Neto MF, Furtado CLM, Ceccatto VM, Ara\u0026uacute;jo VR, Silva JRV (2024) Punicalagin increases follicular activation, development and activity of superoxide dismutase 1, catalase, and glutathione peroxidase 1 in cultured bovine ovarian tissues. Reprod Fertil Dev 36:RD24029. https://doi.org/10.1071/RD24029\u003c/li\u003e\n\u003cli\u003eBezerra M\u0026Eacute;S, Gouveia BB, Barberino RS, Menezes VG, Macedo TJS, Cavalcante AYP, Monte APO, Santos JMS, Matos MHT (2018) Resveratrol promotes \u003cem\u003ein vitro\u003c/em\u003e activation of ovine primordial follicles by reducing DNA damage and enhancing granulosa cell proliferation via phosphatidylinositol 3-kinase pathway. Reprod Domest Anim 53:1298-1305. https://doi.org/10.1111/rda.13274\u003c/li\u003e\n\u003cli\u003eCai M, Wang J, Sun H, Guo Q, Zhang C, Yao H, Zhao C, Jia Y, Zhu H (2023) Resveratrol attenuates hydrogen peroxide-induced injury of rat ovarian granulosa-lutein cells by resisting oxidative stress via the SIRT1/Nrf2/ARE signaling pathway. Curr Pharm Des 29:947-956. https://doi.org/10.2174/1381612829666230403133322\u003c/li\u003e\n\u003cli\u003eCao L, Li S, Huang S, Shi D, Li X (2021) AQP8 participates in estrogen-mediated buffalo follicular development by regulating apoptosis of granulosa cells. Reprod Domest Anim 56: 812-820. https://doi.org/10.1111/rda.13921\u003c/li\u003e\n\u003cli\u003eCavalcante de Freitas PG, Rodrigues Arruda B, Ara\u0026uacute;jo Mendes MG, Barroso de Freitas JV, da Silva ME, Sampaio TL, Petrilli R, Eloy JO (2023) Resveratrol-loaded polymeric nanoparticles: the effects of d-\u0026alpha;-tocopheryl polyethylene glycol 1000 succinate (TPGS) on physicochemical and biological properties against breast cancer in vitro and \u003cem\u003ein vivo\u003c/em\u003e. \u003cem\u003eCancers (Basel)\u003c/em\u003e 15:2802. https://doi.org/10.3390/cancers15102802\u003c/li\u003e\n\u003cli\u003eChen M, He C, Zhu K, Chen Z, Meng Z, Jiang X, Cai J, Yang C, Zuo Z (2022) Resveratrol ameliorates polycystic ovary syndrome via transzonal projections within oocyte-granulosa cell communication. Theranostics 12:782-795. https://doi.org/10.7150/thno.67167\u003c/li\u003e\n\u003cli\u003eCheng H, Wei F, del Valle JS, Stolk THR, Huirne JA, Asseler JD, Pilgram GSK, van der Westerlaken LAJ, van Mello NM, Chuva de Sousa Lopes SM (2024) \u003cem\u003eIn vitro\u003c/em\u003e growth of secondary follicles from cryopreserved-thawed ovarian cortex. Hum Reprod 39:2743-2753. https://doi.org/10.1093/humrep/deae240\u003c/li\u003e\n\u003cli\u003eChiti MC, Dolmans MM, Orellana O, Soares M, Paulini F, Donnez J, Amorim CA (2016) Influence of follicle stage on artificial ovary outcome using fibrin as a matrix. Hum Reprod 31:2898-2898. https://doi.org/10.1093/humrep/dew254\u003c/li\u003e\n\u003cli\u003eCosta FC, Silva BR, Filho FFC, Bezerra VS, Azevedo VAN, Silva AA, Silva JRV (2025) Ascorbic acid and resveratrol improve the structural integrity of the extracellular matrix and enhance follicular survival in cultured bovine ovarian tissue. Theriogenology 235:231-244. https://doi.org/10.1016/j.theriogenology.2025.01.020\u003c/li\u003e\n\u003cli\u003eDadashzadeh A, Moghassemi S, Peaucelle A, Lucci CM, Amorim CA (2023) Mind the mechanical strength: tailoring a 3D matrix to encapsulate isolated human preantral follicles. Hum Reprod Open 2023:hoad004. https://doi.org/10.1093/hropen/hoad004\u003c/li\u003e\n\u003cli\u003eDanaei M, Dehghankhold M, Ataei S, Hasanzadeh Davarani F, Javanmard R, Dokhani A, Khorasani S, Mozafari MR (2018) Impact of particle size and polydispersity index on the clinical applications of lipidic nanocarrier systems. Pharmaceutics 10:57. https://doi.org/10.3390/pharmaceutics10020057\u003c/li\u003e\n\u003cli\u003eDey P, Monferini N, Donadini L, Lodde V, Franciosi F, Luciano AM (2024) A spotlight on factors influencing the \u003cem\u003ein vitro\u003c/em\u003e folliculogenesis of isolated preantral follicles. J Assist Reprod Genet 41:3287-3300. https://doi.org/10.1007/s10815-024-03277-5\u003c/li\u003e\n\u003cli\u003eDey P, Monferini N, Donadini L, Lodde V, Franciosi F, Luciano AM (2024) Method of isolation and \u003cem\u003ein vitro\u003c/em\u003e culture of primordial follicles in bovine animal model. Methods Mol Biol 2770:171-182. https://doi.org/10.1007/978-1-0716-3698-5_13\u003c/li\u003e\n\u003cli\u003eEbrahimi M, Mara L, Succu S, Gadau SD, Palmerini MG, Chessa F, Dattena M, Sotgiu FD, Pasciu V, Mascitti IA, Macchiarelli G, Luciano AM, Berlinguer F (2025) The effect of single versus group culture on cumulus-oocyte complexes from early antral follicles. J Assist Reprod Genet 42:961-976. https://doi.org/10.1007/s10815-025-03404-w\u003c/li\u003e\n\u003cli\u003eEspinosa-Diez C, Miguel V, Mennerich D, Kietzmann T, S\u0026aacute;nchez-P\u0026eacute;rez P, Cadenas S, Lamas S (2015) Antioxidant responses and cellular adjustments to oxidative stress. Redox Biol 6:183-197. https://doi.org/10.1016/j.redox.2015.07.008\u003c/li\u003e\n\u003cli\u003eFiorentino G, Cimadomo D, Innocenti F, Soscia D, Vaiarelli A, Ubaldi FM, Gennarelli G, Garagna S, Rienzi L, Zuccotti M (2023) Biomechanical forces and signals operating in the ovary during folliculogenesis and their dysregulation: implications for fertility. Hum Reprod Update 29:1-23. https://doi.org/10.1093/humupd/dmac031\u003c/li\u003e\n\u003cli\u003eForoozandeh P, Aziz AA (2018) Insight into cellular uptake and intracellular trafficking of nanoparticles. Nanoscale Res Lett 13:339. https://doi.org/10.1186/s11671-018-2728-6\u003c/li\u003e\n\u003cli\u003eFranc\u0026eacute;s-Herrero E, Bueno-Fernandez C, Rodr\u0026iacute;guez-Eguren A, G\u0026oacute;mez-\u0026Aacute;lvarez M, Faus A, Soto-Prado A, Buigues A, Herraiz S, Pellicer A, Cervell\u0026oacute; I (2024) Growth factor-loaded ovarian extracellular matrix hydrogels promote \u003cem\u003ein vivo\u003c/em\u003e ovarian niche regeneration and enhance fertility in premature ovarian insufficiency preclinical models. Acta Biomater 186:125-140. https://doi.org/10.1016/j.actbio.2024.07.056\u003c/li\u003e\n\u003cli\u003eGaschler MM, Stockwell BR (2017) Lipid peroxidation in cell death. Biochem Biophys Res Commun 48:419-425. https://doi.org/10.1016/j.bbrc.2016.10.086\u003c/li\u003e\n\u003cli\u003eHarada M, Takahashi N, Azhary JM, Kunitomi C, Fujii T, Osuga Y (2021) Endoplasmic reticulum stress: a key regulator of the follicular microenvironment in the ovary. Mol Hum Reprod 27:gaaa088. https://doi.org/10.1093/molehr/gaaa088\u003c/li\u003e\n\u003cli\u003eHe J, Zhong Y, Li Y, Liu S, Pan X (2025) Astaxanthin alleviates oxidative stress in mouse preantral follicles and enhances follicular development through the AMPK signaling pathway. Int J Mol Sci 26:2241. https://doi.org/10.3390/ijms26052241\u003c/li\u003e\n\u003cli\u003eJachter SL, Simmons WP, Estill C, Xu J, Bishop CV (2022) Matrix-free three-dimensional culture of bovine secondary follicles to antral stage: Impact of media formulation and epidermal growth factor (EGF). Theriogenology 181:89-94. https://doi.org/10.1016/j.theriogenology.2022.01.013\u003c/li\u003e\n\u003cli\u003eJiang X, Ma Y, Gong S, Zi X, Zhang D (2024) Resveratrol promotes proliferation, antioxidant properties, and progesterone production in yak (Bos grunniens) granulosa cells. Animals (Basel) 14:240. https://doi.org/10.3390/ani14020240\u003c/li\u003e\n\u003cli\u003eJoo S, Oh SH, Sittadjody S, Opara EC, Jackson JD, Lee SJ, Yoo JJ, Atala A (2016) The effect of collagen hydrogel on 3D culture of ovarian follicles. Biomed Mater 11:065009. https://doi.org/10.1088/1748-6041/11/6/065009\u003c/li\u003e\n\u003cli\u003eKussano NR, Franco MM, Dode MAN (2024) Biochemical profiling of the follicular environment to predict oocyte competence in cattle. PLoS One 19:e0298316. https://doi.org/10.1371/journal.pone.0298316\u003c/li\u003e\n\u003cli\u003eLaronda MM, Jakus AE, Whelan KA, Wertheim JA, Shah RN, Woodruff TK (2015) Initiation of puberty in mice following decellularized ovary transplant. Biomaterials 50:20-29. https://doi.org/10.1016/j.biomaterials.2015.01.051\u003c/li\u003e\n\u003cli\u003eLe\u0026oacute;n-F\u0026eacute;lix CM, Ouni E, Herinckx G, Vertommen D, Amorim CA, Lucci CM (2025) Decellularized extracellular matrix from bovine ovarian tissue maintains the protein composition of the native matrisome. J Proteomics 311:105347. https://doi.org/10.1016/j.jprot.2024.105347\u003c/li\u003e\n\u003cli\u003eLe\u0026oacute;n-F\u0026eacute;lix CM, Maranh\u0026atilde;o AQ, Amorim CA, Lucci CM (2024) Optimizing decellularization of bovine ovarian tissue: toward a transplantable artificial ovary scaffold with minimized residual toxicity and preserved extracellular matrix morphology. Cells Tissues Organs 213:413-423. https://doi.org/10.1159/000537838\u003c/li\u003e\n\u003cli\u003eL\u0026oacute;pez-Mart\u0026iacute;nez S, Rodr\u0026iacute;guez-Eguren A, de Miguel-G\u0026oacute;mez L, Barcel\u0026oacute; H, Berenguer-Izquierdo A, Vinader-Capello F, Garc\u0026iacute;a-Sancho C (2021) Bioengineered endometrial hydrogels with growth factors promote tissue regeneration and restore fertility in murine models. Acta Biomater 135:113-125. https://doi.org/10.1016/j.actbio.2021.08.025\u003c/li\u003e\n\u003cli\u003eMacedo TJS, Barros VRP, Monte APO, Alves VC, Gabriel CN, Wischral CA (2017) Resveratrol has dose-dependent effects on DNA fragmentation and mitochondrial activity of ovine secondary follicles cultured \u003cem\u003ein vitro\u003c/em\u003e. Zygote 25:434-442. https://doi.org/10.1017/S0967199417000193\u003c/li\u003e\n\u003cli\u003eMcInnes AD, Moser MAJ, Chen X, Wijeratne K, Hutson DA (2022) Preparation and use of decellularized extracellular matrix for tissue engineering. J Funct Biomater 13:240. https://doi.org/10.3390/jfb13040240\u003c/li\u003e\n\u003cli\u003eMoreira-Pinto B, Costa L, Felgueira E, Fonseca BM, Rebelo I (2021) Low doses of resveratrol protect human granulosa cells from induced-oxidative stress. Antioxidants (Basel) 10:561. https://doi.org/10.3390/antiox10040561\u003c/li\u003e\n\u003cli\u003eNascimento DR, Azevedo VAN, Barroso PAA, Barrozo LG, Silva BR, Silva AWB, Donato MAM, Peixoto CA, Silva JRV (2022) Effects of n-acetylcysteine on growth, viability, and ultrastructure of \u003cem\u003ein vitro\u003c/em\u003e cultured bovine secondary follicles. Animals (Basel) 12:3190. https://doi.org/10.3390/ani12223190\u003c/li\u003e\n\u003cli\u003eNgo V, Duennwald ML (2022) Nrf2 and oxidative stress: a general overview of mechanisms and implications in human disease. Antioxidants (Basel) 11:2345. https://doi.org/10.3390/antiox11122345\u003c/li\u003e\n\u003cli\u003eNishigaki A, Tsubokura H, Tsuzuki-Nakao T, Okada H (2021) Hypoxia: Role of SIRT1 and the protective effect of resveratrol in ovarian function. Reprod Med Biol 21:e12428. https://doi.org/10.1002/rmb2.12428\u003c/li\u003e\n\u003cli\u003eNikniaz H, Zandieh Z, Nouri M, Daei-farshbaf N, Aflatoonian R, Gholipourmalekabadi M, Jameie SB (2021) Comparing various protocols of human and bovine ovarian tissue decellularization to prepare extracellular matrix-alginate scaffold for better follicle development \u003cem\u003ein vitro\u003c/em\u003e. BMC Biotechnol 21:8. https://doi.org/10.1186/s12896-020-00658-3\u003c/li\u003e\n\u003cli\u003ePaulino LRFM, Cunha EV, Barbalho Silva AW, Souza GB, Lopes EPF, Donato MAM, Peixoto CA, Silva JRV (2018) Effects of tumour necrosis factor-alpha and interleukin-1 beta on in vitro development of bovine secondary follicles. Reprod Domest Anim 53:997-1005. https://doi.org/10.1111/rda.13199\u003c/li\u003e\n\u003cli\u003ePennarossa G, De Iorio T, Gandolfi F, Brevini TAL (2021) Ovarian decellularized bioscaffolds provide an optimal microenvironment for cell growth and differentiation \u003cem\u003ein vitro\u003c/em\u003e. Cells 10:2126. https://doi.org/10.3390/cells10082126\u003c/li\u003e\n\u003cli\u003eRitti\u0026eacute; L (2017) Method for picrosirius red-polarization detection of collagen fibers in tissue sections. Methods Mol Biol 1627:395-407. https://doi.org/10.1007/978-1-4939-7113-8_26\u003c/li\u003e\n\u003cli\u003eRocha-Frigoni NAS, Le\u0026atilde;o BCS, Dall\u0026rsquo;Acqua PC, Mingoti GZ (2016) Improving the cytoplasmic maturation of bovine oocytes matured \u003cem\u003ein vitro\u003c/em\u003e with intracellular and/or extracellular antioxidants is not associated with increased rates of embryo development. Theriogenology 86:1897-1905. https://doi.org/10.1016/j.theriogenology.2016.06.009\u003c/li\u003e\n\u003cli\u003eSaber YHA, Ibrahim S, Mahmoud KGM, Ahmed WM, Ragab RSA, Seida AAM (2024) Expression profile of viability and stress response genes as a result of resveratrol supplementation in vitrified \u003cem\u003eand in vitro\u003c/em\u003e produced cattle embryos. Mol Biol Rep 51:692. https://doi.org/10.1007/s11033-024-09614-2\u003c/li\u003e\n\u003cli\u003eSilva BR, Costa FC, De Lima Neto MF, Caetano Filho FF, de Assis EIT, Aguiar FLN, Silva AWB, Costa JJN, Silva J (2024) Melatonin acts through different mechanisms to control oxidative stress and primordial follicle activation and survival during \u003cem\u003ein vitro\u003c/em\u003e culture of bovine ovarian tissue. Domest. Anim. Endocrinol. 86:106824. https://doi.org/10.1016/j.domaniend.2023.106824\u003c/li\u003e\n\u003cli\u003eSilva BR, Nascimento DR, Costa FC, Caetano Filho FF, de Assis EIT, Aguiar FLN, Silva AWB, Costa JJN, Silva JRV (2024) Melatonin improves the viability and ultrastructure of bovine oocyte-granulosa complexes of \u003cem\u003ein vitro\u003c/em\u003e cultured early antral follicles. Reprod Domest Anim 59:e14543. https://doi.org/10.1111/rda.14543\u003c/li\u003e\n\u003cli\u003eSilva RLDS, de Sousa Barberino R, Tavares de Matos MHT (2023) Impact of antioxidant supplementation during \u003cem\u003ein vitro\u003c/em\u003e culture of ovarian preantral follicles: a review. Theriogenology 207:110-122. https://doi.org/10.1016/j.theriogenology.2023.05.027\u003c/li\u003e\n\u003cli\u003eSummerlin N, Soo E, Thakur S, Qu Z, Jambhrunkar S, Popat A (2015) Resveratrol nanoformulations: challenges and opportunities. Int J Pharm 479:282-290. https://doi.org/10.1016/j.ijpharm.2015.01.003\u003c/li\u003e\n\u003cli\u003eSugiyama M, Kawahara-Miki R, Kawana H, Shirasuna K, Kuwayama T, Iwata H (2015) Resveratrol-induced mitochondrial synthesis and autophagy in oocytes derived from early antral follicles of aged cows. J Reprod Dev 61:251-259. https://doi.org/10.1262/jrd.2015-001\u003c/li\u003e\n\u003cli\u003eTakeo S, Sato D, Kimura K, Monji Y, Kuwayama T, Kawahara-Miki R, Iwata H (2014) Resveratrol improves the mitochondrial function and fertilization outcome of bovine oocytes. J Reprod Dev 60:92-99. https://doi.org/10.1262/jrd.2013-102\u003c/li\u003e\n\u003cli\u003eTruong VL, Jun M, Jeong WS (2018) Role of resveratrol in regulation of cellular defense systems against oxidative stress. Biofactors 44:36\u0026ndash;49. https://doi.org/10.1002/biof.1399\u003c/li\u003e\n\u003cli\u003eVasse J, Fiscus J, Fraison E, Salle B, David L, Labrune E (2025) Biomechanical properties of ovarian tissue and their impact on the activation of follicular growth: a narrative review. Reprod. Biomed. Online 50:104450. https://doi.org/10.1016/j.rbmo.2024.104450\u003c/li\u003e\n\u003cli\u003eWang H, Yang L (2025) Ovarian mechanobiology: understanding the interplay between mechanics and follicular development. Cells 14:355. https://doi.org/10.3390/cells14050355\u003c/li\u003e\n\u003cli\u003eWang J, Du H, Ma L, Feng M, Li L, Zhao X, Dai Y (2023) MitoQ protects ovarian organoids against oxidative stress during oogenesis and folliculogenesis in vitro. Int. J. Mol. Sci. 24:924. https://doi.org/10.3390/ijms24020924\u003c/li\u003e\n\u003cli\u003eWang L, Tang J, Wang L, Tan F, Song H, Zhou J, Li F (2021) Oxidative stress in oocyte aging and female reproduction. J. Cell. Physiol. 236:7966-7983. https://doi.org/10.1002/jcp.30468\u003c/li\u003e\n\u003cli\u003eYan HJ, Casalini T, Hulsart-Billstr\u0026ouml;m G (2018) Synthetic design of growth factor sequestering extracellular matrix mimetic hydrogel for promoting \u003cem\u003ein vivo\u003c/em\u003e bone formation. Biomaterials 161:190-202. https://doi.org/10.1016/j.biomaterials.2018.01.041\u003c/li\u003e\n\u003cli\u003eZhao X, Zhang S, Gao S, Chang H-M, Leung PCK, Tan J (2023) A novel three-dimensional follicle culture system decreases oxidative stress and promotes the prolonged culture of human granulosa cells. ACS Appl Mater Interfaces 15:15084-15095. https://doi.org/10.1021/acsami.2c18734\u003c/li\u003e\n\u003cli\u003eZheng M, Cadenas J, Pors SE, Esa T, Kristensen SG, Mamsen LS, Adrados CS, Andersen CY (2023) Reducing 3D hydrogel stiffness, addition of estradiol in a physiological concentration and increasing FSH concentration improve in vitro growth of murine preantral follicles. Int. J. Mol. Sci. 24:12499. https://doi.org/10.3390/ijms241512499\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":false,"email":"","identity":"journal-of-assisted-reproduction-and-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Journal of Assisted Reproduction and Genetics","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"VoR Journals","inReviewEnabled":false,"inReviewRevisionsEnabled":false},"keywords":"Decellularization, Ovarian follicles, Nanotechnology, Resveratrol, Antioxidant","lastPublishedDoi":"10.21203/rs.3.rs-7760007/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7760007/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study evaluated the effects of decellularized ovarian bioscaffolds and resveratrol-loaded polymeric nanoparticles (RLPN) on the \u003cem\u003ein vitro\u003c/em\u003e development of bovine secondary follicles. Decellularized extracellular matrix (dECM) from cortical fragments was obtained by freeze\u0026ndash;thaw cycles and sequential incubation in Triton X-100 and sodium dodecyl sulfate. Decellularization efficiency and extracellular matrix integrity were assessed by hematoxylin-eosin, Hoechst staining, scanning electron microscopy, and quantification of collagen and glycosaminoglycans. Bovine secondary follicles were isolated and cultured for 12 days in either a two-dimensional (2D) system or in dECM scaffolds in medium supplemented with 0.02, 0.2, or 2.0\u0026micro;M RLNP, blank nanoparticles, or unencapsulated resveratrol. Follicular viability and ultrastructure were evaluated by calcein-AM/ethidium homodimer-1 staining and transmission electron microscopy. Expression of mRNA for catalase, superoxide dismutase, glutathione peroxidase 1, peroxiredoxin 6, and nuclear factor erythroid 2-related factor 2 was assessed by qRT-PCR. Quantitative data were analyzed by unpaired t-tests or one-way ANOVA, followed by Tukey\u0026rsquo;s test (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Hematoxylin-eosin and Hoechst staining confirmed effective cell removal, while collagen, glycosaminoglycans, and ECM ultrastructure were preserved. Follicles cultured in the three-dimensional (3D) system showed increased viability, further enhanced by 0.02 or 2.00 \u0026micro;M RLPN. Follicles cultured with 0.02 \u0026micro;M RLPN exhibited well-preserved morphology, including intact zona pellucida, oocyte membrane, and organelles. RLPN downregulated the expression of antioxidant genes. In conclusion, the decellularization protocol effectively removed cellular content and preserved ECM structure and ultrastructure. 3D culture system in combination with medium supplemented with 0.02 \u0026micro;M RLPN supported follicular development and ultrastructure, as well as downregulated antioxidant gene expression.\u003c/p\u003e","manuscriptTitle":"Decellularized ovarian bioscaffolds and resveratrol-loaded polymeric nanoparticles improve in vitro development of bovine preantral follicles","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-16 11:56:05","doi":"10.21203/rs.3.rs-7760007/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-11-17T14:26:19+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-03T19:22:54+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-28T19:37:57+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"22215567572719997584106781799546457961","date":"2025-10-26T02:36:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"227891948352540544664817954785752617087","date":"2025-10-25T19:29:04+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"155144136927839617944078479505105443288","date":"2025-10-15T12:34:45+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"88529308135971254382966940744611760401","date":"2025-10-10T18:05:23+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-05T15:09:43+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-03T02:47:08+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-03T02:45:31+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Assisted Reproduction and Genetics","date":"2025-10-01T13:34:54+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":false,"email":"","identity":"journal-of-assisted-reproduction-and-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Journal of Assisted Reproduction and Genetics","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"VoR Journals","inReviewEnabled":false,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"92e00b43-c9c9-4fbd-9127-32ade423c94e","owner":[],"postedDate":"October 16th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-01-29T14:40:37+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-16 11:56:05","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7760007","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7760007","identity":"rs-7760007","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.