Molecular characterization and salinity-responsive expression of Isocitrate dehydrogenase (NADP) in cichlid Etroplus suratensis (Bloch, 1790). | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular characterization and salinity-responsive expression of Isocitrate dehydrogenase (NADP) in cichlid Etroplus suratensis (Bloch, 1790). Arun Kumar T V, Pradeep M A, Vijayan K K, Preena P G This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9137136/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Euryhaline cichlid Etroplus suratensis (Pearl spot), was found to exhibit strong acclimatization efficiency in brackish water (BW), fresh water (FW) as well as in sea water (SW) condition throughout their life cycle. This capability makes it to be considered as a suitable euryhaline teleost model for investigating and understanding the effect of salinity challenges in fishes. Here, we investigated the effect of salinity on the gills of E.suratensis acclimated to different salinity conditions using Suppression Subtractive Hybridization (SSH) and Real Time PCR (qPCR). The Rapid amplification of cDNA ends (RACE) technique was used to obtain complete coding sequences (CDSs) from the selected EST’s obtained through SSH. The findings revealed the increased expression of isocitrate dehydrogenase (IDH) when E.suratensis were exposed to higher salinities. Thus the study highlights the role of IDH in salinity adaptation as a constant supply of ATP to the cell and as a scavenger of ROS from the cell during oxidative stress. The derived complete CDS was used to deduce its amino acid sequences, which were used to construct a phylogenetic tree and protein model to obtain secondary and tertiary structure information of IDH. The present study is the first of its kind in characterising and studying the expression analysis of IDH derived from E.suratensis at varying salinities. Etroplus suratensis Isocitrate dehydrogenase salinity adaptation Suppression Subtractive Hybridization euryhaline teleost reactive oxygen species Real-Time PCR Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Living organisms have developed adaptation mechanisms to resist the determinant effects of climate change. Enhanced expression of functional genes involved in complex stress tolerance mechanisms can alter normal physiological and biochemical processes through adaptation mechanisms. Changes in the pH, temperature, and salinity of water above or below the optimal species range can act as environmental stressors for aquatic organisms, affecting their existence (Heugens et al. 2001 ). Approximately 20–60% of the total energy budget of a teleost has been estimated to be used in osmoregulation under hyper-saline stress (Boeuf and Payan 2001 ). Salinity is one among the important environmental factors that affects the growth, reproduction, development and physiological functions of teleosts. The initial health impacts of estuarine fish exposed to various environmental stressors, including varying salinities, can be monitored by investigating gill histology and ultra-microscopy. Tolerance to salinity changes in the external environment greatly depends on its osmotic regulation capability. Various enzymes, ion transporters, signalling molecules, etc., participate in osmo-regulatory mechanisms and salinity acclimation when the fish are in a fluctuating saline environment (Tseng and Hwang 2008 ). Therefore, it is not surprising to find numerous genes involved in energy metabolism in transcriptomic studies. Variations in constituents related to the electron transport chain (ETC), glycolysis, fatty acid metabolism, and ATP production are often associated with salinity levels (Lavado et al. 2013 ). It has also been indicated that regulation of similar kind of genes is greatly influenced by different concentrations of salinity, specific organs and time of exposure (Tseng and Hwang 2008 ). Carbohydrate metabolism, which comprises glycolysis, Krebs cycle and electron transport chain, is one of the significant pathways involved in spending energy for controlling osmotic pressure (De Boeck et al. 2000 ). Isocitrate dehydrogenase (EC 1.1.1.42) (IDH), located in mitochondria, is an important enzyme in tricarboxylic acid (TCA) cycle responsible for cellular respiration in aerobic as well as anaerobic pathway. IDH catalyses the oxidative decarboxylation of isocitrate to produce α-ketoglutaric acid, CO 2 and NADH, providing energy for organisms as well as biosynthetic precursors. It also plays an important role in cellular defence mechanisms against oxidative stress caused by reactive oxygen species (ROS) (Jo et al. 2001 ). Biochemical biomarkers related to oxidative damage, biotransformation and neuro-transmission can be routinely used to investigate the effects of environmental stressors in estuarine and coastal organisms (Maria et al. 2009 ). In marine species, IDH can be used as a biomarker gene as it is highly sensitive to chemical contaminations and abiotic factors such as salinity (Freire et al. 2011 ). Sequence information regarding the candidate gene and its corresponding protein, quantitative expression involved in stress responses and the respective homology model pave the way for further studies on the genetic improvement and adaptive variation programs of this species with aquaculture and ornamental value. Although some studies have explored osmoregulatory mechanisms in E.suratensis , research specifically addressing salinity stress-responsive genes related to energy metabolism in Etroplus species remains limited, with no detailed molecular characterization reported to date. For instance, Chandrasekar et al. ( 2014 ) studied the osmoregulatory mechanisms and expression of ion transporters under various salinity conditions in E.suratensis . While, Marbade et al. ( 2023 ) analysed the expression of stress-responsive and osmoregulatory genes like HSP70 and OSTF1 respectively in E.suratensis across varying salinities. Based on these findings, the current study targets on the molecular and functional characterization of the isocitrate dehydrogenase gene, a key component of energy metabolism. This is the first report of its kind in E.suratensis , highlighting its upregulation under high salinity stress and its potential role in salinity adaptation through enhanced metabolic activity. Materials and methods Experimental animals E.suratensis (n = 75, 12 ± 2 cm length, 75–100 gm weight) samples required for the study were obtained from brackish water Pearl spot farms, Ernakulam, Kerala, India and acclimated in the laboratory for 15 days in one-ton capacity fiber-reinforced plastic tanks containing 500 L water with continuous aeration (salinity: 16‰, temperature: 28 ± 1 and pH: 7.8 ± 0.4). Salinity tolerance experiment and tissue collection After acclimatization, the fish were divided into three groups with 18 fishes each. Each group was maintained in triplicates with six fish per replicate. The fish were maintained in 250 L experimental glass tanks. The first group was exposed to 0‰ (fresh water, FW); the second group was exposed to 36‰ (sea water, SW) and the third group to 18‰ (brackish water, BW) for 21 days. The required salinity was attained by steadily increasing or decreasing the salinity by 2–3‰ every day. After adjusting the respective salinity, the fishes were maintained for four weeks. At the end of the experiment, gill samples were excised and were immediately transferred to RNA later™ (Ambion) and stored at room temperature for 1hr and then at -80 o C until RNA isolation. RNA isolation Total-RNA was extracted according to standard TRIZOL RNA isolation protocol (Life Technologies, Inc., Grand Island, NY) from gills of FW, BW and SW adapted animals for the study. Isolated total RNA was quantified by Bio photometer plus (Eppendorf, Germany) and its integrity was checked in 1.5% agarose gel. The poly(A)+ mRNA for SSH was isolated from the total-RNA using a poly (dT) resin (Qiagen, Hilden, Germany) as per the recommended guidelines Isolation and Identification of Isocitrate dehydrogenase gene using SSH Partial sequences of the IDH gene have been identified using Suppressive Subtractive Hybridization (SSH) (Diatchenko et al. 1999 ). Total RNA isolated from the gills of E.suratensis acclimated to SW was used as the tester and FW as the driver. A 2 µg of mRNA was used to synthesise cDNA. The differentially expressed gene fragments were amplified using suppression PCR and was ligated and cloned into the pJET vector and transformed into Top 10 competent cells. Positive clones were PCR screened and sequenced. Sequences were made into contigs with overlapping regions using DNASTAR SeqMan (Version 7.1.0) and similarity was analysed using BLAST (Basic Local Alignment Search Tool). Quantitative validation of IDH under Hyper and Hypo-saline condition Differentially expressed IDH was validated for its expression levels under 36‰ and 0‰ salinity using a Light Cycler 96 (Roche, Switzerland) Real-time Thermal cycler. The expression level of the gene at 36‰ and 0‰ was normalised to an expression level of 18‰, which was taken as a control. Gene specific primers were designed and synthesised for IDH and 18s rRNA. Real-time primer sequences of IDH were as follows: Iso-citrate QF, 5’-GCCACCATTACACCTGACGA-3’ and Iso-citrate QR, 5’-TTCCTGATGGTTCCGTTGGG-3’ with the product of size 83bp. 18s rRNA served as the housekeeping gene that determined the efficiency of real time amplification using the method described by Pfaffl ( 2001 ). Real-time primer sequences of 18s rRNA were as follows: 18S rRNA qF, 5’-GGACACGGAAAGGATTGACAG-3’ and 18S rRNA qR, 5’-GTTCGTTATCGGAATTAACCAGAC − 3’ with the product size of 140bp. The RNA samples isolated from the gills of acclimatised fish were quantified spectrophotometrically (Eppendorf, Germany) and the sample integrity was checked in agarose gel (1.5%). RNase free DNase I (1U/µg RNA, Fermentas) was used to remove genomic DNA contamination from the quantified RNA. cDNA was synthesised using an iScript cDNA synthesis kit (Bio-Rad, USA). The resultant product was diluted and used as a template in a 25µl PCR reaction mix with iQ SYBR Green super mix (Bio-Rad, USA). qPCR amplification was carried out using the following cycling parameters: 94 ℃ for 3min followed by 45 cycles at 94 ℃ for 10 sec, 60 ℃ for 30 sec and 72 ℃ for 20 sec and final melting curve starting from 99℃ to 55℃, 0.5 ℃ decrease in every 10 seconds was carried out to make ensure that the specific products were amplified. PCR conditions were standardised for both the house keeping genes and IDH genes. The relative expression was determined using the following formula. Expression Ratio = {(E target ) ΔCt target (Control−Sample) }/ {(E ref ) ΔCt ref (Control−Sample) } Here, E target and E ref denoted the PCR efficiency of the target and reference genes respectively, and C t is the cycle threshold. Relative quantification of gene expression was expressed as fold- change. Full gene Amplification of IDH by RACE PCR Total RNA isolated from E.suratensis gills acclimatized to 36‰ was used as the template. Gene specific primers (GSPs) for both 5’ and 3’ RACE were manually designed. RACE was performed using SMARTer RACE 5’/3’ cDNA amplification kit (Clontech, USA) following manufacture’s protocol. RACE specific primers designed were as follows IDH 3'RACE TTCTGCCCTGGCCACCAAGAAATAC and IDH 5'RACE CTTGCAGATGATTGGCTCACGGAAG. The cDNA for both 5’ and 3’ RACE was synthesized and RACE PCR was performed under the following cycling parameters for touchdown PCR: 94℃ 30 sec, 72℃ 3min: 5 cycles. 94℃ 30 sec, 70℃ 30 sec, 72 ℃ 3min: 5 cycles and finally 94℃ 30 sec, 68 ℃ 30 sec, 72℃ 3min: 25 cycles. Products of the desired size obtained after amplification were ligated into the pJET cloning vector and transformed into the Top 10 competent cells. Transformed cells were grown on Luria Berthoni (LB) agar plates containing ampicillin (100mg/ml) at 37 ℃. The clones containing desired insert was screened using PCR and cultured in LB broth supplemented with ampicillin (100mg/ml). Plasmids were isolated and sequenced using the vector specific primers. Sequences obtained were aligned and vector portions were removed using SeqMan software. The trimmed sequences were assembled to create contigs with overlapping region. The respective contigs obtained from both the 5’ and 3’ regions were analysed in NCBI (BLASTN and BLASTX) to find the similarity with available sequences in the database. Recombinant cloning of IDH The coding sequence of the IDH gene was amplified using the oligonucleotide forward primer 5’ TCTTATTTCATGAAGGCTGGATACTTGAAAGTCCTCA 3’ (> IDH F) and oligonucleotide reverse primer 5’ ATATAAATCTCGAGCTTTCCGAGGGCTTTATCCAGA 3’ (> IDH R) and cloned into NcoI and XhoI site of pET28b (Novagen, USA). pET28b IDH construct was then transformed to Escherichia coli BL 21(DE3). Phylogenetic tree construction and protein modelling IDH gene sequences obtained were translated into to their corresponding amino acid sequences using the Expert Protein Analysis System (EXPASY) tool. CLUSTAL Omega multiple sequence alignment tool were used to generate multiple sequence alignments using homologous IDH gene sequences retrieved from NCBI. Molecular Evolutionary Genetics Analysis (MEGA version X) software was used to construct a phylogenetic tree using the Neighbor- Joining method (Kumar et al. 2018 ). SWISS-MODEL, an automated protein modelling server (Schwede et al. 2018) was used to predict the tertiary structure of the IDH protein. The location of signal peptide cleavage sites in IDH amino acid sequences were predicted using the software SignalP 4.0 (Petersen et al. 2011 ). Sequence analysis The sequences were analysed using BLASTN, BLASTX, LALIGN (ExPASy) (Huang and Miller 1991 ), NetSurfP 2.0 (Klausen et al. 2019 ), SignalP 4.0 (Petersen et al. 2011 ), CLUSTAL Omega and BioEdit sequence alignment editor software (version 7.2.5) (Hall 1999 ). Results Isolation and Identification of Isocitrate dehydrogenase gene using SSH One hundred and five clones were randomly selected and sequenced from the subtractive cDNA libraries and the representative EST’s revealed 68 unique genes. Those genes were found to exhibit various functions such as cellular processes, stress, immunity, transporter and cytoskeleton and we have already studied the gene expression profile of the selected 10 EST’s responsible for osmoregulation (Kumar et al. 2020). IDH is one among the identified candidate genes, which play a vital role in E. suratensis for increased cellular respiration and energy production and was targeted for characterisation in the present study. Thus the IDH gene partial sequence of E.suratensis under salinity stress (36‰) obtained using SSH (SSH#15_1) was identified using BLAST and submitted to the GenBank database with the accession number MN821125. Quantitative validation of IDH under Hyper and Hypo-saline condition The partial sequence of IDH was further used to determine the effect of salinity on their mRNA expression in gills, which showed a 0.6-fold decrease (60% reduction, down regulated) in FW (0‰) with respect to the normalised control (18‰) and 0.65-fold increase (65% enhancement in the activity, upregulated) in SW (36‰) when compared with the control and this can be also projected as 1.20 fold increase (i.e, more than double, 120%) in SW with respect to FW acclimated fish. This finding indicates that IDH, which is involved in energy metabolism, was expressed more vigorously during hypersaline acclimation rather than hypo-saline. Hence, as the salinity increases, the energy required by the organisms in that particular environment also increases. Full gene Amplification of IDH by RACE PCR The complete gene sequence of IDH was determined using the 5’ and 3’ RACE technique with the product size of 572 bp and 1649 bp for 5’ RACE and 3’ RACE respectively. Both forward and reverse IDH gene sequences were aligned and assembled as single contig to obtain the complete gene and further identified by NCBI-BLAST analysis. IDH gene possessed an ORF of 1359 bp (Fig. 2) (Accession No: MT439957) which codes for 452 amino acids (Fig. 3). The predicted molecular weight was about 50.55 kilo Dalton (kDa). The 5’ UTR comprised 59 nucleotides and the 3’UTR included 350 nucleotides (Fig. 2). The protein consisted of 54 strongly acidic (-) amino acids (D, E), 55 strongly basic (+) amino acids (K, R), 112 polar amino acids (N,C,Q,S,T and Y) and 158 hydrophobic amino acids (A,I,L,F,W and V). Isoelectric point and charge at pH 7 of the protein were 7.594 and + 2.162 respectively. The aliphatic index of IDH was 80.29 which indicates that the protein is likely to be thermally stable and less prone to denaturation. The grand average of hydropathicity (GRAVY) index score of the protein measured by Kyte-Doolittle and Hopp Woods formula was − 0.296 which in turn suggests that the protein is globular and hydrophilic in nature that can affect its solubility and interaction with the aqeous environment. As predicted by SignalP 4.0 software, no signal peptides were found in the deduced amino acid sequence of E suratensis IDH (Fig. 5). Recombinant cloning of IDH Amplified cDNA possessed an ORF of 1359 bp (Fig. 4) which was later used for induced recombinant protein expression and purification of IDH. Multiple sequence alignment, phylogenetic tree construction and protein modelling Multiple sequence alignments showed that the deduced amino acid sequence of E.suratensis IDH shared high similarity with other IDH amino acid sequences from O.niloticus (97.79%), A.centrarchus (97.57%), M.zebra (96.90%), N.bichardi (96.90%), T.rubripes (94.92%), S.aurata (94.03%), D.rerio (93.36%), C.auratus (92.92%) and C.virginica (73.8%). Based on blast results, a phylogenetic tree was constructed using MEGA X (Fig. 5) with the IDH amino acid sequences from Austrofundulus limnaeus, Oreochromis niloticus, Neolamprologus brichardi, Mylandia zebra, Stegastes partitus, Amphiprion ocellaris, Fundulus heteroclitus, Larimichthys crocea, Perca flavescens, Onchorynchus mykiss and Crassostrea gigas . The IDH relationship in the phylogenetic tree were consistent with the traditional taxonomy of the above species. Deduced amino acids from coding sequences (CDS) were used to predict the secondary (NetSurfP 2.0) and 3-Dimensional structure IDH gene (mitochondrial) in E.suratensis . The 3-D prediction was done using IDH alpha fold DB model of Oreochromis mossambicus (Template ID: Q1KN73.1.A) as template with a sequence identity of 98.01% (Fig. 8). The Ramachandran plot value (favoured score) of IDH was found to be 91.78% with 452 amino acid residues lying in the favoured region, indicating that the majority residues are in the most stable and common backbone confirmations. Discussion The acclimatisation of freshwater and brackish water teleost to raised salinity condition demands high energy expenditure in order to maintain an internal homeostasis. During the adaptation from FW to SW, the gill epithelium of euryhaline fishes undergoes extensive remodelling to account for altered requirements of ion transport and permeability (Fiol et al. 2006 ). Osmotic stress responses associated with SW acclimation triggers the activation of significant molecular and physiological adaptations, including changes in gill cell proliferation and differentiation, and modulation in the expression and activity of ATPases, secondary active ion transporters and structural proteins (Evans 2002 ). In a study on P.hypopthalmus , prolonged exposure to elevated salinity resulted in the upregulation of several genes having prime role in energy metabolism (Nguyen et al. 2016 ). The present finding indicates that IDH involved in energy metabolism was expressed more vigorously during hypersaline acclimation rather than hypo-saline. Hence the energy expenditure is found to be higher during SW acclimation as compared to FW. As salinity increases, the energy required by the organism inhabited in that particular environment also increases. Higher fold expression of IDH in fish exposed to increased salinity indicates that NADPH is being recycled at higher rates in these organisms than in fish exposed to low salinity. In our recent study, molecular pathways such as oxidative phosphorylation and mitochondrial energy metabolism were found to be activated in the gills of Etroplus suratensis under salinity stress, as demonstrated through transcriptomic analysis (Pradeep et al. 2026 ). This pointed out the increased demand for cellular energy during osmotic adaptation. This is in consistent with the present findings, where the elevated expression of specific mitochondrial gene further highlighted the significance of mitochondrial metabolic pathways in ATP production and alleviating oxidative stress during salinity acclimation. It has already been hypothesised that the tolerance capability of the fishes to environmental stress like salinity could have direct influence on the rate of metabolic performance (Djiba et al. 2021 ). Fluctuations in environmental salinity disrupt ionic homeostasis, leading to excessive production of reactive oxygen species (ROS) and subsequent oxidative stress in aquatic organisms (Bal et al., 2021 ; Dildar et al., 2025 ). Hyper-salinity has a vital role in affecting the redox balance as it paves the way for more reactive oxygen species (ROS) generation (Freire et al. 2011 ). Formation of ROS could enhance oxidative stress, which is the result of the increased respiratory activity in mitochondria for higher energy production. However, Jo et al. ( 2001 ) stated that the IDH could act as a potent antioxidant enzyme through the increased production of mitochondrial NADPH, which is essential for glutathione regeneration, thereby suppressing the oxidative stress and protecting the cells. This pointed out that, even though IDH could increase the respiratory rate in E. suratensis , the cell damage due to ROS would be diminished and enhances the probability of survival of teleost under salinity stress. Understanding the way of energy utilization in fishes will help to unearth the physiological responses behind the environmental stresses and to establish better strategies for sustainable fish farming. Very recently, IDH and fructose-bisphosphate aldolase were found to be upregulated when marine Nibea albiflora was acclimated to low salinity (fresh water) from marine environment (Zhao et al. 2021 ). This indicates the enhancement of carbohydrate metabolism and aerobic respiration under low salinity stress. Meanwhile, the present finding highlighted the upregulation of IDH only under high salinity stress and is downregulated in low salinity conditions. This reduced expression might be due to the least energy expenditure necessary for the fish to cope with low salinity stress as compared to hyper saline environment. There are studies indicating that fishes could utilize lipids also as source of energy other than carbohydrates (Watanabe 1982 ). A study in Centropomus parallelus indicated that for long term salinity acclimation, lipids contribute to major metabolic requirements (Rocha et al. 2005 , 2007 ). Therefore, it has been speculated that pathways other than glycolysis may also play a major role in supplying energy for adapting to higher salinity conditions. In a previous case, the variations in carbohydrate metabolism were observed in gills of Oncorhynchus mykiss (rainbow trout) during the gradual acclimation to SW suggested demand for more ATP in order to acclimatize under hyper saline conditions (Soengas et al. 1995 ). As evidenced through transcriptome analysis, Zhang et al. ( 2017 ) also reported the enhanced gene expression of significant enzymes in Krebs cycle viz . acetyl coA synthetase and malate dehydrogenase under high salinity conditions in spotted sea bass. In another study by Tseng et al. ( 2008 ) on Mozambique tilapia ( O.mossambicus ), a significant variation in the activity of carbohydrate metabolism genes like lactate dehydrogenase and citrate synthase (CS) were observed after one hour post acclimation to different salinities. Perry and Walsh ( 1989 ) also observed an increased activity of CS after the transfer of O.mossambicus to SW for two weeks. However, in contrast to the present study, Chen et al. ( 2009 ) demonstrated the decreased expression of IDH in Plecoglossus altivelis when transferred to BW from FW. Evans and Somero ( 2008 ) also hardly detected any alteration in CS activity of euryhaline teleost G.mirabilis while salinity changed. In the case of Macrobrachium nipponense , TCA cycle and ETC related genes like CS and CytC oxidase respectively were found to be downregulated under high salinity conditions, while glycolysis related genes were upregulated, since glycolysis serves as the primary energy generating pathway in crustaceans (Xue et al. 2022 ). Overall, the present study revealed the differential mRNA expression of IDH in the gills of E.suratensis with respect to the altered salinity conditions and is corroborated with the previous studies. Significant enzymes involved in free radical scavenging or ROS quenching are found to be elevated in compensatory manner during stressed conditions (Yadav et al. 2015 ). Although IDH protein is not directly involved in water or ion transport, they lead a vital role in activities that have direct or indirect roles in adaptation to salinity fluctuations in the environment. Thus, the study suggests that IDH may serve as a key candidate gene in maintaining ionic and osmotic homeostasis in E.suratensis , thereby supporting their proper survival in hyper saline environments. Proteomic profiling along with whole genomic sequencing and transcriptomic studies using next generation sequencing techniques can be taken into account in future prospects for the better understanding of fish behaviour under different salinity stressed conditions. Conclusion In euryhaline teleost, sufficient and timely energy production is a prerequisite factor for the proper functioning of osmoregulatory mechanism. It is known that energy metabolite translocation occurs between teleost gill chloride cells (ionocytes) and neighbouring glycogen-rich cells. The present study gives insights into the energetics of osmoregulation in Pearl spot fish. The upregulation of isocitrate dehydrogenase, an important enzyme in the tricarboxylic acid cycle during increased salinity exposure illustrates the essentiality of energy required for maintaining osmotic balance and compensating physiological processes. This information generated, for the first time, can be further utilised to understand the ROS scavenging activity and pathway and to explore the significance of local energy supply for ion-regulatory mechanisms especially in gills through the isolation and purification of IDH protein. Also the species demonstrated remarkable adaptability with 100% survival at 0, 18 and 36 ppt salinities. Thus advanced molecular, genomic and proteomic techniques can be adopted in future to obtain immense knowledge on osmoregulatory mechanism that can resolve various existing queries. Declarations Compliance with Ethical Standards No ethical issues involved. Conflict of Interest The authors confirm that they have no conflicts of interest to declare. Funding Information This research was funded by AMAAS network project under ICAR-NBAIM, Indian Council of Agricultural Research, New Delhi. Author Contribution AKTV performed the wet lab work and drafted the paper. MAP and KKV developed the experimental design and acquired funding for this study and PGP contributed in editing and reviewing the manuscript. Acknowledgement The authors are thankful to the Director, Central Marine Fisheries Research Institute (ICAR-CMFRI), Ernakulam for providing necessary facilities. Data Availability The data presented in this study can be found in online repositories. The names of the repository/repositories and accession number can be found in the article. References Arun Kumar TV, Pradeep MA, Esha A, Vijayan KK (2020) Transcriptomic approach to study salinity tolerance in euryhaline cichlid, Etroplus suratensis (Bloch, 1790). J mar biol Ass India 62(1):24–32. https://doi.org/10.6024/jmbai.2020.62.1.2200-02 Bal A, Pati SG, Panda F, Mohanty L, Paital B (2021) Low salinity induced challenges in the hardy fish Heteropneustes fossilis ; future prospective of aquaculture in near coastal zones. Aquaculture 543:737007. https://doi.org/10.1016/j.aquaculture.2021.737007 Boeuf G, Payan P (2001) How should salinity influence fish growth? Comp Biochem Physiol C Toxicol Pharmacol. 130(4):411–423. https://doi.org/10.1016/S1532-0456(01)00268-X Chandrasekar S, Nich T, Tripathi G, Sahu NP, Pal AK, Dasgupta S (2014) Acclimation of brackish water pearl spot ( Etroplus suratensis ) to various salinities: relative changes in abundance of branchial Na+/K+-ATPase and Na+/K+/2Cl – co-transporter in relation to osmoregulatory parameters. Fish Physiol Biochem 40:983–996. https://doi.org/10.1007/s10695-013-9899-y Chen J, Wu HQ, Shi YH, Li CH, Li MY (2009) The effects of environmental salinity on trunk kidney proteome of juvenile ayu ( Plecoglossus altivelis ). Comp Biochem Physiol Part D Genomics Proteom 4(4):263–267. https://doi.org/10.1016/j.cbd.2009.06.003 De Boeck G, Vlaeminck A, Van der Linden A, Blust R (2000) The energy metabolism of common carp ( Cyprinus carpio ) when exposed to salt stress: an increase in energy expenditure or effects of starvation? Physiol Biochem Zool 73(1):102–111. https://doi.org/10.1086/316717 Diatchenko L, Lukyanov S, Lau YF, Siebert PD (1999) Suppression subtractive hybridization: a versatile method for identifying differentially expressed genes. Methods Enzymol 303:349–380. https://doi.org/10.1016/S0076-6879(99)03022-0 Dildar T, Cui W, Ikhwanuddin M, Ma H (2025) Aquatic organisms in response to salinity stress: ecological impacts, adaptive mechanisms, and resilience strategies. Biology 14(6):667. https://doi.org/10.3390/biology14060667 Djiba PK, Zhang J, Xu Y, Zhang P, Zhou J, Zhang Y, Luo Y (2021) Correlation between metabolic rate and salinity tolerance and metabolic response to salinity in grass carp ( Ctenopharyngodon idella ). Animals 11(12):3445. https://doi.org/10.3390/ani11123445 Evans T, Somero G (2008) A microarray based transcriptomic time- course of Hyper and Hypo-osmotic stress signalling events in the euryhaline fish Gillichthys mirabilis : osmosensors to effectors. J Exp Biol 211(Pt 22):3636–3649. https://doi.org/10.1242/jeb.022160 Freire CA, Togni VG, Hermes-Lima M (2011) Responses of free radical metabolism to air exposure or salinity stress, in crabs ( Callinectes danae and C.ornatus ) with different estuarine distributions. Comp Biochem Physiol Part Mol Integr Physiol 160(2):291–300. https://doi.org/10.1016/j.cbpa.2011.06.024 Hall TA (1999) BioEdit: a user friendly- biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98 Heugens EHW, Hendriks AJ, Dekker T, Van-Straalen NM, Admiraal W (2001) A review of the effects of multiple stressors on aquatic organisms and analysis of uncertainty factors for use in risk assessment. Crit Rev Toxicol 31(3):247–284. https://doi.org/10.1080/20014091111695 Huang X, Miller W (1991) A time-efficient, linear-space local similarity algorithm. Adv Appl Math 12(3):337–357. https://doi.org/10.1016/0196-8858(91)90017-D Jo SH, Son MK, Koh HJ, Lee SM, Song IH, Kim YO, Lee YS, Jeong KS, Kim WB, Park JW, Song BJ, Huhe TL (2001) Control of mitochondrial redox balance and cellular defence against oxidative damage by mitochondrial NADP + dependent isocitrate dehydrogenase. J Biol Chem 276:16168–16176. https://doi.org/10.1074/jbc.M010120200 Klausen MS, Jespersen MC, Nielsen H, Jensen KK, Jurtz VI, Sonderby CK, Sommer MOA, Winther O, Nielsen M, Petersen B, Marcatili P (2019) NetSurfP 2.0: Improved prediction of protein structural features by integrated deep learning. Proteins 87(6):520–527. https://doi.org/10.1002/prot.25674 Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol Biol Evol 35:1547–1549 Lavado R, Aparicio-Fabre R, Schlenk D (2013) Effects of salinity acclimation on the expression and activity of phase I enzymes (CYP450 and FMOs) in coho salmon ( Oncorhynchus kisutch ). Fish Physiol Biochem 40(1):267–278. https://doi.org/10.1007/s10695-013-9842-2 Marbade P, Shanmugam SA, Suresh E, Rathipriya A, Rather MA, Agarwal D (2023) Gene expression profiling and physiological adaptations of pearl spot ( Etroplus suratensis ) under varying salinity conditions. Int J Biol Macromol 253(8):127569. https://doi.org/10.1016/j.ijbiomac.2023.127569 Maria VL, Santos MA, Bebianno MJ (2009) Contaminant effects in shore crabs ( Carcinus maenas ) from Ria Formosa Lagoon. Comp Biochem Physiol C Toxicol Pharmacol 150(2):196–208. https://doi.org/10.1016/j.cbpc.2009.04.013 Nguyen TV, Jung H, Nguyen TM, Hurwood D, Mather P (2016) Evaluation of potential candidate genes involved in salinity tolerance in striped catfish ( P.hypopthalmus ) using an RNA-seq approach. Mar Genom 25:75–88. https://doi.org/10.1016/j.margen.2015.11.010 Perry SF, Walsh PJ (1989) Metabolism of isolated fish gill cells: Contribution of epithelial chloride cells. J Exp Biol 144:507–520 Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29(9):e45. https://doi.org/10.1093/nar/29.9.e45 Petersen TN, Brunak S, Heijne GV, Nielsen H (2011) SignalP 4.0: Discriminating signal peptides from transmembrane regions. Nat Methods 8:785–786. https://doi.org/10.1038/nmeth.1701 Pradeep MA, Rehman S, Jose IM, Kumar TVA, Katneni VK, Gora AH, Dhanutha NR, Jangam AK, Shahansha TSA, Vijayan KK (2026) Molecular adaptations of the estuarine fish Etroplus suratensis in response to salinity fluctuations. Front Mar Sci 13:1775985. https://doi.org/10.3389/fmars.2026.1775985 Rocha AJS, Gomes V, Ngan PV, Passos MJ, Furia RR (2007) Effects of anionic surfactant and salinity on the bioenergetics of juveniles of Centropomus parallelus . Ecotoxicol Environ Saf 68(3):397–404. https://doi.org/10.1016/j.ecoenv.2006.10.007 Rocha AJS, Gomes V, Phan VN, Passos MJ, Furia RR (2005) Metabolic demand and growth of juveniles of Centropomus parallelus as function of salinity. J Exp Mar Biol Ecol 316(2):157–165. https://doi.org/10.1016/j.jembe.2004.11.006 Soengas JL, Aldegunde M, Andres MD (1995) Gradual transfer to sea water of rainbow trout: Effects on liver carbohydrate metabolism. J Fish Biol 47(3):466–478. https://doi.org/10.1111/j.1095-8649.1995.tb01915.x Tseng Y, Hwang P (2008) Some insights into energy metabolism for osmoregulation in fish. Comp Biochem Physiol C Toxicol Pharmacol 148(4):419–429. https://doi.org/10.1088/0268.1242118/6/311 Tseng YC, Lee JR, Chang JCH, Kuo CH, Lee SJ, Hwang PP (2008) Regulation of lactate dehydrogenase in Tilapia ( Oreochromis mossambicus ) gills during acclimation to salinity challenge. Zool Stud 47(4):473–480 Watanabe T (1982) Lipid nutrition in Fish. Comp Biochem Physiol B Biochem Mol Biol 73(1):3–15. https://doi.org/10.1016/0305-0491(82)90196-1 Waterhouse A, Bertoni M, Bienert S, Studer G, Tauriello G, Gumienny R, Heer FT, de Beer TAP, Rempfer C, Bordoli L, Lepore R, Schwede T (2018) SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res 46(W1):W296–W303. https://doi.org/10.1093/nar/gky427 Xue C, Xu K, Jin Y, Bian C, Sun S (2022) Transcriptome analysis to study the molecular response in the gill and hepatopancreas tissues of Macrobrachium nipponense to salinity acclimation. Front Physiol 13:926885. https://doi.org/10.3389/fphys.2022.926885 Yadav SS, Kumar R, Khare P, Tripathi M (2015) Oxidative stress biomarkers in the freshwater fish Heteropneustes fossilis (Bloch) exposed to sodium fluoride: Antioxidant defence and role of Ascorbic acid. Toxicol Int 22(1):71–76. https://doi.org/10.4103/0971-6580.172261 Zhang H, Wen H, Wang H, Ren Y, Zhao Ji, Li Y (2017) RNA-Seq analysis of salinity stress–responsive transcriptome in the liver of spotted sea bass (Lateolabrax maculatus). PLoS ONE 12(3):e0173238. https://doi.org/10.1371/journal.pone.0173238 Zhao X, Sun Z, Gao T, Song N (2021) Transcriptome profiling reveals a divergent adaptive response to hyper- and hypo-salinity in the Yellow drum, Nibea albiflora . Animals 11(8):2201. https://doi.org/10.3390/ani11082201 Fiol DF, Chan SY, Kültz D (2006) Identification and pathway analysis of immediate hyperosmotic stress responsive molecular mechanisms in tilapia ( Oreochromis mossambicus ) gill. Comp Biochem Physiol Part D Genomics Proteom 1(3):344–356. https://doi.org/10.1016/j.cbd.2006.08.002 Evans DH (2002) Cell signalling and ion transport across the fish gill epithelium. J Exp Zool 293(3):336–347. https://doi.org/10.1002/jez.10128 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9137136","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":617107088,"identity":"c92ded34-c184-4c48-8496-e77a2f672cb0","order_by":0,"name":"Arun Kumar T V","email":"","orcid":"","institution":"Central Marine Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Arun","middleName":"Kumar T","lastName":"V","suffix":""},{"id":617107089,"identity":"5eed3dc8-5fc0-438a-9397-f07af47d1971","order_by":1,"name":"Pradeep M A","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5klEQVRIiWNgGAWjYDCCAyCCDcxkfAAkePhI0cJsANLCRooWNgkEGw/gu3322IcfZTZy5mKHn1V+zbGTYWNgfvjoBh4tkufykmf2nEsztpydZnZbdlsy0GFsxsY5eLQYnOExZuBtO5y44XaC2W3JbcxALTxs0oS0MP5t+1+/4Xb6t2LJbfXEaWHmbTuQYHA7x4zx47bDhLVInuFLZpY5l2y4c3ZOsTTjtuM8bMwE/MJ3hvcw45syO3lz6fSNH39uq7bnZ29++BifFmDcQV0IxMxgNjNe5WhaGH8QVD0KRsEoGAUjEQAAKt1FIlBGAq4AAAAASUVORK5CYII=","orcid":"","institution":"Central Marine Fisheries Research Institute","correspondingAuthor":true,"prefix":"","firstName":"Pradeep","middleName":"M","lastName":"A","suffix":""},{"id":617107090,"identity":"5d111dc2-28a3-42f2-ba2e-2c01122587e2","order_by":2,"name":"Vijayan K K","email":"","orcid":"","institution":"Central Institute of Brackish water Aquaculture","correspondingAuthor":false,"prefix":"","firstName":"Vijayan","middleName":"K","lastName":"K","suffix":""},{"id":617107091,"identity":"c5a4d831-ee94-4a01-81a2-621898a3a5e2","order_by":3,"name":"Preena P G","email":"","orcid":"","institution":"Kerala University of Fisheries and Ocean Studies","correspondingAuthor":false,"prefix":"","firstName":"Preena","middleName":"P","lastName":"G","suffix":""}],"badges":[],"createdAt":"2026-03-16 11:23:47","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9137136/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9137136/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":106227606,"identity":"13f6329d-f8d4-4f5f-9deb-02f48b040db0","added_by":"auto","created_at":"2026-04-06 11:41:16","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":11838,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpression level at 0‰, 18‰ and 36‰ was normalised with expression level of 18‰ (ctrl). Each independent experiment was performed at least in triplicates (n=3) (p\u0026lt;0.05, one way ANOVA).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-9137136/v1/bf0d0e305d0e31fb672d3a30.png"},{"id":106227679,"identity":"bba8c51f-1a3b-4279-917e-d0f6ae562603","added_by":"auto","created_at":"2026-04-06 11:41:30","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":741756,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ecDNA sequence of Isocitrate dehydrogenase (IDH) isolated from \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE.suratensis.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-9137136/v1/3ce751cbb1466f27b66f4295.png"},{"id":106227693,"identity":"8608dbd2-7535-4e64-a403-c10473f5632d","added_by":"auto","created_at":"2026-04-06 11:41:33","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":89689,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDeduced amino acid sequence of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE.suratensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e IDH gene\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9137136/v1/5a73e0dbb7d6466ae7c651e9.jpg"},{"id":106227678,"identity":"ccb8d9dc-31eb-4769-b887-9f79e2aa372f","added_by":"auto","created_at":"2026-04-06 11:41:29","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":21362,"visible":true,"origin":"","legend":"\u003cp\u003e: \u003cstrong\u003ec-DNA amplification of IDH gene (complete CDS)\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-9137136/v1/af805bf999b5e893c35d6132.png"},{"id":106227624,"identity":"86a51a1c-c6b0-4e03-89c9-c1f08e0e4389","added_by":"auto","created_at":"2026-04-06 11:41:23","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":34863,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNeighbour-joining phylogenetic tree of IDH constructed using MEGAX software with 1000 replicates.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-9137136/v1/e767d5ee99eb4d2271f2d58d.png"},{"id":106227609,"identity":"fb24ba77-205b-417f-9ee4-1292fd6b492f","added_by":"auto","created_at":"2026-04-06 11:41:16","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":48345,"visible":true,"origin":"","legend":"","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-9137136/v1/7245f56318a10e51268071ef.png"},{"id":106227628,"identity":"b5a75a17-10e7-4d3c-827b-2cb027c67cfa","added_by":"auto","created_at":"2026-04-06 11:41:24","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":375743,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSecondary structure of IDH protein predicted by NetSurfP 2.0\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-9137136/v1/3a77e2ead71e8a8d23607427.png"},{"id":106227623,"identity":"f2f15877-be2d-47e7-82c0-530665462fcb","added_by":"auto","created_at":"2026-04-06 11:41:23","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":297700,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e3D model of IDH (mitochondrial) protein and its predicted Ramachandran plot predicted by Swiss-Model (Top) visualized by PyMol (Bottom) (Molecular graphics system, version 4.3 Schrodinger, LLC).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-9137136/v1/025cf0f36dbb99098f33201c.png"},{"id":106227625,"identity":"d3c568b5-2251-450a-b514-d0d9a0ebf98f","added_by":"auto","created_at":"2026-04-06 11:41:24","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":862298,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAmino acid multiple sequence alignment (Clustal Omega) of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEtroplus suratensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e IDH protein (MT439957) compared to \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eO.niloticus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA.centrarchus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eM.zebra\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eN.bichardi\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eS.aurata\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eT.rubripes\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eD.rerio\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC.auratus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC.virginica\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-9137136/v1/a77a737741697b6c1edba3d9.png"},{"id":106227770,"identity":"bca4283d-2fcd-4a83-ae4c-ad3d756d2e19","added_by":"auto","created_at":"2026-04-06 11:42:02","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3486011,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9137136/v1/6d8bae74-6023-4cd5-a146-16865b15f00a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Molecular characterization and salinity-responsive expression of Isocitrate dehydrogenase (NADP) in cichlid Etroplus suratensis (Bloch, 1790).","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLiving organisms have developed adaptation mechanisms to resist the determinant effects of climate change. Enhanced expression of functional genes involved in complex stress tolerance mechanisms can alter normal physiological and biochemical processes through adaptation mechanisms. Changes in the pH, temperature, and salinity of water above or below the optimal species range can act as environmental stressors for aquatic organisms, affecting their existence (Heugens et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Approximately 20\u0026ndash;60% of the total energy budget of a teleost has been estimated to be used in osmoregulation under hyper-saline stress (Boeuf and Payan \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Salinity is one among the important environmental factors that affects the growth, reproduction, development and physiological functions of teleosts. The initial health impacts of estuarine fish exposed to various environmental stressors, including varying salinities, can be monitored by investigating gill histology and ultra-microscopy. Tolerance to salinity changes in the external environment greatly depends on its osmotic regulation capability. Various enzymes, ion transporters, signalling molecules, etc., participate in osmo-regulatory mechanisms and salinity acclimation when the fish are in a fluctuating saline environment (Tseng and Hwang \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Therefore, it is not surprising to find numerous genes involved in energy metabolism in transcriptomic studies. Variations in constituents related to the electron transport chain (ETC), glycolysis, fatty acid metabolism, and ATP production are often associated with salinity levels (Lavado et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). It has also been indicated that regulation of similar kind of genes is greatly influenced by different concentrations of salinity, specific organs and time of exposure (Tseng and Hwang \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2008\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCarbohydrate metabolism, which comprises glycolysis, Krebs cycle and electron transport chain, is one of the significant pathways involved in spending energy for controlling osmotic pressure (De Boeck et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). Isocitrate dehydrogenase (EC 1.1.1.42) (IDH), located in mitochondria, is an important enzyme in tricarboxylic acid (TCA) cycle responsible for cellular respiration in aerobic as well as anaerobic pathway. IDH catalyses the oxidative decarboxylation of isocitrate to produce α-ketoglutaric acid, CO\u003csub\u003e2\u003c/sub\u003e and NADH, providing energy for organisms as well as biosynthetic precursors. It also plays an important role in cellular defence mechanisms against oxidative stress caused by reactive oxygen species (ROS) (Jo et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Biochemical biomarkers related to oxidative damage, biotransformation and neuro-transmission can be routinely used to investigate the effects of environmental stressors in estuarine and coastal organisms (Maria et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). In marine species, IDH can be used as a biomarker gene as it is highly sensitive to chemical contaminations and abiotic factors such as salinity (Freire et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Sequence information regarding the candidate gene and its corresponding protein, quantitative expression involved in stress responses and the respective homology model pave the way for further studies on the genetic improvement and adaptive variation programs of this species with aquaculture and ornamental value. Although some studies have explored osmoregulatory mechanisms in \u003cem\u003eE.suratensis\u003c/em\u003e, research specifically addressing salinity stress-responsive genes related to energy metabolism in \u003cem\u003eEtroplus\u003c/em\u003e species remains limited, with no detailed molecular characterization reported to date. For instance, Chandrasekar et al. (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) studied the osmoregulatory mechanisms and expression of ion transporters under various salinity conditions in \u003cem\u003eE.suratensis\u003c/em\u003e. While, Marbade et al. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) analysed the expression of stress-responsive and osmoregulatory genes like HSP70 and OSTF1 respectively in \u003cem\u003eE.suratensis\u003c/em\u003e across varying salinities. Based on these findings, the current study targets on the molecular and functional characterization of the isocitrate dehydrogenase gene, a key component of energy metabolism. This is the first report of its kind in \u003cem\u003eE.suratensis\u003c/em\u003e, highlighting its upregulation under high salinity stress and its potential role in salinity adaptation through enhanced metabolic activity.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eExperimental animals\u003c/h2\u003e \u003cp\u003e \u003cem\u003eE.suratensis\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;75, 12\u0026thinsp;\u0026plusmn;\u0026thinsp;2 cm length, 75\u0026ndash;100 gm weight) samples required for the study were obtained from brackish water Pearl spot farms, Ernakulam, Kerala, India and acclimated in the laboratory for 15 days in one-ton capacity fiber-reinforced plastic tanks containing 500 L water with continuous aeration (salinity: 16\u0026permil;, temperature: 28\u0026thinsp;\u0026plusmn;\u0026thinsp;1 and pH: 7.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eSalinity tolerance experiment and tissue collection\u003c/h3\u003e\n\u003cp\u003eAfter acclimatization, the fish were divided into three groups with 18 fishes each. Each group was maintained in triplicates with six fish per replicate. The fish were maintained in 250 L experimental glass tanks. The first group was exposed to 0\u0026permil; (fresh water, FW); the second group was exposed to 36\u0026permil; (sea water, SW) and the third group to 18\u0026permil; (brackish water, BW) for 21 days. The required salinity was attained by steadily increasing or decreasing the salinity by 2\u0026ndash;3\u0026permil; every day. After adjusting the respective salinity, the fishes were maintained for four weeks. At the end of the experiment, gill samples were excised and were immediately transferred to RNA later\u0026trade; (Ambion) and stored at room temperature for 1hr and then at -80\u003csup\u003eo\u003c/sup\u003eC until RNA isolation.\u003c/p\u003e\n\u003ch3\u003eRNA isolation\u003c/h3\u003e\n\u003cp\u003eTotal-RNA was extracted according to standard TRIZOL RNA isolation protocol (Life Technologies, Inc., Grand Island, NY) from gills of FW, BW and SW adapted animals for the study. Isolated total RNA was quantified by Bio photometer plus (Eppendorf, Germany) and its integrity was checked in 1.5% agarose gel. The poly(A)+ mRNA for SSH was isolated from the total-RNA using a poly (dT) resin (Qiagen, Hilden, Germany) as per the recommended guidelines\u003c/p\u003e\n\u003ch3\u003eIsolation and Identification of Isocitrate dehydrogenase gene using SSH\u003c/h3\u003e\n\u003cp\u003ePartial sequences of the IDH gene have been identified using Suppressive Subtractive Hybridization (SSH) (Diatchenko et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). Total RNA isolated from the gills of \u003cem\u003eE.suratensis\u003c/em\u003e acclimated to SW was used as the tester and FW as the driver. A 2 \u0026micro;g of mRNA was used to synthesise cDNA. The differentially expressed gene fragments were amplified using suppression PCR and was ligated and cloned into the pJET vector and transformed into Top 10 competent cells. Positive clones were PCR screened and sequenced. Sequences were made into contigs with overlapping regions using DNASTAR SeqMan (Version 7.1.0) and similarity was analysed using BLAST (Basic Local Alignment Search Tool).\u003c/p\u003e\n\u003ch3\u003eQuantitative validation of IDH under Hyper and Hypo-saline condition\u003c/h3\u003e\n\u003cp\u003eDifferentially expressed IDH was validated for its expression levels under 36\u0026permil; and 0\u0026permil; salinity using a Light Cycler 96 (Roche, Switzerland) Real-time Thermal cycler. The expression level of the gene at 36\u0026permil; and 0\u0026permil; was normalised to an expression level of 18\u0026permil;, which was taken as a control. Gene specific primers were designed and synthesised for IDH and 18s rRNA. Real-time primer sequences of IDH were as follows: Iso-citrate QF, 5\u0026rsquo;-GCCACCATTACACCTGACGA-3\u0026rsquo; and Iso-citrate QR, 5\u0026rsquo;-TTCCTGATGGTTCCGTTGGG-3\u0026rsquo; with the product of size 83bp. 18s rRNA served as the housekeeping gene that determined the efficiency of real time amplification using the method described by Pfaffl (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Real-time primer sequences of 18s rRNA were as follows: 18S rRNA qF, 5\u0026rsquo;-GGACACGGAAAGGATTGACAG-3\u0026rsquo; and 18S rRNA qR, 5\u0026rsquo;-GTTCGTTATCGGAATTAACCAGAC\u0026thinsp;\u0026minus;\u0026thinsp;3\u0026rsquo; with the product size of 140bp. The RNA samples isolated from the gills of acclimatised fish were quantified spectrophotometrically (Eppendorf, Germany) and the sample integrity was checked in agarose gel (1.5%). RNase free DNase I (1U/\u0026micro;g RNA, Fermentas) was used to remove genomic DNA contamination from the quantified RNA. cDNA was synthesised using an iScript cDNA synthesis kit (Bio-Rad, USA). The resultant product was diluted and used as a template in a 25\u0026micro;l PCR reaction mix with iQ SYBR Green super mix (Bio-Rad, USA). qPCR amplification was carried out using the following cycling parameters: 94 ℃ for 3min followed by 45 cycles at 94 ℃ for 10 sec, 60 ℃ for 30 sec and 72 ℃ for 20 sec and final melting curve starting from 99℃ to 55℃, 0.5 ℃ decrease in every 10 seconds was carried out to make ensure that the specific products were amplified. PCR conditions were standardised for both the house keeping genes and IDH genes. The relative expression was determined using the following formula.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eExpression Ratio = {(E\u003csub\u003etarget\u003c/sub\u003e ) \u003csup\u003eΔCt\u003c/sup\u003e\u003csub\u003etarget\u003c/sub\u003e\u003csup\u003e(Control\u0026minus;Sample)\u003c/sup\u003e}/ {(E\u003csub\u003eref\u003c/sub\u003e ) \u003csup\u003eΔCt\u003c/sup\u003e\u003csub\u003eref\u003c/sub\u003e\u003csup\u003e(Control\u0026minus;Sample)\u003c/sup\u003e}\u003c/h2\u003e \u003cp\u003eHere, E\u003csub\u003etarget\u003c/sub\u003e and E\u003csub\u003eref\u003c/sub\u003e denoted the PCR efficiency of the target and reference genes respectively, and C\u003csub\u003et\u003c/sub\u003e is the cycle threshold. Relative quantification of gene expression was expressed as fold- change.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eFull gene Amplification of IDH by RACE PCR\u003c/h3\u003e\n\u003cp\u003eTotal RNA isolated from \u003cem\u003eE.suratensis\u003c/em\u003e gills acclimatized to 36\u0026permil; was used as the template. Gene specific primers (GSPs) for both 5\u0026rsquo; and 3\u0026rsquo; RACE were manually designed. RACE was performed using SMARTer RACE 5\u0026rsquo;/3\u0026rsquo; cDNA amplification kit (Clontech, USA) following manufacture\u0026rsquo;s protocol. RACE specific primers designed were as follows IDH 3'RACE TTCTGCCCTGGCCACCAAGAAATAC and IDH 5'RACE CTTGCAGATGATTGGCTCACGGAAG. The cDNA for both 5\u0026rsquo; and 3\u0026rsquo; RACE was synthesized and RACE PCR was performed under the following cycling parameters for touchdown PCR: 94℃ 30 sec, 72℃ 3min: 5 cycles. 94℃ 30 sec, 70℃ 30 sec, 72 ℃ 3min: 5 cycles and finally 94℃ 30 sec, 68 ℃ 30 sec, 72℃ 3min: 25 cycles. Products of the desired size obtained after amplification were ligated into the pJET cloning vector and transformed into the Top 10 competent cells. Transformed cells were grown on Luria Berthoni (LB) agar plates containing ampicillin (100mg/ml) at 37 ℃. The clones containing desired insert was screened using PCR and cultured in LB broth supplemented with ampicillin (100mg/ml). Plasmids were isolated and sequenced using the vector specific primers. Sequences obtained were aligned and vector portions were removed using SeqMan software. The trimmed sequences were assembled to create contigs with overlapping region. The respective contigs obtained from both the 5\u0026rsquo; and 3\u0026rsquo; regions were analysed in NCBI (BLASTN and BLASTX) to find the similarity with available sequences in the database.\u003c/p\u003e\n\u003ch3\u003eRecombinant cloning of IDH\u003c/h3\u003e\n\u003cp\u003eThe coding sequence of the IDH gene was amplified using the oligonucleotide forward primer 5\u0026rsquo; TCTTATTTCATGAAGGCTGGATACTTGAAAGTCCTCA 3\u0026rsquo; (\u0026gt;\u0026thinsp;IDH F) and oligonucleotide reverse primer 5\u0026rsquo; ATATAAATCTCGAGCTTTCCGAGGGCTTTATCCAGA 3\u0026rsquo; (\u0026gt;\u0026thinsp;IDH R) and cloned into NcoI and XhoI site of pET28b (Novagen, USA). pET28b IDH construct was then transformed to \u003cem\u003eEscherichia coli\u003c/em\u003e BL 21(DE3).\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePhylogenetic tree construction and protein modelling\u003c/h2\u003e \u003cp\u003eIDH gene sequences obtained were translated into to their corresponding amino acid sequences using the Expert Protein Analysis System (EXPASY) tool. CLUSTAL Omega multiple sequence alignment tool were used to generate multiple sequence alignments using homologous IDH gene sequences retrieved from NCBI. Molecular Evolutionary Genetics Analysis (MEGA version X) software was used to construct a phylogenetic tree using the Neighbor- Joining method (Kumar et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). SWISS-MODEL, an automated protein modelling server (Schwede et al. 2018) was used to predict the tertiary structure of the IDH protein. The location of signal peptide cleavage sites in IDH amino acid sequences were predicted using the software SignalP 4.0 (Petersen et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eSequence analysis\u003c/h2\u003e \u003cp\u003eThe sequences were analysed using BLASTN, BLASTX, LALIGN (ExPASy) (Huang and Miller \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1991\u003c/span\u003e), NetSurfP 2.0 (Klausen et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), SignalP 4.0 (Petersen et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), CLUSTAL Omega and BioEdit sequence alignment editor software (version 7.2.5) (Hall \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e1999\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eIsolation and Identification of Isocitrate dehydrogenase gene using SSH\u003c/h2\u003e \u003cp\u003eOne hundred and five clones were randomly selected and sequenced from the subtractive cDNA libraries and the representative EST\u0026rsquo;s revealed 68 unique genes. Those genes were found to exhibit various functions such as cellular processes, stress, immunity, transporter and cytoskeleton and we have already studied the gene expression profile of the selected 10 EST\u0026rsquo;s responsible for osmoregulation (Kumar et al. 2020). IDH is one among the identified candidate genes, which play a vital role in \u003cem\u003eE. suratensis\u003c/em\u003e for increased cellular respiration and energy production and was targeted for characterisation in the present study. Thus the IDH gene partial sequence of \u003cem\u003eE.suratensis\u003c/em\u003e under salinity stress (36\u0026permil;) obtained using SSH (SSH#15_1) was identified using BLAST and submitted to the GenBank database with the accession number MN821125.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative validation of IDH under Hyper and Hypo-saline condition\u003c/h2\u003e \u003cp\u003eThe partial sequence of IDH was further used to determine the effect of salinity on their mRNA expression in gills, which showed a 0.6-fold decrease (60% reduction, down regulated) in FW (0\u0026permil;) with respect to the normalised control (18\u0026permil;) and 0.65-fold increase (65% enhancement in the activity, upregulated) in SW (36\u0026permil;) when compared with the control and this can be also projected as 1.20 fold increase (i.e, more than double, 120%) in SW with respect to FW acclimated fish. This finding indicates that IDH, which is involved in energy metabolism, was expressed more vigorously during hypersaline acclimation rather than hypo-saline. Hence, as the salinity increases, the energy required by the organisms in that particular environment also increases.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eFull gene Amplification of IDH by RACE PCR\u003c/h2\u003e \u003cp\u003eThe complete gene sequence of IDH was determined using the 5\u0026rsquo; and 3\u0026rsquo; RACE technique with the product size of 572 bp and 1649 bp for 5\u0026rsquo; RACE and 3\u0026rsquo; RACE respectively. Both forward and reverse IDH gene sequences were aligned and assembled as single contig to obtain the complete gene and further identified by NCBI-BLAST analysis. IDH gene possessed an ORF of 1359 bp (Fig.\u0026nbsp;2) (Accession No: MT439957) which codes for 452 amino acids (Fig.\u0026nbsp;3). The predicted molecular weight was about 50.55 kilo Dalton (kDa). The 5\u0026rsquo; UTR comprised 59 nucleotides and the 3\u0026rsquo;UTR included 350 nucleotides (Fig.\u0026nbsp;2). The protein consisted of 54 strongly acidic (-) amino acids (D, E), 55 strongly basic (+) amino acids (K, R), 112 polar amino acids (N,C,Q,S,T and Y) and 158 hydrophobic amino acids (A,I,L,F,W and V). Isoelectric point and charge at pH 7 of the protein were 7.594 and +\u0026thinsp;2.162 respectively. The aliphatic index of IDH was 80.29 which indicates that the protein is likely to be thermally stable and less prone to denaturation. The grand average of hydropathicity (GRAVY) index score of the protein measured by Kyte-Doolittle and Hopp Woods formula was \u0026minus;\u0026thinsp;0.296 which in turn suggests that the protein is globular and hydrophilic in nature that can affect its solubility and interaction with the aqeous environment. As predicted by SignalP 4.0 software, no signal peptides were found in the deduced amino acid sequence of \u003cem\u003eE suratensis\u003c/em\u003e IDH (Fig.\u0026nbsp;5).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eRecombinant cloning of IDH\u003c/h2\u003e \u003cp\u003eAmplified cDNA possessed an ORF of 1359 bp (Fig.\u0026nbsp;4) which was later used for induced recombinant protein expression and purification of IDH.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eMultiple sequence alignment, phylogenetic tree construction and protein modelling\u003c/h2\u003e \u003cp\u003eMultiple sequence alignments showed that the deduced amino acid sequence of \u003cem\u003eE.suratensis\u003c/em\u003e IDH shared high similarity with other IDH amino acid sequences from \u003cem\u003eO.niloticus\u003c/em\u003e (97.79%), \u003cem\u003eA.centrarchus\u003c/em\u003e (97.57%), \u003cem\u003eM.zebra\u003c/em\u003e (96.90%), \u003cem\u003eN.bichardi\u003c/em\u003e (96.90%), \u003cem\u003eT.rubripes\u003c/em\u003e (94.92%), \u003cem\u003eS.aurata\u003c/em\u003e (94.03%), \u003cem\u003eD.rerio\u003c/em\u003e (93.36%), \u003cem\u003eC.auratus (92.92%)\u003c/em\u003e and \u003cem\u003eC.virginica\u003c/em\u003e (73.8%). Based on blast results, a phylogenetic tree was constructed using MEGA X (Fig.\u0026nbsp;5) with the IDH amino acid sequences from \u003cem\u003eAustrofundulus limnaeus, Oreochromis niloticus, Neolamprologus brichardi, Mylandia zebra, Stegastes partitus, Amphiprion ocellaris, Fundulus heteroclitus, Larimichthys crocea, Perca flavescens, Onchorynchus mykiss and Crassostrea gigas\u003c/em\u003e. The IDH relationship in the phylogenetic tree were consistent with the traditional taxonomy of the above species. Deduced amino acids from coding sequences (CDS) were used to predict the secondary (NetSurfP 2.0) and 3-Dimensional structure IDH gene (mitochondrial) in \u003cem\u003eE.suratensis\u003c/em\u003e. The 3-D prediction was done using IDH alpha fold DB model of \u003cem\u003eOreochromis mossambicus\u003c/em\u003e (Template ID: Q1KN73.1.A) as template with a sequence identity of 98.01% (Fig.\u0026nbsp;8). The Ramachandran plot value (favoured score) of IDH was found to be 91.78% with 452 amino acid residues lying in the favoured region, indicating that the majority residues are in the most stable and common backbone confirmations.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe acclimatisation of freshwater and brackish water teleost to raised salinity condition demands high energy expenditure in order to maintain an internal homeostasis. During the adaptation from FW to SW, the gill epithelium of euryhaline fishes undergoes extensive remodelling to account for altered requirements of ion transport and permeability (Fiol et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Osmotic stress responses associated with SW acclimation triggers the activation of significant molecular and physiological adaptations, including changes in gill cell proliferation and differentiation, and modulation in the expression and activity of ATPases, secondary active ion transporters and structural proteins (Evans \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). In a study on \u003cem\u003eP.hypopthalmus\u003c/em\u003e, prolonged exposure to elevated salinity resulted in the upregulation of several genes having prime role in energy metabolism (Nguyen et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The present finding indicates that IDH involved in energy metabolism was expressed more vigorously during hypersaline acclimation rather than hypo-saline. Hence the energy expenditure is found to be higher during SW acclimation as compared to FW. As salinity increases, the energy required by the organism inhabited in that particular environment also increases. Higher fold expression of IDH in fish exposed to increased salinity indicates that NADPH is being recycled at higher rates in these organisms than in fish exposed to low salinity. In our recent study, molecular pathways such as oxidative phosphorylation and mitochondrial energy metabolism were found to be activated in the gills of \u003cem\u003eEtroplus suratensis\u003c/em\u003e under salinity stress, as demonstrated through transcriptomic analysis (Pradeep et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2026\u003c/span\u003e). This pointed out the increased demand for cellular energy during osmotic adaptation. This is in consistent with the present findings, where the elevated expression of specific mitochondrial gene further highlighted the significance of mitochondrial metabolic pathways in ATP production and alleviating oxidative stress during salinity acclimation. It has already been hypothesised that the tolerance capability of the fishes to environmental stress like salinity could have direct influence on the rate of metabolic performance (Djiba et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Fluctuations in environmental salinity disrupt ionic homeostasis, leading to excessive production of reactive oxygen species (ROS) and subsequent oxidative stress in aquatic organisms (Bal et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Dildar et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Hyper-salinity has a vital role in affecting the redox balance as it paves the way for more reactive oxygen species (ROS) generation (Freire et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Formation of ROS could enhance oxidative stress, which is the result of the increased respiratory activity in mitochondria for higher energy production. However, Jo et al. (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2001\u003c/span\u003e) stated that the IDH could act as a potent antioxidant enzyme through the increased production of mitochondrial NADPH, which is essential for glutathione regeneration, thereby suppressing the oxidative stress and protecting the cells. This pointed out that, even though IDH could increase the respiratory rate in \u003cem\u003eE. suratensis\u003c/em\u003e, the cell damage due to ROS would be diminished and enhances the probability of survival of teleost under salinity stress. Understanding the way of energy utilization in fishes will help to unearth the physiological responses behind the environmental stresses and to establish better strategies for sustainable fish farming.\u003c/p\u003e \u003cp\u003eVery recently, IDH and fructose-bisphosphate aldolase were found to be upregulated when marine \u003cem\u003eNibea albiflora\u003c/em\u003e was acclimated to low salinity (fresh water) from marine environment (Zhao et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). This indicates the enhancement of carbohydrate metabolism and aerobic respiration under low salinity stress. Meanwhile, the present finding highlighted the upregulation of IDH only under high salinity stress and is downregulated in low salinity conditions. This reduced expression might be due to the least energy expenditure necessary for the fish to cope with low salinity stress as compared to hyper saline environment. There are studies indicating that fishes could utilize lipids also as source of energy other than carbohydrates (Watanabe \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1982\u003c/span\u003e). A study in \u003cem\u003eCentropomus parallelus\u003c/em\u003e indicated that for long term salinity acclimation, lipids contribute to major metabolic requirements (Rocha et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2005\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Therefore, it has been speculated that pathways other than glycolysis may also play a major role in supplying energy for adapting to higher salinity conditions. In a previous case, the variations in carbohydrate metabolism were observed in gills of \u003cem\u003eOncorhynchus mykiss\u003c/em\u003e (rainbow trout) during the gradual acclimation to SW suggested demand for more ATP in order to acclimatize under hyper saline conditions (Soengas et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). As evidenced through transcriptome analysis, Zhang et al. (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) also reported the enhanced gene expression of significant enzymes in Krebs cycle \u003cem\u003eviz\u003c/em\u003e. acetyl coA synthetase and malate dehydrogenase under high salinity conditions in spotted sea bass. In another study by Tseng et al. (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2008\u003c/span\u003e) on Mozambique tilapia (\u003cem\u003eO.mossambicus\u003c/em\u003e), a significant variation in the activity of carbohydrate metabolism genes like lactate dehydrogenase and citrate synthase (CS) were observed after one hour post acclimation to different salinities. Perry and Walsh (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e1989\u003c/span\u003e) also observed an increased activity of CS after the transfer of \u003cem\u003eO.mossambicus\u003c/em\u003e to SW for two weeks. However, in contrast to the present study, Chen et al. (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) demonstrated the decreased expression of IDH in \u003cem\u003ePlecoglossus altivelis\u003c/em\u003e when transferred to BW from FW. Evans and Somero (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2008\u003c/span\u003e) also hardly detected any alteration in CS activity of euryhaline teleost \u003cem\u003eG.mirabilis\u003c/em\u003e while salinity changed. In the case of \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e, TCA cycle and ETC related genes like CS and CytC oxidase respectively were found to be downregulated under high salinity conditions, while glycolysis related genes were upregulated, since glycolysis serves as the primary energy generating pathway in crustaceans (Xue et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOverall, the present study revealed the differential mRNA expression of IDH in the gills of \u003cem\u003eE.suratensis\u003c/em\u003e with respect to the altered salinity conditions and is corroborated with the previous studies. Significant enzymes involved in free radical scavenging or ROS quenching are found to be elevated in compensatory manner during stressed conditions (Yadav et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Although IDH protein is not directly involved in water or ion transport, they lead a vital role in activities that have direct or indirect roles in adaptation to salinity fluctuations in the environment. Thus, the study suggests that IDH may serve as a key candidate gene in maintaining ionic and osmotic homeostasis in \u003cem\u003eE.suratensis\u003c/em\u003e, thereby supporting their proper survival in hyper saline environments. Proteomic profiling along with whole genomic sequencing and transcriptomic studies using next generation sequencing techniques can be taken into account in future prospects for the better understanding of fish behaviour under different salinity stressed conditions.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn euryhaline teleost, sufficient and timely energy production is a prerequisite factor for the proper functioning of osmoregulatory mechanism. It is known that energy metabolite translocation occurs between teleost gill chloride cells (ionocytes) and neighbouring glycogen-rich cells. The present study gives insights into the energetics of osmoregulation in Pearl spot fish. The upregulation of isocitrate dehydrogenase, an important enzyme in the tricarboxylic acid cycle during increased salinity exposure illustrates the essentiality of energy required for maintaining osmotic balance and compensating physiological processes. This information generated, for the first time, can be further utilised to understand the ROS scavenging activity and pathway and to explore the significance of local energy supply for ion-regulatory mechanisms especially in gills through the isolation and purification of IDH protein. Also the species demonstrated remarkable adaptability with 100% survival at 0, 18 and 36 ppt salinities. Thus advanced molecular, genomic and proteomic techniques can be adopted in future to obtain immense knowledge on osmoregulatory mechanism that can resolve various existing queries.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompliance with Ethical Standards\u003c/h2\u003e \u003cp\u003eNo ethical issues involved.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eConflict of Interest\u003c/h2\u003e \u003cp\u003eThe authors confirm that they have no conflicts of interest to declare.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding Information\u003c/h2\u003e \u003cp\u003eThis research was funded by AMAAS network project under ICAR-NBAIM, Indian Council of Agricultural Research, New Delhi.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eAKTV performed the wet lab work and drafted the paper. MAP and KKV developed the experimental design and acquired funding for this study and PGP contributed in editing and reviewing the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors are thankful to the Director, Central Marine Fisheries Research Institute (ICAR-CMFRI), Ernakulam for providing necessary facilities.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe data presented in this study can be found in online repositories. The names of the repository/repositories and accession number can be found in the article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eArun Kumar TV, Pradeep MA, Esha A, Vijayan KK (2020) Transcriptomic approach to study salinity tolerance in euryhaline cichlid, \u003cem\u003eEtroplus suratensis\u003c/em\u003e (Bloch, 1790). J mar biol Ass India 62(1):24\u0026ndash;32. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.6024/jmbai.2020.62.1.2200-02\u003c/span\u003e\u003cspan address=\"10.6024/jmbai.2020.62.1.2200-02\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBal A, Pati SG, Panda F, Mohanty L, Paital B (2021) Low salinity induced challenges in the hardy fish \u003cem\u003eHeteropneustes fossilis\u003c/em\u003e; future prospective of aquaculture in near coastal zones. Aquaculture 543:737007. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2021.737007\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2021.737007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoeuf G, Payan P (2001) How should salinity influence fish growth? Comp Biochem Physiol C Toxicol Pharmacol. 130(4):411\u0026ndash;423. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S1532-0456(01)00268-X\u003c/span\u003e\u003cspan address=\"10.1016/S1532-0456(01)00268-X\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChandrasekar S, Nich T, Tripathi G, Sahu NP, Pal AK, Dasgupta S (2014) Acclimation of brackish water pearl spot (\u003cem\u003eEtroplus suratensis\u003c/em\u003e) to various salinities: relative changes in abundance of branchial Na+/K+-ATPase and Na+/K+/2Cl\u0026thinsp;\u0026ndash;\u0026thinsp;co-transporter in relation to osmoregulatory parameters. Fish Physiol Biochem 40:983\u0026ndash;996. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10695-013-9899-y\u003c/span\u003e\u003cspan address=\"10.1007/s10695-013-9899-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen J, Wu HQ, Shi YH, Li CH, Li MY (2009) The effects of environmental salinity on trunk kidney proteome of juvenile ayu (\u003cem\u003ePlecoglossus altivelis\u003c/em\u003e). Comp Biochem Physiol Part D Genomics Proteom 4(4):263\u0026ndash;267. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cbd.2009.06.003\u003c/span\u003e\u003cspan address=\"10.1016/j.cbd.2009.06.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Boeck G, Vlaeminck A, Van der Linden A, Blust R (2000) The energy metabolism of common carp (\u003cem\u003eCyprinus carpio\u003c/em\u003e) when exposed to salt stress: an increase in energy expenditure or effects of starvation? Physiol Biochem Zool 73(1):102\u0026ndash;111. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1086/316717\u003c/span\u003e\u003cspan address=\"10.1086/316717\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDiatchenko L, Lukyanov S, Lau YF, Siebert PD (1999) Suppression subtractive hybridization: a versatile method for identifying differentially expressed genes. Methods Enzymol 303:349\u0026ndash;380. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0076-6879(99)03022-0\u003c/span\u003e\u003cspan address=\"10.1016/S0076-6879(99)03022-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDildar T, Cui W, Ikhwanuddin M, Ma H (2025) Aquatic organisms in response to salinity stress: ecological impacts, adaptive mechanisms, and resilience strategies. Biology 14(6):667. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/biology14060667\u003c/span\u003e\u003cspan address=\"10.3390/biology14060667\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDjiba PK, Zhang J, Xu Y, Zhang P, Zhou J, Zhang Y, Luo Y (2021) Correlation between metabolic rate and salinity tolerance and metabolic response to salinity in grass carp (\u003cem\u003eCtenopharyngodon idella\u003c/em\u003e). Animals 11(12):3445. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ani11123445\u003c/span\u003e\u003cspan address=\"10.3390/ani11123445\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEvans T, Somero G (2008) A microarray based transcriptomic time- course of Hyper and Hypo-osmotic stress signalling events in the euryhaline fish \u003cem\u003eGillichthys mirabilis\u003c/em\u003e: osmosensors to effectors. J Exp Biol 211(Pt 22):3636\u0026ndash;3649. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/jeb.022160\u003c/span\u003e\u003cspan address=\"10.1242/jeb.022160\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFreire CA, Togni VG, Hermes-Lima M (2011) Responses of free radical metabolism to air exposure or salinity stress, in crabs (\u003cem\u003eCallinectes danae\u003c/em\u003e and \u003cem\u003eC.ornatus\u003c/em\u003e) with different estuarine distributions. Comp Biochem Physiol Part Mol Integr Physiol 160(2):291\u0026ndash;300. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cbpa.2011.06.024\u003c/span\u003e\u003cspan address=\"10.1016/j.cbpa.2011.06.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHall TA (1999) BioEdit: a user friendly- biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symp Ser 41:95\u0026ndash;98\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeugens EHW, Hendriks AJ, Dekker T, Van-Straalen NM, Admiraal W (2001) A review of the effects of multiple stressors on aquatic organisms and analysis of uncertainty factors for use in risk assessment. Crit Rev Toxicol 31(3):247\u0026ndash;284. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/20014091111695\u003c/span\u003e\u003cspan address=\"10.1080/20014091111695\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang X, Miller W (1991) A time-efficient, linear-space local similarity algorithm. Adv Appl Math 12(3):337\u0026ndash;357. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0196-8858(91)90017-D\u003c/span\u003e\u003cspan address=\"10.1016/0196-8858(91)90017-D\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJo SH, Son MK, Koh HJ, Lee SM, Song IH, Kim YO, Lee YS, Jeong KS, Kim WB, Park JW, Song BJ, Huhe TL (2001) Control of mitochondrial redox balance and cellular defence against oxidative damage by mitochondrial NADP\u003csup\u003e+\u003c/sup\u003e dependent isocitrate dehydrogenase. J Biol Chem 276:16168\u0026ndash;16176. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.M010120200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M010120200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKlausen MS, Jespersen MC, Nielsen H, Jensen KK, Jurtz VI, Sonderby CK, Sommer MOA, Winther O, Nielsen M, Petersen B, Marcatili P (2019) NetSurfP 2.0: Improved prediction of protein structural features by integrated deep learning. Proteins 87(6):520\u0026ndash;527. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/prot.25674\u003c/span\u003e\u003cspan address=\"10.1002/prot.25674\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol Biol Evol 35:1547\u0026ndash;1549\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLavado R, Aparicio-Fabre R, Schlenk D (2013) Effects of salinity acclimation on the expression and activity of phase I enzymes (CYP450 and FMOs) in coho salmon (\u003cem\u003eOncorhynchus kisutch\u003c/em\u003e). Fish Physiol Biochem 40(1):267\u0026ndash;278. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10695-013-9842-2\u003c/span\u003e\u003cspan address=\"10.1007/s10695-013-9842-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarbade P, Shanmugam SA, Suresh E, Rathipriya A, Rather MA, Agarwal D (2023) Gene expression profiling and physiological adaptations of pearl spot (\u003cem\u003eEtroplus suratensis\u003c/em\u003e) under varying salinity conditions. Int J Biol Macromol 253(8):127569. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ijbiomac.2023.127569\u003c/span\u003e\u003cspan address=\"10.1016/j.ijbiomac.2023.127569\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaria VL, Santos MA, Bebianno MJ (2009) Contaminant effects in shore crabs (\u003cem\u003eCarcinus maenas\u003c/em\u003e) from Ria Formosa Lagoon. Comp Biochem Physiol C Toxicol Pharmacol 150(2):196\u0026ndash;208. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cbpc.2009.04.013\u003c/span\u003e\u003cspan address=\"10.1016/j.cbpc.2009.04.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNguyen TV, Jung H, Nguyen TM, Hurwood D, Mather P (2016) Evaluation of potential candidate genes involved in salinity tolerance in striped catfish (\u003cem\u003eP.hypopthalmus\u003c/em\u003e) using an RNA-seq approach. Mar Genom 25:75\u0026ndash;88. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.margen.2015.11.010\u003c/span\u003e\u003cspan address=\"10.1016/j.margen.2015.11.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerry SF, Walsh PJ (1989) Metabolism of isolated fish gill cells: Contribution of epithelial chloride cells. J Exp Biol 144:507\u0026ndash;520\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29(9):e45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/nar/29.9.e45\u003c/span\u003e\u003cspan address=\"10.1093/nar/29.9.e45\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePetersen TN, Brunak S, Heijne GV, Nielsen H (2011) SignalP 4.0: Discriminating signal peptides from transmembrane regions. Nat Methods 8:785\u0026ndash;786. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nmeth.1701\u003c/span\u003e\u003cspan address=\"10.1038/nmeth.1701\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePradeep MA, Rehman S, Jose IM, Kumar TVA, Katneni VK, Gora AH, Dhanutha NR, Jangam AK, Shahansha TSA, Vijayan KK (2026) Molecular adaptations of the estuarine fish \u003cem\u003eEtroplus suratensis\u003c/em\u003e in response to salinity fluctuations. Front Mar Sci 13:1775985. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmars.2026.1775985\u003c/span\u003e\u003cspan address=\"10.3389/fmars.2026.1775985\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRocha AJS, Gomes V, Ngan PV, Passos MJ, Furia RR (2007) Effects of anionic surfactant and salinity on the bioenergetics of juveniles of \u003cem\u003eCentropomus parallelus\u003c/em\u003e. Ecotoxicol Environ Saf 68(3):397\u0026ndash;404. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ecoenv.2006.10.007\u003c/span\u003e\u003cspan address=\"10.1016/j.ecoenv.2006.10.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRocha AJS, Gomes V, Phan VN, Passos MJ, Furia RR (2005) Metabolic demand and growth of juveniles of \u003cem\u003eCentropomus parallelus\u003c/em\u003e as function of salinity. J Exp Mar Biol Ecol 316(2):157\u0026ndash;165. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jembe.2004.11.006\u003c/span\u003e\u003cspan address=\"10.1016/j.jembe.2004.11.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoengas JL, Aldegunde M, Andres MD (1995) Gradual transfer to sea water of rainbow trout: Effects on liver carbohydrate metabolism. J Fish Biol 47(3):466\u0026ndash;478. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1095-8649.1995.tb01915.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1095-8649.1995.tb01915.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTseng Y, Hwang P (2008) Some insights into energy metabolism for osmoregulation in fish. Comp Biochem Physiol C Toxicol Pharmacol 148(4):419\u0026ndash;429. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1088/0268.1242118/6/311\u003c/span\u003e\u003cspan address=\"10.1088/0268.1242118/6/311\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTseng YC, Lee JR, Chang JCH, Kuo CH, Lee SJ, Hwang PP (2008) Regulation of lactate dehydrogenase in Tilapia (\u003cem\u003eOreochromis mossambicus\u003c/em\u003e) gills during acclimation to salinity challenge. Zool Stud 47(4):473\u0026ndash;480\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatanabe T (1982) Lipid nutrition in Fish. Comp Biochem Physiol B Biochem Mol Biol 73(1):3\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0305-0491(82)90196-1\u003c/span\u003e\u003cspan address=\"10.1016/0305-0491(82)90196-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWaterhouse A, Bertoni M, Bienert S, Studer G, Tauriello G, Gumienny R, Heer FT, de Beer TAP, Rempfer C, Bordoli L, Lepore R, Schwede T (2018) SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res 46(W1):W296\u0026ndash;W303. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/nar/gky427\u003c/span\u003e\u003cspan address=\"10.1093/nar/gky427\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXue C, Xu K, Jin Y, Bian C, Sun S (2022) Transcriptome analysis to study the molecular response in the gill and hepatopancreas tissues of \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e to salinity acclimation. Front Physiol 13:926885. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphys.2022.926885\u003c/span\u003e\u003cspan address=\"10.3389/fphys.2022.926885\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYadav SS, Kumar R, Khare P, Tripathi M (2015) Oxidative stress biomarkers in the freshwater fish \u003cem\u003eHeteropneustes fossilis\u003c/em\u003e (Bloch) exposed to sodium fluoride: Antioxidant defence and role of Ascorbic acid. Toxicol Int 22(1):71\u0026ndash;76. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4103/0971-6580.172261\u003c/span\u003e\u003cspan address=\"10.4103/0971-6580.172261\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang H, Wen H, Wang H, Ren Y, Zhao Ji, Li Y (2017) RNA-Seq analysis of salinity stress\u0026ndash;responsive transcriptome in the liver of spotted sea bass (Lateolabrax maculatus). PLoS ONE 12(3):e0173238. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0173238\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0173238\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao X, Sun Z, Gao T, Song N (2021) Transcriptome profiling reveals a divergent adaptive response to hyper- and hypo-salinity in the Yellow drum, \u003cem\u003eNibea albiflora\u003c/em\u003e. Animals 11(8):2201. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ani11082201\u003c/span\u003e\u003cspan address=\"10.3390/ani11082201\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFiol DF, Chan SY, K\u0026uuml;ltz D (2006) Identification and pathway analysis of immediate hyperosmotic stress responsive molecular mechanisms in tilapia (\u003cem\u003eOreochromis mossambicus\u003c/em\u003e) gill. Comp Biochem Physiol Part D Genomics Proteom 1(3):344\u0026ndash;356. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cbd.2006.08.002\u003c/span\u003e\u003cspan address=\"10.1016/j.cbd.2006.08.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEvans DH (2002) Cell signalling and ion transport across the fish gill epithelium. J Exp Zool 293(3):336\u0026ndash;347. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jez.10128\u003c/span\u003e\u003cspan address=\"10.1002/jez.10128\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Etroplus suratensis, Isocitrate dehydrogenase, salinity adaptation, Suppression Subtractive Hybridization, euryhaline teleost, reactive oxygen species, Real-Time PCR","lastPublishedDoi":"10.21203/rs.3.rs-9137136/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9137136/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEuryhaline cichlid \u003cem\u003eEtroplus suratensis\u003c/em\u003e (Pearl spot), was found to exhibit strong acclimatization efficiency in brackish water (BW), fresh water (FW) as well as in sea water (SW) condition throughout their life cycle. This capability makes it to be considered as a suitable euryhaline teleost model for investigating and understanding the effect of salinity challenges in fishes. Here, we investigated the effect of salinity on the gills of \u003cem\u003eE.suratensis\u003c/em\u003e acclimated to different salinity conditions using Suppression Subtractive Hybridization (SSH) and Real Time PCR (qPCR). The Rapid amplification of cDNA ends (RACE) technique was used to obtain complete coding sequences (CDSs) from the selected EST\u0026rsquo;s obtained through SSH. The findings revealed the increased expression of isocitrate dehydrogenase (IDH) when \u003cem\u003eE.suratensis\u003c/em\u003e were exposed to higher salinities. Thus the study highlights the role of IDH in salinity adaptation as a constant supply of ATP to the cell and as a scavenger of ROS from the cell during oxidative stress. The derived complete CDS was used to deduce its amino acid sequences, which were used to construct a phylogenetic tree and protein model to obtain secondary and tertiary structure information of IDH. The present study is the first of its kind in characterising and studying the expression analysis of IDH derived from \u003cem\u003eE.suratensis\u003c/em\u003e at varying salinities.\u003c/p\u003e","manuscriptTitle":"Molecular characterization and salinity-responsive expression of Isocitrate dehydrogenase (NADP) in cichlid Etroplus suratensis (Bloch, 1790).","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-06 11:39:09","doi":"10.21203/rs.3.rs-9137136/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"41a96e97-25dc-4f46-bf74-db72ac3c1f3e","owner":[],"postedDate":"April 6th, 2026","published":true,"recentEditorialEvents":[{"type":"editorInvitedReview","content":"","date":"2026-04-30T10:41:46+00:00","index":17,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-04-06T11:39:09+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-06 11:39:09","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9137136","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9137136","identity":"rs-9137136","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.