WWP1 targeting PTEN for polyubiquitination to promote bone metastasis of luminal breast cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article WWP1 targeting PTEN for polyubiquitination to promote bone metastasis of luminal breast cancer Hao Jiang, Zhenxi Li, Wei Xu, Jianru Xiao This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4441947/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 02 Dec, 2024 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Luminal breast cancer exhibits a high incidence of bone recurrence when metastasizing to distant organs. The mechanisms underlying the organotropism of luminal breast cancer cells remain unclear. In this study, we aimed to determine the role of WWP1 (WW domain-containing E3 ubiquitin protein ligase 1)-PTEN (Phosphatase and tensin homolog deleted on chromosome ten) interaction in bone tropism in luminal breast cancer. We observed that WWP1 was overexpressed in luminal breast cancer tissues and associated with poor prognosis in breast cancer patients. In luminal breast cancer cells, WWP1 was found to mediate PTEN ubiquitination, resulting in the functional loss of PTEN. As a result, we demonstrate that the WWP1 contributes to bone tropism in luminal breast cancer cells via the polyubiquitination of PTEN. Consequently, WWP1-mediated PTEN polyubiquitination contributed to the early metastasis of luminal breast cancer cells to the bone. Thus, our study provides a mechanistic insight into the bone tropism of luminal breast cancer cells and proposes a potential therapeutic strategy for mitigating cancer metastasis to the bone. Biological sciences/Cancer Biological sciences/Cell biology WWP1 PTEN luminal breast cancer bone metastasis ubiquitination Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The bone is the most common site of metastasis in breast cancer, particularly in the luminal subtype( 1 , 2 ). Over two-thirds of breast cancer patients develop bone metastasis, resulting in severe pain, pathological fractures, and other skeletal-related events, which are associated with poor prognosis for breast cancer patients( 3 ). Clinical studies have revealed that luminal breast cancer is more likely to metastasize to the bone than to the non-bone organs( 4 , 5 ). However, the molecular mechanisms that regulate this bone selectivity remain unclear. Intricate molecular interactions within cancer cells, which are highly context-dependent, contribute to the development of bone metastasis( 6 ). In particular, phosphatase and tension homologue deleted on chromosome 10 (PTEN) is a significant tumor suppressor that cancer cells cannot afford to lose completely before maturation( 7 ). By antagonizing the PI3K (Phosphatidylinositol-3-kinase)/AKT (Protein kinase B) signaling pathway, PTEN can govern fundamental cellular processes in various cancer cells( 8 ). Mice with PTEN overexpression have achieved a tumor-suppressive metabolic state, leading to a life-span extension( 7 ). Therefore, the active and reactive functions of PTEN are considered promising therapeutic opportunities for human health. In terms of molecular mechanisms, the activity, expression, and localization of PTEN are frequently dysregulated through post-translational modifications, such as ubiquitylation( 9 ). The ubiquitylation of PTEN can be promoted by several E3 ubiquitin ligases, affecting its protein stability or dimer formation, both of which are highly consequential for tumor initiation, progression, and metastasis( 10 – 14 ). As post-translational modification is a complex process influenced by various molecules within different cells, ubiquitylation is context-dependent( 15 ). Several E3 ubiquitin ligases have been reported to promote PTEN polyubiquitylation for degradation( 10 , 13 ). However, WW domain-containing E3 ubiquitin protein ligase 1 (WWP1) was found to regulate PTEN dimerization and membrane recruitment, rather than degradation, through K27-linked polyubiquitination( 8 ). WWP1 belongs to the NEDD4 (Neural precursor cell expressed, developmentally down-regulated 4) - like protein family, characterized by an N-terminal C2 domain, four WW domains, and a C-terminal catalytic HECT (homologoustoE6-APCterminus) domain( 16 ). After binding to PTEN, WWP1 mediates polyubiquitylation of lysine residue 342, 344, or both( 8 ). Thus, WWP1 may suppress PTEN dimerization and membrane recruitment, ultimately resulting in neoplastic transformation( 8 ). Among various cancers, breast cancer is the most sensitive to PTEN dysfunction( 17 ). In addition, WWP1 was reported to be a potential therapy target in breast cancer. Many studies have demonstrated that WWP1 played a potent role in breast cancer tumorigenesis or drug resistance, by the ubiquitination of PTEN, MUC1, and other breast cancer promoting or suppressing proteins( 18 , 19 ). However, reports regarding the role of the WWP1-PTEN interaction in luminal breast cancer are lacking. Therefore, the purpose of our study was to investigate the role of WWP1-PTEN interaction in the bone tropism in luminal breast cancer and to explore their mechanisms. In this study. We demonstrated that WWP1 was upregulated in breast cancer and contributed to the tumorigenesis. We confirmed the interaction between WWP1 and PTEN in luminal breast cancer cells. Moreover, we verified K27-linked polyubiquitination of PTEN by WWP1 in luminal breast cancer cells. In addition, we found that WWP1 could promoted luminal breast cancer cell invasion and migration in vitro and metastases in vivo. Generally, our study highlights the critical role of the WWP1-PTEN interaction in luminal breast cancer bone metastasis and suggests a new potential approach for managing breast cancer metastasis. Results WWP1 was overexpressed and related with a poor prognosis in breast cancer To elucidate the potential role of WWP1 in breast cancer, we first analyzed data from TCGA (The cancer genome atlas) and GTEx (Genotype-Tissue Expression) databases, revealing an upregulation of WWP1 mRNA (Fig. 1 A). We further validated this finding by confirming strong WWP1 expression in the tumors of most breast cancer patients with spinal metastasis, but minimal expression in their adjacent noncancerous breast tissues (Fig. 1 B and Fig. 1 C). This observation indicates that WWP1 is barely expressed in normal breast tissues but is frequently overexpressed in breast tumor tissues that metastasize to bone. The WWP1 expressions are also analyzed between luminal breast cancer patients with and without spinal metastases. As shown in Fig. 1 D and Fig. 1 E, the luminal breast cancers that developed spinal metastasis (M) had a relatively higher WWP1 expressions than those did not developed metastasis (T). In addition, Kaplan–Meier analysis demonstrated that breast cancer patients with low WWP1 expression achieved a relatively longer overall survival (Fig. 1 F). These results indicated that WWP1 might be a risk factor in breast cancer metastasis. WWP1 interacts with PTEN in luminal breast cancer cell lines To determine the underlying mechanisms of WWP1 in breast cancer metastasis, we first assessed the protein levels of WWP1 in various breast cancer cell lines. As shown in Fig. 2 A, WWP1 exhibited an upregulation in luminal cell lines compared with that in other cell lines. The highest expression of WWP1 in luminal breast cancer cell lines, especially in MCF7 cells, was further verified by imaging analysis (Fig. 2 B and Fig. 2 C). Indicated the important role of WWP1 in luminal breast cancer metastasis. As PTEN is well known to be dysregulated, such as through posttranslational modification, during the breast cancer progression. And, WWP1 was reported to mediated PTEN posttranslational modification in prostate cancer. Therefore, we explored whether WWP1 could regulate PTEN in luminal breast cancer cells, as posttranslational modification is context-dependent. Binding assays revealed a strong interaction between WWP1 and PTEN in luminal breast cancer. As shown in Fig. 2 D, WWP1 exhibited strong binding capability for PTEN in luminal breast cancer lines (MCF7, BT474, and T-47D), suggesting a promising role for WWP1 in regulating PTEN in luminal breast cancer cells. Co-immunoprecipitation experiments confirmed the binding between endogenous WWP1 and PTEN proteins in the three cell lines (Fig. 2 E, Fig. 2 F, and Fig. 2 G). These observations, verified the interaction between WWP1 and PTEN in luminal breast cancer cells and suggesting that WWP1 should be a regulator of PTEN in the luminal breast cancer metastasis. WWP1 polyubiquitylates PTEN As WWP1 is an E3 ubiquitin ligase, we went on to determine the possibility that WWP1 mediates polyubiquitination of PTEN, which had not been studied in luminal breast cancer cells. According to Fig. 2 A-C, WWP1 had high expression in MCF7 cells, so we silenced endogenous WWP1 in MCF7 cells using shRNAs (Fig. 3 A), and imaging analysis confirmed the successful knockdown of WWP1 in MCF7 cells (Fig. 3 B). Consequently, the downregulation of WWP1 by shRNA led to reduction in PTEN polyubiquitination in MCF-7 cells (Fig. 3 C). imaging analysis exhibited a significantly decrease of PTEN ubiquitination level when WWP1 was knocked down (Fig. 3 D). Conversely, the overexpression of wild type WWP1 (WWP WT) in MCF7 cells recused PTEN polyubiquitination, whereas the expression of WWP1 C890A (WWP1 CA), a catalytically inactive mutation, abolished this effect (Fig. 3 E and Fig. 3 F). As ubiquitination is a context-dependent and intricate process, these results suggested an indispensable role of WWP1 in triggering PTEN polyubiquitination in luminal breast cancer cells. WWP1 did not affect PTEN stability Previous studies have shown that the stabilization of PTEN protein suppresses breast cancer tumorigenesis( 23 ). However, according to Fig. 3 C and 3 E, WWP1 did not affect the PTEN protein levels. Indicating polyubiquitination by WWP1 did not lead to PTEN degradation. In order to further exam the effects of WWP1 on PTEN stability, we subsequently assessed the correlation between the protein turnover rate and WWP1-mediated polyubiquitination of PTEN in luminal breast cancer cells. The cycloheximide (CHX) treatment experiment in MCF7 cells showed the turnover rate of PTEN was not affected by WWP1 (Fig. 4 A and Fig. 4 B). In addition, we compared the PTEN expressions between luminal breast cancers with and without spinal metastasis. Hardly any obviously difference could be detected from the western blot imaging and analysis (Fig. 4 C and 4 D). Given that WWP1 had a higher expression in luminal breast cancers which developed spinal metastasis against those without spinal metastasis (Fig. 1 D and 1 E), these findings demonstrated that WWP1-rugulated polyubiquitination dose not lead to PTEN degradation. Indeed, recently, WWP1 was found to affects the dimerization and membrane recruitment of PTEN, which defunctionalized PTEN( 8 ). Taken together, these results emphasize the crucial role of WWP1 in regulating PTEN function in luminal breast cancer cells rather than the PTEN stabilization. WWP1 promotes luminal breast cancer cells migration via PTEN polyubiquitination The above data lead us to propose that WWP1 might function as a promotor for luminal breast cancer metastasis through regulation of PTEN. To verify this hypothesis, we generated WWP1-knockdown derivatives of MCF7 cells using a lentiviral shRNA vector in MCF7 cells, and carried out transwell assays to evaluate the migration ability of WWP1-knockdown MCF7 cells. As shown in Fig. 5 A, WWP1 knockdown substantially suppressed the migration ability of MCF7 cells in vitro. Furthermore, to explore the underlying mechanism, we then stably expressing either wild type WWP1 (WWP1 WT) or inactive WWP1 C890A mutant (WWP1 CA) to the WWP1-knockdown MCF7 cells. Only WWP1 WT was able to reverse the migration phenotype, suggesting the essential role of WWP1 catalytic activity, functioned in PTEN ubiquitination, in mediating MCF7 migration (Fig. 5 A and Fig. 5 B). Therefore, these results demonstrated that WWP1 could promote the migration ability of luminal breast cancer cells through the polyubiquitination of PTEN, as evidenced by its requirement for catalytic activity. WWP1 contributes to early-stage bone metastasis of luminal breast cancer in vivo Encouraged by the in vitro results, we further explored the function role of WWP1 in breast cancer metastasis via an IIA injection model in node mice. This model enables monitoring of early-stage bone colonization( 22 ); which is particularly relevant for luminal breast cancer due to its strong bone tropism. As shown in Fig. 5 C, WWP1 knockdown markedly reduced the bone metastasis burden following the IIA injection of cancer cells in mice. Bioluminescent imaging (BLI) quantification substantiated the decrease in metastatic signal in the hind limbs within the first two weeks after cancer cell inoculation (Fig. 5 D). Besides, survival analyses confirmed that mice injected with WWP1 overexpression clones of MCF7 cells had significantly shorter survival periods (Fig. 5 E). These results underscore the pivotal role of WWP1 in bone metastasis of luminal cancers. Discussion Numerous studies have focused on bone metastasis in breast cancer. Breast cancer is categorized into different subtypes based on its molecular types( 24 ). Identifying molecules responsible for tumor progression, metastasis, and chemotherapy resistance can shed light on breast cancer treatment( 25 ). Several tumor-derived molecules, such as IL-6, MMP1, and Jagged1( 26 ) have been identified, in studies of ER − cell lines. However, while ER is reported to have a significant clinical association with the bone tropism of breast cancer, only a few studies have provided partial explanations for the bone preference in ER + luminal breast cancer( 2 , 27 ). In our study, we identified the E3 ligase WWP1 as a key regulator of bone preference in ER + luminal breast cancer cells. WWP1 was upregulated in most breast cancer and luminal breast cancer cell lines, and this upregulation was linked to poor prognosis in breast cancer patients. The interaction between WWP1 and the tumor suppressor PTEN, which regulates early bone metastasis, was detected in ER + luminal breast cancer cells. Mechanistically, the increased abundance of WWP1 promotes its binding with PTEN in luminal breast cancer cells, thus increasing the K27-linked polyubiquitination of PTEN( 8 ). This polyubiquitination of PTEN, regulated by WWP1, directly inhibits the formation of dimers and membrane recruitment( 8 ), which ultimately promotes bone metastasis in MCF7 cells. Increasing evidence has shown a significant relationship between HECT E3 ubiquitin ligases and the progression of various human cancers( 28 , 29 ). WWP1 belongs to the NEDD4 family, which is characterized by C2, HECT, and four WW domains( 16 ). According to the data from TCGA and GETx, WWP1 is frequently upregulated and amplified in breast and prostate cancers. These cancers have a higher propensity to metastasize to bone( 2 , 30 , 31 ). Aberrant WWP1 expression is significantly associated with the progression of human cancers( 16 ), but no study has previously focused on its function in luminal breast cancers. Accordingly, our study highlights the promising role of WWP1 in promoting luminal breast cancer metastasis to the bone, providing a new therapeutic target for bone metastasis in breast cancer. In luminal breast cancer cells, WWP1 targets PTEN for polyubiquitination, promoting metastasis to the bone. Polyubiquitination mediated by WWP1 regulates PTEN dimer formation and membrane recruitment rather than PTEN stability( 8 ). The function of PTEN is strictly controlled through its subcellular localization, post-translational modifications, or both( 8 ). Maintaining the balance of PTEN plays a key role in the proliferation and metastasis of various human cancers( 23 ). However, whether PTEN dimer formation and membrane recruitment can prevent cancer cells from metastasizing to specific organs remains to be elucidated. To investigate the potent bone tropism of luminal breast cancer cells, we silenced WWP1 using shRNA. Consequently, the polyubiquitination of PTEN decreased, and the invasion and migration ability of MCF7 cells were decreased as assessed using the transwell assay. Subsequent overexpression of WWP1 restored PTEN polyubiquitination and thus the invasion and migration ability of MCF7 cells. These results were further verified in the animal experiments. In summary, our study revealed that WWP1 could promote the early bone metastasis of luminal breast cancer cells by regulating PTEN function through polyubiquitination. However, more details need to be further studied before we could target WWP1-PTEN for the treatment of ER + breast cancer metastasis to bone. Firstly, more breast cancer samples need to be collected according to their subtype to analysis the WWP1 expression and the correlation between WWP1 and PTEN. Besides, the binding site between WWP1 and PTEN need to be well studied for designing targeted drugs. Fortunately, identification of WWP1 as a key regulator for the luminal breast cancer bone metastasis may server as a valuable treatment strategy. In conclusion, this study is the first to establish the nonproteolytic ubiquitination of PTEN mediated by WWP1 in luminal breast cancer cells. It underscores the critical role of WWP1 in mediating bone colonization of luminal breast cancer cells by preventing PTEN dimer formation and membrane recruitment (Fig. 6 ). This non-proteolytic ubiquitination of PTEN mediated by WWP1 in luminal breast cancer cells could represent a general mechanism underlying their preference for bone metastasis, offering a novel insight into the bone preference of luminal breast cancer metastasis. Therefore, targeting the WWP1-PTEN interaction holds promise for ER + breast cancer patients at high risk of bone metastasis. Methods Clinical analysis Expression analysis of breast cancer patients was downloaded from GEPIA (Gene Expression Profiling Interactive Analysis) 2.0 ( http://gepia2.cancer-pku.cn/ ). Frozen samples of breast cancer bone metastasis, adjacent tissues, and breast cancer tissues were acquired from the Department of Orthopedic Oncology of Changzheng Hospital (Navy Medical University), and the basic information of these samples was listed in Table SⅠ. We obtained written informed consent and received approval from the Ethics Committee of Changzheng Hospital. Informed consent was provided by the patients. Cell culture All the cell lines used in this study were purchased from ATCC (American Type Culture Collection), and were authenticated by STR (Short Tandem Repeat) profiling. Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% FBS and 1% penicillin–streptomycin. The cells were grown at 37℃ in a 5% CO2 incubator and were free from mycoplasma contamination. Plasmids and antibodies Plasmids: pSPAX2, pMD2.G, His-Ub, Flag-PTEN, HA-PTEN, Flag-WWP1, Flag-WWP1-C890A (Flag-WWP1 CA) were stored in our laboratory. Antibodies: anti-WWP1 (Abcam, ab227213), anti-PTEN (Abcam, ab32199), anti-GAPDH (Sigma-Aldrich, G9545), anti-Flag (Abcam, ab205606), anti-His (Abcam, ab200537), normal IgG (Santa Cruz, sc-2025). Immunoprecipitation and western blotting Immunoprecipitation was performed as previously described( 8 ), using different antibodies and reagents. Western blotting was conducted as previously described( 20 ). Lentivirus infection We cotransfected 293T cells with plasmids pSPAX2, pMD2.G, and the lentivirus-based constructs as indicated. The supernatant was collected to harvest recombinant lentivirus. Lentiviruses carrying short hairpin RNA (shRNA) targeting human WWP1 (TRCN0000003395: ATTGCTTATGAACGCGGCTTT and TRCN0000003396: ACAACACACCTTCATCTCCGT)( 18 ) were used to infect MCF7 cells with Polybrene (10 µg/ml), The infected MCF7 cells were selected with puromycin (2 µg/ml) to generate stable clones. Ubiquitination assay For the ubiquitination analysis of PTEN, MCF7 cells were transfected with the indicated constructs, along with His-ubiquitin. Cells were lysed as previously described( 8 ). Briefly, cells were lysed in buffer A [6 M guanidine HCl, 10 mM imidazole, and Na2HPO4/NaH2PO4 (pH 8.0)]. The lysates were incubated with Ni-NTA agarose for 3 h at 37℃, followed by western blot analysis. WWP1 WT, WWP1 C890A, were cloned into pFlag-CMV-2; PTEN was cloned into pCMV-HA; ubiquitin was cloned into pcDNA3.1/His-N. All the plasmids were stored in our lab. Animal experiments Female nude mice (6-weeks-old), bred and housed under SPF (Specific Pathogen Free) facilities, were used in animal experiments. These experiments were approved by the Committee for Animal Welfare of the Naval Medical University and all the experiments in this article were in accordance with ARRIVE guidelines. Intra-iliac artery (IIA) injection was performed according to previous reports( 21 , 22 ) after anesthetized by inhalation of 2.5% isoflurane. In summary, 1×10 5 luciferase-labeled cells were injected into the intra-iliac artery for early bone metastasis analysis. Mice were euthanized by intraperitoneal injection of pentobarbital sodium (200mg/Kg). Experimental statement. The experiments and methods used in this article were all in accordance with relevant guidelines and regulations. Statistical analyses All data are representative of at least three independent experiments and are presented as the mean ± SD, analyzed by GraphPad Prism 8.0. Statistical differences between the two groups were assessed using Student’s t-test. Statistical analysis was performed using 1-way ANOVA, 2-way ANOVA test followed by Tukey’s or Fisher’s least significant difference multiple comparisons for multigroup data sets. P < 0.05 means significant (* P < 0.05, ** P < 0.01, and *** P < 0.001). Declarations Conflicts of Interest The authors declare no conflict of interest. Author Contribution Conceptualization, Hao Jiang and Jianru Xiao; Methodology, Hao Jiang and Jianru Xiao; Software, Hao Jiang; Validation, Jianru Xiao; Formal Analysis, Hao jiang, Zhenxi Li, and Wei Xu; Investigation, Hao jiang, Zhenxi Li, and Wei Xu; Resources, Jianru Xiao; Data Curation, Hao Jiang; Writing – Original Draft Preparation, Hao jiang, Zhenxi Li, and Wei Xu; Writing – Review & Editing, Jianru Xiao; Visualization, Hao jiang; Supervision, Jianru Xiao; Project Administration, Jianru Xiao; Funding Acquisition, Jianru Xiao. Data Availability The data presented in this study are available on request from the corresponding author. References Clézardin P, Coleman R, Puppo M, Ottewell P, Bonnelye E, Paycha F, et al. Bone metastasis: mechanisms, therapies, and biomarkers. Physiol Rev. 2021;101(3):797–855. Nolan E, Lindeman GJ, Visvader JE. Deciphering breast cancer: from biology to the clinic. Cell. 2023;186(8):1708–28. van Uden DJP, van Maaren MC, Strobbe LJA, Bult P, van der Hoeven JJ, Siesling S, et al. Metastatic behavior and overall survival according to breast cancer subtypes in stage IV inflammatory breast cancer. Breast Cancer Res. 2019;21(1):113. Falato C, Schettini F, Pascual T, Brasó-Maristany F, Prat A. Clinical implications of the intrinsic molecular subtypes in hormone receptor-positive and HER2-negative metastatic breast cancer. Cancer Treat Rev. 2023;112:102496. Kim S, Shin D, Min A, Kim M, Na D, Lee HB, et al. Genomic profile of metastatic breast cancer patient-derived xenografts established using percutaneous biopsy. J Transl Med. 2021;19(1):7. Waning DL, Guise TA, Mohammad KS. A "Connexin" Responsible for the Fatal Attraction of Cancer to Bone. Cell Metab. 2019;29(1):6–8. Liu A, Zhu Y, Chen W, Merlino G, Yu Y. PTEN Dual Lipid- and Protein-Phosphatase Function in Tumor Progression. Cancers (Basel). 2022;14(15). Lee YR, Chen M, Lee JD, Zhang J, Lin SY, Fu TM, et al. Reactivation of PTEN tumor suppressor for cancer treatment through inhibition of a MYC-WWP1 inhibitory pathway. Science. 2019;364(6441). Álvarez-Garcia V, Tawil Y, Wise HM, Leslie NR. Mechanisms of PTEN loss in cancer: It's all about diversity. Semin Cancer Biol. 2019;59:66–79. Dai C, Wu B, Chen Y, Li X, Bai Y, Du Y, et al. Aagab acts as a novel regulator of NEDD4-1-mediated Pten nuclear translocation to promote neurological recovery following hypoxic-ischemic brain damage. Cell Death Differ. 2021;28(8):2367–84. Guo Y, He J, Zhang H, Chen R, Li L, Liu X, et al. Linear ubiquitination of PTEN impairs its function to promote prostate cancer progression. Oncogene. 2022;41(44):4877–92. Iwase R, Dempsey DR, Whedon SD, Jiang H, Palanski BA, Deng B, et al. Semisynthetic Approach to the Analysis of Tumor Suppressor PTEN Ubiquitination. J Am Chem Soc. 2023;145(11):6039–44. Lee YR, Yehia L, Kishikawa T, Ni Y, Leach B, Zhang J, et al. WWP1 Gain-of-Function Inactivation of PTEN in Cancer Predisposition. N Engl J Med. 2020;382(22):2103–16. Van Themsche C, Leblanc V, Parent S, Asselin E. X-linked inhibitor of apoptosis protein (XIAP) regulates PTEN ubiquitination, content, and compartmentalization. J Biol Chem. 2009;284(31):20462–6. Cockram PE, Kist M, Prakash S, Chen SH, Wertz IE, Vucic D. Ubiquitination in the regulation of inflammatory cell death and cancer. Cell Death Differ. 2021;28(2):591–605. Hu X, Yu J, Lin Z, Feng R, Wang ZW, Chen G. The emerging role of WWP1 in cancer development and progression. Cell Death Discov. 2021;7(1):163. Gao X, Qin T, Mao J, Zhang J, Fan S, Lu Y, et al. PTENP1/miR-20a/PTEN axis contributes to breast cancer progression by regulating PTEN via PI3K/AKT pathway. J Exp Clin Cancer Res. 2019;38(1):256. Kishikawa T, Higuchi H, Wang L, Panch N, Maymi V, Best S, et al. WWP1 inactivation enhances efficacy of PI3K inhibitors while suppressing their toxicities in breast cancer models. J Clin Invest. 2021;131(24). Liao C, Yu L, Pang Z, Deng H, Liao X, Li S, et al. WWP1 targeting MUC1 for ubiquitin-mediated lysosomal degradation to suppress carcinogenesis. Signal Transduction and Targeted Therapy. 2021;6(1):297. Zhang Z, Du J, Wang S, Shao L, Jin K, Li F, et al. OTUB2 Promotes Cancer Metastasis via Hippo-Independent Activation of YAP and TAZ. Mol Cell. 2019;73(1):7–21.e7. Zhang W, Xu Z, Hao X, He T, Li J, Shen Y, et al. Bone Metastasis Initiation Is Coupled with Bone Remodeling through Osteogenic Differentiation of NG2 + Cells. Cancer Discov. 2023;13(2):474–95. Bado IL, Zhang W, Hu J, Xu Z, Wang H, Sarkar P, et al. The bone microenvironment increases phenotypic plasticity of ER(+) breast cancer cells. Dev Cell. 2021;56(8):1100-17.e9. Zhang P, Li C, Li H, Yuan L, Dai H, Peng Z, et al. Ubiquitin ligase CHIP regulates OTUD3 stability and suppresses tumour metastasis in lung cancer. Cell Death Differ. 2020;27(11):3177–95. Waks AG, Winer EP. Breast Cancer Treatment: A Review. Jama. 2019;321(3):288–300. Hofbauer LC, Bozec A, Rauner M, Jakob F, Perner S, Pantel K. Novel approaches to target the microenvironment of bone metastasis. Nat Rev Clin Oncol. 2021;18(8):488–505. Satcher RL, Zhang XH. Evolving cancer-niche interactions and therapeutic targets during bone metastasis. Nat Rev Cancer. 2022;22(2):85–101. Coleman RE, Croucher PI, Padhani AR, Clézardin P, Chow E, Fallon M, et al. Bone metastases. Nat Rev Dis Primers. 2020;6(1):83. Bernassola F, Chillemi G, Melino G. HECT-Type E3 Ubiquitin Ligases in Cancer. Trends Biochem Sci. 2019;44(12):1057–75. Cruz Walma DA, Chen Z, Bullock AN, Yamada KM. Ubiquitin ligases: guardians of mammalian development. Nat Rev Mol Cell Biol. 2022;23(5):350–67. Liang Y, Zhang H, Song X, Yang Q. Metastatic heterogeneity of breast cancer: Molecular mechanism and potential therapeutic targets. Semin Cancer Biol. 2020;60:14–27. Kfoury Y, Baryawno N, Severe N, Mei S, Gustafsson K, Hirz T, et al. Human prostate cancer bone metastases have an actionable immunosuppressive microenvironment. Cancer Cell. 2021;39(11):1464-78.e8. Additional Declarations No competing interests reported. Supplementary Files SupplementaryTableI.docx Cite Share Download PDF Status: Published Journal Publication published 02 Dec, 2024 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 22 Jul, 2024 Reviews received at journal 04 Jul, 2024 Reviews received at journal 28 Jun, 2024 Reviewers agreed at journal 27 Jun, 2024 Reviewers agreed at journal 15 Jun, 2024 Reviewers invited by journal 03 Jun, 2024 Editor assigned by journal 03 Jun, 2024 Editor invited by journal 23 May, 2024 Submission checks completed at journal 23 May, 2024 First submitted to journal 18 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4441947","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":310576419,"identity":"ed4ff8cd-f368-4fca-9810-886f0a1f36ea","order_by":0,"name":"Hao Jiang","email":"","orcid":"","institution":"Changzheng Hospital, Second Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Hao","middleName":"","lastName":"Jiang","suffix":""},{"id":310576420,"identity":"82915ed9-1562-4ede-8aa0-5cafb72fdd54","order_by":1,"name":"Zhenxi Li","email":"","orcid":"","institution":"Changzheng Hospital, Second Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhenxi","middleName":"","lastName":"Li","suffix":""},{"id":310576421,"identity":"b88a7e8a-814c-4d3a-a649-76789b2de1f6","order_by":2,"name":"Wei Xu","email":"","orcid":"","institution":"Changzheng Hospital, Second Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Xu","suffix":""},{"id":310576422,"identity":"5d922abe-9b0b-4e0c-be8f-a9f4285fe90f","order_by":3,"name":"Jianru Xiao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6ElEQVRIiWNgGAWjYBAC9mYIndjGwMD48EOFhJw8IS2MSFqYjSXOWBgbNhDSAlVgDMRsErxtFYkMBwhpaWd+9riyjUGOj/3wYQPJeRIJjA3MDx/dwOswNnPDs20MPGw8aYkPCrdJ5LEzsBkb5+D3i5lkI0gLQ46xgeQ2iWLGBh42afxa2L+BtMix8b8xk+CdI5HYcICAFsFmHrAtxmwSOUAtDURokWbmKZNsOAcMZIlnycYSxySMDZsJ+IWP//g2yYYyhsT5/ckHH36oqZOTZ29++BifFij4j8RmJqx8FIyCUTAKRgEBAAAYDkA/tjenQAAAAABJRU5ErkJggg==","orcid":"","institution":"Changzheng Hospital, Second Military Medical University","correspondingAuthor":true,"prefix":"","firstName":"Jianru","middleName":"","lastName":"Xiao","suffix":""}],"badges":[],"createdAt":"2024-05-18 17:23:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4441947/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4441947/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-81541-5","type":"published","date":"2024-12-02T15:58:13+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":58076662,"identity":"b775c969-498b-450c-a6db-736b99a486de","added_by":"auto","created_at":"2024-06-10 22:21:36","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":292029,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eWWP1 was overexpressed and related with a poor prognosis in breast cancer\u003c/strong\u003e. (A) Pan-cancer analysis of WWP1 expression between normal and tumor tissues from TCGA and GETx. (B) Western bolt analysis of WWP1 expression in paired samples of breast cancer spinal metastasis (M) and adjacent nontumorous tissues (N). (C) Quantification of WWP1 protein levels relative to GAPDH in (B) is shown. (D) Western bolt analysis of WWP1 expression in samples of luminal breast cancer with spinal metastasis (M) and without spinal metastasis (T). (E) Quantification of WWP1 protein levels relative to GAPDH in (D) is shown. (F) Overall survival analysis for breast cancer patients based on WWP1 expression, categorized into high (red) and low (blue) expression. P-values were calculated using the log-rank test. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, results are representative of at least three independent experiments and shown as mean ± SD.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-4441947/v1/58d841724be3df1b6ad9a975.png"},{"id":58077202,"identity":"41ac64d0-6d70-45f8-ab96-6b78d590b85d","added_by":"auto","created_at":"2024-06-10 22:29:36","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":228326,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eWWP1 interacts with PTEN in luminal breast cancer cell lines.\u003c/strong\u003e (A) Western blot analysis of WWP1 expression levels in different breast cancer cell lines. (B-C) Quantifications of WWP1 levels relative to GAPDH among different breast cancer cell lines are shown. (D) BT474, MCF7, and T47D cells transfected with Flag-WWP1 were subjected to immunoprecipitation using anti-Flag antibodies. Both cell lysates and immunoprecipitates were then blotted. (E-G) Interaction between WWP1 and PTEN in MCF7 cells, T47D cells, and BT474 cells was confirmed through Co-IP assays. Cell lysates were immunoprecipitated using control IgG, anti-WWP1, and anti-PTEN antibodies. The immunoprecipitates were then analyzed.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-4441947/v1/646926ec2070f1fb0aa0b2d2.png"},{"id":58077200,"identity":"05e97339-6f09-4e5d-ab73-90374ac7cf01","added_by":"auto","created_at":"2024-06-10 22:29:36","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":258450,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eWWP1 polyubiquitylates PTEN. \u003c/strong\u003e(A) WWP1 was knocked down in MCF7 cells using shRNA, and the efficiency of knockdown was verified through western blotting. (B) Quantification of WWP1 protein levels related to (A) is shown. (C) Effects of WWP1 knockdown on WWP1-mediated PTEN polyubiquitination. WWP1-silenced MCF7 cells were transfected with the indicated constructs, and PTEN polyubiquitination was analyzed through western blotting. (D) Quantification of the ubiquitination levels of PTEN in (C) is shown. (E) Analysis of PTEN polyubiquitination level in WWP1-knockdown MCF7 cells with stable reconstitution of either WWP1 WT or CA (C890A, a catalytically inactive mutant of WWP1). (F) Quantification of the ubiquitination levels of PTEN in (F) is shown. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, ****\u003cem\u003eP\u003c/em\u003e\u0026lt;0.0001, results are representative of at least three independent experiments and shown as mean + SD.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-4441947/v1/99625bc205e4b5b867be7bcc.png"},{"id":58077651,"identity":"c811216c-3daf-40ec-ba88-ac9fc778dfcc","added_by":"auto","created_at":"2024-06-10 22:37:36","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":203999,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eWWP1 did not affect PTEN stability. (A) \u003c/strong\u003eMCF7 cells transfected with WWP1 were treated with cycloheximide (10 µg/ml), and analyzed at the indicated times for western blot. (B) Quantification of PTEN levels relative to GAPDH in (A) is shown. (C) Western bolt analysis of PTEN expression in samples of luminal breast cancer with spinal metastasis (M) and without spinal metastasis (T). (D) Quantification of PTEN protein levels relative to GAPDH in (C) is shown. *\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, and ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001. Data are representative of at least three independent experiments and are presented as mean ± SD.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-4441947/v1/f9ded3052748d6f4c748b998.png"},{"id":58076668,"identity":"8512b64c-0837-4ce8-bf00-f8d1ef94908b","added_by":"auto","created_at":"2024-06-10 22:21:36","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":646924,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eWWP1 promotes migration of luminal breast cancer cells in vitro and early bone metastasis in vivo. \u003c/strong\u003e(A) Effects of WWP1 on MCF7 cells migration were accessed using Transwell assays. (B) Quantification of MCF7 cell number in different group in (A) is shown. (C) BLI analyses of early bone metastasis in nude mice 2 weeks after IIA injection of MCF7 control cells, WWP1 knockdown, and WT overexpression in WWP1-konckdown cells (n=5 mice in each group). (D) BLI signals of all nude mice in each group of (C) at 2 weeks. (E) Percentage of metastasis-free nude mice per group. *\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, and ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001. Data are representative of at least three independent experiments and are presented as mean ± SD.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-4441947/v1/ba62610a6435ac5347138b36.png"},{"id":58076664,"identity":"96ad5009-41d2-4cc8-8c7b-5c023472eaf5","added_by":"auto","created_at":"2024-06-10 22:21:36","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":211142,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA schematic model of WWP1 in promoting luminal breast cancer bone metastasis.\u003c/strong\u003e WWP1 could promote luminal breast cancer bone metastasis through polyubiquitination of PTEN.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-4441947/v1/f0e8b1ecc031225dc8028876.png"},{"id":70964979,"identity":"b4202cec-0c4f-4276-82f6-c2bf971cd866","added_by":"auto","created_at":"2024-12-09 16:17:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2499040,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4441947/v1/c4ce543a-397e-47ed-b618-59437cad2751.pdf"},{"id":58077199,"identity":"cb3f26ab-ba80-4704-b4de-26a24357894f","added_by":"auto","created_at":"2024-06-10 22:29:36","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":16999,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTableI.docx","url":"https://assets-eu.researchsquare.com/files/rs-4441947/v1/7aa434fa9453c7888d98b97f.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"WWP1 targeting PTEN for polyubiquitination to promote bone metastasis of luminal breast cancer","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe bone is the most common site of metastasis in breast cancer, particularly in the luminal subtype(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Over two-thirds of breast cancer patients develop bone metastasis, resulting in severe pain, pathological fractures, and other skeletal-related events, which are associated with poor prognosis for breast cancer patients(\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Clinical studies have revealed that luminal breast cancer is more likely to metastasize to the bone than to the non-bone organs(\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). However, the molecular mechanisms that regulate this bone selectivity remain unclear. Intricate molecular interactions within cancer cells, which are highly context-dependent, contribute to the development of bone metastasis(\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). In particular, phosphatase and tension homologue deleted on chromosome 10 (PTEN) is a significant tumor suppressor that cancer cells cannot afford to lose completely before maturation(\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). By antagonizing the PI3K (Phosphatidylinositol-3-kinase)/AKT (Protein kinase B) signaling pathway, PTEN can govern fundamental cellular processes in various cancer cells(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Mice with PTEN overexpression have achieved a tumor-suppressive metabolic state, leading to a life-span extension(\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Therefore, the active and reactive functions of PTEN are considered promising therapeutic opportunities for human health. In terms of molecular mechanisms, the activity, expression, and localization of PTEN are frequently dysregulated through post-translational modifications, such as ubiquitylation(\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). The ubiquitylation of PTEN can be promoted by several E3 ubiquitin ligases, affecting its protein stability or dimer formation, both of which are highly consequential for tumor initiation, progression, and metastasis(\u003cspan additionalcitationids=\"CR11 CR12 CR13\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). As post-translational modification is a complex process influenced by various molecules within different cells, ubiquitylation is context-dependent(\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSeveral E3 ubiquitin ligases have been reported to promote PTEN polyubiquitylation for degradation(\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). However, WW domain-containing E3 ubiquitin protein ligase 1 (WWP1) was found to regulate PTEN dimerization and membrane recruitment, rather than degradation, through K27-linked polyubiquitination(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). WWP1 belongs to the NEDD4 (Neural precursor cell expressed, developmentally down-regulated 4) - like protein family, characterized by an N-terminal C2 domain, four WW domains, and a C-terminal catalytic HECT (homologoustoE6-APCterminus) domain(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). After binding to PTEN, WWP1 mediates polyubiquitylation of lysine residue 342, 344, or both(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Thus, WWP1 may suppress PTEN dimerization and membrane recruitment, ultimately resulting in neoplastic transformation(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Among various cancers, breast cancer is the most sensitive to PTEN dysfunction(\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). In addition, WWP1 was reported to be a potential therapy target in breast cancer. Many studies have demonstrated that WWP1 played a potent role in breast cancer tumorigenesis or drug resistance, by the ubiquitination of PTEN, MUC1, and other breast cancer promoting or suppressing proteins(\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). However, reports regarding the role of the WWP1-PTEN interaction in luminal breast cancer are lacking. Therefore, the purpose of our study was to investigate the role of WWP1-PTEN interaction in the bone tropism in luminal breast cancer and to explore their mechanisms.\u003c/p\u003e \u003cp\u003eIn this study. We demonstrated that WWP1 was upregulated in breast cancer and contributed to the tumorigenesis. We confirmed the interaction between WWP1 and PTEN in luminal breast cancer cells. Moreover, we verified K27-linked polyubiquitination of PTEN by WWP1 in luminal breast cancer cells. In addition, we found that WWP1 could promoted luminal breast cancer cell invasion and migration in vitro and metastases in vivo. Generally, our study highlights the critical role of the WWP1-PTEN interaction in luminal breast cancer bone metastasis and suggests a new potential approach for managing breast cancer metastasis.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eWWP1 was overexpressed and related with a poor prognosis in breast cancer\u003c/h2\u003e \u003cp\u003eTo elucidate the potential role of WWP1 in breast cancer, we first analyzed data from TCGA (The cancer genome atlas) and GTEx (Genotype-Tissue Expression) databases, revealing an upregulation of WWP1 mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). We further validated this finding by confirming strong WWP1 expression in the tumors of most breast cancer patients with spinal metastasis, but minimal expression in their adjacent noncancerous breast tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB and Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). This observation indicates that WWP1 is barely expressed in normal breast tissues but is frequently overexpressed in breast tumor tissues that metastasize to bone. The WWP1 expressions are also analyzed between luminal breast cancer patients with and without spinal metastases. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD and Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, the luminal breast cancers that developed spinal metastasis (M) had a relatively higher WWP1 expressions than those did not developed metastasis (T). In addition, Kaplan\u0026ndash;Meier analysis demonstrated that breast cancer patients with low WWP1 expression achieved a relatively longer overall survival (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). These results indicated that WWP1 might be a risk factor in breast cancer metastasis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eWWP1 interacts with PTEN in luminal breast cancer cell lines\u003c/h2\u003e \u003cp\u003eTo determine the underlying mechanisms of WWP1 in breast cancer metastasis, we first assessed the protein levels of WWP1 in various breast cancer cell lines. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, WWP1 exhibited an upregulation in luminal cell lines compared with that in other cell lines. The highest expression of WWP1 in luminal breast cancer cell lines, especially in MCF7 cells, was further verified by imaging analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Indicated the important role of WWP1 in luminal breast cancer metastasis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAs PTEN is well known to be dysregulated, such as through posttranslational modification, during the breast cancer progression. And, WWP1 was reported to mediated PTEN posttranslational modification in prostate cancer. Therefore, we explored whether WWP1 could regulate PTEN in luminal breast cancer cells, as posttranslational modification is context-dependent. Binding assays revealed a strong interaction between WWP1 and PTEN in luminal breast cancer. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, WWP1 exhibited strong binding capability for PTEN in luminal breast cancer lines (MCF7, BT474, and T-47D), suggesting a promising role for WWP1 in regulating PTEN in luminal breast cancer cells. Co-immunoprecipitation experiments confirmed the binding between endogenous WWP1 and PTEN proteins in the three cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF, and Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). These observations, verified the interaction between WWP1 and PTEN in luminal breast cancer cells and suggesting that WWP1 should be a regulator of PTEN in the luminal breast cancer metastasis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eWWP1 polyubiquitylates PTEN\u003c/h2\u003e \u003cp\u003eAs WWP1 is an E3 ubiquitin ligase, we went on to determine the possibility that WWP1 mediates polyubiquitination of PTEN, which had not been studied in luminal breast cancer cells. According to Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-C, WWP1 had high expression in MCF7 cells, so we silenced endogenous WWP1 in MCF7 cells using shRNAs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA), and imaging analysis confirmed the successful knockdown of WWP1 in MCF7 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Consequently, the downregulation of WWP1 by shRNA led to reduction in PTEN polyubiquitination in MCF-7 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). imaging analysis exhibited a significantly decrease of PTEN ubiquitination level when WWP1 was knocked down (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Conversely, the overexpression of wild type WWP1 (WWP WT) in MCF7 cells recused PTEN polyubiquitination, whereas the expression of WWP1 C890A (WWP1 CA), a catalytically inactive mutation, abolished this effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE and Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). As ubiquitination is a context-dependent and intricate process, these results suggested an indispensable role of WWP1 in triggering PTEN polyubiquitination in luminal breast cancer cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003eWWP1 did not affect PTEN stability\u003c/h2\u003e \u003cp\u003ePrevious studies have shown that the stabilization of PTEN protein suppresses breast cancer tumorigenesis(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). However, according to Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, WWP1 did not affect the PTEN protein levels. Indicating polyubiquitination by WWP1 did not lead to PTEN degradation. In order to further exam the effects of WWP1 on PTEN stability, we subsequently assessed the correlation between the protein turnover rate and WWP1-mediated polyubiquitination of PTEN in luminal breast cancer cells. The cycloheximide (CHX) treatment experiment in MCF7 cells showed the turnover rate of PTEN was not affected by WWP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). In addition, we compared the PTEN expressions between luminal breast cancers with and without spinal metastasis. Hardly any obviously difference could be detected from the western blot imaging and analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Given that WWP1 had a higher expression in luminal breast cancers which developed spinal metastasis against those without spinal metastasis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE), these findings demonstrated that WWP1-rugulated polyubiquitination dose not lead to PTEN degradation. Indeed, recently, WWP1 was found to affects the dimerization and membrane recruitment of PTEN, which defunctionalized PTEN(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Taken together, these results emphasize the crucial role of WWP1 in regulating PTEN function in luminal breast cancer cells rather than the PTEN stabilization.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eWWP1 promotes luminal breast cancer cells migration via PTEN polyubiquitination\u003c/h2\u003e \u003cp\u003eThe above data lead us to propose that WWP1 might function as a promotor for luminal breast cancer metastasis through regulation of PTEN. To verify this hypothesis, we generated WWP1-knockdown derivatives of MCF7 cells using a lentiviral shRNA vector in MCF7 cells, and carried out transwell assays to evaluate the migration ability of WWP1-knockdown MCF7 cells. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, WWP1 knockdown substantially suppressed the migration ability of MCF7 cells in vitro. Furthermore, to explore the underlying mechanism, we then stably expressing either wild type WWP1 (WWP1 WT) or inactive WWP1 C890A mutant (WWP1 CA) to the WWP1-knockdown MCF7 cells. Only WWP1 WT was able to reverse the migration phenotype, suggesting the essential role of WWP1 catalytic activity, functioned in PTEN ubiquitination, in mediating MCF7 migration (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Therefore, these results demonstrated that WWP1 could promote the migration ability of luminal breast cancer cells through the polyubiquitination of PTEN, as evidenced by its requirement for catalytic activity.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWWP1 contributes to early-stage bone metastasis of luminal breast cancer in vivo\u003c/h2\u003e \u003cp\u003eEncouraged by the in vitro results, we further explored the function role of WWP1 in breast cancer metastasis via an IIA injection model in node mice. This model enables monitoring of early-stage bone colonization(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e); which is particularly relevant for luminal breast cancer due to its strong bone tropism. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, WWP1 knockdown markedly reduced the bone metastasis burden following the IIA injection of cancer cells in mice. Bioluminescent imaging (BLI) quantification substantiated the decrease in metastatic signal in the hind limbs within the first two weeks after cancer cell inoculation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Besides, survival analyses confirmed that mice injected with WWP1 overexpression clones of MCF7 cells had significantly shorter survival periods (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). These results underscore the pivotal role of WWP1 in bone metastasis of luminal cancers.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eNumerous studies have focused on bone metastasis in breast cancer. Breast cancer is categorized into different subtypes based on its molecular types(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). Identifying molecules responsible for tumor progression, metastasis, and chemotherapy resistance can shed light on breast cancer treatment(\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). Several tumor-derived molecules, such as IL-6, MMP1, and Jagged1(\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e) have been identified, in studies of ER\u003csup\u003e\u0026minus;\u003c/sup\u003e cell lines. However, while ER is reported to have a significant clinical association with the bone tropism of breast cancer, only a few studies have provided partial explanations for the bone preference in ER\u003csup\u003e+\u003c/sup\u003e luminal breast cancer(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). In our study, we identified the E3 ligase WWP1 as a key regulator of bone preference in ER\u003csup\u003e+\u003c/sup\u003e luminal breast cancer cells. WWP1 was upregulated in most breast cancer and luminal breast cancer cell lines, and this upregulation was linked to poor prognosis in breast cancer patients. The interaction between WWP1 and the tumor suppressor PTEN, which regulates early bone metastasis, was detected in ER\u003csup\u003e+\u003c/sup\u003e luminal breast cancer cells. Mechanistically, the increased abundance of WWP1 promotes its binding with PTEN in luminal breast cancer cells, thus increasing the K27-linked polyubiquitination of PTEN(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). This polyubiquitination of PTEN, regulated by WWP1, directly inhibits the formation of dimers and membrane recruitment(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e), which ultimately promotes bone metastasis in MCF7 cells.\u003c/p\u003e \u003cp\u003eIncreasing evidence has shown a significant relationship between HECT E3 ubiquitin ligases and the progression of various human cancers(\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). WWP1 belongs to the NEDD4 family, which is characterized by C2, HECT, and four WW domains(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). According to the data from TCGA and GETx, WWP1 is frequently upregulated and amplified in breast and prostate cancers. These cancers have a higher propensity to metastasize to bone(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). Aberrant WWP1 expression is significantly associated with the progression of human cancers(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e), but no study has previously focused on its function in luminal breast cancers. Accordingly, our study highlights the promising role of WWP1 in promoting luminal breast cancer metastasis to the bone, providing a new therapeutic target for bone metastasis in breast cancer.\u003c/p\u003e \u003cp\u003eIn luminal breast cancer cells, WWP1 targets PTEN for polyubiquitination, promoting metastasis to the bone. Polyubiquitination mediated by WWP1 regulates PTEN dimer formation and membrane recruitment rather than PTEN stability(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). The function of PTEN is strictly controlled through its subcellular localization, post-translational modifications, or both(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Maintaining the balance of PTEN plays a key role in the proliferation and metastasis of various human cancers(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). However, whether PTEN dimer formation and membrane recruitment can prevent cancer cells from metastasizing to specific organs remains to be elucidated. To investigate the potent bone tropism of luminal breast cancer cells, we silenced WWP1 using shRNA. Consequently, the polyubiquitination of PTEN decreased, and the invasion and migration ability of MCF7 cells were decreased as assessed using the transwell assay. Subsequent overexpression of WWP1 restored PTEN polyubiquitination and thus the invasion and migration ability of MCF7 cells. These results were further verified in the animal experiments. In summary, our study revealed that WWP1 could promote the early bone metastasis of luminal breast cancer cells by regulating PTEN function through polyubiquitination.\u003c/p\u003e \u003cp\u003eHowever, more details need to be further studied before we could target WWP1-PTEN for the treatment of ER\u003csup\u003e+\u003c/sup\u003e breast cancer metastasis to bone. Firstly, more breast cancer samples need to be collected according to their subtype to analysis the WWP1 expression and the correlation between WWP1 and PTEN. Besides, the binding site between WWP1 and PTEN need to be well studied for designing targeted drugs. Fortunately, identification of WWP1 as a key regulator for the luminal breast cancer bone metastasis may server as a valuable treatment strategy.\u003c/p\u003e \u003cp\u003eIn conclusion, this study is the first to establish the nonproteolytic ubiquitination of PTEN mediated by WWP1 in luminal breast cancer cells. It underscores the critical role of WWP1 in mediating bone colonization of luminal breast cancer cells by preventing PTEN dimer formation and membrane recruitment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). This non-proteolytic ubiquitination of PTEN mediated by WWP1 in luminal breast cancer cells could represent a general mechanism underlying their preference for bone metastasis, offering a novel insight into the bone preference of luminal breast cancer metastasis. Therefore, targeting the WWP1-PTEN interaction holds promise for ER\u003csup\u003e+\u003c/sup\u003e breast cancer patients at high risk of bone metastasis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eClinical analysis\u003c/h2\u003e \u003cp\u003eExpression analysis of breast cancer patients was downloaded from GEPIA (Gene Expression Profiling Interactive Analysis) 2.0 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gepia2.cancer-pku.cn/\u003c/span\u003e\u003cspan address=\"http://gepia2.cancer-pku.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Frozen samples of breast cancer bone metastasis, adjacent tissues, and breast cancer tissues were acquired from the Department of Orthopedic Oncology of Changzheng Hospital (Navy Medical University), and the basic information of these samples was listed in Table SⅠ. We obtained written informed consent and received approval from the Ethics Committee of Changzheng Hospital. Informed consent was provided by the patients.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eAll the cell lines used in this study were purchased from ATCC (American Type Culture Collection), and were authenticated by STR (Short Tandem Repeat) profiling. Cells were cultured in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM) containing 10% FBS and 1% penicillin\u0026ndash;streptomycin. The cells were grown at 37℃ in a 5% CO2 incubator and were free from mycoplasma contamination.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePlasmids and antibodies\u003c/h2\u003e \u003cp\u003ePlasmids: pSPAX2, pMD2.G, His-Ub, Flag-PTEN, HA-PTEN, Flag-WWP1, Flag-WWP1-C890A (Flag-WWP1 CA) were stored in our laboratory. Antibodies: anti-WWP1 (Abcam, ab227213), anti-PTEN (Abcam, ab32199), anti-GAPDH (Sigma-Aldrich, G9545), anti-Flag (Abcam, ab205606), anti-His (Abcam, ab200537), normal IgG (Santa Cruz, sc-2025).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eImmunoprecipitation and western blotting\u003c/h2\u003e \u003cp\u003eImmunoprecipitation was performed as previously described(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e), using different antibodies and reagents. Western blotting was conducted as previously described(\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eLentivirus infection\u003c/h2\u003e \u003cp\u003eWe cotransfected 293T cells with plasmids pSPAX2, pMD2.G, and the lentivirus-based constructs as indicated. The supernatant was collected to harvest recombinant lentivirus. Lentiviruses carrying short hairpin RNA (shRNA) targeting human WWP1 (TRCN0000003395: ATTGCTTATGAACGCGGCTTT and TRCN0000003396: ACAACACACCTTCATCTCCGT)(\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e) were used to infect MCF7 cells with Polybrene (10 \u0026micro;g/ml), The infected MCF7 cells were selected with puromycin (2 \u0026micro;g/ml) to generate stable clones.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eUbiquitination assay\u003c/h2\u003e \u003cp\u003eFor the ubiquitination analysis of PTEN, MCF7 cells were transfected with the indicated constructs, along with His-ubiquitin. Cells were lysed as previously described(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Briefly, cells were lysed in buffer A [6 M guanidine HCl, 10 mM imidazole, and Na2HPO4/NaH2PO4 (pH 8.0)]. The lysates were incubated with Ni-NTA agarose for 3 h at 37℃, followed by western blot analysis. WWP1 WT, WWP1 C890A, were cloned into pFlag-CMV-2; PTEN was cloned into pCMV-HA; ubiquitin was cloned into pcDNA3.1/His-N. All the plasmids were stored in our lab.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eAnimal experiments\u003c/h2\u003e \u003cp\u003eFemale nude mice (6-weeks-old), bred and housed under SPF (Specific Pathogen Free) facilities, were used in animal experiments. These experiments were approved by the Committee for Animal Welfare of the Naval Medical University and all the experiments in this article were in accordance with ARRIVE guidelines. Intra-iliac artery (IIA) injection was performed according to previous reports(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e) after anesthetized by inhalation of 2.5% isoflurane. In summary, 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e luciferase-labeled cells were injected into the intra-iliac artery for early bone metastasis analysis. Mice were euthanized by intraperitoneal injection of pentobarbital sodium (200mg/Kg).\u003c/p\u003e \u003cp\u003e \u003cb\u003eExperimental statement.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe experiments and methods used in this article were all in accordance with relevant\u003c/p\u003e \u003cp\u003eguidelines and regulations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analyses\u003c/h2\u003e \u003cp\u003eAll data are representative of at least three independent experiments and are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD, analyzed by GraphPad Prism 8.0. Statistical differences between the two groups were assessed using Student\u0026rsquo;s t-test. Statistical analysis was performed using 1-way ANOVA, 2-way ANOVA test followed by Tukey\u0026rsquo;s or Fisher\u0026rsquo;s least significant difference multiple comparisons for multigroup data sets. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 means significant (* P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, ** P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, and *** P\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflicts of Interest\u003c/h2\u003e \u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceptualization, Hao Jiang and Jianru Xiao; Methodology, Hao Jiang and Jianru Xiao; Software, Hao Jiang; Validation, Jianru Xiao; Formal Analysis, Hao jiang, Zhenxi Li, and Wei Xu; Investigation, Hao jiang, Zhenxi Li, and Wei Xu; Resources, Jianru Xiao; Data Curation, Hao Jiang; Writing \u0026ndash; Original Draft Preparation, Hao jiang, Zhenxi Li, and Wei Xu; Writing \u0026ndash; Review \u0026amp; Editing, Jianru Xiao; Visualization, Hao jiang; Supervision, Jianru Xiao; Project Administration, Jianru Xiao; Funding Acquisition, Jianru Xiao.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe data presented in this study are available on request from the corresponding author.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eCl\u0026eacute;zardin P, Coleman R, Puppo M, Ottewell P, Bonnelye E, Paycha F, et al. Bone metastasis: mechanisms, therapies, and biomarkers. Physiol Rev. 2021;101(3):797\u0026ndash;855.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNolan E, Lindeman GJ, Visvader JE. Deciphering breast cancer: from biology to the clinic. Cell. 2023;186(8):1708\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Uden DJP, van Maaren MC, Strobbe LJA, Bult P, van der Hoeven JJ, Siesling S, et al. Metastatic behavior and overall survival according to breast cancer subtypes in stage IV inflammatory breast cancer. Breast Cancer Res. 2019;21(1):113.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFalato C, Schettini F, Pascual T, Bras\u0026oacute;-Maristany F, Prat A. Clinical implications of the intrinsic molecular subtypes in hormone receptor-positive and HER2-negative metastatic breast cancer. Cancer Treat Rev. 2023;112:102496.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim S, Shin D, Min A, Kim M, Na D, Lee HB, et al. Genomic profile of metastatic breast cancer patient-derived xenografts established using percutaneous biopsy. J Transl Med. 2021;19(1):7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWaning DL, Guise TA, Mohammad KS. A \"Connexin\" Responsible for the Fatal Attraction of Cancer to Bone. Cell Metab. 2019;29(1):6\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu A, Zhu Y, Chen W, Merlino G, Yu Y. PTEN Dual Lipid- and Protein-Phosphatase Function in Tumor Progression. Cancers (Basel). 2022;14(15).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee YR, Chen M, Lee JD, Zhang J, Lin SY, Fu TM, et al. Reactivation of PTEN tumor suppressor for cancer treatment through inhibition of a MYC-WWP1 inhibitory pathway. Science. 2019;364(6441).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u0026Aacute;lvarez-Garcia V, Tawil Y, Wise HM, Leslie NR. Mechanisms of PTEN loss in cancer: It's all about diversity. Semin Cancer Biol. 2019;59:66\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai C, Wu B, Chen Y, Li X, Bai Y, Du Y, et al. Aagab acts as a novel regulator of NEDD4-1-mediated Pten nuclear translocation to promote neurological recovery following hypoxic-ischemic brain damage. Cell Death Differ. 2021;28(8):2367\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo Y, He J, Zhang H, Chen R, Li L, Liu X, et al. Linear ubiquitination of PTEN impairs its function to promote prostate cancer progression. Oncogene. 2022;41(44):4877\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIwase R, Dempsey DR, Whedon SD, Jiang H, Palanski BA, Deng B, et al. Semisynthetic Approach to the Analysis of Tumor Suppressor PTEN Ubiquitination. J Am Chem Soc. 2023;145(11):6039\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee YR, Yehia L, Kishikawa T, Ni Y, Leach B, Zhang J, et al. WWP1 Gain-of-Function Inactivation of PTEN in Cancer Predisposition. N Engl J Med. 2020;382(22):2103\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Themsche C, Leblanc V, Parent S, Asselin E. X-linked inhibitor of apoptosis protein (XIAP) regulates PTEN ubiquitination, content, and compartmentalization. J Biol Chem. 2009;284(31):20462\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCockram PE, Kist M, Prakash S, Chen SH, Wertz IE, Vucic D. Ubiquitination in the regulation of inflammatory cell death and cancer. Cell Death Differ. 2021;28(2):591\u0026ndash;605.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu X, Yu J, Lin Z, Feng R, Wang ZW, Chen G. The emerging role of WWP1 in cancer development and progression. Cell Death Discov. 2021;7(1):163.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao X, Qin T, Mao J, Zhang J, Fan S, Lu Y, et al. PTENP1/miR-20a/PTEN axis contributes to breast cancer progression by regulating PTEN via PI3K/AKT pathway. J Exp Clin Cancer Res. 2019;38(1):256.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKishikawa T, Higuchi H, Wang L, Panch N, Maymi V, Best S, et al. WWP1 inactivation enhances efficacy of PI3K inhibitors while suppressing their toxicities in breast cancer models. J Clin Invest. 2021;131(24).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao C, Yu L, Pang Z, Deng H, Liao X, Li S, et al. WWP1 targeting MUC1 for ubiquitin-mediated lysosomal degradation to suppress carcinogenesis. Signal Transduction and Targeted Therapy. 2021;6(1):297.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Z, Du J, Wang S, Shao L, Jin K, Li F, et al. OTUB2 Promotes Cancer Metastasis via Hippo-Independent Activation of YAP and TAZ. Mol Cell. 2019;73(1):7\u0026ndash;21.e7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang W, Xu Z, Hao X, He T, Li J, Shen Y, et al. Bone Metastasis Initiation Is Coupled with Bone Remodeling through Osteogenic Differentiation of NG2\u0026thinsp;+\u0026thinsp;Cells. Cancer Discov. 2023;13(2):474\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBado IL, Zhang W, Hu J, Xu Z, Wang H, Sarkar P, et al. The bone microenvironment increases phenotypic plasticity of ER(+) breast cancer cells. Dev Cell. 2021;56(8):1100-17.e9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang P, Li C, Li H, Yuan L, Dai H, Peng Z, et al. Ubiquitin ligase CHIP regulates OTUD3 stability and suppresses tumour metastasis in lung cancer. Cell Death Differ. 2020;27(11):3177\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWaks AG, Winer EP. Breast Cancer Treatment: A Review. Jama. 2019;321(3):288\u0026ndash;300.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHofbauer LC, Bozec A, Rauner M, Jakob F, Perner S, Pantel K. Novel approaches to target the microenvironment of bone metastasis. Nat Rev Clin Oncol. 2021;18(8):488\u0026ndash;505.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSatcher RL, Zhang XH. Evolving cancer-niche interactions and therapeutic targets during bone metastasis. Nat Rev Cancer. 2022;22(2):85\u0026ndash;101.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColeman RE, Croucher PI, Padhani AR, Cl\u0026eacute;zardin P, Chow E, Fallon M, et al. Bone metastases. Nat Rev Dis Primers. 2020;6(1):83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBernassola F, Chillemi G, Melino G. HECT-Type E3 Ubiquitin Ligases in Cancer. Trends Biochem Sci. 2019;44(12):1057\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCruz Walma DA, Chen Z, Bullock AN, Yamada KM. Ubiquitin ligases: guardians of mammalian development. Nat Rev Mol Cell Biol. 2022;23(5):350\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang Y, Zhang H, Song X, Yang Q. Metastatic heterogeneity of breast cancer: Molecular mechanism and potential therapeutic targets. Semin Cancer Biol. 2020;60:14\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKfoury Y, Baryawno N, Severe N, Mei S, Gustafsson K, Hirz T, et al. Human prostate cancer bone metastases have an actionable immunosuppressive microenvironment. Cancer Cell. 2021;39(11):1464-78.e8.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"WWP1, PTEN, luminal breast cancer, bone metastasis, ubiquitination","lastPublishedDoi":"10.21203/rs.3.rs-4441947/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4441947/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLuminal breast cancer exhibits a high incidence of bone recurrence when metastasizing to distant organs. The mechanisms underlying the organotropism of luminal breast cancer cells remain unclear. In this study, we aimed to determine the role of WWP1 (WW domain-containing E3 ubiquitin protein ligase 1)-PTEN (Phosphatase and tensin homolog deleted on chromosome ten) interaction in bone tropism in luminal breast cancer. We observed that WWP1 was overexpressed in luminal breast cancer tissues and associated with poor prognosis in breast cancer patients. In luminal breast cancer cells, WWP1 was found to mediate PTEN ubiquitination, resulting in the functional loss of PTEN. As a result, we demonstrate that the WWP1 contributes to bone tropism in luminal breast cancer cells via the polyubiquitination of PTEN. Consequently, WWP1-mediated PTEN polyubiquitination contributed to the early metastasis of luminal breast cancer cells to the bone. Thus, our study provides a mechanistic insight into the bone tropism of luminal breast cancer cells and proposes a potential therapeutic strategy for mitigating cancer metastasis to the bone.\u003c/p\u003e","manuscriptTitle":"WWP1 targeting PTEN for polyubiquitination to promote bone metastasis of luminal breast cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-10 22:21:31","doi":"10.21203/rs.3.rs-4441947/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-07-22T13:54:39+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-04T13:56:39+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-28T04:45:07+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"200386212494030075633463505142571885394","date":"2024-06-27T08:33:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"29492381927087464188968327266332676552","date":"2024-06-15T15:29:22+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-03T15:14:23+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-03T14:56:27+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-05-24T03:11:17+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-24T03:08:39+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-05-18T17:16:57+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"106046c2-671c-4d47-8881-57fcd777e4e0","owner":[],"postedDate":"June 10th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":32821634,"name":"Biological sciences/Cancer"},{"id":32821635,"name":"Biological sciences/Cell biology"}],"tags":[],"updatedAt":"2024-12-09T16:08:11+00:00","versionOfRecord":{"articleIdentity":"rs-4441947","link":"https://doi.org/10.1038/s41598-024-81541-5","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2024-12-02 15:58:13","publishedOnDateReadable":"December 2nd, 2024"},"versionCreatedAt":"2024-06-10 22:21:31","video":"","vorDoi":"10.1038/s41598-024-81541-5","vorDoiUrl":"https://doi.org/10.1038/s41598-024-81541-5","workflowStages":[]},"version":"v1","identity":"rs-4441947","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4441947","identity":"rs-4441947","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.