Downregulation of Immune Response- and External Stimulus-Related Genes in CRC Organoids, and Their Re-Expression by Co-Culturing with CAFs | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Downregulation of Immune Response- and External Stimulus-Related Genes in CRC Organoids, and Their Re-Expression by Co-Culturing with CAFs Mie Naruse, Masako Ochiai, Shigeki Sekine, Hirokazu Taniguchi, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-107047/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 22 Jan, 2021 Read the published version in Scientific Reports → Version 1 posted 8 You are reading this latest preprint version Abstract Organoids derived from epithelial tumors have recently been utilized as a preclinical model in basic and translational studies. This model is considered to reproduce the features of cell-cell contacted and differentiated original tumor cells, but not the tumor microenvironment. In this study, we established organoids and paired cancer-associated fibroblasts (CAFs) from surgical specimens of colorectal carcinomas (CRCs), and evaluated gene expression profiles in organoids with and without co-culture with CAFs to assess interactions between tumor cells and CAFs in tumor tissues. We found that the expression levels of several genes, which are highly expressed in original CRC tissues, were downregulated in organoids but re-expressed by co-culturing with CAFs. They comprised immune response- and external stimulus-related genes, e.g., REG family and dual oxidases (DUOXs), which are known to have malignant functions, e.g., cell-proliferation and/or reducing apoptosis of epithelia and drug resistance for anti-cancer drugs in tumors. In addition, the degree of re-production of REG1 and DUOX2 in the co-culture system varied depending on CAFs from each CRC case. In conclusion, the co-culture system of CRC organoids with paired CAFs was able to partially reproduce the tumor microenvironment. Oncology CAFs REG CRC cancer Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Two-dimensional (2D) cancer cell lines that can be easily and reproducibly maintained in vitro have been mainly used for cancer studies targeting the clarification of molecular mechanisms of carcinogenesis or evaluation of anticancer drugs. As most cancer cell lines were cultured under over-nourished conditions, differing from the in vivo environment, and repeated passages, the characteristics of original tumor tissues, such as expression of stem cell markers and differentiation marker genes, and proliferation, invasion, and drug metabolic abilities are altered in cancer cell lines 1-3 . The low probability of success of clinical trials is partly due to the use of cancer cell lines in preclinical evaluations of drug candidates 3-6 . To promote efficient drug discovery, organoid culture systems have been utilized recently 7, 8 . An organoid is a miniaturized and simplified organ produced in vitro using 3D culture systems that resembles a realistic micro-organ. They are derived from one or a few cells from a tissue, and demonstrate natural cell-cell communication and undergo self-organization in 3D culture 9, 10 . As an ex vivo model, cancer tissue-derived organoids are considered suitable to analyze direct reactivities of carcinoma cells to growth factors/cytokines, miRNAs, or synthetic compounds; however, stroma cells, including fibroblasts, immune cells, and vascular cells, which interact with carcinoma cells in original cancer tissues, are absent in organoid systems. The interactions between cancer cells and cancer associated fibroblasts (CAFs) vary and are considered to be important for carcinogenesis 11-17 . Moreover, the epithelial mesenchymal transition (EMT), which enables tumor cells to acquire resistance to anti-cancer drugs, was reported to be facilitated by the presence of CAFs 18-20 . To date, there have been limited investigations using co-culture systems of 3D-cultured cancer cells with CAFs on several types of cancers, e.g., pancreatic ductal adenocarcinomas 21, 22 , prostate adenocarcinomas 23 , and esophageal carcinomas 24 , and interactions between cancer cells and CAFs were demonstrated to affect cancer aggressiveness and resistance to anti-cancer drugs. The purpose of the present study was to clarify if the co-culture system of CRC organoids with CAFs reproduces the microenvironment between tumor cells and CAFs observed in the original cancer tissues. First, comprehensive gene expression analyses between original tumor tissues and organoids were performed to characterize the features of the organoid culture system. Second, to identify gene expression changes in organoids induced by co-culturing with CAFs, paired CAFs from each case were established, and gene expression profiles between organoids with or without associated CAFs were compared. The present comparative screening of gene expression profiles of clinical tissue-derived CRC organoids with or without corresponding patient tissue-derived CAFs is highly important because the major molecules involved in interactions between tumor cells and CAFs have not been comprehensively evaluated in natural cell-cell communication-constructed and self-organizing in vitro systems. Results Baseline characteristics of CRC Basic patient and pathological data in the 45 CRC cases used for establishment of organoids and fibroblasts are summarized in Supplementary Table S1. Of the 45 cancer patients, 60% were males and 40% were females. This male per female ratio is comparable with Japanese Cancer Statistics (Cancer Registry and Statistics. Cancer Information Service, National Cancer Center, Japan (Monitoring of Cancer Incidence in Japan (MCIJ)). Average ages were 62 years old, ranging from 36 years old to 88 years old. The proportions of stage I, stage II, stage III, and stage IV cancers were 7%, 47%, 31%, and 15%, respectively, and 85% were found in the left colon (D, S, Rs, Ra, and Rb) and 15% in the right colon (T, A, and C). The detailed baseline characteristics of donor patients are summarized in Supplementary Table S1 and Supplementary Fig. S1. Establishment of organoids and fibroblasts Organoids from 11/45 (#1, #11, #13, #16, #18, #21, #25, #28, #32, #33, and #44) cases were established. All CRC organoids had globular and/or irregularly elongated crypts with monolayered or partially multilayered structures. These features of organoids resembled those of CRC tumor tissues in cases #21, #28, and #32 (Fig. 1a-f). CRC-derived cancer associated fibroblasts (CAFs) (Fig. 1g-i) and normal mucosa-derived fibroblasts (NFs) were isolated from cancer tissues and adjacent normal tissues, respectively. The success rate of the presently established organoids was 24.4% (11/45), that of CAFs was 77.1% (27/35), and that of NFs was 88.6% (31/35). CAFs were established from cases obtained during the period from September 2016 to February 2018. The success rate of CRC-derived organoids did not correlate with the basic patient or pathological information, e.g., the sex, age of patient, or pathological stage of cancer (Supplementary Table S2). The characteristic difference between CAFs and NFs was the high expression levels of actin alpha 2, smooth muscle ( ACTA2 ), a marker for CAFs, in cases #28 and #32 (Fig. 1j). In case #21, NFs were not available; however, the expression level of ACTA2 in CAFs was comparable with that in CAFs from #28 and #32. Mutation analysis by NCC Oncopanel Mutations in original CRC tissues and established organoids were analyzed by targeted sequencing using the NCC Oncopanel test. The prevalence rates of APC, TP53, and KRAS mutations in original tissues were 91.1%, 80.0%, and 35.6%, respectively (Fig. 2). The frequently mutated genes including APC , TP53 , and KRAS were highly consistent between our cohort and TCGA (The Cancer Genome Atlas) database 25 . Most of the mutations found in the CRC tissues were maintained in their organoids with higher mutation allele frequencies. However, there are some exceptions, suggesting a reflection of intratumor heterogeneity. Loss of the minor mutations in organoids was considered to partly be attributed to clonal evolution of cancer cells during the organoid culture (Table 1). Then, we performed Sanger sequencing to confirm that the established fibroblasts did not harbor the mutations found in cancer tissues. The TP53 mutations of the cases #21, #28, and #32 were detected in their organoids but not in their fibroblasts (Supplementary Fig. S2). Other mutations such as those of DDR2 in #21, ESR1 in #28, and APC in #32, were also not detected in the corresponding fibroblasts (data not shown). Gene expression analysis by DNA microarray Gene expression analyses by DNA microarray were carried out using original CRC specimens and organoids. Data sets for original tumor tissues and organoids from 5 cases were successfully adjusted and validated for principal components analysis (PCA). The PC1-axis demonstrated a different spatial distribution between the original tumors and organoids. The two groups had significant differences in gene expression distribution, indicating two transcriptionally distant populations (Fig. 3a). There were two typical gene expression profiles of PC1 genes: One was the gene groups highly expressed in organoids and the other was gene groups whose expression in organoids was lower than that in the original tumors. In total, 586 probes exhibited a similar gene expression profile with the latter group of PC1 genes (Pearson’s correlation between 0.95 and 1). Based on Gene Ontology (GO) term analysis, the genes with lower expression in organoids than in the original tumors were enriched for GO terms “extracellular matrix organization”, “blood vessel development”, and “lymphocyte activation” (Fig. 3c). This reflected the lack of fibrous, vascular, and immune cell populations in organoids, whereas the original tumors consist of both epithelial cells and stromal cells. On the other hand, expression profiles of intestinal epithelial-stemness-related genes demonstrated that the organoids maintained the characteristics of the original CRC tissues (Fig. 3d). It is also possible that there was a subset of genes induced via cell-cell communication with other cell types, including CAFs. Cell proliferation abilities of CRC organoids were stimulated by co-culturing with paired CAFs The cell proliferation ability significantly varied among CRC organoid lines (Fig. 4a). CAFs were also established from the same CRC specimens in some cases. To address the effects of cell-cell interaction between CRC organoids and corresponding CAFs, we developed a novel co-culture method using a chamber system. By co-culturing organoids with CAFs, cell viability of organoids increased by 1.2 to 1.5-fold compared with corresponding single-culture organoids in three out of four cases (Fig. 4a). This suggested that the tumor microenvironment constructed by cell-cell communication between tumor cells and CAFs plays a role in the cell proliferative/anti-apoptotic abilities of tumor cells. Identification of upregulated genes by co-culturing with CAFs To identify genes whose expression levels were different between organoids co-cultured with and without CAFs, we performed DNA microarray analysis. Volcano plot analysis demonstrated that the expression levels of 73 genes with 87 probes in organoids were reduced to less than half, whereas those of 177 genes with 238 probes were increased by more than double by co-culturing with CAFs ( P < 0.05; Fig. 4b, Supplementary Tables S3 and S4). These upregulated genes included REG1A, REG1B, REG3A, REG3G, DMBT1, DUOXA2, DUOX2, SOCS3, and LOC340340, with more than 10-fold upregulation. Hierarchical clustering analysis confirmed that these CAF-induced genes were expressed at higher levels also in the original CRC tissues but not in single-culture organoids (Fig. 4c). To validate the microarray data obtained from the co-culture of CRC organoids and CAFs, two candidates for CAF-induced gene groups, REG1A, REG3A, DUOX2 , and DUOX2A, were quantified by quantitative RT-PCR (Fig. 4d-g). The levels of REG1A increased by more than 121 (#21), 480 (#28), and 21-fold (#32) when co-cultured with CAFs. The levels of REG3A increased by more than 26 (#21), 55 (#28), and 11-fold (#32). The levels of DUOX2 increased by more than 29 (#21), 3 (#28), and 33-fold (#32). The levels of DUOXA2 increased by more than 10 (#21), 3 (#28), and 15-fold (#32). This analysis confirmed that the microarray data is reliable, and the degree of induction of each REG family and dual oxidase gene by CAFs varied among cases. Other than REG family and dual oxidase genes, microarray analysis suggested that expression of CEACAM6 and CEACAM7 , members of the carcinoembryonic antigen-related cell adhesion molecule family, and MUC1, which inhibits the anti-tumor immune response, was upregulated by more than 2-fold (Supplementary Table S3).Although many cancer-related genes were induced by the co-culture with CAFs, the degree of their induction by CAFs varied among cases. GO term enrichment analysis for upregulated genes in organoids by co-culturing with CAFs revealed that innate immune response, including “cell wall disruption in other organisms”, “response to bacterium”, “complement and coagulation cascades”, and “interferon-gamma-mediated signaling pathway”, were significantly enriched (Supplementary Fig. S3a). These induced pathways by CAFs were abundantly expressed in CRC tissues but downregulated in single-culture CRC organoids (Supplementary Fig. S3b). CAFs derived from different cases exhibit case-specific ability for REG1A induction in organoids Organoids derived from different cases exhibited varying degrees of induction of REG family and dual oxidase genes by co-culturing with paired CAFs, e.g., organoids from cases #21 and 32 had high reactions for dual oxidase genes, and those from case #28 had high reactions for REG family genes (Fig. 4d-g). Next, combinations of organoids and CAFs derived from different cases were examined because CAFs consist of numerous cell types and their characteristics vary among lines 26, 27 . Organoids of cases #28 and #32 co-cultured with CAFs from three different cases and corresponding normal mucosa-derived fibroblasts (NFs) exhibited almost identical induction patterns by co-culture with CAFs from each case and corresponding NFs (Fig. 5a and b), suggesting the case-specific ability of CAFs for the induction of REG1A in organoids. Thus, re-expressed genes in CRC organoids by co-culturing with CAFs may depend on the characteristics of each organoid and CAF line. Discussion We established 11 organoids from 45 CRC cases, and simultaneously prepared paired CAFs and normal fibroblasts from several of them. Interactions between cancer cells and CAFs using colon or lung cancer cell line-originated organoids and patient-derived CAFs were previously reported 28, 29 . Other reports suggested that the molecular characteristics of CAFs vary among cases 30, 31 . The newly established CRC model of organoids co-cultured with paired CAFs from the same case in the present study may provide novel insights into cell-cell communication between these cell types. Target sequencing analyses of original tumor tissues revealed that mutation patterns varied among patients, and the most frequently mutated genes were APC, TP53, and KRAS, as previously reported 25 . In addition, most mutations found in the original tumor tissues were conserved in organoids 32 . The mutation rates in CRC organoids were higher than those in CRC tissues, with several exceptions (Table 1). This may be because CRC organoids consist of only epithelial tumor cells, whereas CRC tissues include epithelial tumor cells and stromal cells, which do not have mutations. Indeed, CAFs did not carry the mutations found in corresponding CRC organoids (Supplementary Fig. S2). The fold changes in the mutation ratios (early passage/late passage - up to passage 20) were almost identical (0.84-1.13) (Table 1), as previously reported in ovarian cancer organoids 33 . This suggests that organoids from CRC passaged up to 20 times can be applied as an ex vivo model in basic and translational studies for the evaluation of anti-cancer drugs. Furthermore, cancer stem cells comprising CRC organoids and their proliferative ability were maintained in our culture conditions. Next, to examine whether CRC organoids can reproduce the gene expression of the original tumor tissues, gene expression profiles were compared between the original tumor tissues and established CRC organoids using DNA microarray (Fig. 3). As a result, CRC organoids lacked gene expression from mesenchymal cell populations and blood cells, whereas each CRC organoid had a variable expression profile for intestinal stem cell marker genes, e.g. LGR5 and ORFM4 , as observed in CRC tissues. This suggests that gene expression in CRC organoids is mostly conserved, but they lack cell-cell communication with the tumor microenvironment, including fibroblasts and immune cells. In this study, a co-culture system using the CRC organoids and paired CAFs and/or normal fibroblasts from each case was prepared, and gene expression profiles for both CRC organoids with or without co-culture with CAFs were compared. As a result, we identified 177 genes, including REG family and DUOX family genes, which were markedly upregulated by more than 2-fold by co-culturing with CAFs in all three cases analyzed. Some of these upregulated genes were reported to have oncogenic functions. For example, REG family genes are known to be upregulated in several carcinomas compared with normal tissue 34-37 . REG family genes have cell-proliferative and anti-apoptotic functions 38 . REG3A is also known to act as an extracellular matrix (ECM)-targeted scavenger of reactive oxygen species (ROS) in a dose-dependent manner and to prevent ROS-induced mitochondrial damage due to acetaminophen overdose 39, 40 . ROS is a key regulator for EMT, and is produced by NOX gene family and DUOX family genes 41 . Therefore, REG3A and DUOX2 gene expression is considered to be important for EMT. DUOX family genes also have cell-proliferative functions 41, 42 . Moreover, DUOX2 was reported to have anti-cancer drug resistant activities through EMT 43 . GO term enrichment analysis for the above mentioned 177 upregulated genes revealed that co-culturing of CRC organoids with CAFs induced innate immune responses, suggesting that some oncogenic signal cascades induced by cell-cell interaction between organoids and CAFs were mediated by the signal pathways related to immune responses. Other than immune response- and external stimulus-related genes, CEACAM6, a member of the carcinoembryonic antigen (CEA) family 44 , was also upregulated by more than 2-fold in CRC organoids by co-culturing with CAFs. CEA is normally produced in gastrointestinal tissue during fetal development, but its production stops before birth. Consequently, CEA is usually present at low levels in the blood of healthy adults (approximately 2-4 ng/mL) 45 . However, the serum levels increase in some types of cancer, suggesting its utility as a diagnostic marker and/or a drug efficacy marker in clinical tests. CEACAM6 was highly upregulated in colon cancer tissues and may therefore be a suitable candidate for a diagnostic marker of colorectal cancer 46 . CEACAM6 loss increases mitochondrial basal and maximal respiratory capacity. It also affects several hallmarks of pancreatic ductal adenocarcinoma (PDA), including fibrotic reactions, immune regulation, and energy metabolism, and was recently investigated as a novel therapeutic target in PDA 47 . Thus, there is a subset of genes expressed in CRC tumor cells in the original tissues, but not in the CRC organoids without co-culture with CAFs. These silenced genes in CRC organoids were induced by the co-culture with CAFs (Fig. 4c).The degrees of upregulation of the genes by co-culturing with CAFs varied among the CRC cases. We investigated whether these effects on the gene expression changes depend on the ability of CAFs or their compatibility with CRC organoids. Organoids from two CRC cases exhibited almost identical induction patterns by co-culture with CAFs from three different cases and paired normal mucosa-derived fibroblasts (Fig. 5). Therefore, the degrees of upregulation of several genes, e.g., REG1A, depend on the ability of CAFs from CRC. In addition, it should be noted that normal fibroblasts also induced gene expression, suggesting that some factors, possibly growth factors/cytokines secreted by CRC organoids or miRNA delivered by extracellular vesicles (EVs) secreted from CRC organoids, can induce gene expression to a similar degree as CAFs. To address which factors are essential for the induction of genes in CRC organoids, detailed analyses of the co-culture system of CRC organoids are needed. The upregulated genes mentioned above were related to malignancy of tumor cells, and the malignancy of cancer may partly depend on the characteristics of CAFs and/or original normal fibroblasts. Indeed, cell viability of organoids increased by 1.2 to 1.5-fold compared with corresponding single-culture organoids in three of four cases by co-culturing with CAFs (Fig. 4a); however, those in one case (#28) were not altered. We compared the efficiency of induction of the REG1A gene in organoids by co-culture with CAFs from three cases and it was the lowest by #28 CAFs. In conclusion, 1) gene mutation patterns, fold changes in the mutation allele frequencies, and expression profiles for intestinal stem cell marker genes were nearly similarly maintained in CRC organoids as in the original tumor tissues, suggesting that CRC organoids can be applied as an ex vivo model in basic and translational studies. 2) Expression levels of several genes, which are highly expressed in original CRC tissues, were downregulated in organoids but re-expressed by co-culturing with CAFs. They comprised immune response- and external stimulus-related genes, e.g., REG family and dual oxidases (DUOXs). In addition, gene induction by co-culturing with CAFs varied depending on the CAFs from each CRC case, suggesting that the present co-culture system of CRC organoids with paired CAFs partially reproduces the tumor-microenvironment. Materials And Methods Tissue sampling A total of 45 surgical specimens of colorectal carcinomas (CRCs) and adjacent normal mucosa were obtained between February 2016 and February 2018 at National Cancer Center Hospital. All experimental methods were carried out in accordance with relevant guidelines and regulations. The use of patients’ surgical specimens in this study was approved by the ethics committee of the National Cancer Center, Tokyo, Japan (2015-108), and written informed consent was obtained from all patients. After sampling for pathological evaluation, they were stored on ice, and each sample was dissected into approximately 2-5-mm cubes and used for culture of organoids and fibroblasts. Remaining fragments were simultaneously frozen in liquid nitrogen and stored at −80˚C for isolation of DNA and RNA, or fixed with 10% buffered formalin for preparation of tissue sections for morphological identification of the organoid- and fibroblast-originated tumor tissues. The fragments for RNA isolation were stored in RNA later solution (ThermoFisher Scientific, Tokyo, Japan) at 4°C overnight before storage. Organoid culture The protocol employed for organoid culture was a modified version of those previously reported 48, 49 . The fragments of CRC tissues were washed with cold HBSS(-), minced with scissors, and washed again. These fragments were incubated in Accumax (Innovative Cell Technologies, San Diego, CA, USA) at room temperature or TrypLE Express (ThermoFisher Scientific, Tokyo, Japan) at 37°C for 30 min with shaking. The digested fragments were rinsed with cold HBSS(-), dissociated using a 100-μm cell strainer, and pelleted. Advanced DMEM/F12 (ThermoFisher Scientific) supplemented with 1 x penicillin-streptomycin, 500 ng/ml of Amphotericin B (FUJIFILM Wako, Osaka, Japan), 1 x Zell Shield (Minelva Biolabs GmbH, Berlin, Germany), 10 mM HEPES (ThermoFisher Scientific), 1 x L-glutamine (FUJIFILM Wako), [Leu 15 ]-GastrinI (Sigma-Aldrich, Tokyo, Japan), 1 mM N-acetyl-L-cysteine (FUJIFILM Wako), 1 x B27 supplement (ThermoFisher Scientific), 1% BSA (FUJIFILM Wako), and 10 μM Y27632 (FUJIFILM Wako) was used as the basal culture medium for CRC organoids. The pellet was suspended in the basal culture medium containing the following factors: 50 ng/ml of Recombinant Human EGF (Peprotech, Rocky Hill, NJ, USA), 100 ng/ml of Noggin (Peprotech), and 500 nM A83-01 (FUJIFILM Wako). In a 12-well plate, 65 μl of Matrigel (Corning, Bedford, MA, USA) /well was polymerized for 15 min at 37°C and a 650-μl cell suspension /well x 3 was seeded and incubated in a 37°C humidified CO 2 incubator. After 24 hours, the supernatants were removed and 85 μl/well of Matrigel was overlaid. After Matrigel polymerization, the basal culture media containing different factor combinations [A:250 ng/ml of R-spondin 1 (Peprotech) + 20 ng/ml of Wnt-3a (Peprotech) +25 μM SB202190, B: 25 μM SB202190, and C: none] was used to select the most efficient growth media during several passages. The organoids were dispersed by Accumax and passaged approximately once a week. Zell Shield was not used after several passages. When organoids with more than 10 passages (P10) survived after a freeze and thaw cycle, they were defined as “successfully established”. Fibroblast culture Two to three tissue fragments were washed three times with HBSS(-), placed in a 60-mm dish, and minced with scissors. Then, culture medium, RPMI-1640, containing L-Glutamine (FUJIFILM Wako) and 10% FBS, penicillin-streptomycin was added into the dish and cells were incubated at 37°C in a humidified 5% CO 2 incubator. After they reached 70% confluency, cells were passaged using TrypLE Express dissociation reagent (ThermoFisher Scientific). Co-culture of organoids with fibroblasts using a chamber system Organoids were cultured in the cell culture inserts with a porous membrane and fibroblasts were cultured in the carrier plates (Corning). The pore size of the insert was 1.0 μm to allow the free exchange of media but not cells to migrate through. One day before starting the co-culture, fibroblasts were dissociated into single cells using TrypLE Express and 1 x 10 4 cells were cultured in a 24-well plate with RPMI-1640 containing penicillin-streptomycin, Amphotericin B, and 10% FBS. For organoid culture, cell culture inserts were set on the 24-well companion plate and 20 μl of Matrigel was polymerized on the insert. Organoids were dissociated by Accumax and resuspended in optimized media for organoids described above. The cell suspension (1 x 10 4 cells / 200 μl) was seeded onto the Matrigel and 620 μl of media for organoids was added to the basal compartment. Fibroblasts and organoids were incubated at 37°C in a CO 2 incubator. The next day, apical and basal media were removed from the plate containing organoids attached on the Matrigel, and organoids were covered with 20 μl of Matrigel and polymerized at 37°C for 15 min. The inserts containing organoids were transferred to the fibroblast-containing compartment plate after changing the medium from that for fibroblasts to 820 μl of optimized media for organoids. The co-culture plate was incubated at 37°C in a CO 2 incubator for 96 hours, and organoids and fibroblasts were collected separately for gene expression analysis. Targeted sequencing analysis Genomic DNA from 45 samples of CRC and organoids of cases #11, #21, #25, #28, #32, #33, and #44 were prepared using NucleoSpin Tissue kit (Takara Bio, Kusatsu, Japan) according to the manufacturer’s protocol. Targeted sequencing analyses of those DNAs were performed using the NCC Oncopanel v4 test, which can analyze mutations of 114 genes and amplifications and fusions of 12 genes 50 . Procedures for targeted sequencing and data analysis were previously described 50 . TP53 mutations identified by the NCC Oncopanel test were confirmed by Sanger sequencing. The PCR products including mutations were amplified using specific PCR primers. Primers used for A578G and G589A mutations of #21 and #32, respectively, were forward: 5’-GGAGGTCAAATAAGCAGCAGG-3’ and reverse: 5’-GGCCTCTGATTCCTCACTGA-3’. Primers used for a 45_48TCAG deletion of #28 were forward: 5’-CCCAACCCTTGTCCTTACCA-3’ and reverse: 5’-CAGTCAGATCCTAGCGTCGA-3’. The amplified PCR products were directly sequenced by Sanger sequencing using the following primers. The primer for #21 and #32 was 5’-ACAACCACCCTTAACCCCTC-3’. The primer for #28 was 5’- CCCAACCCTTGTCCTTACCA -3’ Gene expression analysis using DNA microarray Total RNA was extracted from original tumor tissues and established organoids of cases #11, #25, #28, #32, and #44 using NucleoSpin RNA Plus (TaKaRa) according to the manufacturer’s protocol. Total RNA was extracted from three replicates of co-cultured organoids and fibroblasts for #21, #28, and #32 using the RNeasy Micro kit (QIAGEN, Tokyo, Japan). The quality of the RNA samples was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) and highly qualified RNA samples with a RIN score > 7.0 were selected for further DNA microarray analysis. Triplicate samples were used as an RNA cocktail. Cy3-labeled cRNA was hybridized on SurePrint G3 Human GE Microarray GE 8 x 60K Ver.3.0 (Agilent Technologies) according to the manufacturer’s instructions. The Subio Platform, Subio Basic plug-in, and Subio Advanced plug-in (ver 1.24) (Subio, Kagoshima, Japan) were used for data analysis. Quantitative real-time PCR One µg of total RNA for each sample was treated with DNase I (NIPPON GENE, Tokyo, Japan) prior to reverse transcription to cDNA using Multiscribe Reverse Transcriptase with random primers (ThermoFisher Scientific). qRT-PCR was performed with SsoAdvanced Universal SYBR Green Supermix (BIO-RAD, California, USA) using DNA Engine Opticon 2 (MJ Research, Quebec, Canada). Reactions were run in triplicate in three independent experiments. Data were normalized with the housekeeping gene b- ACTIN and were calculated by the 2 -ΔΔCT method 51 . Data were presented as means ± SD (1.0-fold as the control). The primer sequences were as follows: b -ACTIN forward 5’- AAACTGGAACGGTGAAGGTG-3’ and reverse AGAGAAGTGGGGTGGCTTTT3’, ACTA2 forward 5’-CTGTTCCAGCCATCCTTCAT-3’ and reverse 5’-GCTGGAAGGTGGACAGAGAG-3’, REG1A forward 5’ CTGGAATCCTGTGCTTGAGG-3’ and reverse 5’-GGTCTCCTACAAGTCCTGGG-3’, REG3A forward 5’-CCTCTGGAAACCTGGTGTCT3’ and reverse 5’-CCACTCCCAACCTTCTCCAT3’, DUOX2 forward 5’- GAGCCCTTCTTCAACTCCCT-3’ and reverse 5’-GGAGGACAGGCTCAGAAGTT-3’, and DUOXA2 forward 5’-GGTCTCCTACAAGTCCTGGG-3’ and reverse 5’-TTTACAGATCGCCCCAGGAG-3’. Cell viability The viability of organoids was assessed after co-culture with fibroblasts for 96 hours using the chamber system. After aspirating culture medium, 100 μl of fresh culture medium was added. Then, Matrigel including organoids was scraped using a mini cell scraper, 100 μl of CellTiter-Glo 3D reagent was added (Promega, Tokyo, Japan), and organoids were disrupted by pipetting. Suspensions were transferred to 96-well assay plates and incubated at room temperature for 25 min. After incubation, the luminescence was measured using Synergy H1 (BioTek, Tokyo, Japan). Gene Ontology (GO) enrichment analysis To clarify the biological meaning of the key modules, the gene information was loaded into Metascape (http://metascape.org) for Gene Ontology (GO) enrichment analysis 52 . Terms with a P -value 1.5 were collected and grouped into clusters based on their membership similarities (Kappa scores >0.3). Statistical analysis The associations between clinical factors and the establishment of organoids were tested using Fisher’s exact test in EZR 53 . For qRT-PCR and cell viability assay, results were presented as the mean ± s.d. Differences between groups were analyzed by the Student’s- t- test or one-way ANOVA using EZR. P- values of < 0.05 were considered significant. Declarations Acknowledgments We thank the Omics Core and Animal Core Facilities of the National Cancer Center Research Institute for the targeted sequencing analysis and their technical support in histopathological evaluations. The Core Facilities were supported by the National Cancer Center Research and Development Fund (2020-J-002). We are grateful to Ryoichi Masui, Ruri Nakanishi, Naoaki Uchiya, and Yurika Shiotani for their excellent technical assistance. Author contributions M.N. carried out overall experiments, the initial development of the methods for co-culture of organoids with fibroblasts, and drafted the submitted version of this manuscript. M.O. performed several of the initial organoid culturing. S.S. and H.T. collected the surgical specimens and evaluated pathological and clinical information. T.Y., H.I. H.S. and T.K. performed mutation analysis by NCC Oncopanel, and K.M. performed gene expression analysis by DNA microarray. A.O. contributed in developing the overall strategies and concepts. T.I. was responsible for the overall study design, data analysis and manuscript finalization. Funding This study was supported by a Grant for Research on Development of New Drugs and Funding for Research to Expedite Effective Drug Discovery by Government, Academia and Private Partnership (GAPFREE) from the Japan Agency for Medical Research and Development (AMED). References Birgersdotter, A., Sandberg, R. & Ernberg, I. Gene expression perturbation in vitro--a growing case for three-dimensional (3D) culture systems. Semin Cancer Biol 15 , 405-412 (2005). Weaver, V.M. et al. Reversion of the malignant phenotype of human breast cells in three-dimensional culture and in vivo by integrin blocking antibodies. J Cell Biol 137 , 231-245 (1997). DiMasi, J.A. & Grabowski, H.G. Economics of new oncology drug development. J Clin Oncol 25 , 209-216 (2007). Breslin, S. & O'Driscoll, L. Three-dimensional cell culture: the missing link in drug discovery. Drug Discov Today 18 , 240-249 (2013). Hopkins, A.L. Network pharmacology: the next paradigm in drug discovery. Nat Chem Biol 4 , 682-690 (2008). Kola, I. The state of innovation in drug development. Clin Pharmacol Ther 83 , 227-230 (2008). Lancaster, M.A. & Knoblich, J.A. Organogenesis in a dish: modeling development and disease using organoid technologies. Science 345 , 1247125 (2014). Fang, Y. & Eglen, R.M. Three-Dimensional Cell Cultures in Drug Discovery and Development. SLAS Discov 22 , 456-472 (2017). Clevers, H. Modeling Development and Disease with Organoids. Cell 165 , 1586-1597 (2016). Drost, J. & Clevers, H. Organoids in cancer research. Nat Rev Cancer 18 , 407-418 (2018). Xouri, G. & Christian, S. Origin and function of tumor stroma fibroblasts. Semin Cell Dev Biol 21 , 40-46 (2010). LeBleu, V.S. & Kalluri, R. A peek into cancer-associated fibroblasts: origins, functions and translational impact. Dis Model Mech 11 (2018). Kati Räsänen, A.V. Activation of fibroblasts in cancer stroma. Experimental Cell Research 316 , 2713-2722 (2010). Kalluri, R. The biology and function of fibroblasts in cancer. Nat Rev Cancer 16 , 582-598 (2016). Shiga, K. et al. Cancer-Associated Fibroblasts: Their Characteristics and Their Roles in Tumor Growth. Cancers (Basel) 7 , 2443-2458 (2015). Kalluri, R. & Zeisberg, M. Fibroblasts in cancer. Nat Rev Cancer 6 , 392-401 (2006). Tommelein, J. et al. Cancer-associated fibroblasts connect metastasis-promoting communication in colorectal cancer. Front Oncol 5 , 63 (2015). Shan, T. et al. Prometastatic mechanisms of CAF-mediated EMT regulation in pancreatic cancer cells. Int J Oncol 50 , 121-128 (2017). Yu, Y. et al. Cancer-associated fibroblasts induce epithelial-mesenchymal transition of breast cancer cells through paracrine TGF-beta signalling. Br J Cancer 110 , 724-732 (2014). Zhuang, J. et al. TGFbeta1 secreted by cancer-associated fibroblasts induces epithelial-mesenchymal transition of bladder cancer cells through lncRNA-ZEB2NAT. Sci Rep 5 , 11924 (2015). Ohlund, D. et al. Distinct populations of inflammatory fibroblasts and myofibroblasts in pancreatic cancer. J Exp Med 214 , 579-596 (2017). Biffi, G. et al. IL1-Induced JAK/STAT Signaling Is Antagonized by TGFbeta to Shape CAF Heterogeneity in Pancreatic Ductal Adenocarcinoma. Cancer Discov 9 , 282-301 (2019). Adisetiyo, H. et al. Dependence of castration-resistant prostate cancer (CRPC) stem cells on CRPC-associated fibroblasts. J Cell Physiol 229 , 1170-1176 (2014). Ebbing, E.A. et al. Stromal-derived interleukin 6 drives epithelial-to-mesenchymal transition and therapy resistance in esophageal adenocarcinoma. Proc Natl Acad Sci U S A 116 , 2237-2242 (2019). Cancer Genome Atlas, N. Comprehensive molecular characterization of human colon and rectal cancer. Nature 487 , 330-337 (2012). Ohlund, D., Elyada, E. & Tuveson, D. Fibroblast heterogeneity in the cancer wound. J Exp Med 211 , 1503-1523 (2014). Augsten, M. Cancer-associated fibroblasts as another polarized cell type of the tumor microenvironment. Front Oncol 4 , 62 (2014). Dolznig, H. et al. Modeling colon adenocarcinomas in vitro a 3D co-culture system induces cancer-relevant pathways upon tumor cell and stromal fibroblast interaction. Am J Pathol 179 , 487-501 (2011). Nakamura, H. et al. Organoid culture containing cancer cells and stromal cells reveals that podoplanin-positive cancer-associated fibroblasts enhance proliferation of lung cancer cells. Lung Cancer 134 , 100-107 (2019). Herrera, M. et al. Functional heterogeneity of cancer-associated fibroblasts from human colon tumors shows specific prognostic gene expression signature. Clin Cancer Res 19 , 5914-5926 (2013). Chen, X. & Song, E. Turning foes to friends: targeting cancer-associated fibroblasts. Nat Rev Drug Discov 18 , 99-115 (2019). Weeber, F. et al. Preserved genetic diversity in organoids cultured from biopsies of human colorectal cancer metastases. Proc Natl Acad Sci U S A 112 , 13308-13311 (2015). Kopper, O. et al. An organoid platform for ovarian cancer captures intra- and interpatient heterogeneity. Nat Med 25 , 838-849 (2019). Zheng, H.C. et al. Expression profile of the REG gene family in colorectal carcinoma. J Histochem Cytochem 59 , 106-115 (2011). Matsumura, N. et al. Identification of novel molecular markers for detection of gastric cancer cells in the peripheral blood circulation using genome-wide microarray analysis. Exp Ther Med 2 , 705-713 (2011). Nigri, J. et al. PAP/REG3A favors perineural invasion in pancreatic adenocarcinoma and serves as a prognostic marker. Cell Mol Life Sci 74 , 4231-4243 (2017). Sasaki, Y. et al. REG1A expression is an independent factor predictive of poor prognosis in patients with breast cancer. Ann Surg Oncol 15 , 3244-3251 (2008). Chen, Z., Downing, S. & Tzanakakis, E.S. Four Decades After the Discovery of Regenerating Islet-Derived (Reg) Proteins: Current Understanding and Challenges. Front Cell Dev Biol 7 , 235 (2019). Moniaux, N. et al. Human hepatocarcinoma-intestine-pancreas/pancreatitis-associated protein cures fas-induced acute liver failure in mice by attenuating free-radical damage in injured livers. Hepatology 53 , 618-627 (2011). Lieu, H.T. et al. HIP/PAP accelerates liver regeneration and protects against acetaminophen injury in mice. Hepatology 42 , 618-626 (2005). Lin, S.C. et al. High Immunoreactivity of DUOX2 Is Associated With Poor Response to Preoperative Chemoradiation Therapy and Worse Prognosis in Rectal Cancers. J Cancer 8 , 2756-2764 (2017). Wang, J. et al. PKCalpha promotes generation of reactive oxygen species via DUOX2 in hepatocellular carcinoma. Biochem Biophys Res Commun 463 , 839-845 (2015). Kang, K.A. et al. DUOX2-mediated production of reactive oxygen species induces epithelial mesenchymal transition in 5-fluorouracil resistant human colon cancer cells. Redox Biol 17 , 224-235 (2018). Rizeq, B., Zakaria, Z. & Ouhtit, A. Towards understanding the mechanisms of actions of carcinoembryonic antigen-related cell adhesion molecule 6 in cancer progression. Cancer Sci 109 , 33-42 (2018). Ballesta, A.M., Molina, R., Filella, X., Jo, J. & Gimenez, N. Carcinoembryonic antigen in staging and follow-up of patients with solid tumors. Tumour Biol 16 , 32-41 (1995). Kim, K.S. et al. Overexpression and clinical significance of carcinoembryonic antigen-related cell adhesion molecule 6 in colorectal cancer. Clin Chim Acta 415 , 12-19 (2013). Pandey, R. et al. Carcinoembryonic antigen cell adhesion molecule 6 (CEACAM6) in Pancreatic Ductal Adenocarcinoma (PDA): An integrative analysis of a novel therapeutic target. Sci Rep 9 , 18347 (2019). Fujii, M., Matano, M., Nanki, K. & Sato, T. Efficient genetic engineering of human intestinal organoids using electroporation. Nat Protoc 10 , 1474-1485 (2015). Fujii, M. et al. A Colorectal Tumor Organoid Library Demonstrates Progressive Loss of Niche Factor Requirements during Tumorigenesis. Cell Stem Cell 18 , 827-838 (2016). Sunami, K. et al. Feasibility and utility of a panel testing for 114 cancer-associated genes in a clinical setting: A hospital-based study. Cancer Sci 110 , 1480-1490 (2019). Livak, K.J. & Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25 , 402-408 (2001). Zhou, Y. et al. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat Commun 10 , 1523 (2019). Kanda, Y. Investigation of the freely available easy-to-use software 'EZR' for medical statistics. Bone Marrow Transplant 48 , 452-458 (2013). Tables Due to technical limitations, table 1 is only available as a download in the Supplemental Files section. Supplementary Files Table1.pdf Supplementv5.pdf Cite Share Download PDF Status: Published Journal Publication published 22 Jan, 2021 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Major revision 11 Dec, 2020 Reviews received at journal 06 Dec, 2020 Reviewers agreed at journal 01 Dec, 2020 Reviewers invited by journal 25 Nov, 2020 Editor assigned by journal 19 Nov, 2020 Editor invited by journal 13 Nov, 2020 Submission checks completed at journal 13 Nov, 2020 First submitted to journal 12 Nov, 2020 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-107047","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":4749993,"identity":"ca662d47-5c74-49c0-8559-f60b6e4c72d5","order_by":0,"name":"Mie Naruse","email":"","orcid":"","institution":"National Cancer Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mie","middleName":"","lastName":"Naruse","suffix":""},{"id":4749994,"identity":"718a979c-84e8-4647-8caa-165a1f3b9594","order_by":1,"name":"Masako Ochiai","email":"","orcid":"","institution":"National Cancer Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Masako","middleName":"","lastName":"Ochiai","suffix":""},{"id":4749995,"identity":"97e98bab-4e6b-4aa5-b261-53fa7925fe73","order_by":2,"name":"Shigeki Sekine","email":"","orcid":"","institution":"National Cancer Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shigeki","middleName":"","lastName":"Sekine","suffix":""},{"id":4749996,"identity":"61e80c99-51d9-41ba-aec0-c29c0d2b8363","order_by":3,"name":"Hirokazu Taniguchi","email":"","orcid":"","institution":"National Cancer Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hirokazu","middleName":"","lastName":"Taniguchi","suffix":""},{"id":4749997,"identity":"2045d0ed-e639-4c19-aa09-75085ec247c1","order_by":4,"name":"Teruhiko Yoshida","email":"","orcid":"","institution":"National Cancer Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Teruhiko","middleName":"","lastName":"Yoshida","suffix":""},{"id":4749998,"identity":"f558e78c-2443-4520-9081-bbd17c1d8ab6","order_by":5,"name":"Hitoshi Ichikawa","email":"","orcid":"","institution":"National Cancer Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hitoshi","middleName":"","lastName":"Ichikawa","suffix":""},{"id":4749999,"identity":"e1dfd7d4-c7b5-46df-876c-7684cdcb19ac","order_by":6,"name":"Hiromi Sakamoto","email":"","orcid":"","institution":"National Cancer Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hiromi","middleName":"","lastName":"Sakamoto","suffix":""},{"id":4750003,"identity":"ba3f18ba-100b-4e59-a7fe-c22f0366926d","order_by":7,"name":"Takashi Kubo","email":"","orcid":"","institution":"National Cancer Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Takashi","middleName":"","lastName":"Kubo","suffix":""},{"id":4750004,"identity":"7c542b37-5c83-4caf-a0ef-9b4ebd814619","order_by":8,"name":"Kenji Matsumoto","email":"","orcid":"","institution":"National Research Institute for Child Health and Development","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kenji","middleName":"","lastName":"Matsumoto","suffix":""},{"id":4750006,"identity":"eceed531-89c6-45f3-b24a-ed96bbf71529","order_by":9,"name":"Atsushi Ochiai","email":"","orcid":"","institution":"National Cancer Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Atsushi","middleName":"","lastName":"Ochiai","suffix":""},{"id":4750007,"identity":"ef5feb12-b9fa-48bf-8d42-d5324b391b23","order_by":10,"name":"Toshio Imai","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuUlEQVRIiWNgGAWjYFACxgYGBgMbGI+NsAYeiJY0krSAwWESnGXP3ty64UfB+Tz+9gPMLz4w8OURtoXnYNvNHoPbxRJnEtgsZzCwFRPWIpHYdoPH4HbiBgkGNmMeBrbEBmK03PxjcI5ELbd5DA6AtDA/Jk7LmYNtt2UMkhNnnElsY5xhQIRf2Nvbn91888cusb/98OEPHyqOEQ4xJMDYJsFgcCyBFC0MzB8YGGpI0zIKRsEoGAUjAgAAOhM6VqPFze4AAAAASUVORK5CYII=","orcid":"","institution":"National Cancer Centre","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Toshio","middleName":"","lastName":"Imai","suffix":""}],"badges":[],"createdAt":"2020-11-12 14:13:52","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-107047/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-107047/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-021-81475-2","type":"published","date":"2021-01-22T19:02:06+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":3794509,"identity":"1de4e886-7569-4521-9ea1-e00f0cdbd740","added_by":"auto","created_at":"2020-11-24 15:17:43","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":88548,"visible":true,"origin":"","legend":"Morphological and gene expression features of CRC organoids and CAFs\n(a-c) Bright-field microscopy images of CRC organoids. Scale bar, 50 μm. (d-f) Representative H\u0026E micrographs of CRC organoids. Scale bar, 50 μm. (g-i) Bright-field microscopy images of fibroblasts established from CRC. Scale bar, 100 μm. (j) Increased expression levels of ACTA2 in CAFs are shown by comparing with NFs. Blue and red bars represent the relative expression level of ACTA2 in CAFs and NFs, respectively. *: p\u003c0.05, **: p \u003c0.01","description":"","filename":"Fig1.JPG","url":"https://assets-eu.researchsquare.com/files/rs-107047/v1/5c78828668b8852fa994d730.JPG"},{"id":3794511,"identity":"298886d4-b147-464f-a194-96b9516611da","added_by":"auto","created_at":"2020-11-24 15:17:44","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1487338,"visible":true,"origin":"","legend":"Comparison chart of gene mutations in 45 CRC samples\nMutations of 114 cancer-related genes were analyzed using NCC Oncopanel test. The left graph shows the mutation frequency of each gene in the present 45 samples (pink) and the TCGA data set (green). Most frequently mutated gene was APC followed by TP53 and KRAS.\nLight blue; nonsynonymous SNV, blue; frameshift deletion, purple; nonframeshift deletion, red; synonymous SNV, orange; stopgain SNV, green; splicing, yellow; frameshift insertion.","description":"","filename":"Fig2.JPG","url":"https://assets-eu.researchsquare.com/files/rs-107047/v1/f8ac788e581896b11eb3eaa9.JPG"},{"id":3794512,"identity":"ed66150c-2546-4cf7-a50b-a355be628ac5","added_by":"auto","created_at":"2020-11-24 15:17:44","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":905918,"visible":true,"origin":"","legend":"Comparative gene expression profile between original tumor tissues and organoids.\nPCA score plot displaying the distinct dissimilarities between the primary tumors and organoids from cases #11, #21, #25, #28, #32, and #44 (a). The PCA scores for components 1 and 2 were determined from the entire spectra. (b) In total, 586 probes with a gene expression profile similar to that with high expression only in tumor tissues in PC1 were extracted (Pearson’s correlation between 0.95 and 1). Tree clustering of these genes is shown. The clustering separated each sample type. (c) Gene Ontology analysis and significantly enriched GO terms of 586 probes whose expression in organoids was lower than that in the original tumors. (d) Expression profiles of intestinal stem cell marker genes. Line graphs using normalized microarray data show expression levels of LGR5, OLFM4, LEFTY, and ASCL2.","description":"","filename":"Fig3.JPG","url":"https://assets-eu.researchsquare.com/files/rs-107047/v1/e73b5e4f18965489046da887.JPG"},{"id":3794513,"identity":"d72f8f6a-0835-424c-af50-64ab4a3b8861","added_by":"auto","created_at":"2020-11-24 15:17:44","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":667350,"visible":true,"origin":"","legend":"Comparison of cell viability and gene expression profile between organoids with or without co-culture with CAFs\nCell viability of single-culture and co-cultured organoids at Day 6. (b) Volcano plot of gene expression levels comparing those in single-culture organoids and those in organoids co-cultured with CAFs (n=3). The y-axis shows the P-value for the differences in gene expression levels between organoids with and without co-culture with CAFs by a negative logarithm. The x-axis is the log2 difference in the estimated relative gene expression values. Vertical red lines represent the threshold of the log 2-fold change (equivalent to a 2-fold change). Thus, the dots in the beige-colored region correspond to genes that show a significant (p\u003c= 0.05) 2-fold or greater change in gene expression between single-culture organoids and organoids co-cultured with CAFs. (c) Gene expression profile of CAF-induced genes with 10-fold upregulation, including REG family genes and DUOX gene families, were extracted from microarray data for CRC tissues and single-culture organoids. Relative quantification of two CAF-induced gene candidates, REG1A (d), REG3A (e) DUOX2 (f), and DUOXA2 (g) measured by qRT-PCR. The expression levels of each genes were calculated by comparing with beta-ACTIN. Blue bars represent gene expression levels in organoids without CAFs. Red bars represent gene expression levels in organoids co-cultured with CAFs. **: p\u003c0.01","description":"","filename":"Fig4.JPG","url":"https://assets-eu.researchsquare.com/files/rs-107047/v1/597eeb85ef8f26cea0ccc966.JPG"},{"id":3794514,"identity":"ff828c95-b602-4941-ac00-39958911ec74","added_by":"auto","created_at":"2020-11-24 15:17:44","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":69097,"visible":true,"origin":"","legend":"Induction of REG1A in organoids by co-culture with CAFs from three different cases and normal fibroblasts from one case \nqRT-PCR for REG1A gene in organoids co-cultured with CAFs from three different cases and normal mucosa-derived fibroblasts was performed using #28 (a) and #32 organoids (b). Relative gene expression levels are shown with the expression level of single-culture organoids set to 1. *: p \u003c0.05, **: p \u003c0.01","description":"","filename":"Fig5.JPG","url":"https://assets-eu.researchsquare.com/files/rs-107047/v1/e3f6794a2c65b6ef9ef3ef58.JPG"},{"id":13620221,"identity":"ff21574c-8d60-4e1a-87d7-848c549e53e6","added_by":"auto","created_at":"2021-09-17 07:04:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":945224,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-107047/v1/8143353e-e3a7-4c5e-9058-a6ad9814c5a0.pdf"},{"id":3794508,"identity":"08ce7f71-41d8-43bb-9c83-a5de2c1435fd","added_by":"auto","created_at":"2020-11-24 15:17:43","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":55547,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-107047/v1/68074cf0daf7fbe7e059194a.pdf"},{"id":3794510,"identity":"44bd9460-682c-4479-90eb-ea356e0ef920","added_by":"auto","created_at":"2020-11-24 15:17:44","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":890653,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementv5.pdf","url":"https://assets-eu.researchsquare.com/files/rs-107047/v1/c4e0c21fd03c82744ac41f39.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eDownregulation of Immune Response- and External Stimulus-Related Genes in CRC Organoids, and Their Re-Expression by Co-Culturing with CAFs\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eTwo-dimensional (2D) cancer cell lines that can be easily and reproducibly maintained \u003cem\u003ein vitro\u003c/em\u003e have been mainly used for cancer studies targeting the clarification of molecular mechanisms of carcinogenesis or evaluation of anticancer drugs. As most cancer cell lines were cultured under over-nourished conditions, differing from the\u003cem\u003e in vivo\u003c/em\u003e environment, and repeated passages, the characteristics of original tumor tissues, such as expression of stem cell markers and differentiation marker genes, and proliferation, invasion, and drug metabolic abilities are altered in cancer cell lines \u003csup\u003e1-3\u003c/sup\u003e. The low probability of success of clinical trials is partly due to the use of cancer cell lines in preclinical evaluations of drug candidates \u003csup\u003e3-6\u003c/sup\u003e. To promote efficient drug discovery, organoid culture systems have been utilized recently \u003csup\u003e7, 8\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eAn organoid is a miniaturized and simplified organ produced \u003cem\u003ein vitro\u003c/em\u003e using 3D culture systems that resembles a realistic micro-organ. They are derived from one or a few cells from a tissue, and demonstrate natural cell-cell communication and undergo self-organization in 3D culture \u003csup\u003e9, 10\u003c/sup\u003e. As an \u003cem\u003eex vivo\u003c/em\u003e model, cancer tissue-derived organoids are considered suitable to analyze direct reactivities of carcinoma cells to growth factors/cytokines, miRNAs, or synthetic compounds; however, stroma cells, including fibroblasts, immune cells, and vascular cells, which interact with carcinoma cells in original cancer tissues, are absent in organoid systems. The interactions between cancer cells and cancer associated fibroblasts (CAFs) vary and are considered to be important for carcinogenesis \u003csup\u003e11-17\u003c/sup\u003e. Moreover, the epithelial mesenchymal transition (EMT), which enables tumor cells to acquire resistance to anti-cancer drugs, was reported to be facilitated by the presence of CAFs \u003csup\u003e18-20\u003c/sup\u003e. To date, there have been limited investigations using co-culture systems of 3D-cultured cancer cells with CAFs on several types of cancers, e.g., pancreatic ductal adenocarcinomas \u003csup\u003e21, 22\u003c/sup\u003e, prostate adenocarcinomas \u003csup\u003e23\u003c/sup\u003e, and esophageal carcinomas \u003csup\u003e24\u003c/sup\u003e, and interactions between cancer cells and CAFs were demonstrated to affect cancer aggressiveness and resistance to anti-cancer drugs.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The purpose of the present study was to clarify if the co-culture system of CRC organoids with CAFs reproduces the microenvironment between tumor cells and CAFs observed in the original cancer tissues. First, comprehensive gene expression analyses between original tumor tissues and organoids were performed to characterize the features of the organoid culture system. Second, to identify gene expression changes in organoids induced by co-culturing with CAFs, paired CAFs from each case were established, and gene expression profiles between organoids with or without associated CAFs were compared. The present comparative screening of gene expression profiles of clinical tissue-derived CRC organoids with or without corresponding patient tissue-derived CAFs is highly important because the major molecules involved in interactions between tumor cells and CAFs have not been comprehensively evaluated in natural cell-cell communication-constructed and self-organizing \u003cem\u003ein vitro\u003c/em\u003e systems.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eBaseline characteristics of CRC\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBasic patient and pathological data in the 45 CRC cases used for establishment of organoids and fibroblasts are summarized in Supplementary Table S1. Of the 45 cancer patients, 60% were males and 40% were females. This male per female ratio is comparable with Japanese Cancer Statistics (Cancer Registry and Statistics. Cancer Information Service, National Cancer Center, Japan (Monitoring of Cancer Incidence in Japan (MCIJ)). Average ages were 62 years old, ranging from 36 years old to 88 years old. The proportions of stage I, stage II, stage III, and stage IV cancers were 7%, 47%, 31%, and 15%, respectively, and 85% were found in the left colon (D, S, Rs, Ra, and Rb) and 15% in the right colon (T, A, and C). The detailed baseline characteristics of donor patients are summarized in Supplementary Table S1 and Supplementary Fig. S1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEstablishment of organoids and fibroblasts\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOrganoids from 11/45 (#1, #11, #13, #16, #18, #21, #25, #28, #32, #33, and #44) cases were established. All CRC organoids had globular and/or irregularly elongated crypts with monolayered or partially multilayered structures. These features of organoids resembled those of CRC tumor tissues in cases #21, #28, and #32 (Fig. 1a-f). CRC-derived cancer associated fibroblasts (CAFs) (Fig. 1g-i) and normal mucosa-derived fibroblasts (NFs) were isolated from cancer tissues and adjacent normal tissues, respectively. The success rate of the presently established organoids was 24.4% (11/45), that of CAFs was 77.1% (27/35), and that of NFs was 88.6% (31/35). CAFs were established from cases obtained during the period from September 2016 to February 2018. The success rate of CRC-derived organoids did not correlate with the basic patient or pathological information, e.g., the sex, age of patient, or pathological stage of cancer (Supplementary Table S2). The characteristic difference between CAFs and NFs was the high expression levels of actin alpha 2, smooth muscle (\u003cem\u003eACTA2\u003c/em\u003e), a marker for CAFs, in cases #28 and #32 (Fig. 1j). In case #21, NFs were not available; however, the expression level of \u003cem\u003eACTA2\u003c/em\u003e in CAFs was comparable with that in CAFs from #28 and #32.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMutation analysis by NCC Oncopanel\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMutations in original CRC tissues and established organoids were analyzed by targeted sequencing using the NCC Oncopanel test. The prevalence rates of \u003cem\u003eAPC, TP53, and KRAS\u003c/em\u003e mutations in original tissues were 91.1%, 80.0%, and 35.6%, respectively (Fig. 2).\u0026nbsp;The frequently mutated genes including \u003cem\u003eAPC\u003c/em\u003e, \u003cem\u003eTP53\u003c/em\u003e, and \u003cem\u003eKRAS\u003c/em\u003e were highly consistent between our cohort and TCGA (The Cancer Genome Atlas) database \u003csup\u003e25\u003c/sup\u003e. Most of the mutations found in the CRC tissues were maintained in their organoids with higher mutation allele frequencies. However, there are some exceptions, suggesting a reflection of intratumor heterogeneity. Loss of the minor mutations in organoids was considered to partly be attributed to clonal evolution of cancer cells during the organoid culture (Table 1).\u003c/p\u003e\n\u003cp\u003eThen, we performed Sanger sequencing to confirm that the established fibroblasts did not harbor the mutations found in cancer tissues. The \u003cem\u003eTP53 \u003c/em\u003emutations of the cases #21, #28, and #32 were detected in their organoids but not in their fibroblasts (Supplementary Fig. S2). Other mutations such as those of \u003cem\u003eDDR2\u003c/em\u003e in #21, \u003cem\u003eESR1\u003c/em\u003e in #28, and\u003cem\u003e APC\u003c/em\u003e in #32, were also not detected in the corresponding fibroblasts (data not shown).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGene expression analysis by DNA microarray\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGene expression analyses by DNA microarray were carried out using original CRC specimens and organoids. Data sets for original tumor tissues and organoids from 5 cases were successfully adjusted and validated for principal components analysis (PCA). The PC1-axis demonstrated a different spatial distribution between the original tumors and organoids. The two groups had significant differences in gene expression distribution, indicating two transcriptionally distant populations (Fig. 3a). There were two typical gene expression profiles of PC1 genes: One was the gene groups highly expressed in organoids and the other was gene groups whose expression in organoids was lower than that in the original tumors. In total, 586 probes exhibited a similar gene expression profile with the latter group of PC1 genes (Pearson\u0026rsquo;s correlation between 0.95 and 1). Based on Gene Ontology (GO) term analysis, the genes with lower expression in organoids than in the original tumors were enriched for GO terms \u0026ldquo;extracellular matrix organization\u0026rdquo;, \u0026ldquo;blood vessel development\u0026rdquo;, and \u0026ldquo;lymphocyte activation\u0026rdquo; (Fig. 3c). This reflected the lack of fibrous, vascular, and immune cell populations in organoids, whereas the original tumors consist of both epithelial cells and stromal cells. On the other hand, expression profiles of intestinal epithelial-stemness-related genes demonstrated that the organoids maintained the characteristics of the original CRC tissues (Fig. 3d). It is also possible that there was a subset of genes induced via cell-cell communication with other cell types, including CAFs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell proliferation abilities of CRC organoids were stimulated by co-culturing with paired CAFs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cell proliferation ability significantly varied among CRC organoid lines (Fig. 4a). CAFs were also established from the same CRC specimens in some cases. To address the effects of cell-cell interaction between CRC organoids and corresponding CAFs, we developed a novel co-culture method using a chamber system. By co-culturing organoids with CAFs, cell viability of organoids increased by 1.2 to 1.5-fold compared with corresponding single-culture organoids in three out of four cases (Fig. 4a). This suggested that the tumor microenvironment constructed by cell-cell communication between tumor cells and CAFs plays a role in the cell proliferative/anti-apoptotic abilities of tumor cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIdentification of upregulated genes by co-culturing with CAFs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo identify genes whose expression levels were different between organoids co-cultured with and without CAFs, we performed DNA microarray analysis. Volcano plot analysis demonstrated that the expression levels of 73 genes with 87 probes in organoids were reduced to less than half, whereas those of 177 genes with 238 probes were increased by more than double by co-culturing with CAFs (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; Fig. 4b, Supplementary Tables S3 and S4). These upregulated genes included\u003cem\u003e REG1A, REG1B, REG3A, REG3G, DMBT1, DUOXA2, DUOX2, SOCS3,\u003c/em\u003e and \u003cem\u003eLOC340340,\u003c/em\u003e with more than 10-fold upregulation. Hierarchical clustering analysis confirmed that these CAF-induced genes were expressed at higher levels also in the original CRC tissues but not in single-culture organoids (Fig. 4c). To validate the microarray data obtained from the co-culture of CRC organoids and CAFs, two candidates for CAF-induced gene groups, \u003cem\u003eREG1A, REG3A, DUOX2\u003c/em\u003e, and \u003cem\u003eDUOX2A,\u003c/em\u003e were quantified by quantitative RT-PCR (Fig. 4d-g). The levels of \u003cem\u003eREG1A\u003c/em\u003e increased by more than 121 (#21), 480 (#28), and 21-fold (#32) when co-cultured with CAFs. The levels of \u003cem\u003eREG3A\u003c/em\u003e increased by more than 26 (#21), 55 (#28), and 11-fold (#32). The levels of \u003cem\u003eDUOX2 \u003c/em\u003eincreased by more than 29 (#21), 3 (#28), and 33-fold (#32). The levels of \u003cem\u003eDUOXA2\u003c/em\u003e increased by more than 10 (#21), 3 (#28), and 15-fold (#32). This analysis confirmed that the microarray data is reliable, and the degree of induction of each REG family and dual oxidase gene by CAFs varied among cases.\u003c/p\u003e\n\u003cp\u003eOther than \u003cem\u003eREG\u003c/em\u003e family and dual oxidase genes, microarray analysis suggested that expression of \u003cem\u003eCEACAM6\u003c/em\u003e and \u003cem\u003eCEACAM7\u003c/em\u003e, members of the carcinoembryonic antigen-related cell adhesion molecule family, and MUC1, which inhibits the anti-tumor immune response, was upregulated by more than 2-fold (Supplementary Table S3).Although many cancer-related genes were induced by the co-culture with CAFs, the degree of their induction by CAFs varied among cases.\u003c/p\u003e\n\u003cp\u003eGO term enrichment analysis for upregulated genes in organoids by co-culturing with CAFs revealed that innate immune response, including \u0026ldquo;cell wall disruption in other organisms\u0026rdquo;, \u0026ldquo;response to bacterium\u0026rdquo;, \u0026ldquo;complement and coagulation cascades\u0026rdquo;, and \u0026ldquo;interferon-gamma-mediated signaling pathway\u0026rdquo;, were significantly enriched (Supplementary Fig. S3a). These induced pathways by CAFs were abundantly expressed in CRC tissues but downregulated in single-culture CRC organoids (Supplementary Fig. S3b).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCAFs derived from different cases exhibit case-specific ability for \u003cem\u003eREG1A\u003c/em\u003e induction in organoids\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOrganoids derived from different cases exhibited varying degrees of induction of REG family and dual oxidase genes by co-culturing with paired CAFs, e.g., organoids from cases #21 and 32 had high reactions for dual oxidase genes, and those from case #28 had high reactions for REG family genes (Fig. 4d-g). Next, combinations of organoids and CAFs derived from different cases were examined because CAFs consist of numerous cell types and their characteristics vary among lines \u003csup\u003e26, 27\u003c/sup\u003e. Organoids of cases #28 and #32 co-cultured with CAFs from three different cases and corresponding normal mucosa-derived fibroblasts (NFs) exhibited almost identical induction patterns by co-culture with CAFs from each case and corresponding NFs (Fig. 5a and b), suggesting the case-specific ability of CAFs for the induction of\u003cem\u003e REG1A\u003c/em\u003e in organoids. Thus, re-expressed genes in CRC organoids by co-culturing with CAFs may depend on the characteristics of each organoid and CAF line.\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eWe established 11 organoids from 45 CRC cases, and simultaneously prepared paired CAFs and normal fibroblasts from several of them. Interactions between cancer cells and CAFs using colon or lung cancer cell line-originated organoids and patient-derived CAFs were previously reported \u003csup\u003e28, 29\u003c/sup\u003e. Other reports suggested that the molecular characteristics of CAFs vary among cases \u003csup\u003e30, 31\u003c/sup\u003e. The newly established CRC model of organoids co-cultured with paired CAFs from the same case in the present study may provide novel insights into cell-cell communication between these cell types.\u003c/p\u003e\n\u003cp\u003eTarget sequencing analyses of original tumor tissues revealed that mutation patterns varied among patients, and the most frequently mutated genes were \u003cem\u003eAPC, TP53, \u003c/em\u003eand\u003cem\u003e KRAS,\u003c/em\u003e as previously reported \u003csup\u003e25\u003c/sup\u003e. In addition, most mutations found in the original tumor tissues were conserved in organoids \u003csup\u003e32\u003c/sup\u003e. The mutation rates in CRC organoids were higher than those in CRC tissues, with several exceptions (Table 1). This may be because CRC organoids consist of only epithelial tumor cells, whereas CRC tissues include epithelial tumor cells and stromal cells, which do not have mutations. Indeed, CAFs did not carry the mutations found in corresponding CRC organoids (Supplementary Fig. S2). The fold changes in the mutation ratios (early passage/late passage - up to passage 20) were almost identical (0.84-1.13) (Table 1), as previously reported in ovarian cancer organoids \u003csup\u003e33\u003c/sup\u003e. This suggests that organoids from CRC passaged up to 20 times can be applied as an \u003cem\u003eex vivo\u003c/em\u003e model in basic and translational studies for the evaluation of anti-cancer drugs. Furthermore, cancer stem cells comprising CRC organoids and their proliferative ability were maintained in our culture conditions.\u003c/p\u003e\n\u003cp\u003eNext, to examine whether CRC organoids can reproduce the gene expression of the original tumor tissues, gene expression profiles were compared between the original tumor tissues and established CRC organoids using DNA microarray (Fig. 3). As a result, CRC organoids lacked gene expression from mesenchymal cell populations and blood cells, whereas each CRC organoid had a variable expression profile for intestinal stem cell marker genes, e.g. \u003cem\u003eLGR5 \u003c/em\u003eand\u003cem\u003e ORFM4\u003c/em\u003e, as observed in CRC tissues. This suggests that gene expression in CRC organoids is mostly conserved, but they lack cell-cell communication with the tumor microenvironment, including fibroblasts and immune cells.\u003c/p\u003e\n\u003cp\u003eIn this study, a co-culture system using the CRC organoids and paired CAFs and/or normal fibroblasts from each case was prepared, and gene expression profiles for both CRC organoids with or without co-culture with CAFs were compared. As a result, we identified 177 genes, including REG family and DUOX family genes, which were markedly upregulated by more than 2-fold by co-culturing with CAFs in all three cases analyzed. Some of these upregulated genes were reported to have oncogenic functions. For example, REG family genes are known to be upregulated in several carcinomas compared with normal tissue \u003csup\u003e34-37\u003c/sup\u003e. REG family genes have cell-proliferative and anti-apoptotic functions \u003csup\u003e38\u003c/sup\u003e. REG3A is also known to act as an extracellular matrix (ECM)-targeted scavenger of reactive oxygen species (ROS) in a dose-dependent manner and to prevent ROS-induced mitochondrial damage due to acetaminophen overdose \u003csup\u003e39, 40\u003c/sup\u003e. ROS is a key regulator for EMT, and is produced by NOX gene family and DUOX family genes \u003csup\u003e41\u003c/sup\u003e. Therefore, REG3A and DUOX2 gene expression is considered to be important for EMT. DUOX family genes also have cell-proliferative functions \u003csup\u003e41, 42\u003c/sup\u003e. Moreover, DUOX2 was reported to have anti-cancer drug resistant activities through EMT \u003csup\u003e43\u003c/sup\u003e. GO term enrichment analysis for the above mentioned 177 upregulated genes revealed that co-culturing of CRC organoids with CAFs induced innate immune responses, suggesting that some oncogenic signal cascades induced by cell-cell interaction between organoids and CAFs were mediated by the signal pathways related to immune responses.\u003c/p\u003e\n\u003cp\u003eOther than immune response- and external stimulus-related genes, CEACAM6, a member of the carcinoembryonic antigen (CEA) family \u003csup\u003e44\u003c/sup\u003e, was also upregulated by more than 2-fold in CRC organoids by co-culturing with CAFs. CEA is normally produced in gastrointestinal tissue during fetal development, but its production stops before birth. Consequently, CEA is usually present at low levels in the blood of healthy adults (approximately 2-4 ng/mL) \u003csup\u003e45\u003c/sup\u003e. However, the serum levels increase in some types of cancer, suggesting its utility as a diagnostic marker and/or a drug efficacy marker in clinical tests. CEACAM6 was highly upregulated in colon cancer tissues and may therefore be a suitable candidate for a diagnostic marker of colorectal cancer \u003csup\u003e46\u003c/sup\u003e. CEACAM6 loss increases mitochondrial basal and maximal respiratory capacity. It also affects several hallmarks of pancreatic ductal adenocarcinoma (PDA), including fibrotic reactions, immune regulation, and energy metabolism, and was recently investigated as a novel therapeutic target in PDA \u003csup\u003e47\u003c/sup\u003e. Thus, there is a subset of genes expressed in CRC tumor cells in the original tissues, but not in the CRC organoids without co-culture with CAFs. These silenced genes in CRC organoids were induced by the co-culture with CAFs (Fig. 4c).The degrees of upregulation of the genes by co-culturing with CAFs varied among the CRC cases. We investigated whether these effects on the gene expression changes depend on the ability of CAFs or their compatibility with CRC organoids. Organoids from two CRC cases exhibited almost identical induction patterns by co-culture with CAFs from three different cases and paired normal mucosa-derived fibroblasts (Fig. 5). Therefore, the degrees of upregulation of several genes, e.g., \u003cem\u003eREG1A,\u003c/em\u003e depend on the ability of CAFs from CRC. In addition, it should be noted that normal fibroblasts also induced gene expression, suggesting that some factors, possibly growth factors/cytokines secreted by CRC organoids or miRNA delivered by extracellular vesicles (EVs) secreted from CRC organoids, can induce gene expression to a similar degree as CAFs. To address which factors are essential for the induction of genes in CRC organoids, detailed analyses of the co-culture system of CRC organoids are needed. The upregulated genes mentioned above were related to malignancy of tumor cells, and the malignancy of cancer may partly depend on the characteristics of CAFs and/or original normal fibroblasts. Indeed, cell viability of organoids increased by 1.2 to 1.5-fold compared with corresponding single-culture organoids in three of four cases by co-culturing with CAFs (Fig. 4a); however, those in one case (#28) were not altered. We compared the efficiency of induction of the \u003cem\u003eREG1A\u003c/em\u003e gene in organoids by co-culture with CAFs from three cases and it was the lowest by #28 CAFs. In conclusion, 1) gene mutation patterns, fold changes in the mutation allele frequencies, and expression profiles for intestinal stem cell marker genes were nearly similarly maintained in CRC organoids as in the original tumor tissues, suggesting that CRC organoids can be applied as an \u003cem\u003eex vivo\u003c/em\u003e model in basic and translational studies. 2) Expression levels of several genes, which are highly expressed in original CRC tissues, were downregulated in organoids but re-expressed by co-culturing with CAFs. They comprised immune response- and external stimulus-related genes, e.g., REG family and dual oxidases (DUOXs). In addition, gene induction by co-culturing with CAFs varied depending on the CAFs from each CRC case, suggesting that the present co-culture system of CRC organoids with paired CAFs partially reproduces the tumor-microenvironment.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eTissue sampling\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 45 surgical specimens of colorectal carcinomas (CRCs) and adjacent normal mucosa were obtained between February 2016 and February 2018 at National Cancer Center Hospital. All experimental methods were carried out in accordance with relevant guidelines and regulations. The use of patients\u0026rsquo; surgical specimens in this study was approved by the ethics committee of the National Cancer Center, Tokyo, Japan (2015-108), and written informed consent was obtained from all patients. After sampling for pathological evaluation, they were stored on ice, and each sample was dissected into approximately 2-5-mm cubes and used for culture of organoids and fibroblasts. Remaining fragments were simultaneously frozen in liquid nitrogen and stored at \u0026minus;80˚C for isolation of DNA and RNA, or fixed with 10% buffered formalin for preparation of tissue sections for morphological identification of the organoid- and fibroblast-originated tumor tissues. The fragments for RNA isolation were stored in RNA\u003cem\u003elater \u003c/em\u003esolution (ThermoFisher Scientific, Tokyo, Japan) at 4\u0026deg;C overnight before storage.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOrganoid culture \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe protocol employed for organoid culture was a modified version of those previously reported \u003csup\u003e48, 49\u003c/sup\u003e. The fragments of CRC tissues were washed with cold HBSS(-), minced with scissors, and washed again. These fragments were incubated in Accumax (Innovative Cell Technologies, San Diego, CA, USA) at room temperature or TrypLE Express (ThermoFisher Scientific, Tokyo, Japan) at 37\u0026deg;C for 30 min with shaking. The digested fragments were rinsed with cold HBSS(-), dissociated using a 100-\u0026mu;m cell strainer, and pelleted. Advanced DMEM/F12 (ThermoFisher Scientific) supplemented with 1 x penicillin-streptomycin, 500 ng/ml of Amphotericin B (FUJIFILM Wako, Osaka, Japan), 1 x Zell Shield (Minelva Biolabs GmbH, Berlin, Germany), 10 mM HEPES (ThermoFisher Scientific), 1 x L-glutamine (FUJIFILM Wako), [Leu\u003csup\u003e15\u003c/sup\u003e]-GastrinI (Sigma-Aldrich, Tokyo, Japan), 1 mM N-acetyl-L-cysteine (FUJIFILM Wako), 1 x B27 supplement (ThermoFisher Scientific), 1% BSA (FUJIFILM Wako), and 10 \u0026mu;M Y27632 (FUJIFILM Wako) was used as the basal culture medium for CRC organoids. The pellet was suspended in the basal culture medium containing the following factors: 50 ng/ml of Recombinant Human EGF (Peprotech, Rocky Hill, NJ, USA), 100 ng/ml of Noggin (Peprotech), and 500 nM A83-01 (FUJIFILM Wako).\u003c/p\u003e\n\u003cp\u003eIn a 12-well plate, 65 \u0026mu;l of Matrigel (Corning, Bedford, MA, USA) /well was polymerized for 15 min at 37\u0026deg;C and a 650-\u0026mu;l cell suspension /well x 3 was seeded and incubated in a 37\u0026deg;C humidified CO\u003csub\u003e2 \u003c/sub\u003eincubator. After 24 hours, the supernatants were removed and 85 \u0026mu;l/well of Matrigel was overlaid. After Matrigel polymerization, the basal culture media containing different factor combinations [A:250 ng/ml of R-spondin 1 (Peprotech) + 20 ng/ml of Wnt-3a (Peprotech) +25 \u0026mu;M SB202190, B: 25 \u0026mu;M SB202190, and C: none] was used to select the most efficient growth media during several passages. The organoids were dispersed by Accumax and passaged approximately once a week. Zell Shield was not used after several passages. When organoids with more than 10 passages (P10) survived after a freeze and thaw cycle, they were defined as \u0026ldquo;successfully established\u0026rdquo;.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFibroblast culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTwo to three tissue fragments were washed three times with HBSS(-), placed in a 60-mm dish, and minced with scissors. Then, culture medium, RPMI-1640, containing L-Glutamine (FUJIFILM Wako) and 10% FBS, penicillin-streptomycin was added into the dish and cells were incubated at 37\u0026deg;C in a humidified 5% CO\u003csub\u003e2\u003c/sub\u003e\u0026nbsp;incubator. After they reached 70% confluency, cells were passaged using TrypLE Express dissociation reagent (ThermoFisher Scientific).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCo-culture of organoids with fibroblasts using a chamber system\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOrganoids were cultured in the cell culture inserts with a porous membrane and fibroblasts were cultured in the carrier plates (Corning). The pore size of the insert was 1.0 \u0026mu;m to allow the free exchange of media but not cells to migrate through. One day before starting the co-culture, fibroblasts were dissociated into single cells using TrypLE Express and 1 x 10\u003csup\u003e4 \u003c/sup\u003ecells were cultured in a 24-well plate with RPMI-1640 containing penicillin-streptomycin, Amphotericin B, and 10% FBS. For organoid culture, cell culture inserts were set on the 24-well companion plate and 20 \u0026mu;l of Matrigel was polymerized on the insert. Organoids were dissociated by Accumax and resuspended in optimized media for organoids described above. The cell suspension (1 x 10\u003csup\u003e4 \u003c/sup\u003ecells / 200 \u0026mu;l) was seeded onto the Matrigel and 620 \u0026mu;l of media for organoids was added to the basal compartment. Fibroblasts and organoids were incubated at 37\u0026deg;C in a CO\u003csub\u003e2 \u003c/sub\u003eincubator.\u003c/p\u003e\n\u003cp\u003eThe next day, apical and basal media were removed from the plate containing organoids attached on the Matrigel, and organoids were covered with 20 \u0026mu;l of Matrigel and polymerized at 37\u0026deg;C for 15 min. The inserts containing organoids were transferred to the fibroblast-containing compartment plate after changing the medium from that for fibroblasts to 820 \u0026mu;l of optimized media for organoids. The co-culture plate was incubated at 37\u0026deg;C in a CO\u003csub\u003e2 \u003c/sub\u003eincubator for 96 hours, and organoids and fibroblasts were collected separately for gene expression analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTargeted sequencing analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGenomic DNA from 45 samples of CRC and organoids of cases #11, #21, #25, #28, #32, #33, and #44 were prepared using NucleoSpin Tissue kit (Takara Bio, Kusatsu, Japan) according to the manufacturer\u0026rsquo;s protocol. Targeted sequencing analyses of those DNAs were performed using the NCC Oncopanel v4 test, which can analyze mutations of 114 genes and amplifications and fusions of 12 genes \u003csup\u003e50\u003c/sup\u003e. Procedures for targeted sequencing and data analysis were previously described \u003csup\u003e50\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTP53\u003c/em\u003e mutations identified by the NCC Oncopanel test were confirmed by Sanger sequencing. The PCR products including mutations were amplified using specific PCR primers. Primers used for A578G and G589A mutations of #21 and #32, respectively, were forward: 5\u0026rsquo;-GGAGGTCAAATAAGCAGCAGG-3\u0026rsquo; and reverse: 5\u0026rsquo;-GGCCTCTGATTCCTCACTGA-3\u0026rsquo;. Primers used for a 45_48TCAG deletion of #28 were forward: 5\u0026rsquo;-CCCAACCCTTGTCCTTACCA-3\u0026rsquo; and reverse: 5\u0026rsquo;-CAGTCAGATCCTAGCGTCGA-3\u0026rsquo;. The amplified PCR products were directly sequenced by Sanger sequencing using the following primers. The primer for #21 and #32 was 5\u0026rsquo;-ACAACCACCCTTAACCCCTC-3\u0026rsquo;. The primer for #28 was 5\u0026rsquo;- CCCAACCCTTGTCCTTACCA -3\u0026rsquo;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGene expression analysis using DNA microarray \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from original tumor tissues and established organoids of cases #11, #25, #28, #32, and #44 using NucleoSpin RNA Plus (TaKaRa) according to the manufacturer\u0026rsquo;s protocol. Total RNA was extracted from three replicates of co-cultured organoids and fibroblasts for #21, #28, and #32 using the RNeasy Micro kit (QIAGEN, Tokyo, Japan). The quality of the RNA samples was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) and highly qualified RNA samples with a RIN score \u0026gt; 7.0 were selected for further DNA microarray analysis. Triplicate samples were used as an RNA cocktail. Cy3-labeled cRNA was hybridized on SurePrint G3 Human GE Microarray GE 8 x 60K Ver.3.0 (Agilent Technologies) according to the manufacturer\u0026rsquo;s instructions. The Subio Platform, Subio Basic plug-in, and Subio Advanced plug-in (ver 1.24) (Subio, Kagoshima, Japan) were used for data analysis.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eQuantitative real-time PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOne \u0026micro;g of total RNA for each sample was treated with DNase I (NIPPON GENE, Tokyo, Japan) prior to reverse transcription to cDNA using Multiscribe Reverse Transcriptase with random primers (ThermoFisher Scientific). qRT-PCR was performed with SsoAdvanced Universal SYBR Green Supermix (BIO-RAD, California, USA) using DNA Engine Opticon 2 (MJ Research, Quebec, Canada). Reactions were run in triplicate in three independent experiments. Data were normalized with the housekeeping gene b-\u003cem\u003eACTIN\u003c/em\u003e and were calculated by the 2 -\u0026Delta;\u0026Delta;CT method \u003csup\u003e51\u003c/sup\u003e. Data were presented as means \u0026plusmn; SD (1.0-fold as the control). The primer sequences were as follows: b\u003cem\u003e -ACTIN\u003c/em\u003e forward 5\u0026rsquo;- AAACTGGAACGGTGAAGGTG-3\u0026rsquo; and reverse AGAGAAGTGGGGTGGCTTTT3\u0026rsquo;, \u003cem\u003eACTA2\u003c/em\u003e forward 5\u0026rsquo;-CTGTTCCAGCCATCCTTCAT-3\u0026rsquo; and reverse 5\u0026rsquo;-GCTGGAAGGTGGACAGAGAG-3\u0026rsquo;, \u003cem\u003eREG1A \u003c/em\u003eforward 5\u0026rsquo; CTGGAATCCTGTGCTTGAGG-3\u0026rsquo; and reverse 5\u0026rsquo;-GGTCTCCTACAAGTCCTGGG-3\u0026rsquo;, \u003cem\u003eREG3A \u003c/em\u003eforward 5\u0026rsquo;-CCTCTGGAAACCTGGTGTCT3\u0026rsquo; and reverse 5\u0026rsquo;-CCACTCCCAACCTTCTCCAT3\u0026rsquo;, \u003cem\u003eDUOX2\u003c/em\u003e forward 5\u0026rsquo;- GAGCCCTTCTTCAACTCCCT-3\u0026rsquo; and reverse 5\u0026rsquo;-GGAGGACAGGCTCAGAAGTT-3\u0026rsquo;, and \u003cem\u003eDUOXA2\u003c/em\u003e forward 5\u0026rsquo;-GGTCTCCTACAAGTCCTGGG-3\u0026rsquo; and reverse 5\u0026rsquo;-TTTACAGATCGCCCCAGGAG-3\u0026rsquo;.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell viability\u003c/strong\u003eThe viability of organoids was assessed after co-culture with fibroblasts for 96 hours using the chamber system. After aspirating culture medium, 100 \u0026mu;l of fresh culture medium was added. Then, Matrigel including organoids was scraped using a mini cell scraper, 100 \u0026mu;l of CellTiter-Glo 3D reagent was added (Promega, Tokyo, Japan), and organoids were disrupted by pipetting. Suspensions were transferred to 96-well assay plates and incubated at room temperature for 25 min. After incubation, the luminescence was measured using Synergy H1 (BioTek, Tokyo, Japan).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGene Ontology (GO) enrichment analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo clarify the biological meaning of the key modules, the gene information was loaded into Metascape (http://metascape.org) for Gene Ontology (GO) enrichment analysis \u003csup\u003e52\u003c/sup\u003e. Terms with a \u003cem\u003eP\u003c/em\u003e-value \u0026lt;0.01, a minimum count of 3, and an enrichment factor \u0026gt;1.5 were collected and grouped into clusters based on their membership similarities (Kappa scores \u0026gt;0.3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe associations between clinical factors and the establishment of organoids were tested using Fisher\u0026rsquo;s exact test in EZR \u003csup\u003e53\u003c/sup\u003e. For qRT-PCR and cell viability assay, results were presented as the mean \u0026plusmn; s.d. Differences between groups were analyzed by the Student\u0026rsquo;s- t- test or one-way ANOVA using EZR. \u003cem\u003eP-\u003c/em\u003evalues of \u0026lt;\u0026thinsp;0.05 were considered significant.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank the Omics Core and Animal Core Facilities of the National Cancer Center Research Institute for the targeted sequencing analysis and their technical support in histopathological evaluations. The Core Facilities were supported by the National Cancer Center Research and Development Fund (2020-J-002). We are grateful to Ryoichi Masui, Ruri Nakanishi, Naoaki Uchiya, and Yurika Shiotani for their excellent technical assistance.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM.N. carried out overall experiments, the initial development of the methods for co-culture of organoids with fibroblasts, and drafted the submitted version of this manuscript. M.O. performed several of the initial organoid culturing. S.S. and H.T. collected the surgical specimens and evaluated pathological and clinical information. T.Y., H.I. H.S. and T.K. performed mutation analysis by NCC Oncopanel, and K.M. performed gene expression analysis by DNA microarray. A.O. contributed in developing the overall strategies and concepts. T.I. was responsible for the overall study design, data analysis and manuscript finalization.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by a Grant for Research on Development of New Drugs and Funding for Research to Expedite Effective Drug Discovery by Government, Academia and Private Partnership (GAPFREE) from the Japan Agency for Medical Research and Development (AMED).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBirgersdotter, A., Sandberg, R. \u0026amp; Ernberg, I. Gene expression perturbation in vitro--a growing case for three-dimensional (3D) culture systems. \u003cem\u003eSemin Cancer Biol\u003c/em\u003e\u003cstrong\u003e15\u003c/strong\u003e, 405-412 (2005).\u003c/li\u003e\n\u003cli\u003eWeaver, V.M. et al. Reversion of the malignant phenotype of human breast cells in three-dimensional culture and in vivo by integrin blocking antibodies. \u003cem\u003eJ Cell Biol\u003c/em\u003e\u003cstrong\u003e137\u003c/strong\u003e, 231-245 (1997).\u003c/li\u003e\n\u003cli\u003eDiMasi, J.A. \u0026amp; Grabowski, H.G. Economics of new oncology drug development. \u003cem\u003eJ Clin Oncol\u003c/em\u003e\u003cstrong\u003e25\u003c/strong\u003e, 209-216 (2007).\u003c/li\u003e\n\u003cli\u003eBreslin, S. \u0026amp; O'Driscoll, L. Three-dimensional cell culture: the missing link in drug discovery. \u003cem\u003eDrug Discov Today\u003c/em\u003e\u003cstrong\u003e18\u003c/strong\u003e, 240-249 (2013).\u003c/li\u003e\n\u003cli\u003eHopkins, A.L. Network pharmacology: the next paradigm in drug discovery. \u003cem\u003eNat Chem Biol\u003c/em\u003e\u003cstrong\u003e4\u003c/strong\u003e, 682-690 (2008).\u003c/li\u003e\n\u003cli\u003eKola, I. The state of innovation in drug development. \u003cem\u003eClin Pharmacol Ther\u003c/em\u003e\u003cstrong\u003e83\u003c/strong\u003e, 227-230 (2008).\u003c/li\u003e\n\u003cli\u003eLancaster, M.A. \u0026amp; Knoblich, J.A. Organogenesis in a dish: modeling development and disease using organoid technologies. \u003cem\u003eScience\u003c/em\u003e\u003cstrong\u003e345\u003c/strong\u003e, 1247125 (2014).\u003c/li\u003e\n\u003cli\u003eFang, Y. \u0026amp; Eglen, R.M. Three-Dimensional Cell Cultures in Drug Discovery and Development. \u003cem\u003eSLAS Discov\u003c/em\u003e\u003cstrong\u003e22\u003c/strong\u003e, 456-472 (2017).\u003c/li\u003e\n\u003cli\u003eClevers, H. Modeling Development and Disease with Organoids. \u003cem\u003eCell\u003c/em\u003e\u003cstrong\u003e165\u003c/strong\u003e, 1586-1597 (2016).\u003c/li\u003e\n\u003cli\u003eDrost, J. \u0026amp; Clevers, H. Organoids in cancer research. \u003cem\u003eNat Rev Cancer\u003c/em\u003e\u003cstrong\u003e18\u003c/strong\u003e, 407-418 (2018).\u003c/li\u003e\n\u003cli\u003eXouri, G. \u0026amp; Christian, S. Origin and function of tumor stroma fibroblasts. \u003cem\u003eSemin Cell Dev Biol\u003c/em\u003e\u003cstrong\u003e21\u003c/strong\u003e, 40-46 (2010).\u003c/li\u003e\n\u003cli\u003eLeBleu, V.S. \u0026amp; Kalluri, R. A peek into cancer-associated fibroblasts: origins, functions and translational impact. \u003cem\u003eDis Model Mech\u003c/em\u003e\u003cstrong\u003e11\u003c/strong\u003e (2018).\u003c/li\u003e\n\u003cli\u003eKati R\u0026auml;s\u0026auml;nen, A.V. Activation of fibroblasts in cancer stroma. \u003cem\u003eExperimental Cell Research\u003c/em\u003e\u003cstrong\u003e316\u003c/strong\u003e, 2713-2722 (2010).\u003c/li\u003e\n\u003cli\u003eKalluri, R. The biology and function of fibroblasts in cancer. \u003cem\u003eNat Rev Cancer\u003c/em\u003e\u003cstrong\u003e16\u003c/strong\u003e, 582-598 (2016).\u003c/li\u003e\n\u003cli\u003eShiga, K. et al. Cancer-Associated Fibroblasts: Their Characteristics and Their Roles in Tumor Growth. \u003cem\u003eCancers (Basel)\u003c/em\u003e\u003cstrong\u003e7\u003c/strong\u003e, 2443-2458 (2015).\u003c/li\u003e\n\u003cli\u003eKalluri, R. \u0026amp; Zeisberg, M. Fibroblasts in cancer. \u003cem\u003eNat Rev Cancer\u003c/em\u003e\u003cstrong\u003e6\u003c/strong\u003e, 392-401 (2006).\u003c/li\u003e\n\u003cli\u003eTommelein, J. et al. Cancer-associated fibroblasts connect metastasis-promoting communication in colorectal cancer. \u003cem\u003eFront Oncol\u003c/em\u003e\u003cstrong\u003e5\u003c/strong\u003e, 63 (2015).\u003c/li\u003e\n\u003cli\u003eShan, T. et al. Prometastatic mechanisms of CAF-mediated EMT regulation in pancreatic cancer cells. \u003cem\u003eInt J Oncol\u003c/em\u003e\u003cstrong\u003e50\u003c/strong\u003e, 121-128 (2017).\u003c/li\u003e\n\u003cli\u003eYu, Y. et al. Cancer-associated fibroblasts induce epithelial-mesenchymal transition of breast cancer cells through paracrine TGF-beta signalling. \u003cem\u003eBr J Cancer\u003c/em\u003e\u003cstrong\u003e110\u003c/strong\u003e, 724-732 (2014).\u003c/li\u003e\n\u003cli\u003eZhuang, J. et al. TGFbeta1 secreted by cancer-associated fibroblasts induces epithelial-mesenchymal transition of bladder cancer cells through lncRNA-ZEB2NAT. \u003cem\u003eSci Rep\u003c/em\u003e\u003cstrong\u003e5\u003c/strong\u003e, 11924 (2015).\u003c/li\u003e\n\u003cli\u003eOhlund, D. et al. Distinct populations of inflammatory fibroblasts and myofibroblasts in pancreatic cancer. \u003cem\u003eJ Exp Med\u003c/em\u003e\u003cstrong\u003e214\u003c/strong\u003e, 579-596 (2017).\u003c/li\u003e\n\u003cli\u003eBiffi, G. et al. IL1-Induced JAK/STAT Signaling Is Antagonized by TGFbeta to Shape CAF Heterogeneity in Pancreatic Ductal Adenocarcinoma. \u003cem\u003eCancer Discov\u003c/em\u003e\u003cstrong\u003e9\u003c/strong\u003e, 282-301 (2019).\u003c/li\u003e\n\u003cli\u003eAdisetiyo, H. et al. Dependence of castration-resistant prostate cancer (CRPC) stem cells on CRPC-associated fibroblasts. \u003cem\u003eJ Cell Physiol\u003c/em\u003e\u003cstrong\u003e229\u003c/strong\u003e, 1170-1176 (2014).\u003c/li\u003e\n\u003cli\u003eEbbing, E.A. et al. Stromal-derived interleukin 6 drives epithelial-to-mesenchymal transition and therapy resistance in esophageal adenocarcinoma. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e\u003cstrong\u003e116\u003c/strong\u003e, 2237-2242 (2019).\u003c/li\u003e\n\u003cli\u003eCancer Genome Atlas, N. Comprehensive molecular characterization of human colon and rectal cancer. \u003cem\u003eNature\u003c/em\u003e\u003cstrong\u003e487\u003c/strong\u003e, 330-337 (2012).\u003c/li\u003e\n\u003cli\u003eOhlund, D., Elyada, E. \u0026amp; Tuveson, D. Fibroblast heterogeneity in the cancer wound. \u003cem\u003eJ Exp Med\u003c/em\u003e\u003cstrong\u003e211\u003c/strong\u003e, 1503-1523 (2014).\u003c/li\u003e\n\u003cli\u003eAugsten, M. Cancer-associated fibroblasts as another polarized cell type of the tumor microenvironment. \u003cem\u003eFront Oncol\u003c/em\u003e\u003cstrong\u003e4\u003c/strong\u003e, 62 (2014).\u003c/li\u003e\n\u003cli\u003eDolznig, H. et al. Modeling colon adenocarcinomas in vitro a 3D co-culture system induces cancer-relevant pathways upon tumor cell and stromal fibroblast interaction. \u003cem\u003eAm J Pathol\u003c/em\u003e\u003cstrong\u003e179\u003c/strong\u003e, 487-501 (2011).\u003c/li\u003e\n\u003cli\u003eNakamura, H. et al. Organoid culture containing cancer cells and stromal cells reveals that podoplanin-positive cancer-associated fibroblasts enhance proliferation of lung cancer cells. \u003cem\u003eLung Cancer\u003c/em\u003e\u003cstrong\u003e134\u003c/strong\u003e, 100-107 (2019).\u003c/li\u003e\n\u003cli\u003eHerrera, M. et al. Functional heterogeneity of cancer-associated fibroblasts from human colon tumors shows specific prognostic gene expression signature. \u003cem\u003eClin Cancer Res\u003c/em\u003e\u003cstrong\u003e19\u003c/strong\u003e, 5914-5926 (2013).\u003c/li\u003e\n\u003cli\u003eChen, X. \u0026amp; Song, E. Turning foes to friends: targeting cancer-associated fibroblasts. \u003cem\u003eNat Rev Drug Discov\u003c/em\u003e\u003cstrong\u003e18\u003c/strong\u003e, 99-115 (2019).\u003c/li\u003e\n\u003cli\u003eWeeber, F. et al. Preserved genetic diversity in organoids cultured from biopsies of human colorectal cancer metastases. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e\u003cstrong\u003e112\u003c/strong\u003e, 13308-13311 (2015).\u003c/li\u003e\n\u003cli\u003eKopper, O. et al. An organoid platform for ovarian cancer captures intra- and interpatient heterogeneity. \u003cem\u003eNat Med\u003c/em\u003e\u003cstrong\u003e25\u003c/strong\u003e, 838-849 (2019).\u003c/li\u003e\n\u003cli\u003eZheng, H.C. et al. Expression profile of the REG gene family in colorectal carcinoma. \u003cem\u003eJ Histochem Cytochem\u003c/em\u003e\u003cstrong\u003e59\u003c/strong\u003e, 106-115 (2011).\u003c/li\u003e\n\u003cli\u003eMatsumura, N. et al. Identification of novel molecular markers for detection of gastric cancer cells in the peripheral blood circulation using genome-wide microarray analysis. \u003cem\u003eExp Ther Med\u003c/em\u003e\u003cstrong\u003e2\u003c/strong\u003e, 705-713 (2011).\u003c/li\u003e\n\u003cli\u003eNigri, J. et al. PAP/REG3A favors perineural invasion in pancreatic adenocarcinoma and serves as a prognostic marker. \u003cem\u003eCell Mol Life Sci\u003c/em\u003e\u003cstrong\u003e74\u003c/strong\u003e, 4231-4243 (2017).\u003c/li\u003e\n\u003cli\u003eSasaki, Y. et al. REG1A expression is an independent factor predictive of poor prognosis in patients with breast cancer. \u003cem\u003eAnn Surg Oncol\u003c/em\u003e\u003cstrong\u003e15\u003c/strong\u003e, 3244-3251 (2008).\u003c/li\u003e\n\u003cli\u003eChen, Z., Downing, S. \u0026amp; Tzanakakis, E.S. Four Decades After the Discovery of Regenerating Islet-Derived (Reg) Proteins: Current Understanding and Challenges. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e\u003cstrong\u003e7\u003c/strong\u003e, 235 (2019).\u003c/li\u003e\n\u003cli\u003eMoniaux, N. et al. Human hepatocarcinoma-intestine-pancreas/pancreatitis-associated protein cures fas-induced acute liver failure in mice by attenuating free-radical damage in injured livers. \u003cem\u003eHepatology\u003c/em\u003e\u003cstrong\u003e53\u003c/strong\u003e, 618-627 (2011).\u003c/li\u003e\n\u003cli\u003eLieu, H.T. et al. HIP/PAP accelerates liver regeneration and protects against acetaminophen injury in mice. \u003cem\u003eHepatology\u003c/em\u003e\u003cstrong\u003e42\u003c/strong\u003e, 618-626 (2005).\u003c/li\u003e\n\u003cli\u003eLin, S.C. et al. High Immunoreactivity of DUOX2 Is Associated With Poor Response to Preoperative Chemoradiation Therapy and Worse Prognosis in Rectal Cancers. \u003cem\u003eJ Cancer\u003c/em\u003e\u003cstrong\u003e8\u003c/strong\u003e, 2756-2764 (2017).\u003c/li\u003e\n\u003cli\u003eWang, J. et al. PKCalpha promotes generation of reactive oxygen species via DUOX2 in hepatocellular carcinoma. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e\u003cstrong\u003e463\u003c/strong\u003e, 839-845 (2015).\u003c/li\u003e\n\u003cli\u003eKang, K.A. et al. DUOX2-mediated production of reactive oxygen species induces epithelial mesenchymal transition in 5-fluorouracil resistant human colon cancer cells. \u003cem\u003eRedox Biol\u003c/em\u003e\u003cstrong\u003e17\u003c/strong\u003e, 224-235 (2018).\u003c/li\u003e\n\u003cli\u003eRizeq, B., Zakaria, Z. \u0026amp; Ouhtit, A. Towards understanding the mechanisms of actions of carcinoembryonic antigen-related cell adhesion molecule 6 in cancer progression. \u003cem\u003eCancer Sci\u003c/em\u003e\u003cstrong\u003e109\u003c/strong\u003e, 33-42 (2018).\u003c/li\u003e\n\u003cli\u003eBallesta, A.M., Molina, R., Filella, X., Jo, J. \u0026amp; Gimenez, N. Carcinoembryonic antigen in staging and follow-up of patients with solid tumors. \u003cem\u003eTumour Biol\u003c/em\u003e\u003cstrong\u003e16\u003c/strong\u003e, 32-41 (1995).\u003c/li\u003e\n\u003cli\u003eKim, K.S. et al. Overexpression and clinical significance of carcinoembryonic antigen-related cell adhesion molecule 6 in colorectal cancer. \u003cem\u003eClin Chim Acta\u003c/em\u003e\u003cstrong\u003e415\u003c/strong\u003e, 12-19 (2013).\u003c/li\u003e\n\u003cli\u003ePandey, R. et al. Carcinoembryonic antigen cell adhesion molecule 6 (CEACAM6) in Pancreatic Ductal Adenocarcinoma (PDA): An integrative analysis of a novel therapeutic target. \u003cem\u003eSci Rep\u003c/em\u003e\u003cstrong\u003e9\u003c/strong\u003e, 18347 (2019).\u003c/li\u003e\n\u003cli\u003eFujii, M., Matano, M., Nanki, K. \u0026amp; Sato, T. Efficient genetic engineering of human intestinal organoids using electroporation. \u003cem\u003eNat Protoc\u003c/em\u003e\u003cstrong\u003e10\u003c/strong\u003e, 1474-1485 (2015).\u003c/li\u003e\n\u003cli\u003eFujii, M. et al. A Colorectal Tumor Organoid Library Demonstrates Progressive Loss of Niche Factor Requirements during Tumorigenesis. \u003cem\u003eCell Stem Cell\u003c/em\u003e\u003cstrong\u003e18\u003c/strong\u003e, 827-838 (2016).\u003c/li\u003e\n\u003cli\u003eSunami, K. et al. Feasibility and utility of a panel testing for 114 cancer-associated genes in a clinical setting: A hospital-based study. \u003cem\u003eCancer Sci\u003c/em\u003e\u003cstrong\u003e110\u003c/strong\u003e, 1480-1490 (2019).\u003c/li\u003e\n\u003cli\u003eLivak, K.J. \u0026amp; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. \u003cem\u003eMethods\u003c/em\u003e\u003cstrong\u003e25\u003c/strong\u003e, 402-408 (2001).\u003c/li\u003e\n\u003cli\u003eZhou, Y. et al. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. \u003cem\u003eNat Commun\u003c/em\u003e\u003cstrong\u003e10\u003c/strong\u003e, 1523 (2019).\u003c/li\u003e\n\u003cli\u003eKanda, Y. Investigation of the freely available easy-to-use software 'EZR' for medical statistics. \u003cem\u003eBone Marrow Transplant\u003c/em\u003e\u003cstrong\u003e48\u003c/strong\u003e, 452-458 (2013).\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eDue to technical limitations, table 1 is only available as a download in the Supplemental Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"CAFs, REG, CRC, cancer","lastPublishedDoi":"10.21203/rs.3.rs-107047/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-107047/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Organoids derived from epithelial tumors have recently been utilized as a preclinical model in basic and translational studies. This model is considered to reproduce the features of cell-cell contacted and differentiated original tumor cells, but not the tumor microenvironment. In this study, we established organoids and paired cancer-associated fibroblasts (CAFs) from surgical specimens of colorectal carcinomas (CRCs), and evaluated gene expression profiles in organoids with and without co-culture with CAFs to assess interactions between tumor cells and CAFs in tumor tissues. We found that the expression levels of several genes, which are highly expressed in original CRC tissues, were downregulated in organoids but re-expressed by co-culturing with CAFs. They comprised immune response- and external stimulus-related genes, e.g., REG family and dual oxidases (DUOXs), which are known to have malignant functions, e.g., cell-proliferation and/or reducing apoptosis of epithelia and drug resistance for anti-cancer drugs in tumors. In addition, the degree of re-production of REG1 and DUOX2 in the co-culture system varied depending on CAFs from each CRC case. In conclusion, the co-culture system of CRC organoids with paired CAFs was able to partially reproduce the tumor microenvironment.","manuscriptTitle":"Downregulation of Immune Response- and External Stimulus-Related Genes in CRC Organoids, and Their Re-Expression by Co-Culturing with CAFs","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-11-24 15:17:42","doi":"10.21203/rs.3.rs-107047/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2020-12-11T07:15:39+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-12-07T03:24:01+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"f4efdc37-3474-48ae-901a-02b32269e9ee","date":"2020-12-02T00:19:57+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2020-11-25T12:03:16+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2020-11-19T11:19:08+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-11-13T10:30:52+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2020-11-13T10:18:24+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2020-11-12T05:02:57+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"bbd56e3e-28cc-428b-8d00-e1b21552e3af","owner":[],"postedDate":"November 24th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":1186307,"name":"Oncology"}],"tags":[],"updatedAt":"2021-08-18T19:12:59+00:00","versionOfRecord":{"articleIdentity":"rs-107047","link":"https://doi.org/10.1038/s41598-021-81475-2","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2021-01-22 19:02:06","publishedOnDateReadable":"January 22nd, 2021"},"versionCreatedAt":"2020-11-24 15:17:42","video":"","vorDoi":"10.1038/s41598-021-81475-2","vorDoiUrl":"https://doi.org/10.1038/s41598-021-81475-2","workflowStages":[]},"version":"v1","identity":"rs-107047","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-107047","identity":"rs-107047","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.