Diversity of hypervirulent Klebsiella pneumoniae clones causing cryptogenic liver abscesses and metastatic complications in Argentina.

preprint OA: closed
Full text JSON View at publisher

Abstract

Cryptogenic liver abscesses (CLA) caused by hypervirulent Klebsiella pneumoniae (hvKP) strains are emerging in western countries. The aim of the study was to describe the clinical characteristics of patients from Argentina with hvKP-related CLA and the analysis of isolated strains. A retrospective chart review of 15 patients hospitalized in 8 hospitals of Argentina between October 2015 and November 2018 was performed. PCR for genes associated with capsular and multilocus sequence (MLST) determination and virulence factors were done in 8 hvKP isolates from these patients. We found that the mean age was 60 years and 73% were men; 40% had diabetes. Sixty percent had bacteremia and 73% had ≥1 metastatic foci of infection. There was no in-hospital death but 2 patients with endophthalmitis required eye enucleation. From the 8 studied isolates, 4 belonged to K1 and 4 to K2 serotypes, the rpmA and iroB genes were present in all of them, and 7 and 5 also harbored the iucA and the rmpA2 gene, respectively. MSLT analysis showed that most of the K1 serotypes belonged to ST23 while a diverse MLST pattern was seen with K2 strains. In addition, the four hvKP strains associated to metastatic complications, belonging to three distinct sequence types, were positive to the rpmA , iroB and iuc virulence genes. We could show an important morbidity associated with this syndrome in Argentina, a significant diversity in the hvKP clones causing CLA in Argentina, and the potential utility of the rpmA and iroB genes as predictors of virulence.
Full text 118,223 characters · extracted from preprint-html · click to expand
Diversity of hypervirulent Klebsiella pneumoniae clones causing cryptogenic liver abscesses and metastatic complications in Argentina. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Diversity of hypervirulent Klebsiella pneumoniae clones causing cryptogenic liver abscesses and metastatic complications in Argentina. Esteban Nannini, Matías Lahitte, Pablo Scapellato, Corina Nemirosvky, and 9 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4231517/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Cryptogenic liver abscesses (CLA) caused by hypervirulent Klebsiella pneumoniae (hvKP) strains are emerging in western countries. The aim of the study was to describe the clinical characteristics of patients from Argentina with hvKP-related CLA and the analysis of isolated strains. A retrospective chart review of 15 patients hospitalized in 8 hospitals of Argentina between October 2015 and November 2018 was performed. PCR for genes associated with capsular and multilocus sequence (MLST) determination and virulence factors were done in 8 hvKP isolates from these patients. We found that the mean age was 60 years and 73% were men; 40% had diabetes. Sixty percent had bacteremia and 73% had ≥1 metastatic foci of infection. There was no in-hospital death but 2 patients with endophthalmitis required eye enucleation. From the 8 studied isolates, 4 belonged to K1 and 4 to K2 serotypes, the rpmA and iroB genes were present in all of them, and 7 and 5 also harbored the iucA and the rmpA2 gene, respectively. MSLT analysis showed that most of the K1 serotypes belonged to ST23 while a diverse MLST pattern was seen with K2 strains. In addition, the four hvKP strains associated to metastatic complications, belonging to three distinct sequence types, were positive to the rpmA , iroB and iuc virulence genes. We could show an important morbidity associated with this syndrome in Argentina, a significant diversity in the hvKP clones causing CLA in Argentina, and the potential utility of the rpmA and iroB genes as predictors of virulence. Klebsiella pneumoniae Cryptogenic liver abscess hypermucoviscous hypervirulent Introduction Pyogenic liver abscesses (PLA) are serious life-threatening infections with an incidence of 1.1 to 17.6 per 10,000 persons throughout the world, with a mortality rate of 6–19%, even in treated patients [ 19 ]. PLA is usually related to biliary obstruction, intra-abdominal infections (i.e., suppurative pylephlebitis, appendicitis, diverticulitis or peritonitis), and colonic diseases such as inflammatory bowel disease, diverticulitis, colon cancer and polyps. Less frequently, liver abscess arises from a systemic infection trough hematological seed [ 28 ]. Cryptogenic liver abscesses (CLA) are designated when no obvious extrahepatic source of infection is identified and they account for about 20% of the PLA in industrialized countries [ 28 ]. Since the mid-1980s, reports of CLA caused by mucoid strains of Klebsiella pneumoniae have been described in countries from the Asian Pacific Rim [ 17 ]. In the following years, an increasing number of cases were reported worldwide [ 27 ][ 22 ] representing a serious emerging infectious disease. These K. pneumoniae strains have been initially termed ¨hypermucoviscous¨ due the formation of viscous strings of > 5 mm in length when a loop is used to stretch the colony (positive “string test”). However, due to its invasiveness, genotypic features, and associated clinical presentation, they were later renamed as hypervirulent K. pneumoniae (hvKP) [ 29 ][ 24 ]. Even though the outcome of patients with CLA is better than those suffering from non-cryptogenic pyogenic liver abscesses, the typical spread of the infection to other organs has been associated with significant morbidity[ 27 ][ 6 ]. Even more, cases of CLA caused by multidrug resistant hvKP, including carbapenem-resistant hvKP [ 2 ], have raised remarkable concerns. A number of accessory virulence genes have been linked to hvKP strains such as iucA (aerobactin siderophore biosynthesis) and iroB (salmochelin siderophore biosynthesis), as well as rmpA and rmpA2 , both of which are involved in increased capsule expression and hypermucoviscosity [ 25 , 33 ]. Several capsule serotypes were described among hvKP strains, but K1 and K2 account for approximately 70% of them [ 21 , 24 ]. Also, certain clones appear to predominate within each capsular serotypes; for instance, ST23 is the most frequent sequence type (ST) among K1 strains while ST65/ST375, ST66, and ST86 among K2 ones [ 14 , 21 , 32 ]. Since the documented spread of these hvKP strains represent a serious public health threat, it is critical to have a better understanding of the epidemiological behavior of these strains. As cases of CLA caused by hvKP have been sporadically reported from Latin America [ 3 , 31 ], we aimed to describe the clinical characteristics of 15 hospitalized patients with CLA from different cities of Argentina and the molecular analysis of 8 hvKP strains isolated from these patients. Material and methods Patients with cryptogenic liver abscesses. A retrospective study was conducted obtaining clinical information through clinical chart review from 15 hospitalized patients with diagnosis of CLA in 8 hospitals from 4 different cities in Argentina (Buenos Aires, Rosario, Mendoza, and La Plata) between October 2015 and November 2018. Cases were identified by a surveillance evaluation implemented within a working group in the Argentinian Society of Infectious Diseases (SADI). Clinical data from patients with confirmed CLA caused by hvKP were collected in a preformed spreadsheet. Each case required the presence of the liver abscess and the isolation of this pathogen from samples obtained from blood or liver abscess fluid. The study was approved by a local ethic committee and due to the retrospective nature of the study, the need for a signed informed consent was waived. Bacterial Isolates. From this series of patients, 8 K. pneumoniae isolates recovered from liver abscess and/or blood cultures exhibiting hypermucoviscosity phenotype by a positive string test [ 27 ] were available for further molecular analysis. The string test was considered positive when a viscous string of more than 5 mm in length was obtained by stretching bacterial colonies grown overnight on a blood agar plate with a bacteriological loop. Identification and antimicrobial susceptibility assays were performed by BD Phoenix™ System (Becton Dickinson). Identification of virulence-associated genes. Four genes for virulence including iucA , iroB , plasmid-borne rmpA and an isoform rmpA2 were identified by PCR with the specific primers previously reported [ 25 ][ 36 ][ 30 ] (Table 1 ). Table 1 Primers used for amplification of target genes of K. pneumoniae isolates Target gene Primer sequence (5´ → 3´) Size of PCR Product (bp) Reference rmpA F: ACTGGGCTACCTCTGCTTCA R: CTTGCATGAGCCATCTTTCA 535 [ 17 ] rmpA2 F: ACGTATGAAGGCTCGATGGATA R: CCTCCTGGAGAGTAAGCATTGT 354 [ 18 ] iucA F2: GCTTATTTCTCCCCAACCC R2: TCAGCCCTTTAGCGACAAG 583 [ 10 ] iroB F1: ATCTCATCATCTACCCTCCGCTC R1:GGTTCGCCGTCGTTTTCAA 235 [ 10 ] wzc_ K1 F: AGATAGAGGTGTATTGTCGC R: GAGCTCTATATGTTGGATGC 352 [ 19 ] orf 10_K2 F: TCATACTTGACAGAGGGAGTAG R: ACGATCGTTACAGTGACAAG 321 [ 19 ] magA F: 5’-GGTGCTCTTTACATCATTGC R: 5-GCAATGGCCATTTGCGTTAG 1283 [ 17 ] Characterization of capsular types. The detection of capsular K1 and K2 serotypes of these hvKP strains was performed by PCR assays previously reported [ 5 ]. The specific primers amplifying the wzc gene were used to identify K1 strains, and those corresponding to the open reading frame (ORF)-10 region from the cps gene cluster to detect K2 ones [ 5 ]. Also, PCR was performed to amplify magA (mucoviscosity-associated gene A), a chromosome gene involved in the biosynthesis of the outer core lipopolysaccharide, encoded on the operon responsible for capsular serotype K1 and have been related to the K. pneumoniae hypervirulent phenotype [ 36 ]. Detection of clones employing molecular methods The clonal relatedness among the hvKP isolates was based on multilocus sequence typing (MLST) performed by amplification and sequencing of the standard seven housekeeping genes of K. pneumoniae according to the Pasteur Institute MLST website ( http://bigsdb.pasteur.fr/klebsiella/klebsiella.html ). Also, the random amplification PCR assay employing degenerate oligonucleotides (DO-PCR) was employed to distinguish different clones [ 15 ]. Results Fifteen non-Asian descent patients with diagnosis of CLA caused by hvKP strains were included in the analysis (Table 2 ), 11 (73%) of them were men having a mean age of 60 years (range: 45–77 years). Diabetes was the most frequent comorbidity (n = 6; 40%) and in 9 (60%) of the cases the corresponding hvKP strain was isolated from blood cultures. Percutaneous drainage of the liver abscess was performed in the majority (n = 12; 80%) although in 2 (13%) subjects an open surgical procedure was required. Eleven patients (73%) had clinical and radiological confirmation of at least one metastatic foci of infection: 6 patients had one, 4 had two, and 1 had three. The anatomical sites of infection spread outside the liver are listed in Table 2 . Table 2 Clinical and epidemiologic characteristics of 15 patients with cryptogenic liver abscesses. a CASE NUMBER DATE SEX AGE (years) UNDERLINE CONDITION/ RISK FACTOR POSITIVE BLOOD CULTURES PROCEDURES ANTIBIOTIC TREATMENT METASTATIC FOCI DAYS OF IV TREATMENT hvKP STRAIN #1 10/2015 M 77 none No none CRO Lung/Septic arthritis 14 NA #2 05/2016 M 71 none No Percut drain CAZ Endophtalmitis 21 NA #3 04/2017 F 48 DBT No Percut drain /Surgical CRO Empyema 26 NA #4 06/2016 M 67 none No Percut drain SAM Epidural abscess 28 NA #5 08/2017 M 55 DBT Yes Percut drain SAM none 42 K1/ST571 #6 08/2017 F 59 DBT No Percut drain CRO none 30 K2/ST65 #7 04/2017 M 63 none Yes Percut drain SAM none 14 K2/ST375 #8 11/2017 F 68 Hypertension, obesity Yes Percut drain CRO Endophtalmitis/Lung 30 NA #9 06/2018 M 68 none No Percut drain CRO Endophtalmitis/Empyema 28 NA #10 11/2018 M 74 Hypertension, obesity Yes Submand abscess drain SAM Submandibual abscess 10 K1/ST23 #11 09/2018 M 48 DBT, alcoholism, stroke Yes Percut drain SAM Lung/Empyema 42 K2/ST86 #12 09/2018 M 55 DBT Yes Percut drain /Surgical CIP Peritonitis/Prostatic abscess/Neck SSTI 26 K1/ST23 #13 09/2018 F 63 DBT, hypertension Yes none SAM Lung / Suprahepatic thrombophlebitis 21 NA #14 06/2019 M 47 none Yes Percut drain CRO none 64 K1/ST23 #15 06/2019 M 45 none Yes Percut drain/Surgical SAM Lung 20 K2/ST3690 a The cases are ordered taking into account the chronology as revealed for the first strain found on each hospital (dates in bold for the first one). M: male; F: female; DBT: diabetes; IV treatment: intravenous treatment; SSTI: skin soft tissue infections; CRO: ceftriaxone; CAZ: ceftazidime; SAM: ampicillin/sulbactam; CIP: ciprofloxacin; ND: not determined; Percut: percutaneous. Reflecting the severity of the CLA, intravenous antibiotic treatment was given for a mean of 32 days (range: 14–64 days). All the patients were considered cured at the end of hospitalization although two patients with endophthalmitis required eye enucleation. The 15 isolates were reported as susceptible to all the tested antibiotics except ampicillin, to which K. pneumoniae is intrinsically resistant. The eight available K. pneumoniae isolates for analysis displayed a positive string test and carried the plasmid-mediated rpmA virulence gene (Table 3 ) compatible with the hypermucoviscous phenotype, also uncovering its association to the K. pneumoniae hypervirulent pathotype [ 13 ]. In addition, other genes associated with hvKP strains were identified, such as the iroB in all the 8 isolates, and the iucA and the rmpA2 in 7 and 5 isolates, respectively. K1 isolates were positive for the wzc_K1 and the magA gene (renamed as wzy_K1 ) [ 35 ] and the ORF-10 region from the cps gene cluster were found in K2 ones (Table 3 ). The MLST analysis showed that, among the 4 K1 strains, 3 belonged to the ST23 and one to ST571, while the K2 ones were represented by diverse STs including ST65 and ST375 (from the same clonal complex) [ 37 ], ST86, and the most recently described ST3690 [ 21 ]. According to the MLST assay, DO-PCR showed each sequence type as a different clone as revealed by a distinguishable DNA amplification profile for each case (Table 2 ). Overall, these results revealed that the K1/ST23 strains exhibited all virulence genes included in this study. Interestingly, all the K2 strains here characterized were positive for rpmA , iroB and iucA genes. In turn, the association among the presence of metastatic foci and the involved strains showed that in 4 cases from the 8 characterized occurred metastasis complications. Specifically, patients infected with ST23 (K1), ST86 (K2), and ST3690 (K2) hvKP strains demonstrated elevated clonal diversity (Table 2 ). Table 3 Characteristics of the 8 hypervirulent K. pneumoniae clinical strains studied. STRAIN FROM CASE # STRING TEST rpmA rmpA2 iroB iucA magA wzc_k1 ORF-10 CAPSULAR SEROTYPE Sequence type CLONES (DO-PCR) #5 + + - + - + + - K1 ST571 B #6 + + + + + - - + K2 ST65 C #7 + + - + + - - + K2 ST375 E #10 + + + + + + + - K1 ST23 A #11 + + + + + - - + K2 ST86 D #12 + + + + + + + - K1 ST23 A #14 + + + + + + + - K1 ST23 A #15 + + - + + - - + K2 ST3690 F OD-PCR: degenerate oligonucleotide PCR // +: positive; - : negative. Discussion This is the largest series of patients with CLA reported from Latin America including the molecular analysis of 8 hvKP strains (Tables 2 and 3 ). In agreement with previous studies [ 22 , 29 ], we found that all the cases were community-acquired infections, men were the predominance sex, diabetes was the most common comorbidity, more than 50% of the patients had positive blood cultures, the isolated K. pneumoniae strains were susceptible to most antibiotics tested, and a satisfactory outcome was found at the end of hospitalization in the majority of the patients. However, we observed that 73% of the patients developed at least one foci of metastatic spread of the infection. This rate is considerably higher than that reported by others, ranging between 3.5% and 20% in one study[ 12 ] and 10 to 45% in another[ 18 ]. The most common diagnosis elicited by the infection spread were lungs abscesses, empyema, endophthalmitis, and compromise of various other anatomical sites such as prostatic and epidural abscesses. It is interesting to note that almost half of the patients from our cohort suffered from more than one infected site outside the liver. We cannot find a plausible justification for the observed high rate of metastatic complications. An unmeasured delay in the hospitalization and/or in draining liver abscesses could be a hypothesis, particularly in the 60% of the patients who had bacteremia. It should be noted that two patients (13%) developed endogenous endophthalmitis, the most threatened complication of this syndrome, a considerably higher incidence than the 4.5% reported among 11,889 patients included in a systematic review [ 10 ]. These two patients underwent eye enucleation, highlighting the importance of the ophthalmologic screening in patients with CLA for early diagnosis, treatment, and visual preservation [ 26 ]. The pheno-genotypic characterization of the 8 hvKP strains analyzed from this cohort of patients showed equal distribution of K1 and K2 serotypes. Most of the K1 strains belonged to the ST23 clone, considered the archetypal clone among K1 hvKP strains [ 34 ]. Also, the finding of this clone in patients from different hospitals (Table 3 ) highlights their widespread distribution in the community. This type of clonality pattern among K1/K2 capsular serotypes has already been described [ 22 ]. Siderophores and mucoid regulators appear to play key roles in conferring the hypervirulent phenotype to these K. pneumoniae strains, and the plasmid-associated genes iuc , iro , and rmpA / rmpA2 have been recognized as important predictors for this phenotypic trait [ 33 ][ 11 ]. In this context, we detected these four virulence genes in five of the eight strains analyzed (three K1/ST23 and two K2 strains (ST65 and ST86)) (Table 3 ). It is worth noting that the four strains recovered from patients with metastatic focus ( i.e . ST23, ST86 and ST3690 clones) disclosed the four mentioned virulence genes, except for rmpA2 gene in the last clone. In addition, the two virulence genes positive for the 8 studied strains were rpmA and iroB , thus confirming their capacity as pathogenic markers of hvKP. Regarding the pathogenesis, the exact mechanism by which hvKP strains cause CLA is unclear. It was hypothesized that hvKP strains must first colonize the gastrointestinal tract, then cross the intestinal barrier, to latter invade the liver; at this stage, the role of liver Kupffer cells and macrophages appear critical in the control of the infection process [ 8 ]. In vitro studies have shown that K1 and K2 capsular serotypes were more resistant than non-K1/K2 ones to phagocytosis and intracellular killing by neutrophils [ 16 ]. The definition of hvKP has not been clearly outlined and indeed, none of the phenotypic or genotypic tests alone is specific for hypervirulence. However, the presence of hypercapsule, macromolecular exopolysaccharide or excessive siderophores in hvKP and not in classical K. pneumoniae (cKP) strains suggest that these are significant virulence contributors to the observed hypervirulence [ 4 ]. Nonetheless, it has been difficult to ascertain which is the role of each virulence factor and the degree of involvement in these strains. Animal models have confirmed the increased lethality of hvKP strains compared with cKP and with partially virulent hvKP ones although in some but not in all the mouse models tested [ 23 ]. Except for intrinsic resistance to ampicillin, hvKP strains are commonly susceptible to a variety of antibiotics; however, the occurrence of liver abscesses caused by hvKP strains carrying multidrug resistant genes have been initially reported with strains carrying extended-spectrum beta-lactamases genes [ 14 ] in China and in Brazil [ 20 ]. More worrisome, a recent report from Wuhan, China, found that 24 of 45 (53%) of clinical hvKP isolates were carbapenemase producers and that 8 of them, although clonally related, were co-producers of NDM-1 and KPC-2 [ 9 ]. High-risk ST23 hvKp strains producing KPC-2, and dual-carbapenemase-producing KPC-2/VIM-1, were reported in Argentina [ 1 ] and Chile [ 7 ], respectively. This occurrence certainly carries potentially serious public health consequences. The main limitations of this study include the retrospective nature of the report by each participating hospital which could have led to a selection bias towards patients with more extensive disease and the limited number of hvKP strains available for molecular analysis. Conclusions The CLA syndrome caused by community-acquired strains of hvKP is an emerging worldwide public health concern. We report a series of cases from Argentina highlighting a significant prevalence of metastatic foci of infection. Attending physicians should be aware of this syndrome to provide the appropriate treatment and prevent significant central nervous system or sight-threatening ophthalmologic complications due to hvKP. The hypermucoviscous phenotype of the hvKP strains can be identified by the positive string test and by performing PCR for virulence genes such as rmpA and/or iroB . Epidemiological and molecular studies analyzing the relationship between hvKP cloning spreads and susceptible hosts continue to be crucial, as well as the progressive acquisition of virulence genes among multi-drug resistant clones of K. pneumoniae . Declarations Acknowledgements: We wish to thank all the participating patients and the clinical and microbiology staff of each hospital. Funding. The authors declare that no funds, grants, or other support were received during the preparation of this manuscript. Competing interests. The authors have no relevant financial or non-financial interests to discloser Author Contributions. The authors declare that we have all contributed to the conceptualization and methodology of the study. ECN: original draft writing, data collection, supervision, and revision and editing of the writing. MAL, PS, CN, MZ, VR, RZ: data collection; AV and AM: data collection, writing review and editing; ASL, PMM, MR and VD: laboratory studies, writing revision and editing. Ethics Approval. The study was approved by the Institutional Review Board (IRB) of the Sanatorio Británico, Rosario, Argentina and by each local Ethic Committee. Consent to participate. Since this was a retrospective study, the bacterial analysis was done years after patient´s episodes of infection, and confidentiality and anonymity were reassured throughout the data collection process, the need for a signed informed consent was waived. Consent to publish . As the are no individual details, imaging or videos, the consent for publication was waived. References Cejas D, Fernández Canigia L, Rincón Cruz G, Elena AX, Maldonado I, Gutkind GO, Radice MA (2014) First Isolate of KPC-2-Producing Klebsiella pneumonaie Sequence Type 23 from the Americas. J Clin Microbiol 52:3483–3485 Chen H, Fang L, Chen W, Yang Q, Li D, Hu D, Zhang J (2022) Pyogenic liver abscess-caused Klebsiella pneumoniae in a tertiary hospital in China in 2017: implication of hypervirulent carbapenem-resistant strains. BMC Infect Dis 22:685 Coutinho RL, Visconde MF, Descio FJ, Nicoletti AG, Pinto FC, Silva ACR da, Rodrigues-Costa F, Gales AC, Furtado GH (2014) Community-acquired invasive liver abscess syndrome caused by a K1 serotype Klebsiella pneumoniae isolate in Brazil: a case report of hypervirulent ST23. Mem Inst Oswaldo Cruz 109:970–971 Dai P, Hu D (2022) The making of hypervirulent Klebsiella pneumoniae. J Clin Lab Anal. doi: 10.1002/jcla.24743 Feizabadi MM, Raji N, Delfani S (2013) Identification of Klebsiella pneumoniae K1 and K2 Capsular Types by PCR and Quellung Test. Jundishapur J Microbiol 6:e7585 Fernández Vecilla D, Unzaga Barañano MJ, García de Andoin Sojo C, Díaz de Tuesta del Arco JL (2023) Klebsiella pneumoniae hipervirulenta ST23 como causa de neumonía cavitada y sepsis. Enfermedades Infecc y Microbiol Clin (English ed) 41:129–131 Gálvez-Silva M, Arros P, Berríos-Pastén C, Villamil A, Rodas PI, Araya I, Iglesias R, Araya P, Hormazábal JC, Bohle C, Chen Y, Gan Y-H, Chávez FP, Lagos R, Marcoleta AE (2024) Carbapenem-resistant hypervirulent ST23 Klebsiella pneumoniae with a highly transmissible dual-carbapenemase plasmid in Chile. Biol Res 57:7 Hoh CH, Tan YH, Gan Y-H (2019) Protective Role of Kupffer Cells and Macrophages in Klebsiella pneumoniae -Induced Liver Abscess Disease. Infect Immun. doi: 10.1128/IAI.00369-19 Huang Y, Li J, Wang Q, Tang K, Cai X, Li C (2023) Detection of carbapenem-resistant hypervirulent Klebsiella pneumoniae ST11-K64 co-producing NDM-1 and KPC-2 in a tertiary hospital in Wuhan. J Hosp Infect 131:70–80 Hussain I, Ishrat S, Ho DCW, Khan SR, Veeraraghavan MA, Palraj BR, Molton JS, Abid MB (2020) Endogenous endophthalmitis in Klebsiella pneumoniae pyogenic liver abscess: Systematic review and meta-analysis. Int J Infect Dis 101:259–268 Kochan TJ, Nozick SH, Medernach RL, Cheung BH, Gatesy SWM, Lebrun-Corbin M, Mitra SD, Khalatyan N, Krapp F, Qi C, Ozer EA, Hauser AR (2022) Genomic surveillance for multidrug-resistant or hypervirulent Klebsiella pneumoniae among United States bloodstream isolates. BMC Infect Dis 22:603 Lee SS, Chen Y, Tsai H, Wann S, Lin H, Huang C, Liu Y (2008) Predictors of Septic Metastatic Infection and Mortality among Patients with Klebsiella pneumoniae Liver Abscess. Clin Infect Dis 47:642–650 Lee C-R, Lee JH, Park KS, Jeon JH, Kim YB, Cha C-J, Jeong BC, Lee SH (2017) Antimicrobial Resistance of Hypervirulent Klebsiella pneumoniae : Epidemiology, Hypervirulence-Associated Determinants, and Resistance Mechanisms. Front Cell Infect Microbiol. doi: 10.3389/fcimb.2017.00483 Li W, Sun G, Yu Y, Li N, Chen M, Jin R, Jiao Y, Wu H (2014) Increasing Occurrence of Antimicrobial-Resistant Hypervirulent (Hypermucoviscous) Klebsiella pneumoniae Isolates in China. Clin Infect Dis 58:225–232 Limansky AS, Viale AM (2002) Can composition and structural features of oligonucleotides contribute to their wide-scale applicability as random PCR primers in mapping bacterial genome diversity? J Microbiol Methods 50:291–297 Lin J, Chang F, Fung C, Xu J, Cheng H, Wang J, Huang L, Siu L (2004) High prevalence of phagocytic-resistant capsular serotypes of in liver abscess. Microbes Infect 6:1191–1198 Liu Y-C (1986) Klebsiella pneumoniae Liver Abscess Associated With Septic Endophthalmitis. Arch Intern Med 146:1913 Liu Y, Wang J, Jiang W (2013) An Increasing Prominent Disease of Klebsiella pneumoniae Liver Abscess: Etiology, Diagnosis, and Treatment. Gastroenterol Res Pract 2013:1–12 Meddings L, Myers RP, Hubbard J, Shaheen AA, Laupland KB, Dixon E, Coffin C, Kaplan GG (2010) A Population-Based Study of Pyogenic Liver Abscesses in the United States: Incidence, Mortality, and Temporal Trends. Am J Gastroenterol 105:117–124 Nakamura-Silva R, Oliveira-Silva M, Furlan JPR, Stehling EG, Miranda CES, Pitondo-Silva A (2021) Characterization of multidrug-resistant and virulent Klebsiella pneumoniae strains belonging to the high-risk clonal group 258 (CG258) isolated from inpatients in northeastern Brazil. Arch Microbiol 203:4351–4359 Parrott AM, Shi J, Aaron J, Green DA, Whittier S, Wu F (2021) Detection of multiple hypervirulent Klebsiella pneumoniae strains in a New York City hospital through screening of virulence genes. Clin Microbiol Infect 27:583–589 Rossi B, Gasperini ML, Leflon-Guibout V, Gioanni A, de Lastours V, Rossi G, Dokmak S, Ronot M, Roux O, Nicolas-Chanoine M-H, Fantin B, Lefort A (2018) Hypervirulent Klebsiella pneumoniae in Cryptogenic Liver Abscesses, Paris, France. Emerg Infect Dis 24:221–229 Russo TA, MacDonald U, Hassan S, Camanzo E, LeBreton F, Corey B, McGann P (2021) An Assessment of Siderophore Production, Mucoviscosity, and Mouse Infection Models for Defining the Virulence Spectrum of Hypervirulent Klebsiella pneumoniae . mSphere. doi: 10.1128/mSphere.00045-21 Russo TA, Marr CM (2019) Hypervirulent Klebsiella pneumoniae. Clin Microbiol Rev. doi: 10.1128/CMR.00001-19 Russo TA, Olson R, Fang C-T, Stoesser N, Miller M, MacDonald U, Hutson A, Barker JH, La Hoz RM, Johnson JR, Backer M, Bajwa R, Catanzaro AT, Crook D, de Almeda K, Fierer J, Greenberg DE, Klevay M, Patel P, Ratner A, Wang J-T, Zola J (2018) Identification of Biomarkers for Differentiation of Hypervirulent Klebsiella pneumoniae from Classical K. pneumoniae . J Clin Microbiol. doi: 10.1128/JCM.00776-18 Serban D, Popa Cherecheanu A, Dascalu AM, Socea B, Vancea G, Stana D, Smarandache GC, Sabau AD, Costea DO (2021) Hypervirulent Klebsiella pneumoniae Endogenous Endophthalmitis—A Global Emerging Disease. Life 11:676 Shon AS, Bajwa RPS, Russo TA (2013) Hypervirulent (hypermucoviscous) Klebsiella pneumoniae . Virulence 4:107–118 Sifri C, Maddof L (2018) Infections of the Liver and Biliary System (Liver Abscess, Cholangitis, Cholecystitis. In: Bennett J, Dolin R, Blaser MJ (eds) Mand. Douglas, Bennett’s Princ. Pract. Infect. Dis., 9th editio. Elsevier, p 1037 Siu LK, Yeh K-M, Lin J-C, Fung C-P, Chang F-Y (2012) Klebsiella pneumoniae liver abscess: a new invasive syndrome. Lancet Infect Dis 12:881–887 Sohrabi M, Alizade Naini M, Rasekhi A, Oloomi M, Moradhaseli F, Ayoub A, Bazargani A, Hashemizadeh Z, Shahcheraghi F, Badmasti F (2022) Emergence of K1 ST23 and K2 ST65 hypervirulent Klebsiella pneumoniae as true pathogens with specific virulence genes in cryptogenic pyogenic liver abscesses Shiraz Iran. Front Cell Infect Microbiol. doi: 10.3389/fcimb.2022.964290 Vila A (2011) Appearance of Klebsiella Pneumoniae Liver Abscess Syndrome in Argentina: Case Report and Review of Molecular Mechanisms of Pathogenesis. Open Microbiol J 5:107–113 Wang X, Xie Y, Li G, Liu J, Li X, Tian L, Sun J, Ou H-Y, Qu H (2018) Whole-Genome-Sequencing characterization of bloodstream infection-causing hypervirulent Klebsiella pneumoniae of capsular serotype K2 and ST374. Virulence 9:510–521 Wyres KL, Lam MMC, Holt KE (2020) Population genomics of Klebsiella pneumoniae . Nat Rev Microbiol 18:344–359 Ye M, Tu J, Jiang J, Bi Y, You W, Zhang Y, Ren J, Zhu T, Cao Z, Yu Z, Shao C, Shen Z, Ding B, Yuan J, Zhao X, Guo Q, Xu X, Huang J, Wang M (2016) Clinical and Genomic Analysis of Liver Abscess-Causing Klebsiella pneumoniae Identifies New Liver Abscess-Associated Virulence Genes. Front Cell Infect Microbiol. doi: 10.3389/fcimb.2016.00165 Yeh K, Lin J, Yin F, Fung C, Hung H, Siu L, Chang F (2010) Revisiting the Importance of Virulence Determinant magA and Its Surrounding Genes in Klebsiella pneumoniae Causing Pyogenic Liver Abscesses: Exact Role in Serotype K1 Capsule Formation. J Infect Dis 201:1259–1267 Yu W-L, Ko W-C, Cheng K-C, Lee H-C, Ke D-S, Lee C-C, Fung C-P, Chuang Y-C (2006) Association between rmpA and magA Genes and Clinical Syndromes Caused by Klebsiella pneumoniae in Taiwan. Clin Infect Dis 42:1351–1358 Yu F, Lv J, Niu S, Du H, Tang Y-W, Pitout JDD, Bonomo RA, Kreiswirth BN, Chen L (2018) Multiplex PCR Analysis for Rapid Detection of Klebsiella pneumoniae Carbapenem-Resistant (Sequence Type 258 [ST258] and ST11) and Hypervirulent (ST23, ST65, ST86, and ST375) Strains. J Clin Microbiol. doi: 10.1128/JCM.00731-18 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4231517","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":288766571,"identity":"a2b3aae8-690a-4ff8-beb0-7e80930466ce","order_by":0,"name":"Esteban Nannini","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABPklEQVRIie2RsUrDQBiA/xJIlkjWK4XkFf4QaBUqfRCXhECzNKWjQ5ADIS5i1jr5Chl1sxxkSsmawSGh0KlDQRDEIh6J2gQVdHO4b7nj4Lvvfg5AIPinSJ87G4jOFxkAW+dfhJZivSv4S4Xj0EqpMt+jadliNQseYKAsk6K8PfRuLpbJ6nS2MwaKVBYQDE9AWRYNpTt3JWuerOHocuqhkxI/TqeemSKad+eyhZCMfap6zSbmktxTZQZ4P+kTJ+QKTPpditiJmSqTDmU+hXHzYaOMKS/qK1eyTaV4RrSplNFe0dZNBcGVpYOQK3ldsSGvK85eIa0KyV2rd33FVMzrihnnm4FJ0XJjxmex+SwhaVW0aFE+zp6Yjhm//Dk8M4xo0i/pTj+OM1YW22DoR1qr8oH6wyfYUH+TQCAQCP7EG+qxczwzHwVTAAAAAElFTkSuQmCC","orcid":"","institution":"1-\tInstituto IDICER (CONICET) Rosario – Facultad Ciencias Médicas – Universidad Nacional de Rosario. Suipacha 590, Rosario, Santa Fe, Argentina","correspondingAuthor":true,"prefix":"","firstName":"Esteban","middleName":"","lastName":"Nannini","suffix":""},{"id":288766572,"identity":"4965088d-dc31-49f7-bc3b-ba32bd9b38fa","order_by":1,"name":"Matías Lahitte","email":"","orcid":"","institution":"2-\tSanatorio Británico, Paraguay 40, Rosario, Santa Fe, Argentina.","correspondingAuthor":false,"prefix":"","firstName":"Matías","middleName":"","lastName":"Lahitte","suffix":""},{"id":288766574,"identity":"82f92028-5168-459d-bd94-7128815b679b","order_by":2,"name":"Pablo Scapellato","email":"","orcid":"","institution":"3-\tHospital Santojanni, Pilar 950, Buenos Aires, Argentina.","correspondingAuthor":false,"prefix":"","firstName":"Pablo","middleName":"","lastName":"Scapellato","suffix":""},{"id":288766580,"identity":"db027d21-b602-444a-8d6b-2fd1db46b827","order_by":3,"name":"Corina Nemirosvky","email":"","orcid":"","institution":"Hospital Italiano de Buenos Aires","correspondingAuthor":false,"prefix":"","firstName":"Corina","middleName":"","lastName":"Nemirosvky","suffix":""},{"id":288766585,"identity":"3dbac027-a25a-46e4-97de-6f69c0a3ddfb","order_by":4,"name":"Marcelo Zylberman","email":"","orcid":"","institution":"5-\tHospital Argerich, Pi y Margall 750, Ciudad Autónoma Buenos Aires, Buenos Aires. Argentina.","correspondingAuthor":false,"prefix":"","firstName":"Marcelo","middleName":"","lastName":"Zylberman","suffix":""},{"id":288766588,"identity":"974b560a-980b-4681-9e3b-7fb8b2af6853","order_by":5,"name":"Andrea Vila","email":"","orcid":"","institution":"6-\tHospital Italiano de Mendoza, Av. De Acceso Este 1070, M5519 San José, Mendoza, Argentina.","correspondingAuthor":false,"prefix":"","firstName":"Andrea","middleName":"","lastName":"Vila","suffix":""},{"id":288766589,"identity":"98e1412e-f06c-4146-89a6-6fa5687eec29","order_by":6,"name":"Viviana Rodriguez","email":"","orcid":"","institution":"7-\tHospital Tornú, Av. Combatientes de Malvinas 3002, Ciudad Autónoma Buenos Aires, Buenos Aires. Argentina.","correspondingAuthor":false,"prefix":"","firstName":"Viviana","middleName":"","lastName":"Rodriguez","suffix":""},{"id":288766590,"identity":"1e1e4a58-f1ed-4ed7-aed5-6921a6e213df","order_by":7,"name":"Roman Zucchi","email":"","orcid":"","institution":"8-\tClínica Sagrado Corazón, Bartolomé Mitre 1955, Ciudad Autónoma Buenos Aires, Buenos Aires, Argentina.","correspondingAuthor":false,"prefix":"","firstName":"Roman","middleName":"","lastName":"Zucchi","suffix":""},{"id":288766591,"identity":"b108ee34-c411-4cd4-aaf1-31546de64763","order_by":8,"name":"Analia Mykietiuk","email":"","orcid":"","institution":"9-\tInstituto Médico Platense, Av. 51 315, La Plata, Buenos Aires, Argentina.","correspondingAuthor":false,"prefix":"","firstName":"Analia","middleName":"","lastName":"Mykietiuk","suffix":""},{"id":288766592,"identity":"f014b5ae-44a0-4467-9739-1f7f0516036e","order_by":9,"name":"Valeria David","email":"","orcid":"","institution":"10-\tFacultad de Ciencias Bioquímicas y Farmacéuticas – Universidad Nacional de Rosario. Suipacha 531, Rosario, Santa Fe, Argentina.","correspondingAuthor":false,"prefix":"","firstName":"Valeria","middleName":"","lastName":"David","suffix":""},{"id":288766593,"identity":"c2ec631a-0b6f-454a-a170-316c79970d89","order_by":10,"name":"Adriana Limansky","email":"","orcid":"","institution":"10-\tFacultad de Ciencias Bioquímicas y Farmacéuticas – Universidad Nacional de Rosario. Suipacha 531, Rosario, Santa Fe, Argentina.","correspondingAuthor":false,"prefix":"","firstName":"Adriana","middleName":"","lastName":"Limansky","suffix":""},{"id":288766594,"identity":"b2ca9906-f79b-408e-b8e5-e9be246affaa","order_by":11,"name":"Patricia Marchiaro","email":"","orcid":"","institution":"10-\tFacultad de Ciencias Bioquímicas y Farmacéuticas – Universidad Nacional de Rosario. Suipacha 531, Rosario, Santa Fe, Argentina.","correspondingAuthor":false,"prefix":"","firstName":"Patricia","middleName":"","lastName":"Marchiaro","suffix":""},{"id":288766595,"identity":"ae3753e4-389a-4aab-be80-41c65f3a3c1d","order_by":12,"name":"Mariangel Rinaudo","email":"","orcid":"","institution":"2-\tSanatorio Británico, Paraguay 40, Rosario, Santa Fe, Argentina.","correspondingAuthor":false,"prefix":"","firstName":"Mariangel","middleName":"","lastName":"Rinaudo","suffix":""}],"badges":[],"createdAt":"2024-04-07 13:23:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4231517/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4231517/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54517500,"identity":"4abf8632-356d-4f27-a375-d8d1287d5a6e","added_by":"auto","created_at":"2024-04-11 17:02:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":354007,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4231517/v1/169687fb-c84a-41ab-afb0-31a719c231f8.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Diversity of hypervirulent Klebsiella pneumoniae clones causing cryptogenic liver abscesses and metastatic complications in Argentina.","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePyogenic liver abscesses (PLA) are serious life-threatening infections with an incidence of 1.1 to 17.6 per 10,000 persons throughout the world, with a mortality rate of 6\u0026ndash;19%, even in treated patients [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. PLA is usually related to biliary obstruction, intra-abdominal infections (i.e., suppurative pylephlebitis, appendicitis, diverticulitis or peritonitis), and colonic diseases such as inflammatory bowel disease, diverticulitis, colon cancer and polyps. Less frequently, liver abscess arises from a systemic infection trough hematological seed [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Cryptogenic liver abscesses (CLA) are designated when no obvious extrahepatic source of infection is identified and they account for about 20% of the PLA in industrialized countries [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Since the mid-1980s, reports of CLA caused by mucoid strains of \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e have been described in countries from the Asian Pacific Rim [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. In the following years, an increasing number of cases were reported worldwide [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e][\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] representing a serious emerging infectious disease. These \u003cem\u003eK. pneumoniae\u003c/em\u003e strains have been initially termed \u0026uml;hypermucoviscous\u0026uml; due the formation of viscous strings of \u0026gt;\u0026thinsp;5 mm in length when a loop is used to stretch the colony (positive \u0026ldquo;string test\u0026rdquo;). However, due to its invasiveness, genotypic features, and associated clinical presentation, they were later renamed as hypervirulent \u003cem\u003eK. pneumoniae\u003c/em\u003e (hvKP) [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e][\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Even though the outcome of patients with CLA is better than those suffering from non-cryptogenic pyogenic liver abscesses, the typical spread of the infection to other organs has been associated with significant morbidity[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e][\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Even more, cases of CLA caused by multidrug resistant hvKP, including carbapenem-resistant hvKP [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], have raised remarkable concerns.\u003c/p\u003e \u003cp\u003eA number of accessory virulence genes have been linked to hvKP strains such as \u003cem\u003eiucA\u003c/em\u003e (aerobactin siderophore biosynthesis) and \u003cem\u003eiroB\u003c/em\u003e (salmochelin siderophore biosynthesis), as well as \u003cem\u003ermpA\u003c/em\u003e and \u003cem\u003ermpA2\u003c/em\u003e, both of which are involved in increased capsule expression and hypermucoviscosity [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Several capsule serotypes were described among hvKP strains, but K1 and K2 account for approximately 70% of them [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Also, certain clones appear to predominate within each capsular serotypes; for instance, ST23 is the most frequent sequence type (ST) among K1 strains while ST65/ST375, ST66, and ST86 among K2 ones [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Since the documented spread of these hvKP strains represent a serious public health threat, it is critical to have a better understanding of the epidemiological behavior of these strains. As cases of CLA caused by hvKP have been sporadically reported from Latin America [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], we aimed to describe the clinical characteristics of 15 hospitalized patients with CLA from different cities of Argentina and the molecular analysis of 8 hvKP strains isolated from these patients.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cp\u003e\u003cb\u003ePatients with cryptogenic liver abscesses.\u003c/b\u003e A retrospective study was conducted obtaining clinical information through clinical chart review from 15 hospitalized patients with diagnosis of CLA in 8 hospitals from 4 different cities in Argentina (Buenos Aires, Rosario, Mendoza, and La Plata) between October 2015 and November 2018. Cases were identified by a surveillance evaluation implemented within a working group in the Argentinian Society of Infectious Diseases (SADI). Clinical data from patients with confirmed CLA caused by hvKP were collected in a preformed spreadsheet. Each case required the presence of the liver abscess and the isolation of this pathogen from samples obtained from blood or liver abscess fluid. The study was approved by a local ethic committee and due to the retrospective nature of the study, the need for a signed informed consent was waived.\u003c/p\u003e \u003cp\u003e \u003cb\u003eBacterial Isolates.\u003c/b\u003e From this series of patients, 8 \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates recovered from liver abscess and/or blood cultures exhibiting hypermucoviscosity phenotype by a positive string test [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] were available for further molecular analysis. The string test was considered positive when a viscous string of more than 5 mm in length was obtained by stretching bacterial colonies grown overnight on a blood agar plate with a bacteriological loop. Identification and antimicrobial susceptibility assays were performed by BD Phoenix\u0026trade; System (Becton Dickinson).\u003c/p\u003e \u003cp\u003e \u003cb\u003eIdentification of virulence-associated genes.\u003c/b\u003e Four genes for virulence including \u003cem\u003eiucA\u003c/em\u003e, \u003cem\u003eiroB\u003c/em\u003e, plasmid-borne \u003cem\u003ermpA\u003c/em\u003e and an isoform \u003cem\u003ermpA2\u003c/em\u003e were identified by PCR with the specific primers previously reported [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e][\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e][\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for amplification of target genes of \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5\u0026acute; \u0026rarr; 3\u0026acute;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSize of PCR Product (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ermpA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACTGGGCTACCTCTGCTTCA\u003c/p\u003e \u003cp\u003eR: CTTGCATGAGCCATCTTTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e535\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ermpA2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACGTATGAAGGCTCGATGGATA\u003c/p\u003e \u003cp\u003eR: CCTCCTGGAGAGTAAGCATTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e354\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eiucA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF2: GCTTATTTCTCCCCAACCC\u003c/p\u003e \u003cp\u003eR2: TCAGCCCTTTAGCGACAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e583\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eiroB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF1: ATCTCATCATCTACCCTCCGCTC\u003c/p\u003e \u003cp\u003eR1:GGTTCGCCGTCGTTTTCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e235\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ewzc_\u003c/em\u003eK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AGATAGAGGTGTATTGTCGC\u003c/p\u003e \u003cp\u003eR: GAGCTCTATATGTTGGATGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e352\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eorf\u003c/em\u003e10_K2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TCATACTTGACAGAGGGAGTAG\u003c/p\u003e \u003cp\u003eR: ACGATCGTTACAGTGACAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e321\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003emagA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: 5\u0026rsquo;-GGTGCTCTTTACATCATTGC\u003c/p\u003e \u003cp\u003eR: 5-GCAATGGCCATTTGCGTTAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1283\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eCharacterization of capsular types.\u003c/b\u003e The detection of capsular K1 and K2 serotypes of these hvKP strains was performed by PCR assays previously reported [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The specific primers amplifying the \u003cem\u003ewzc\u003c/em\u003e gene were used to identify K1 strains, and those corresponding to the open reading frame (ORF)-10 region from the \u003cem\u003ecps\u003c/em\u003e gene cluster to detect K2 ones [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Also, PCR was performed to amplify \u003cem\u003emagA\u003c/em\u003e (mucoviscosity-associated gene A), a chromosome gene involved in the biosynthesis of the outer core lipopolysaccharide, encoded on the operon responsible for capsular serotype K1 and have been related to the \u003cem\u003eK. pneumoniae\u003c/em\u003e hypervirulent phenotype [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eDetection of clones employing molecular methods\u003c/h3\u003e\n\u003cp\u003eThe clonal relatedness among the hvKP isolates was based on multilocus sequence typing (MLST) performed by amplification and sequencing of the standard seven housekeeping genes of \u003cem\u003eK. pneumoniae\u003c/em\u003e according to the Pasteur Institute MLST website (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://bigsdb.pasteur.fr/klebsiella/klebsiella.html\u003c/span\u003e\u003cspan address=\"http://bigsdb.pasteur.fr/klebsiella/klebsiella.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e).\u003c/span\u003e Also, the random amplification PCR assay employing degenerate oligonucleotides (DO-PCR) was employed to distinguish different clones [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eFifteen non-Asian descent patients with diagnosis of CLA caused by hvKP strains were included in the analysis (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), 11 (73%) of them were men having a mean age of 60 years (range: 45\u0026ndash;77 years). Diabetes was the most frequent comorbidity (n\u0026thinsp;=\u0026thinsp;6; 40%) and in 9 (60%) of the cases the corresponding hvKP strain was isolated from blood cultures. Percutaneous drainage of the liver abscess was performed in the majority (n\u0026thinsp;=\u0026thinsp;12; 80%) although in 2 (13%) subjects an open surgical procedure was required. Eleven patients (73%) had clinical and radiological confirmation of at least one metastatic foci of infection: 6 patients had one, 4 had two, and 1 had three. The anatomical sites of infection spread outside the liver are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eClinical and epidemiologic characteristics of 15 patients with cryptogenic liver abscesses. \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"11\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCASE NUMBER\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDATE\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSEX\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGE (years)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eUNDERLINE CONDITION/ RISK FACTOR\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePOSITIVE BLOOD CULTURES\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePROCEDURES\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eANTIBIOTIC TREATMENT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eMETASTATIC FOCI\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eDAYS OF IV TREATMENT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003ehvKP STRAIN\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e10/2015\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003enone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003enone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eCRO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eLung/Septic arthritis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e05/2016\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003enone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePercut drain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eCAZ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eEndophtalmitis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e04/2017\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDBT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePercut drain /Surgical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eCRO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eEmpyema\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e06/2016\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003enone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePercut drain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSAM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eEpidural abscess\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e08/2017\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDBT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePercut drain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSAM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003enone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eK1/ST571\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e08/2017\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDBT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePercut drain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eCRO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003enone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eK2/ST65\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e04/2017\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003enone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePercut drain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSAM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003enone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eK2/ST375\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e11/2017\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHypertension, obesity\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePercut drain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eCRO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eEndophtalmitis/Lung\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e06/2018\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003enone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePercut drain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eCRO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eEndophtalmitis/Empyema\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11/2018\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHypertension, obesity\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSubmand abscess drain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSAM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eSubmandibual abscess\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eK1/ST23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e09/2018\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDBT, alcoholism, stroke\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePercut drain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSAM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eLung/Empyema\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eK2/ST86\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e09/2018\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDBT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePercut drain /Surgical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eCIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003ePeritonitis/Prostatic abscess/Neck SSTI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eK1/ST23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e09/2018\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDBT, hypertension\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003enone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSAM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eLung / Suprahepatic thrombophlebitis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e06/2019\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003enone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePercut drain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eCRO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003enone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eK1/ST23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e06/2019\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003enone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePercut drain/Surgical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSAM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eLung\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eK2/ST3690\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"11\"\u003e\u003csup\u003ea\u003c/sup\u003e The cases are ordered taking into account the chronology as revealed for the first strain found on each hospital (dates in bold for the first one).\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"11\"\u003eM: male; F: female; DBT: diabetes; IV treatment: intravenous treatment; SSTI: skin soft tissue infections; CRO: ceftriaxone; CAZ: ceftazidime; SAM: ampicillin/sulbactam; CIP: ciprofloxacin; ND: not determined; Percut: percutaneous.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eReflecting the severity of the CLA, intravenous antibiotic treatment was given for a mean of 32 days (range: 14\u0026ndash;64 days). All the patients were considered cured at the end of hospitalization although two patients with endophthalmitis required eye enucleation. The 15 isolates were reported as susceptible to all the tested antibiotics except ampicillin, to which \u003cem\u003eK. pneumoniae\u003c/em\u003e is intrinsically resistant.\u003c/p\u003e \u003cp\u003eThe eight available \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates for analysis displayed a positive string test and carried the plasmid-mediated \u003cem\u003erpmA\u003c/em\u003e virulence gene (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) compatible with the hypermucoviscous phenotype, also uncovering its association to the \u003cem\u003eK. pneumoniae\u003c/em\u003e hypervirulent pathotype [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In addition, other genes associated with hvKP strains were identified, such as the \u003cem\u003eiroB\u003c/em\u003e in all the 8 isolates, and the \u003cem\u003eiucA\u003c/em\u003e and the \u003cem\u003ermpA2\u003c/em\u003e in 7 and 5 isolates, respectively. K1 isolates were positive for the \u003cem\u003ewzc_K1\u003c/em\u003e and the \u003cem\u003emagA\u003c/em\u003e gene (renamed as \u003cem\u003ewzy_K1\u003c/em\u003e) [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] and the ORF-10 region from the \u003cem\u003ecps\u003c/em\u003e gene cluster were found in K2 ones (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The MLST analysis showed that, among the 4 K1 strains, 3 belonged to the ST23 and one to ST571, while the K2 ones were represented by diverse STs including ST65 and ST375 (from the same clonal complex) [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], ST86, and the most recently described ST3690 [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. According to the MLST assay, DO-PCR showed each sequence type as a different clone as revealed by a distinguishable DNA amplification profile for each case (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Overall, these results revealed that the K1/ST23 strains exhibited all virulence genes included in this study. Interestingly, all the K2 strains here characterized were positive for \u003cem\u003erpmA\u003c/em\u003e, \u003cem\u003eiroB\u003c/em\u003e and \u003cem\u003eiucA\u003c/em\u003e genes. In turn, the association among the presence of metastatic foci and the involved strains showed that in 4 cases from the 8 characterized occurred metastasis complications. Specifically, patients infected with ST23 (K1), ST86 (K2), and ST3690 (K2) hvKP strains demonstrated elevated clonal diversity (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCharacteristics of the 8 hypervirulent \u003cem\u003eK. pneumoniae\u003c/em\u003e clinical strains studied.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"12\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSTRAIN FROM CASE #\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSTRING TEST\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003erpmA\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ermpA2\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eiroB\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eiucA\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003emagA\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003ewzc_k1\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eORF-10\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eCAPSULAR SEROTYPE\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003eSequence type\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\"\u003e \u003cp\u003eCLONES (DO-PCR)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eST571\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eB\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eK2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eST65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eK2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eST375\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eST23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eK2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eST86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eD\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eST23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eST23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eK2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eST3690\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"12\"\u003eOD-PCR: degenerate oligonucleotide PCR // +: positive; - : negative.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis is the largest series of patients with CLA reported from Latin America including the molecular analysis of 8 hvKP strains (Tables\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). In agreement with previous studies [\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e], we found that all the cases were community-acquired infections, men were the predominance sex, diabetes was the most common comorbidity, more than 50% of the patients had positive blood cultures, the isolated \u003cem\u003eK. pneumoniae\u003c/em\u003e strains were susceptible to most antibiotics tested, and a satisfactory outcome was found at the end of hospitalization in the majority of the patients. However, we observed that 73% of the patients developed at least one foci of metastatic spread of the infection. This rate is considerably higher than that reported by others, ranging between 3.5% and 20% in one study[\u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e] and 10 to 45% in another[\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eThe most common diagnosis elicited by the infection spread were lungs abscesses, empyema, endophthalmitis, and compromise of various other anatomical sites such as prostatic and epidural abscesses. It is interesting to note that almost half of the patients from our cohort suffered from more than one infected site outside the liver. We cannot find a plausible justification for the observed high rate of metastatic complications. An unmeasured delay in the hospitalization and/or in draining liver abscesses could be a hypothesis, particularly in the 60% of the patients who had bacteremia. It should be noted that two patients (13%) developed endogenous endophthalmitis, the most threatened complication of this syndrome, a considerably higher incidence than the 4.5% reported among 11,889 patients included in a systematic review [\u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e]. These two patients underwent eye enucleation, highlighting the importance of the ophthalmologic screening in patients with CLA for early diagnosis, treatment, and visual preservation [\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eThe pheno-genotypic characterization of the 8 hvKP strains analyzed from this cohort of patients showed equal distribution of K1 and K2 serotypes. Most of the K1 strains belonged to the ST23 clone, considered the archetypal clone among K1 hvKP strains [\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e]. Also, the finding of this clone in patients from different hospitals (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e) highlights their widespread distribution in the community. This type of clonality pattern among K1/K2 capsular serotypes has already been described [\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eSiderophores and mucoid regulators appear to play key roles in conferring the hypervirulent phenotype to these \u003cem\u003eK. pneumoniae\u003c/em\u003e strains, and the plasmid-associated genes \u003cem\u003eiuc\u003c/em\u003e, \u003cem\u003eiro\u003c/em\u003e, and \u003cem\u003ermpA\u003c/em\u003e/\u003cem\u003ermpA2\u003c/em\u003e have been recognized as important predictors for this phenotypic trait [\u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e][\u003cspan class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eIn this context, we detected these four virulence genes in five of the eight strains analyzed (three K1/ST23 and two K2 strains (ST65 and ST86)) (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). It is worth noting that the four strains recovered from patients with metastatic focus (\u003cem\u003ei.e\u003c/em\u003e. ST23, ST86 and ST3690 clones) disclosed the four mentioned virulence genes, except for \u003cem\u003ermpA2\u003c/em\u003e gene in the last clone. In addition, the two virulence genes positive for the 8 studied strains were \u003cem\u003erpmA\u003c/em\u003e and \u003cem\u003eiroB\u003c/em\u003e, thus confirming their capacity as pathogenic markers of hvKP.\u003c/p\u003e\n\u003cp\u003eRegarding the pathogenesis, the exact mechanism by which hvKP strains cause CLA is unclear. It was hypothesized that hvKP strains must first colonize the gastrointestinal tract, then cross the intestinal barrier, to latter invade the liver; at this stage, the role of liver Kupffer cells and macrophages appear critical in the control of the infection process [\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e]. \u003cem\u003eIn vitro\u003c/em\u003e studies have shown that K1 and K2 capsular serotypes were more resistant than non-K1/K2 ones to phagocytosis and intracellular killing by neutrophils [\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eThe definition of hvKP has not been clearly outlined and indeed, none of the phenotypic or genotypic tests alone is specific for hypervirulence. However, the presence of hypercapsule, macromolecular exopolysaccharide or excessive siderophores in hvKP and not in classical \u003cem\u003eK. pneumoniae\u003c/em\u003e (cKP) strains suggest that these are significant virulence contributors to the observed hypervirulence [\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e]. Nonetheless, it has been difficult to ascertain which is the role of each virulence factor and the degree of involvement in these strains. Animal models have confirmed the increased lethality of hvKP strains compared with cKP and with partially virulent hvKP ones although in some but not in all the mouse models tested [\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eExcept for intrinsic resistance to ampicillin, hvKP strains are commonly susceptible to a variety of antibiotics; however, the occurrence of liver abscesses caused by hvKP strains carrying multidrug resistant genes have been initially reported with strains carrying extended-spectrum beta-lactamases genes [\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e] in China and in Brazil [\u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e]. More worrisome, a recent report from Wuhan, China, found that 24 of 45 (53%) of clinical hvKP isolates were carbapenemase producers and that 8 of them, although clonally related, were co-producers of NDM-1 and KPC-2 [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e]. High-risk ST23 hvKp strains producing KPC-2, and dual-carbapenemase-producing KPC-2/VIM-1, were reported in Argentina [\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e] and Chile [\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e], respectively. This occurrence certainly carries potentially serious public health consequences.\u003c/p\u003e\n\u003cp\u003eThe main limitations of this study include the retrospective nature of the report by each participating hospital which could have led to a selection bias towards patients with more extensive disease and the limited number of hvKP strains available for molecular analysis.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe CLA syndrome caused by community-acquired strains of hvKP is an emerging worldwide public health concern. We report a series of cases from Argentina highlighting a significant prevalence of metastatic foci of infection. Attending physicians should be aware of this syndrome to provide the appropriate treatment and prevent significant central nervous system or sight-threatening ophthalmologic complications due to hvKP. The hypermucoviscous phenotype of the hvKP strains can be identified by the positive string test and by performing PCR for virulence genes such as \u003cem\u003ermpA\u0026nbsp;\u003c/em\u003eand/or\u003cem\u003e\u0026nbsp;iroB\u003c/em\u003e. Epidemiological and molecular studies analyzing the relationship between hvKP cloning spreads and susceptible hosts continue to be crucial, as well as the progressive acquisition of virulence genes among multi-drug resistant clones of \u003cem\u003eK. pneumoniae\u003c/em\u003e.\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe wish to thank all the participating patients and the clinical and microbiology staff of each hospital.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding.\u003c/strong\u003e The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests.\u0026nbsp;\u003c/strong\u003e The authors have no relevant financial or non-financial interests to discloser\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions.\u003c/strong\u003e\u0026nbsp; The authors declare that we have all contributed to the conceptualization and methodology of the study. ECN: original draft writing, data collection, supervision, and revision and editing of the writing. MAL, PS, CN, MZ, VR, RZ: data collection; AV and AM: data collection, writing review and editing; ASL, PMM, MR and VD: laboratory studies, writing revision and editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval.\u0026nbsp;\u003c/strong\u003eThe study was approved by the Institutional Review Board (IRB) of the Sanatorio Brit\u0026aacute;nico, Rosario, Argentina and by each local Ethic Committee.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate. \u0026nbsp;\u003c/strong\u003eSince\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003ethis was a retrospective study, the bacterial analysis was done years after patient\u0026acute;s episodes of infection, and confidentiality and anonymity were reassured throughout the data collection process, the need for a signed informed consent was waived.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publish\u003c/strong\u003e. \u0026nbsp;As the are no individual details, imaging or videos, the consent for publication was waived.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eCejas D, Fern\u0026aacute;ndez Canigia L, Rinc\u0026oacute;n Cruz G, Elena AX, Maldonado I, Gutkind GO, Radice MA (2014) First Isolate of KPC-2-Producing \u003cem\u003eKlebsiella pneumonaie\u003c/em\u003e Sequence Type 23 from the Americas. J Clin Microbiol 52:3483\u0026ndash;3485\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen H, Fang L, Chen W, Yang Q, Li D, Hu D, Zhang J (2022) Pyogenic liver abscess-caused \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e in a tertiary hospital in China in 2017: implication of hypervirulent carbapenem-resistant strains. BMC Infect Dis 22:685\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoutinho RL, Visconde MF, Descio FJ, Nicoletti AG, Pinto FC, Silva ACR da, Rodrigues-Costa F, Gales AC, Furtado GH (2014) Community-acquired invasive liver abscess syndrome caused by a K1 serotype \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e isolate in Brazil: a case report of hypervirulent ST23. Mem Inst Oswaldo Cruz 109:970\u0026ndash;971\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai P, Hu D (2022) The making of hypervirulent Klebsiella pneumoniae. J Clin Lab Anal. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jcla.24743\u003c/span\u003e\u003cspan address=\"10.1002/jcla.24743\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeizabadi MM, Raji N, Delfani S (2013) Identification of \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e K1 and K2 Capsular Types by PCR and Quellung Test. Jundishapur J Microbiol 6:e7585\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFern\u0026aacute;ndez Vecilla D, Unzaga Bara\u0026ntilde;ano MJ, Garc\u0026iacute;a de Andoin Sojo C, D\u0026iacute;az de Tuesta del Arco JL (2023) \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e hipervirulenta ST23 como causa de neumon\u0026iacute;a cavitada y sepsis. Enfermedades Infecc y Microbiol Clin (English ed) 41:129\u0026ndash;131\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG\u0026aacute;lvez-Silva M, Arros P, Berr\u0026iacute;os-Past\u0026eacute;n C, Villamil A, Rodas PI, Araya I, Iglesias R, Araya P, Hormaz\u0026aacute;bal JC, Bohle C, Chen Y, Gan Y-H, Ch\u0026aacute;vez FP, Lagos R, Marcoleta AE (2024) Carbapenem-resistant hypervirulent ST23 \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e with a highly transmissible dual-carbapenemase plasmid in Chile. Biol Res 57:7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoh CH, Tan YH, Gan Y-H (2019) Protective Role of Kupffer Cells and Macrophages in \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e-Induced Liver Abscess Disease. Infect Immun. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/IAI.00369-19\u003c/span\u003e\u003cspan address=\"10.1128/IAI.00369-19\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang Y, Li J, Wang Q, Tang K, Cai X, Li C (2023) Detection of carbapenem-resistant hypervirulent \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e ST11-K64 co-producing NDM-1 and KPC-2 in a tertiary hospital in Wuhan. J Hosp Infect 131:70\u0026ndash;80\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHussain I, Ishrat S, Ho DCW, Khan SR, Veeraraghavan MA, Palraj BR, Molton JS, Abid MB (2020) Endogenous endophthalmitis in \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e pyogenic liver abscess: Systematic review and meta-analysis. Int J Infect Dis 101:259\u0026ndash;268\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKochan TJ, Nozick SH, Medernach RL, Cheung BH, Gatesy SWM, Lebrun-Corbin M, Mitra SD, Khalatyan N, Krapp F, Qi C, Ozer EA, Hauser AR (2022) Genomic surveillance for multidrug-resistant or hypervirulent \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e among United States bloodstream isolates. BMC Infect Dis 22:603\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee SS, Chen Y, Tsai H, Wann S, Lin H, Huang C, Liu Y (2008) Predictors of Septic Metastatic Infection and Mortality among Patients with \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e Liver Abscess. Clin Infect Dis 47:642\u0026ndash;650\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee C-R, Lee JH, Park KS, Jeon JH, Kim YB, Cha C-J, Jeong BC, Lee SH (2017) Antimicrobial Resistance of Hypervirulent \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e: Epidemiology, Hypervirulence-Associated Determinants, and Resistance Mechanisms. Front Cell Infect Microbiol. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcimb.2017.00483\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2017.00483\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi W, Sun G, Yu Y, Li N, Chen M, Jin R, Jiao Y, Wu H (2014) Increasing Occurrence of Antimicrobial-Resistant Hypervirulent (Hypermucoviscous) \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e Isolates in China. Clin Infect Dis 58:225\u0026ndash;232\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLimansky AS, Viale AM (2002) Can composition and structural features of oligonucleotides contribute to their wide-scale applicability as random PCR primers in mapping bacterial genome diversity? J Microbiol Methods 50:291\u0026ndash;297\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin J, Chang F, Fung C, Xu J, Cheng H, Wang J, Huang L, Siu L (2004) High prevalence of phagocytic-resistant capsular serotypes of in liver abscess. Microbes Infect 6:1191\u0026ndash;1198\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y-C (1986) \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e Liver Abscess Associated With Septic Endophthalmitis. Arch Intern Med 146:1913\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Wang J, Jiang W (2013) An Increasing Prominent Disease of \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e Liver Abscess: Etiology, Diagnosis, and Treatment. Gastroenterol Res Pract 2013:1\u0026ndash;12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeddings L, Myers RP, Hubbard J, Shaheen AA, Laupland KB, Dixon E, Coffin C, Kaplan GG (2010) A Population-Based Study of Pyogenic Liver Abscesses in the United States: Incidence, Mortality, and Temporal Trends. Am J Gastroenterol 105:117\u0026ndash;124\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakamura-Silva R, Oliveira-Silva M, Furlan JPR, Stehling EG, Miranda CES, Pitondo-Silva A (2021) Characterization of multidrug-resistant and virulent \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e strains belonging to the high-risk clonal group 258 (CG258) isolated from inpatients in northeastern Brazil. Arch Microbiol 203:4351\u0026ndash;4359\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParrott AM, Shi J, Aaron J, Green DA, Whittier S, Wu F (2021) Detection of multiple hypervirulent \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e strains in a New York City hospital through screening of virulence genes. Clin Microbiol Infect 27:583\u0026ndash;589\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRossi B, Gasperini ML, Leflon-Guibout V, Gioanni A, de Lastours V, Rossi G, Dokmak S, Ronot M, Roux O, Nicolas-Chanoine M-H, Fantin B, Lefort A (2018) Hypervirulent \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e in Cryptogenic Liver Abscesses, Paris, France. Emerg Infect Dis 24:221\u0026ndash;229\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRusso TA, MacDonald U, Hassan S, Camanzo E, LeBreton F, Corey B, McGann P (2021) An Assessment of Siderophore Production, Mucoviscosity, and Mouse Infection Models for Defining the Virulence Spectrum of Hypervirulent \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e. mSphere. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/mSphere.00045-21\u003c/span\u003e\u003cspan address=\"10.1128/mSphere.00045-21\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRusso TA, Marr CM (2019) Hypervirulent Klebsiella pneumoniae. Clin Microbiol Rev. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/CMR.00001-19\u003c/span\u003e\u003cspan address=\"10.1128/CMR.00001-19\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRusso TA, Olson R, Fang C-T, Stoesser N, Miller M, MacDonald U, Hutson A, Barker JH, La Hoz RM, Johnson JR, Backer M, Bajwa R, Catanzaro AT, Crook D, de Almeda K, Fierer J, Greenberg DE, Klevay M, Patel P, Ratner A, Wang J-T, Zola J (2018) Identification of Biomarkers for Differentiation of Hypervirulent \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e from Classical \u003cem\u003eK. pneumoniae\u003c/em\u003e. J Clin Microbiol. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JCM.00776-18\u003c/span\u003e\u003cspan address=\"10.1128/JCM.00776-18\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSerban D, Popa Cherecheanu A, Dascalu AM, Socea B, Vancea G, Stana D, Smarandache GC, Sabau AD, Costea DO (2021) Hypervirulent \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e Endogenous Endophthalmitis\u0026mdash;A Global Emerging Disease. Life 11:676\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShon AS, Bajwa RPS, Russo TA (2013) Hypervirulent (hypermucoviscous) \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e. Virulence 4:107\u0026ndash;118\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSifri C, Maddof L (2018) Infections of the Liver and Biliary System (Liver Abscess, Cholangitis, Cholecystitis. In: Bennett J, Dolin R, Blaser MJ (eds) Mand. Douglas, Bennett\u0026rsquo;s Princ. Pract. Infect. Dis., 9th editio. Elsevier, p 1037\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSiu LK, Yeh K-M, Lin J-C, Fung C-P, Chang F-Y (2012) \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e liver abscess: a new invasive syndrome. Lancet Infect Dis 12:881\u0026ndash;887\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSohrabi M, Alizade Naini M, Rasekhi A, Oloomi M, Moradhaseli F, Ayoub A, Bazargani A, Hashemizadeh Z, Shahcheraghi F, Badmasti F (2022) Emergence of K1 ST23 and K2 ST65 hypervirulent \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e as true pathogens with specific virulence genes in cryptogenic pyogenic liver abscesses Shiraz Iran. Front Cell Infect Microbiol. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcimb.2022.964290\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2022.964290\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVila A (2011) Appearance of \u003cem\u003eKlebsiella Pneumoniae\u003c/em\u003e Liver Abscess Syndrome in Argentina: Case Report and Review of Molecular Mechanisms of Pathogenesis. Open Microbiol J 5:107\u0026ndash;113\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Xie Y, Li G, Liu J, Li X, Tian L, Sun J, Ou H-Y, Qu H (2018) Whole-Genome-Sequencing characterization of bloodstream infection-causing hypervirulent \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e of capsular serotype K2 and ST374. Virulence 9:510\u0026ndash;521\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWyres KL, Lam MMC, Holt KE (2020) Population genomics of \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e. Nat Rev Microbiol 18:344\u0026ndash;359\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe M, Tu J, Jiang J, Bi Y, You W, Zhang Y, Ren J, Zhu T, Cao Z, Yu Z, Shao C, Shen Z, Ding B, Yuan J, Zhao X, Guo Q, Xu X, Huang J, Wang M (2016) Clinical and Genomic Analysis of Liver Abscess-Causing \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e Identifies New Liver Abscess-Associated Virulence Genes. Front Cell Infect Microbiol. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcimb.2016.00165\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2016.00165\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYeh K, Lin J, Yin F, Fung C, Hung H, Siu L, Chang F (2010) Revisiting the Importance of Virulence Determinant \u003cem\u003emagA\u003c/em\u003e and Its Surrounding Genes in \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e Causing Pyogenic Liver Abscesses: Exact Role in Serotype K1 Capsule Formation. J Infect Dis 201:1259\u0026ndash;1267\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu W-L, Ko W-C, Cheng K-C, Lee H-C, Ke D-S, Lee C-C, Fung C-P, Chuang Y-C (2006) Association between \u003cem\u003ermpA\u003c/em\u003e and \u003cem\u003emagA\u003c/em\u003e Genes and Clinical Syndromes Caused by \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e in Taiwan. Clin Infect Dis 42:1351\u0026ndash;1358\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu F, Lv J, Niu S, Du H, Tang Y-W, Pitout JDD, Bonomo RA, Kreiswirth BN, Chen L (2018) Multiplex PCR Analysis for Rapid Detection of \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e Carbapenem-Resistant (Sequence Type 258 [ST258] and ST11) and Hypervirulent (ST23, ST65, ST86, and ST375) Strains. J Clin Microbiol. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JCM.00731-18\u003c/span\u003e\u003cspan address=\"10.1128/JCM.00731-18\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Klebsiella pneumoniae, Cryptogenic liver abscess, hypermucoviscous, hypervirulent","lastPublishedDoi":"10.21203/rs.3.rs-4231517/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4231517/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCryptogenic liver abscesses (CLA) caused by hypervirulent \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e (hvKP) strains are emerging in western countries. The aim of the study was to describe the clinical characteristics of patients from Argentina with hvKP-related CLA and the analysis of isolated strains. A retrospective chart review of 15 patients hospitalized in 8 hospitals of Argentina between October 2015 and November 2018 was performed. PCR for genes associated with capsular and multilocus sequence (MLST) determination and virulence factors were done in 8 hvKP isolates from these patients. We found that the mean age was 60 years and 73% were men; 40% had diabetes. Sixty percent had bacteremia and 73% had ≥1 metastatic foci of infection. There was no in-hospital death but 2 patients with endophthalmitis required eye enucleation. From the 8 studied isolates, 4 belonged to K1 and 4 to K2 serotypes, the \u003cem\u003erpmA\u003c/em\u003e and \u003cem\u003eiroB\u003c/em\u003e genes were present in all of them, and 7 and 5 also harbored the \u003cem\u003eiucA\u003c/em\u003e and the \u003cem\u003ermpA2\u003c/em\u003e gene, respectively. MSLT analysis showed that most of the K1 serotypes belonged to ST23 while a diverse MLST pattern was seen with K2 strains. In addition, the four hvKP strains associated to metastatic complications, belonging to three distinct sequence types, were positive to the \u003cem\u003erpmA\u003c/em\u003e, \u003cem\u003eiroB\u003c/em\u003e and \u003cem\u003eiuc\u003c/em\u003e virulence genes. We could show an important morbidity associated with this syndrome in Argentina, a significant diversity in the hvKP clones causing CLA in Argentina, and the potential utility of the \u003cem\u003erpmA\u003c/em\u003e and \u003cem\u003eiroB\u003c/em\u003e genes as predictors of virulence.\u003c/p\u003e","manuscriptTitle":"Diversity of hypervirulent Klebsiella pneumoniae clones causing cryptogenic liver abscesses and metastatic complications in Argentina.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-11 16:45:54","doi":"10.21203/rs.3.rs-4231517/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b27ac1f6-6a30-4c06-9800-fe369ca9aedf","owner":[],"postedDate":"April 11th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-11T16:45:56+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-11 16:45:54","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4231517","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4231517","identity":"rs-4231517","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00