DNA barcoding of Andaman Padauk (Pterocarpus dalbergioides Roxb.,) an endemic tree species of Andaman and Nicobar Islands, India

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract The research investigates the genetic distinctiveness of Pterocarpus dalbergioides Roxb., commonly known as Andaman padauk, an endemic tree species of the Andaman and Nicobar Islands. The study employs DNA barcoding techniques, focusing on three barcode loci (ITS2, matK, and rbcL), to discern the species from closely related counterparts within the Pterocarpus genus. Sampling from 30 distinct locations across the Andaman and Nicobar Islands, genomic DNA isolation, PCR amplification, and sequencing were done. Polymorphism analysis revealed varying degrees of genetic diversity across the three barcode loci, with ITS2 demonstrating the highest discriminatory power. Phylogenetic analyses based on ITS2, matK, and rbcL sequences elucidated distinct species-specific clusters, reaffirming the endemic nature of P. dalbergioides to the Andaman and Nicobar Islands. Notably, ITS2 proved superior in species resolution compared to plastid barcodes (matK and rbcL). The study highlighted the utility of DNA barcoding in accurately identifying species, particularly in distinguishing closely related taxa within the Pterocarpus genus. The findings highlight the ecological and economic significance of P. dalbergioides as a valuable timber species and emphasize the importance of DNA barcoding in combating illegal trade and ensuring the sustainable management of endemic tree species. Overall, the research contributes to our understanding of the genetic diversity and conservation of P. dalbergioides, offering insights into its evolutionary relationships and aiding in the development of conservation strategies.
Full text 129,959 characters · extracted from preprint-html · click to expand
DNA barcoding of Andaman Padauk (Pterocarpus dalbergioides Roxb.,) an endemic tree species of Andaman and Nicobar Islands, India | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article DNA barcoding of Andaman Padauk (Pterocarpus dalbergioides Roxb.,) an endemic tree species of Andaman and Nicobar Islands, India Jaisankar Iyyappan, Arun Kumar De, Prabhu Pari, Manasseh Moses Ezekiel This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4287497/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The research investigates the genetic distinctiveness of Pterocarpus dalbergioides Roxb., commonly known as Andaman padauk, an endemic tree species of the Andaman and Nicobar Islands. The study employs DNA barcoding techniques, focusing on three barcode loci (ITS2, matK , and rbcL ), to discern the species from closely related counterparts within the Pterocarpus genus. Sampling from 30 distinct locations across the Andaman and Nicobar Islands, genomic DNA isolation, PCR amplification, and sequencing were done. Polymorphism analysis revealed varying degrees of genetic diversity across the three barcode loci, with ITS2 demonstrating the highest discriminatory power. Phylogenetic analyses based on ITS2, matK , and rbcL sequences elucidated distinct species-specific clusters, reaffirming the endemic nature of P. dalbergioides to the Andaman and Nicobar Islands. Notably, ITS2 proved superior in species resolution compared to plastid barcodes (matK and rbcL ). The study highlighted the utility of DNA barcoding in accurately identifying species, particularly in distinguishing closely related taxa within the Pterocarpus genus. The findings highlight the ecological and economic significance of P. dalbergioides as a valuable timber species and emphasize the importance of DNA barcoding in combating illegal trade and ensuring the sustainable management of endemic tree species. Overall, the research contributes to our understanding of the genetic diversity and conservation of P. dalbergioides , offering insights into its evolutionary relationships and aiding in the development of conservation strategies. Pterocarpus dalbergioides DNA barcoding ITS2 matK rbcL endemic species conservation Andaman and Nicobar Islands Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Pterocarpus dalbergioides Roxb. , also known as Andaman Padauk, is an endemic tree species of the Andaman and Nicobar Islands and belongs to the family Fabaceae (Arunkumar and Joshi 2014 ). The islands of Andaman and Nicobar have a tropical rainforest shade with highly unique flora because of the tropical humid environment and insular nature of the territory (Rao 1996 ). The Andaman and Nicobar Islands made of a blended verdure in with components from Indian, Myanmar, Malaysian and endemic flower strains (Mondal and Surekhalandge 2019 ). Andaman padauk is a dominant species in both semi-evergreen and moist deciduous Andaman forests, contributing high stem density and basal area in comparison to other species (Arunkumar and Joshi 2014 ; Prasad et al. 2008 ). This species holds significant cultural importance, serving as an important source of valuable timber and holding the esteemed position of being the state tree of the Andaman and Nicobar Islands (Arunkumar and Joshi 2014 ). Its versatility extends to ornamental and decorative applications, making it the primary timber tree in the Andaman and Nicobar Islands. The heartwood of this tree is prized for crafting high-quality furniture, contributing to a noteworthy economic transformation on the Island (Rao 2000 ; Mondal and Surekhalandge 2019 ). Beyond its utilitarian aspects, the Andaman pad auk wood is esteemed for its diverse array of colors, finding applications in a wide range of uses (Parkinson 1923 ). This species is recognized by various local names, including Andaman red wood, East Indian mahogany, and narra (Mondal and Surekhalandge 2019 ). Over the last thirty years, the population of this species has experienced a significant decline of 30% due to extensive harvesting practices (Mondal and Surekhalandge 2019 ). The detrimental effects of logging activities and a diminished capacity for regeneration have collectively contributed to a negative trajectory in the population of the Andaman padauk tree. Due to the threat of extinction and low natural seed germination, the tree has been designated as a reserved tree. The FAO has emphasized the need for conservation initiatives in response to the species restricted distribution pattern and economic significance (Prasad et al. 2008 ). Illicit logging and the illegal timber trade pose substantial challenges on both domestic and international scales, exerting detrimental impacts not only on individual species but also on entire forest ecosystems. Consequently, this issue affects both consumers and producers alike. Global efforts to tackle this problem encompass the implementation of legislation that prohibits or restricts the trade of timber derived unlawfully. (Jiao et al. 2018 ). The species have been listed vulnerable in the IUCN red list ( https://www.iucnredlist.org ). Strict restrictions are imposed globally for trade through the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) (Dormontt et al. 2015 ). Species of Pterocarpus are spread globally across countries specifically in tropical Asia, Africa, and South America (Ng 1992 ; Jansen et al. 1995 ; Chen et al. 2004 ). In India variety of Pterocarpus species namely Pterocarpus santalinus , P. marsupium , P. indicus and P. dalbergioides are present widely across India. In which most of the species has medicinal uses, ornamental and furniture making (Sukhadiya et al. 2019 ; Arunkumar and Joshi 2014 ; Senthilkumar et al. 2020 ). The application of DNA barcoding serves as a pivotal tool in addressing significant challenges, including the identification of illicit logging, illegal timber trade, and forensic wood analysis, which are prevalent issues of considerable concern both at local and global level (Jiao et al. 2018 ; Hassold et al. 2016 ; Jiao et al. 2020 ). The need for species identification in forensic applications is propelled by escalating global apprehensions and the imperative for safeguarding biodiversity. This urgency is further emphasised by notable declines in biological diversity across various geographical, temporal, and biological dimensions. (Tittensor et al. 2014 ). Various DNA barcodes, including rpoC1 , matK , rbcL, trnH-psbA , trnH- ITS, trnH-psbA and ITS, have previously been used to assess genetic variability in plants. These indicators have been determined to be a strong possibility for identifying families, genus, and species (Malik et al. 2018 ; De Mattia et al. 2011 ; De Mattia et al. 2012 ; Fatima et al. 2019 ). The Plant Working Group of the Consortium for the Barcode of Life (CBOL) recommended matK and rbcL sections as universal barcodes for plants (Ford et al. 2009 ). In the current study, ITS2, matK , and rbcL barcoding loci were specifically chosen for amplification to elucidate the interspecific regions of a timber tree. The primary objective of this investigation focus on the demarcation of endemic Andaman padauk tree from closely related counterparts by DNA barcoding and support its endemic nature. Materials and Methods Study Area The study was undertaken at Andaman and Nicobar Islands, a conglomeration of 572 oceanic islands extending from 6° to 14° North latitudes and from 92° to 94° East longitudes. Situated inside the junction of Bay of Bengal and Indian Ocean on one facet and South China Sea and the Pacific Ocean on the opposite facet, these islands are a part of an archipelago unfold alongside 1120 km North to South. The predominant part of this archipelago constitutes five most important islands, four in Andaman (North, South, Middle and Little Andaman) and one in Nicobar (Great Nicobar). The weather of Andaman and Nicobar Islands is hot and humid throughout the year. The season can be divided into dry and rainy seasons with a mean annual temperature of 26.4°C. The average annual precipitation is around 3,100 mm, with mean relative humidity ranging from 65 to 89 percent. Plant Materials and Collection Sites In the present study, candidate plus trees of Andaman padauk were identified from 30 distinct locations encompassing South Andaman, North Andaman, Middle Andaman, Little Andaman, and Katchal (Nicobar group of islands) of the Andaman and Nicobar Islands (Table 1 ). Geo reference map was prepared for collection sites of Andaman padauk, the Andaman and Nicobar Island boundary shape file (.shp) was downloaded from http://www.diva-gis.org/gdata . The downloaded shape files (Country boundaries) are imposed in ArcGIS 10.5v (source from SAC-ISRO). Criteria for selection included trees exceeding 20 meters in height, possessing a clear bole with a robust crown, and exhibiting a girth at breast height (GBH) ranging from 200 cm to 450 cm, along with a diameter at breast height (DBH) exceeding 100 cm. The sampling duration for seed collection extended from April to June 2019. Seed samples were gathered from the identified plants meeting the above specified criteria. Subsequently, these collected seed samples underwent an overnight soaking in water before being sowed in the mother bed in order to facilitate germination. To isolate DNA extraction, young leaf samples were collected from the seedlings raised in the nursery. Table 1 Locations of collection sites of Andaman padauk Acc. No Place Latitude Longitude Altitude (M) Tree Height (M) GBH (CM) District 1 Jirkatang 11 • 50’20”N 92 • 39’14”E 15 24 320 SA 2 Sippighat I 11 • 36’41”N 92 • 40’51”E 24 22 210 SA 3 Sippighat II 11 • 36’42”N 92 • 40’57”E 28 21 220 SA 4 Sippighat III 11 • 36’43”N 92 • 40’44”E 14 23 190 SA 5 Rutland 11 • 26’29”N 92 • 38’25”E 157 23 210 SA 6 Burmanallah 11 • 32’56”N 92 • 43’08”E 38 24 396 SA 7 Wrightmyo 11 • 47’11”N 92 • 42’34”E 13 21 321 SA 8 Mannarghat 11 • 45’40”N 92 • 42’22”E 15 19 417 SA 9 Hutbay 10 • 38’37”N 92 • 30’42”E 78 22 195 SA 10 Nimbudera 12 • 43’24”N 92 • 53’08”E 24 24 420 NA 11 Gandhi jetty 12 • 18’28”N 92 • 47’16”E 7 26 235 NA 12 Nimbudera II 12 • 43’10”N 92 • 53’02”E 22 22 178 NA 13 Kadamtala 12 • 20’00”N 92 • 47’04”E 49 26 390 NA 14 Adajig 12 • 15’30”N 92 • 48’05”E 36 34 198 NA 15 Bakultala 12 • 30’18”N 92 • 51’45”E 7 22 148 NA 16 Rangath 12 • 30’11”N 92 • 53’45”E 87 21 198 NA 17 Bakultala II 12 • 29’58”N 92 • 52’24”E 27 27 150 NA 18 Billiground 12 • 40’06”N 92 • 52’53”E 12 24 190 NA 19 Kadamtala II 12 • 30’39”N 92 • 46’41”E 30 22 135 NA 20 Lamiya Bay 13 • 12’19”N 93 • 01’22”E 32 26 480 NA 21 Buddha Nallah 12 • 33’21”N 92 • 52’17”E 17 23 185 NA 22 Lampagram 13 • 14’29”N 93 • 00’47”E 39 21 210 NA 23 Kalpong 13 • 13’59”N 92 • 57’48”E 17 24 420 NA 24 Pembroke Bay 13 • 10’56”N 92 • 49’43”E 24 24 375 NA 25 Kalapahad 13 • 09’55”N 92 • 49’33”E 22 21 195 NA 26 Prolobjig 12 • 23’44”N 92 • 53’19”E 16 24 480 NA 27 Long Island 12 • 23’34”N 92 • 56’06”E 73 23 390 NA 28 SastriNallah 12 • 14’55”N 92 • 49’35”E 78 20 167 NA 29 Kalighat 13 • 07’35”N 92 • 57’57”E 78 22 325 NA 30 Katchal 7 • 57’18”N 93 • 21’53”E 108 23 275 Nicobar • NA – North Andaman • SA – South Andaman Genomic DNA Isolation DNA isolated from the leaf of one-year-old seedlings. Around 2 gm of leaf samples from the respective accessions were used for genomic DNA isolation. Genomic DNA was extracted by CTAB extraction method using a commercially available DNA extraction kit (HiPurA TM Plant DNA Isolation Kit (CTAB Method), HiMedia Laboratories Pvt. Ltd., Mumbai, India) as per the protocol mentioned by the manufacturer. The isolated DNA samples were dissolved in Tris-EDTA (TE) buffer. The quality and concentration of isolated DNA samples were checked in a Bio Spectrometer (Eppendorf, Hamburg, Germany) at 260 and 280 nm wavelengths. DNA samples with 260/280 ratio between 1.7 to 1.9 were considered for further processing and stored at -80°C. PCR Amplification and Sequencing of Candidate DNA Barcodes For DNA barcoding of Andaman padauk, three established DNA barcoding loci namely Ribulose-1,5-bisphosphate carboxylase large subunit ( rbcL ), Maturase K ( matK ) and Internal Transcribed Spacer 2 (ITS2) were chosen. DNA amplification was carried out in a 25 µl reaction mixture containing 2.5 µl 10X Taq reaction buffer with 1.5 mM MgCl 2 , 0.2 mM dNTPs, 1 µM each forward and reverse primer, 1 IU Taq DNA polymerase (GCC Biotech Pvt. Ltd., West Bengal, India) and approximately 50 ng genomic DNA. The sequences of the primers used are presented in Table 2 . PCR reactions were carried out in a thermal cycler (Prima-96™, HiMedia Laboratories Pvt. Ltd., Mumbai, India) with the following cycling conditions; initial denaturation at 95 ˚C for 5 minutes, 35 cycles of denaturation at 95 ˚C for 30 seconds, annealing at 50 ˚C for 45 seconds, extension at 72 ˚C for 1 minute and a final extension at 72 ˚C for 7 minutes. Confirmation of the amplicons was done in 1.5% agarose gels following which the products were purified and sent to a commercial company (Eurofins Scientific India Pvt. Ltd., Bengaluru, India) for Sanger sequencing in both directions. The generated sequences were edited using Sequencher v 5.4.6 (Gene Codes Corporation, USA). Table 2 Details of the primers used for barcoding Barcode loci Primer sequences (5'-3') rbcL F: ATGCGATACTTGGTGTGA R: TAGCCCCGCCTGACCTGA matK F: CCRTCATCTGGAAATGTTGGTT R: GCTRTRATAATGAGAAAGATTTCTGC ITS2 F: ATGTCACCACAAACAGAAAC R: TCGCATGTACCTGCAGTAGC Bioinformatics analysis Ribulose-1,5-bisphosphate carboxylase large subunit ( rbcL ), Maturase K ( matK ) and Internal Transcribed Spacer 2 (ITS2) sequences of 18 different Pterocarpus species from different parts of the world were retrieved from GenBank ( www.ncbi.nlm.nih.gov ) along with that 30 Andaman padauk barcoding ( rbcL , matK and ITS2) sequences generated in our study and Eucalyptus globulus subsp. maidenii (ITS2), Eucalyptus haemastoma ( matK ), Eucalyptus globulus ( rbcL ) were used as outgroup. All the sequences aligned using ClustalW programme (Thompson et al. 1997 ). in MEGAX (Kumar et al. 2018 ). Polymorphism and population diversity parameters like number of polymorphic sites, haplotype number and diversity, nucleotide diversity and DNA divergence between populations were computed by DnaSp v 6 (Rozas et al. 2017 ). Maximum Composite Likelihood model (Tamura et al. 2004 ). implemented in MEGAX was used to compute pair-wise genetic distance among different sequences. Phylogenetic relationship among the sequences was inferred using the Neighbor-Joining method (Saitou and Nei 1987). with the Tamura-Nei model (Tamura et al. 1993). as implemented in MEGAX following 1,000 bootstrap replications. Bayesian phylogenetic analysis of the sequences was established using MCMC model in BEAST v1.10.4 (Suchard et al. 2018 ). To determine the evolutionary relationship among different sequences, median-joining networks were constructed in PopART ver. 1.7 (Leigh and Bryant 2015 ). with default settings. For phylogenetic tree construction, we trimmed extra nucleotides from our sequences and GenBank retrieved sequences to make a homogeneous length. Results Sequence information of the three barcoding loci (ITS2 complete sequence, rbcL partial sequence, and matK partial sequence) were generated for thirty Andaman padauk isolates from different geographical regions from all three districts of Andaman and Nicobar Islands (Fig. 1 ). (South Andaman 9, North and Middle Andaman 20, and Nicobar 1). Two chloroplast DNA barcoding loci ( matK and rbcL ) recommended by the Consortium for the Barcode of Life (CBOL) and one nuclear barcoding locus (ITS2) (Chen et al. 2004 ). were used for molecular DNA barcoding of Andaman padauk. The PCR amplified products of rbcL, matK, and ITS2 are presented in Fig. 2 . 2.1 Polymorphism Analysis Polymorphism Analysis of ITS2 sequence of the 30 isolates detected in which 2 variable /polymorphic sites including one singleton variable site and one parsimony informative site were found. A total of 30 haplotypes were observed with haplotype diversity of 0.421 ± 0.087 (HD ± SD). The nucleotide diversity (Pi ± SD) of the sequences were 0.00181 ± 0.00041. The ITS2 based polygenetic relationship is presented in Fig. 3 (a). Three well defied clusters were observed, in which two clusters were found in north and middle Andaman and the sequences under the third cluster were distributed in all the three districts of Andaman and Nicobar. The matK polygenetic analysis indicate seven polymorphic sites with two singleton variable sites and five parsimony informative sites. Total of five haplotypes are detected with haplotype diversity (HD ± SD) of 0.662 ± 0.073. The nucleotide diversity (Pi ± SD) of the sequences was 0.00233 ± 0.00036. The geographical distribution of the sequences under five haplotypes are presented in Fig. 3 (b). Five well defined clusters of each haplotype were detected, one from south Andaman specific cluster and another three clusters were from north and middle Andaman, the rest three clusters were not of any region specific. The rbcL based polygenetic analysis indicate only two polymorphic sites, in which both were parsimony informative sites. Total of three haplotypes were detected with haplotype diversity of (HD ± SD) 0.480 ± 0.093. Nucleotide diversity of the sequence was (Pi ± SD) 0.00097 ± 0.00020. The geographical distribution of the haplotypes is presented in Fig. 3 (c). No region specific clusters were found. The concatenated sequences of the three markers were detected in fifteen haplotypes, within haplotype diversity of 0.915 ± 0.031. The nucleotide diversity was 0.0016 ± 0.00019. The polygenetic relationship and geographical distribution of the haplotype is presented in Fig. 3 (d). Total of nine haplotypes were found in north and middle Andaman specific, three were south Andaman specific and rest three were not region specific. ITS2 The neighbor-joining phylogenetic tree and Bayesian phylogenetic tree, both based on ITS2 data, demonstrate distinct species specific clusters, revealing separate groupings for different species of genus Petrocorpus. shown in Fig. 4 . Phylogenetic analysis revealed the close relationship of Andaman padauk ( P.dalbergioides ) with P. marsupium from India and P. santalinus from China and India. Moreover, the ITS-based network tree demonstrated distinct clustering, with all 30 Andaman isolates forming separate and identifiable clusters. P. santalinus from India and China; P. marsupium from Coimbatore; P. tinctorius from Republic of Congo and Tanzania; P. acapulcensis of Venezuela and Mexico; P.soyauxii from Cameroon and Gabon; P. indicus from India, Indonesia and Malaysia; P.angolensis from Angola and Zimbabwe: P. rohri from Columbia, Gautemala, Mexico, Brazil and Bolivia; P. mildbraedii of Nigeria and Tanzania; P.erinaceus of Nigeria and Ghana formed separate groupings with respective species identity with very few exception. i.e. P. ternatus and P. zehntneri from Brazil grouped with P. rohri. matK The evolutionary relationship between Andaman padauk ( P.dalbergioides ) and various Pterocarpus species worldwide was analyzed using matK -based data, depicted in Fig. 5 . The analysis revealed two major clades: The Clade 1 includes P. dalbergioides and P. santalinus from India and China, P. macrocarpus from Thailand, P. marsupium from India, P. angolensis from Angola and South Africa, and other related species from diverse regions such as Myanmar, Cambodia, Malaysia, Vietnam, Indonesia, Papua New Guinea, and Puerto Rico. The Clade 2 encompasses Pterocarpus species like P. acapulcensis , P. tinctorius , P. rohri , P. soyauxii , P. ternatus , P. erinaceus , P. officinalis , P. orbiculatus , P. mildbraedii , and others, spread across regions like Venezuela, Congo, Tanzania, Brazil, Colombia, Mexico, Guatemala, Bolivia, Zimbabwe, Mozambique, Nigeria, Ghana, Puerto Rico, and more. The specific genetic analysis showed certain Andaman padauk isolates ( P. dalbergioides Andaman S1, S3, S21, S30, S6, S28, and S29) to be genetically close to P. santalinus from India and China. Another group of Andaman padauk isolates ( P. dalbergioides Andaman S7, S20, S23, S24, S25, S26, and S27) appeared genetically proximate to P. santalinus of India and China, along with distinct genetic clusters observed in other isolates of P. dalbergioides from the Andaman region. In the network trees depicting the relationship among Pterocarpus species, Andaman padauk ( P . dalbergioides ) clustered with P. santalinus , P. marsupium , P. indicus , P. macrocarpus , and P. angolensis . Overall, the matK-based evolutionary analysis highlighted distinct genetic groupings and relationships among various Pterocarpus species, elucidating the genetic closeness of Andaman padauk to specific counterparts within the Pterocarpus genus across different geographic locations. rbcL A neighbor-joining tree was generated using rbcL gene sequences, the analysis unveiled distinct clustering patterns unlike ITS2 and matK there is no clear species delineation was observed Fig. 6 . Six different clusters were formed without any species-specific clusters. cluster 1 included Andaman padauk ( P.dalbergioides ) isolates S1, S2, S9, S11, S12, S22, S23, S24, and S28, showing genetic proximity to P.soyauxii of Cameroon, P.officinalis of Puerto Rico, and P. macrocarpus of Myanmar. Cluster 2 Isolates S29, S18, S7, S14, and S21 clustered with P. indicus of Indonesia, P. marsupium of India, P. santalinus of India, and P.tinctorius of Congo. Group 3 comprised isolates S15 and S25, closely associated with P . indicus of Malaysia, P. marsupium of India, P. officinalis of Guatemala, and P.rohrii of Brazil. Cluster 4, isolates S4, S10, and S19 (Group 4) displayed genetic similarities with P. angolensis of Angola and Mozambique, P. santalinus of China, P.macrocarpus of Myanmar, and P.indicus of China. Group 5, represented by S5, S13, S20, and S30, showed close relations to P.acapulcensis of Venezuela, P.santalinus of India and China, P. marsupium of India, and P.indicus of China. Finally, Group 6 encompassing isolates S3, S8, S17, S27, S6, S16, and S26 exhibited proximity to various species including P.indicus of Papua New Guinea, P.mildbraedii of Nigeria, P.orbiculatus of Mexico, P.rohrii found across Mexico, Guatemala, Bolivia, Brazil, Colombia, and French Guiana, P. ternatus of Brazil, and P. santalinus of India. Discussion The primary objective of this investigation is to elucidate the distinctiveness of the endemic Andaman padauk species ( Pterocarpus dalbergioides ) in comparison to other closely related Pterocarpus species, with help of DNA barcoding. DNA barcoding proves to be an ideal tool for the discriminate and identification of species. In this study, three DNA barcoding regions were employed, namely the nuclear ribosomal DNA region Internal Transcribed Spacer 2 (ITS2), and two plastid DNA barcodes, ribulose-1,5-bisphosphate carboxylase large subunit ( rbcL ) and maturase K ( matK ). Notably, ITS2 demonstrated the highest discriminatory power among the three barcodes examined. The superior identification capabilities of the nuclear DNA region ITS2 over the plastid barcodes rbcL and matK are in line with findings from previous studies. This reaffirms the effectiveness of ITS2 in distinguishing between closely related species within the Pterocarpus genus (Chen et al. 2010 ; Shaw et al. 2007 ; Ly et al. 2015; Yao et al. 2010 ; Pang et al. 2013 ; Han et al. 2016 ). While the chloroplast DNA regions rbcL and matK were initially advocated as core barcodes for seed plants by the Consortium for the Barcode of Life Plant Working Group, our study revealed a lower species resolution for Pterocarpus when using these two regions, particularly the rbcL region. This observation aligns with the findings of a study conducted by (Jiao et al. 2018 ). Despite their widespread use in phylogenetic analyses, with over 130,000 sequences available in Genbank, both rbcL and matK exhibited limitations in accurately resolving species within the Pterocarpus genus. Kress et al. ( 2005 ) previously demonstrated that the rbcL sequence evolves slowly, and this barcode is recognized for having the lowest divergence among studied plastid genes in flowering plants. Consequently, on average, it may not be sufficiently informative for species-level identification. Additionally, matK has demonstrated varying success rates in discriminating species across different taxonomic groups. For instance, it effectively discriminates more than 90% of species in the Orchidaceae, but its discriminatory power falls below 49% for species in the nutmeg family. In contrast, our study highlights the superior performance of the nuclear DNA region ITS2 in providing enhanced species resolution for Pterocarpus . These observations emphasize the need for a careful selection of DNA barcodes based on their efficacy within specific taxonomic groups. In this context, the ITS2 loci emerge as the most suitable single barcode region for distinguishing Pterocarpus (Chase et al. 2007 ; Kang et al. 2017 ) DNA extracted from wood of Pterocarpus also shows better amplification and high discrimination with ITS2 (But et al. 2023 ). In this investigation, a comprehensive analysis was undertaken by comparing the Internal Transcribed Spacer 2 (ITS2) sequences of 30 Andaman padauk accessions with those of 16 closely related Pterocarpus species obtained from GenBank, originating from diverse global locations. The resulting Neighbor-Joining (NJ) tree, constructed based on the ITS2 sequence data, revealed distinct species-specific clusters. Notably, all 30 Andaman padauk accessions formed a unique cluster clearly different from other related species and similar reports were not found globally, it providing molecular evidence that supports the endemism of Pterocarpus dalbergioides to the Andaman and Nicobar Islands. This finding is consistent with previous research conducted by (Jaisankar et al. 2020 ; Prasad et al. 2008 ). Similarly, DNA barcoding techniques were employed to confirm the distinctiveness of a narrowly distributed endemic tree within the Rubiaceae family on Palau Island in Micronesia. The results indicated that this tree is likely a distinct species within the Timonius genus, as revealed in the study conducted by (Costion et al. 2016 ). Beyond its taxonomic significance, the Andaman padauk ( P. dalbergioides ) holds ecological and economic importance as an endemic tree species with high timber value. Recognizing the critical role of DNA barcoding in species identification, this study emphasizes its potential application in curbing illegal trading and ensuring accurate species identification in the market. Illegal trading poses a substantial threat to the Andaman padauk due to its valuable timber. By leveraging DNA barcoding, a robust and reliable method for species identification, we can establish a stringent mechanism to verify the authenticity of Andaman padauk products in the market. This approach acts as a powerful deterrent against the misrepresentation of other tree species as Andaman padauk, mitigating the risk of unauthorized trade and ensuring the sustainability of the species. Conclusion In conclusion, the study successfully utilized DNA barcoding to distinguish Andaman padauk ( Pterocarpus dalbergioides ) from closely related species, emphasizing the efficacy of ITS2 in species resolution. Molecular evidence supports the endemic nature of Andaman padauk, emphasising its ecological and economic significance. DNA barcoding offers a robust method for accurate species identification, crucial for conservation and trade regulation. Declarations Ethical approval: This article contains no studies on human or animal objects Competing Interests: The authors declare that they have no competing interests. Acknowledgements The authors express their gratitude to Department of Environment, Forests and Climate change for approval to collect the seeds for this study. The authors are also thankful to the Director of ICAR-CIARI, Port Blair for providing Institute facilities and constant encouragement during the study period. Funding This study was supported by the Department of Biotechnology (DBT), Ministry of Science & Technology, Government of India, India (grant number BT/PR29179/FCB/125/7/2018). Authors’ contributions: IJ conceived and supervised the overall execution of the project, PP prepared the manuscript, AKD & EMM assisted in analysis & sample collection. References Arunkumar AN, Joshi G (2014) Pterocarpus santalinus (Red Sanders) an Endemic, Endangered Tree of India: Current Status, Improvement and the Future. J. Trop. For. Sci 4(2) 1-10 https://doi.org/10.31357/jtfe.v4i2.2063 Barstow M (2018) Pterocarpus dalbergioides . The IUCN Red List of Threatened Species:http://dx.doi.org/10.2305/IUCN.UK.2018-1.RLTS.T33261A67802958.en (assessed on 10 Oct 2017). But GW, Wu HY, Siu TY et al (2023) Comparison of DNA extraction methods on CITES-listed timber species and application in species authentication of commercial products using DNA barcoding. Sci. Rep. 13(1):151. https://doi.org/10.1038/s41598-022-27195-7 Chase MW, Cowan RS, Hollingsworth PM et al (2007) A proposal for a standardised protocol to barcode all land plants. Taxon .56(2):295-9. https://doi.org/10.1002/tax.562004 Chen QD, Li XM, Zeng J, L et al (2004) Introduction status and perspectives of Pterocarpus in China. Sci. Technol. 2, 38-41. Chen S, Yao H, Han J et al (2010) Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PloS One 5(1): e8613. https://doi.org/10.1371/journal.pone.0008613 Costion CM, Kress WJ, Crayn DM (2016) DNA barcodes confirm the taxonomic and conservation status of a species of tree on the brink of extinction in the Pacific. PLoS One 11(6): e0155118. https://doi.org/10.1371/journal.pone.0155118 De Mattia F, Bruni I, Galimberti A et al (2011) A comparative study of different DNA barcoding markers for the identification of some members of Lamiacaea. Food Res. Int. 44(3), 693-702 https://doi.org/10.1016/j.foodres.2010.12.032 . De Mattia F, Gentili R, Bruni I et al (2012) A multi-marker DNA barcoding approach to save time and resources in vegetation surveys. Bot. J. Linn. 169(3): 518-29. https://doi.org/10.1111/j.1095-8339.2012.01251.x Dormontt, EE, Boner M, Braun B et al (2015) Forensic timber identification: It's time to integrate disciplines to combat illegal logging. Biol. Conserv. 191: 790-8. https://doi.org/10.1016/j.biocon.2015.06.038 Fatima S, Zaidi NW, Verma N et al (2019) Comparative analysis of different DNA barcoding loci to discriminate among three Brassica species. Plant Syst. Evol . 305(9): 741-750. Ford CS, Ayres KL, Toomey N et al (2009). Selection of candidate coding DNA barcoding regions for use on land plants. Bot. J. Linn. 159(1): 1-1. https://doi.org/10.1111/j.1095-8339.2008.00938.x Han J, Pang X, Liao B et al (2016). An authenticity survey of herbal medicines from markets in China using DNA barcoding. Sci. Rep. 6(1): 18723. https://doi.org/10.1038/srep18723 Hassold S, Lowry PP, Bauert MR (2016) DNA barcoding of Malagasy rosewoods: towards a molecular identification of CITES-listed Dalbergia species. PLoS One . 11(6): e0157881. https://doi.org/10.1371/journal.pone.0157881 Jaisankar I, Sundaram S, Jerard BA et al (2020) Seed microstructures of the Andaman padauk ( Pterocarpus dalbergoides ). Curr. Sci. 119(3): 562-6. https://www.jstor.org/stable/27138894 Jansen PCM, Westphal E, Wulijarni-Soetjipto N et al (1995) Plant resources of South-East Asia 5(2). Timber trees: Minor commercial timbers. Leiden: Backhuys Publishers, 655 p. https://ui.adsabs.harvard.edu/link_gateway/1996KewBu..51..825G/doi:10.2307/4119744 Jiao L, Lu Y, He T et al (2020). DNA barcoding for wood identification: Global review of the last decade and future perspective. IAWA J. 41(4): 620-43. https://doi.org/10.1163/22941932-bja10041 Jiao L, Yu M, Wiedenhoeft AC et al (2018). DNA barcode authentication and library development for the wood of six commercial Pterocarpus species: the critical role of Xylarium specimens. Sci. Rep. 8(1): 1945. https://doi.org/10.1038/s41598-018-20381-6 Kang Y, Deng Z, Zang R et al (2017). DNA barcoding analysis and phylogenetic relationships of tree species in tropical cloud forests. Sci. Rep. 7(1): 12564. https://doi.org/10.1038/s41598-017-13057-0 Kress WJ, Wurdack KJ, Zimmer EA et al (2005) Use of DNA barcodes to identify flowering plants. Proceedings of the National Academy of Sciences 102(23): 8369-74. https://doi.org/10.1073/pnas.0503123102 Kumar S, Stecher G, Li M et al (2018) MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 35(6): 1547. https://doi.org/10.1093%2Fmolbev%2Fmsy096 Leigh JW, Bryant D (2015) POPART: full-feature software for haplotype network construction. Mol Biol Evol. 6(9): 1110-6. doi: 10.1111/2041-210X.12410 Lv T, Teng R, Shao Q et al (2015). DNA barcodes for the identification of Anoectochilus roxburghii and its adulterants. Planta . 242: 1167-74. https://doi.org/10.1007/s00425-015-2353-x Malik S, Kumar M, Kaur S, et al (2018) Barcoding of Indian Berberis species based on rbcL and matK gene fragments. 3 Biotech 8(3): 160. Mondal S, Surekhalandge V (2019) Ecological Status of Pterocarpus dalbergioides , the Endemic Timber Tree of Andaman and Nicobar Islands: Current Status and Management Issues. Forests , 10(8): 712. Ng FSP (1992) Pterocarpus indicus -the majestic N-fixing tree, Nitrogen Fixing Tree Association (NFTA) Pterocarpus indicus -the majestic N-fixing tree NFT Highlights (92-02). Pang X, Shi L, Song J et al (2013). Use of the potential DNA barcode ITS2 to identify herbal materials. J.Nat. Med. 67: 571-5. https://doi.org/10.1007/s11418-012-0715-2 Parkinson CE (1923) The forest flora of the Andaman Islands: An account of the trees, shrubs and principal climbers of the Islands. Superintendent, Government Central Press. Patil UH, Dattatraya KG (2011) Pterocarpus marsupium : A valuable medicinal plant in diabetes management. Int J Appl Biol Pharm 2 (3): 6-13. Prasad R, Maikhuri RK, Singh K et al (2008) Conservation of Pterocarpus dalbergioides : A State Tree of Andaman and Nicobar Islands, India. Int J Biodivers Sci Ecosyst Serv Manag , 4(3): 125-131. Rao A (1996). V. S. S. N. Flora of Andaman and Nicobar Islands. In Botanical Survey of India. Rao RS (2000) Resin tapping and oil yield of Pterocarpus dalbergioides Roxb. in relation to season and tree diameter. Indian For. 126(9): 962-969. Rozas J, Ferrer-Mata A, Sánchez-DelBarrio JC et al (2017). DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol Biol Evol. 34(12) : 3299-302. https://doi.org/10.1093/molbev/msx248 Saitou N, Nei M et al (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 4(4): 406-25. https://doi.org/10.1093/oxfordjournals.molbev.a040454 Senthilkumar N, Baby Shalini T, Lenora et al (2020) Pterocarpus indicus Willd: A Lesser Known Tree Species of Medicinal Importance. Asian J. Res. Bot. 3(4): 20-32. Shaw J, Lickey EB, Schilling EE et al (2007) Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. Am. J. of Bot. 94(3): 275-88. https://doi.org/10.3732/ajb.94.3.275 Suchard MA, Lemey P, Baele G et al (2018). Bayesian phylogenetic and phylodynamic data integration using BEAST 1.10. Virus Evol . 4(1): vey016. doi: 10.1093/ve/vey016 Sukhadiya M, Dholariya C, Behera LK et al (2019). Indian kino tree ( Pterocarpus marsupium roxb.): biography of excellent timber tree species. MFP NEWS 29(1): 4-8. Tamura K, Nei M (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 10(3): 51cc2-26. https://doi.org/10.1093/oxfordjournals.molbev.a040023 Tamura K, Nei M, Kumar S (2004). Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl Acad Sci. U.S.A. 101(30):11030-5. https://doi.org/10.1073/pnas.0404206101 Thompson JD, Gibson TJ, Plewniak F et al (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25(24): 4876-82. https://doi.org/10.1093/nar/25.24.4876 Tittensor DP, Walpole M, Hill SL et al (2014) A mid-term analysis of progress toward international biodiversity targets. Science . 346 (6206): 241-4. https://doi.org/10.1126/science.1257484 Yao H, Song J, Liu C et al (2010) Use of ITS2 region as the universal DNA barcode for plants and animals. PloS One . 5(10): e13102. https://doi.org/10.1371/journal.pone.0013102 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4287497","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":294452153,"identity":"4f8aa5d5-0d94-426a-91bf-1771d31a317b","order_by":0,"name":"Jaisankar Iyyappan","email":"","orcid":"","institution":"ICAR- Central Island Agricultural Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Jaisankar","middleName":"","lastName":"Iyyappan","suffix":""},{"id":294452154,"identity":"c20e5be3-2f46-4d0e-bc21-17cb28ad1ad9","order_by":1,"name":"Arun Kumar De","email":"","orcid":"","institution":"ICAR- Central Island Agricultural Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Arun","middleName":"Kumar","lastName":"De","suffix":""},{"id":294452160,"identity":"6a6c1dff-8d32-4d7f-bcab-1347a6f273c0","order_by":2,"name":"Prabhu Pari","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIiWNgGAWjYJCCA0CcYMDA//CBRAWQyczcQKwWHmYDizMgLYyEtTBAtbBJVLaB2AS0mLOffXi4cI9dnrlE7jGJm/Nqo/nbgVp+VGzDqcWyJ93g8IxnycWWM/KSLWduO5474zBjA2PPmds4tRgcSGM4zHOAOXHDjQTD25LbjuU2ALUwM7bh0XL+GUhLPUiLgfTfOcdy5xPUcgNsy2GglhwjCcmGmtwNhLRYzgDaMuPA8WKDM8+SDSSOHcjdCNRyEJ9fzPnTmD8XHKjOMziefPCBRE1d7rzzhw8++FGBx2FAzIzEPwwmD+BUj0VLHT7Fo2AUjIJRMEIBAKoVZIFXNsE6AAAAAElFTkSuQmCC","orcid":"","institution":"ICAR- Central Island Agricultural Research Institute","correspondingAuthor":true,"prefix":"","firstName":"Prabhu","middleName":"","lastName":"Pari","suffix":""},{"id":294452161,"identity":"b08b7f00-0ff7-440d-91b6-e44cb914d4e5","order_by":3,"name":"Manasseh Moses Ezekiel","email":"","orcid":"","institution":"ICAR-Central Island Agricultural Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Manasseh","middleName":"Moses","lastName":"Ezekiel","suffix":""}],"badges":[],"createdAt":"2024-04-18 11:42:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4287497/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4287497/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":55394662,"identity":"feb717fb-8ecc-4c0f-8b55-1b93182bf261","added_by":"auto","created_at":"2024-04-26 16:43:21","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":372407,"visible":true,"origin":"","legend":"\u003cp\u003eGeo reference map of collection sites of Andaman padauk (\u003cem\u003eP. dalbergioides\u003c/em\u003e).\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-4287497/v1/6632bcda98e4636329c8921d.png"},{"id":55394254,"identity":"a3312d28-1e8f-4e6f-ac12-cb05a069b320","added_by":"auto","created_at":"2024-04-26 16:35:20","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":962461,"visible":true,"origin":"","legend":"\u003cp\u003eGel image of Barcoding primers a) ITS2, (b) \u003cem\u003ematK\u003c/em\u003e, (c) \u003cem\u003erbcL.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-4287497/v1/a2cb1500b61da49fd3e7a506.png"},{"id":55394255,"identity":"41ed3b8b-5e1f-41ea-8e63-c80601de7f7a","added_by":"auto","created_at":"2024-04-26 16:35:20","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":408974,"visible":true,"origin":"","legend":"\u003cp\u003ePolymorphism Analysis of (a) ITS2, (b) \u003cem\u003ematK,\u003c/em\u003e (c)\u003cem\u003erbcL\u003c/em\u003e, (d) Concatenated sequences\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-4287497/v1/114df225f294c3dbe15bab47.png"},{"id":55394661,"identity":"919f6914-f3fb-4fb2-8445-18523dbd3f78","added_by":"auto","created_at":"2024-04-26 16:43:20","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1321409,"visible":true,"origin":"","legend":"\u003cp\u003eITS based phylogenetic relationship of Andaman padauk with different \u003cem\u003ePterocarpus \u003c/em\u003especies all over the world. (a) Neighbor Joining (NJ) phylogenetic tree, (b) Bayesian phylogenetic tree and (c) Network tree\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-4287497/v1/46b858adfe1fdd6357d89e74.png"},{"id":55394258,"identity":"629a7343-7ae3-45e3-926c-c009aa6a5b73","added_by":"auto","created_at":"2024-04-26 16:35:21","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":628088,"visible":true,"origin":"","legend":"\u003cp\u003eMatk based phylogenetic relationship of Andaman padauk with different \u003cem\u003ePterocarpus\u003c/em\u003e species all over the world. (a) Neighbor Joining (NJ) phylogenetic tree, (b) Bayesian phylogenetic tree and (c) Network tree\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-4287497/v1/52ac590bd1a2874ce71c6d7a.png"},{"id":55394259,"identity":"da28bb53-7ea5-4934-beb5-947eecea1896","added_by":"auto","created_at":"2024-04-26 16:35:21","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":449437,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003erbcL \u003c/em\u003ebased phylogenetic relationship of Andaman padauk with different \u003cem\u003ePterocarpus \u003c/em\u003especies all over the world.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-4287497/v1/41ac4f7fe381eb003e36c3fb.png"},{"id":58900528,"identity":"03c6119d-66cf-42b7-a840-61f4a8eb5d28","added_by":"auto","created_at":"2024-06-24 00:01:33","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4411267,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4287497/v1/15bf15c7-00ea-4c8f-8071-8b42b15e85fc.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"DNA barcoding of Andaman Padauk (Pterocarpus dalbergioides Roxb.,) an endemic tree species of Andaman and Nicobar Islands, India","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003ePterocarpus dalbergioides Roxb.\u003c/em\u003e, also known as Andaman Padauk, is an endemic tree species of the Andaman and Nicobar Islands and belongs to the family Fabaceae (Arunkumar and Joshi \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The islands of Andaman and Nicobar have a tropical rainforest shade with highly unique flora because of the tropical humid environment and insular nature of the territory (Rao \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). The Andaman and Nicobar Islands made of a blended verdure in with components from Indian, Myanmar, Malaysian and endemic flower strains (Mondal and Surekhalandge \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Andaman padauk is a dominant species in both semi-evergreen and moist deciduous Andaman forests, contributing high stem density and basal area in comparison to other species (Arunkumar and Joshi \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Prasad et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). This species holds significant cultural importance, serving as an important source of valuable timber and holding the esteemed position of being the state tree of the Andaman and Nicobar Islands (Arunkumar and Joshi \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Its versatility extends to ornamental and decorative applications, making it the primary timber tree in the Andaman and Nicobar Islands. The heartwood of this tree is prized for crafting high-quality furniture, contributing to a noteworthy economic transformation on the Island (Rao \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Mondal and Surekhalandge \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Beyond its utilitarian aspects, the Andaman pad auk wood is esteemed for its diverse array of colors, finding applications in a wide range of uses (Parkinson \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1923\u003c/span\u003e). This species is recognized by various local names, including Andaman red wood, East Indian mahogany, and narra (Mondal and Surekhalandge \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Over the last thirty years, the population of this species has experienced a significant decline of 30% due to extensive harvesting practices (Mondal and Surekhalandge \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The detrimental effects of logging activities and a diminished capacity for regeneration have collectively contributed to a negative trajectory in the population of the Andaman padauk tree. Due to the threat of extinction and low natural seed germination, the tree has been designated as a reserved tree. The FAO has emphasized the need for conservation initiatives in response to the species restricted distribution pattern and economic significance (Prasad et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Illicit logging and the illegal timber trade pose substantial challenges on both domestic and international scales, exerting detrimental impacts not only on individual species but also on entire forest ecosystems. Consequently, this issue affects both consumers and producers alike. Global efforts to tackle this problem encompass the implementation of legislation that prohibits or restricts the trade of timber derived unlawfully. (Jiao et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The species have been listed vulnerable in the IUCN red list (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.iucnredlist.org\u003c/span\u003e\u003cspan address=\"https://www.iucnredlist.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e ). Strict restrictions are imposed globally for trade through the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) (Dormontt et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Species of \u003cem\u003ePterocarpus\u003c/em\u003e are spread globally across countries specifically in tropical Asia, Africa, and South America (Ng \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e1992\u003c/span\u003e; Jansen et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Chen et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). In India variety of \u003cem\u003ePterocarpus\u003c/em\u003e species namely \u003cem\u003ePterocarpus santalinus\u003c/em\u003e, \u003cem\u003eP. marsupium\u003c/em\u003e, \u003cem\u003eP. indicus\u003c/em\u003e and \u003cem\u003eP. dalbergioides\u003c/em\u003e are present widely across India. In which most of the species has medicinal uses, ornamental and furniture making (Sukhadiya et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Arunkumar and Joshi \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Senthilkumar et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The application of DNA barcoding serves as a pivotal tool in addressing significant challenges, including the identification of illicit logging, illegal timber trade, and forensic wood analysis, which are prevalent issues of considerable concern both at local and global level (Jiao et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Hassold et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Jiao et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The need for species identification in forensic applications is propelled by escalating global apprehensions and the imperative for safeguarding biodiversity. This urgency is further emphasised by notable declines in biological diversity across various geographical, temporal, and biological dimensions. (Tittensor et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Various DNA barcodes, including \u003cem\u003erpoC1\u003c/em\u003e, \u003cem\u003ematK\u003c/em\u003e, \u003cem\u003erbcL, trnH-psbA\u003c/em\u003e, \u003cem\u003etrnH-\u003c/em\u003eITS, \u003cem\u003etrnH-psbA\u003c/em\u003e and ITS, have previously been used to assess genetic variability in plants. These indicators have been determined to be a strong possibility for identifying families, genus, and species (Malik et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; De Mattia et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; De Mattia et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Fatima et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The Plant Working Group of the Consortium for the Barcode of Life (CBOL) recommended \u003cem\u003ematK\u003c/em\u003e and \u003cspan refid=\"Sec12\" class=\"InternalRef\"\u003e\u003cem\u003erbcL\u003c/em\u003e\u003c/span\u003e sections as universal barcodes for plants (Ford et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). In the current study, ITS2, \u003cem\u003ematK\u003c/em\u003e, and \u003cem\u003erbcL\u003c/em\u003e barcoding loci were specifically chosen for amplification to elucidate the interspecific regions of a timber tree. The primary objective of this investigation focus on the demarcation of endemic Andaman padauk tree from closely related counterparts by DNA barcoding and support its endemic nature.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy Area\u003c/h2\u003e \u003cp\u003eThe study was undertaken at Andaman and Nicobar Islands, a conglomeration of 572 oceanic islands extending from 6\u0026deg; to 14\u0026deg; North latitudes and from 92\u0026deg; to 94\u0026deg; East longitudes. Situated inside the junction of Bay of Bengal and Indian Ocean on one facet and South China Sea and the Pacific Ocean on the opposite facet, these islands are a part of an archipelago unfold alongside 1120 km North to South. The predominant part of this archipelago constitutes five most important islands, four in Andaman (North, South, Middle and Little Andaman) and one in Nicobar (Great Nicobar). The weather of Andaman and Nicobar Islands is hot and humid throughout the year. The season can be divided into dry and rainy seasons with a mean annual temperature of 26.4\u0026deg;C. The average annual precipitation is around 3,100 mm, with mean relative humidity ranging from 65 to 89 percent.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003ePlant Materials and Collection Sites\u003c/h2\u003e \u003cp\u003eIn the present study, candidate plus trees of Andaman padauk were identified from 30 distinct locations encompassing South Andaman, North Andaman, Middle Andaman, Little Andaman, and Katchal (Nicobar group of islands) of the Andaman and Nicobar Islands (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Geo reference map was prepared for collection sites of Andaman padauk, the Andaman and Nicobar Island boundary shape file (.shp) was downloaded from \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.diva-gis.org/gdata\u003c/span\u003e\u003cspan address=\"http://www.diva-gis.org/gdata\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. The downloaded shape files (Country boundaries) are imposed in ArcGIS 10.5v (source from SAC-ISRO).\u003c/p\u003e \u003cp\u003eCriteria for selection included trees exceeding 20 meters in height, possessing a clear bole with a robust crown, and exhibiting a girth at breast height (GBH) ranging from 200 cm to 450 cm, along with a diameter at breast height (DBH) exceeding 100 cm. The sampling duration for seed collection extended from April to June 2019. Seed samples were gathered from the identified plants meeting the above specified criteria. Subsequently, these collected seed samples underwent an overnight soaking in water before being sowed in the mother bed in order to facilitate germination. To isolate DNA extraction, young leaf samples were collected from the seedlings raised in the nursery.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eLocations of collection sites of Andaman padauk\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAcc. No\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePlace\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLatitude\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLongitude\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAltitude (M)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTree Height (M)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eGBH (CM)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eDistrict\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJirkatang\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003csup\u003e\u0026bull;\u003c/sup\u003e50\u0026rsquo;20\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e39\u0026rsquo;14\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e320\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSippighat I\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003csup\u003e\u0026bull;\u003c/sup\u003e36\u0026rsquo;41\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e40\u0026rsquo;51\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e210\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSippighat II\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003csup\u003e\u0026bull;\u003c/sup\u003e36\u0026rsquo;42\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e40\u0026rsquo;57\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e220\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSippighat III\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003csup\u003e\u0026bull;\u003c/sup\u003e36\u0026rsquo;43\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e40\u0026rsquo;44\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e190\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e5\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRutland\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003csup\u003e\u0026bull;\u003c/sup\u003e26\u0026rsquo;29\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e38\u0026rsquo;25\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e157\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e210\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e6\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBurmanallah\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003csup\u003e\u0026bull;\u003c/sup\u003e32\u0026rsquo;56\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e43\u0026rsquo;08\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e396\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e7\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWrightmyo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003csup\u003e\u0026bull;\u003c/sup\u003e47\u0026rsquo;11\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e42\u0026rsquo;34\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e321\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMannarghat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003csup\u003e\u0026bull;\u003c/sup\u003e45\u0026rsquo;40\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e42\u0026rsquo;22\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e417\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e9\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHutbay\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003csup\u003e\u0026bull;\u003c/sup\u003e38\u0026rsquo;37\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e30\u0026rsquo;42\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e10\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNimbudera\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003csup\u003e\u0026bull;\u003c/sup\u003e43\u0026rsquo;24\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e53\u0026rsquo;08\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e420\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e11\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGandhi jetty\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003csup\u003e\u0026bull;\u003c/sup\u003e18\u0026rsquo;28\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e47\u0026rsquo;16\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e235\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e12\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNimbudera II\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003csup\u003e\u0026bull;\u003c/sup\u003e43\u0026rsquo;10\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e53\u0026rsquo;02\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e178\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e13\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKadamtala\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003csup\u003e\u0026bull;\u003c/sup\u003e20\u0026rsquo;00\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e47\u0026rsquo;04\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e390\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e14\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAdajig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003csup\u003e\u0026bull;\u003c/sup\u003e15\u0026rsquo;30\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e48\u0026rsquo;05\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e198\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e15\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBakultala\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003csup\u003e\u0026bull;\u003c/sup\u003e30\u0026rsquo;18\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e51\u0026rsquo;45\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e148\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRangath\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003csup\u003e\u0026bull;\u003c/sup\u003e30\u0026rsquo;11\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e53\u0026rsquo;45\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e198\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e17\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBakultala II\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003csup\u003e\u0026bull;\u003c/sup\u003e29\u0026rsquo;58\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e52\u0026rsquo;24\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e18\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBilliground\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003csup\u003e\u0026bull;\u003c/sup\u003e40\u0026rsquo;06\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e52\u0026rsquo;53\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e190\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e19\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKadamtala II\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003csup\u003e\u0026bull;\u003c/sup\u003e30\u0026rsquo;39\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e46\u0026rsquo;41\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e135\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e20\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLamiya Bay\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003csup\u003e\u0026bull;\u003c/sup\u003e12\u0026rsquo;19\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e93\u003csup\u003e\u0026bull;\u003c/sup\u003e01\u0026rsquo;22\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e480\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e21\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBuddha Nallah\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003csup\u003e\u0026bull;\u003c/sup\u003e33\u0026rsquo;21\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e52\u0026rsquo;17\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e185\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLampagram\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003csup\u003e\u0026bull;\u003c/sup\u003e14\u0026rsquo;29\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e93\u003csup\u003e\u0026bull;\u003c/sup\u003e00\u0026rsquo;47\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e210\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKalpong\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003csup\u003e\u0026bull;\u003c/sup\u003e13\u0026rsquo;59\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e57\u0026rsquo;48\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e420\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e24\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePembroke Bay\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003csup\u003e\u0026bull;\u003c/sup\u003e10\u0026rsquo;56\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e49\u0026rsquo;43\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e375\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e25\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKalapahad\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003csup\u003e\u0026bull;\u003c/sup\u003e09\u0026rsquo;55\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e49\u0026rsquo;33\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e26\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProlobjig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003csup\u003e\u0026bull;\u003c/sup\u003e23\u0026rsquo;44\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e53\u0026rsquo;19\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e480\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e27\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLong Island\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003csup\u003e\u0026bull;\u003c/sup\u003e23\u0026rsquo;34\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e56\u0026rsquo;06\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e390\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e28\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSastriNallah\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003csup\u003e\u0026bull;\u003c/sup\u003e14\u0026rsquo;55\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e49\u0026rsquo;35\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e167\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e29\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKalighat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003csup\u003e\u0026bull;\u003c/sup\u003e07\u0026rsquo;35\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003csup\u003e\u0026bull;\u003c/sup\u003e57\u0026rsquo;57\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e325\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e30\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKatchal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7\u003csup\u003e\u0026bull;\u003c/sup\u003e57\u0026rsquo;18\u0026rdquo;N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e93\u003csup\u003e\u0026bull;\u003c/sup\u003e21\u0026rsquo;53\u0026rdquo;E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e108\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e275\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNicobar\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"8\" nameend=\"c8\" namest=\"c1\"\u003e \u003cp\u003e\u0026bull; \u003cb\u003eNA \u0026ndash; North Andaman\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u0026bull; \u003cb\u003eSA \u0026ndash; South Andaman\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eGenomic DNA Isolation\u003c/h2\u003e \u003cp\u003eDNA isolated from the leaf of one-year-old seedlings. Around 2 gm of leaf samples from the respective accessions were used for genomic DNA isolation. Genomic DNA was extracted by CTAB extraction method using a commercially available DNA extraction kit (HiPurA\u003csup\u003eTM\u003c/sup\u003ePlant DNA Isolation Kit (CTAB Method), HiMedia Laboratories Pvt. Ltd., Mumbai, India) as per the protocol mentioned by the manufacturer. The isolated DNA samples were dissolved in Tris-EDTA (TE) buffer. The quality and concentration of isolated DNA samples were checked in a Bio Spectrometer (Eppendorf, Hamburg, Germany) at 260 and 280 nm wavelengths. DNA samples with 260/280 ratio between 1.7 to 1.9 were considered for further processing and stored at -80\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003ePCR Amplification and Sequencing of Candidate DNA Barcodes\u003c/h2\u003e \u003cp\u003eFor DNA barcoding of Andaman padauk, three established DNA barcoding loci namely Ribulose-1,5-bisphosphate carboxylase large subunit (\u003cem\u003erbcL\u003c/em\u003e), Maturase K (\u003cem\u003ematK\u003c/em\u003e) and Internal Transcribed Spacer 2 (ITS2) were chosen. DNA amplification was carried out in a 25 \u0026micro;l reaction mixture containing 2.5 \u0026micro;l 10X \u003cem\u003eTaq\u003c/em\u003e reaction buffer with 1.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.2 mM dNTPs, 1 \u0026micro;M each forward and reverse primer, 1 IU \u003cem\u003eTaq\u003c/em\u003e DNA polymerase (GCC Biotech Pvt. Ltd., West Bengal, India) and approximately 50 ng genomic DNA. The sequences of the primers used are presented in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. PCR reactions were carried out in a thermal cycler (Prima-96\u0026trade;, HiMedia Laboratories Pvt. Ltd., Mumbai, India) with the following cycling conditions; initial denaturation at 95 ˚C for 5 minutes, 35 cycles of denaturation at 95 ˚C for 30 seconds, annealing at 50 ˚C for 45 seconds, extension at 72 ˚C for 1 minute and a final extension at 72 ˚C for 7 minutes. Confirmation of the amplicons was done in 1.5% agarose gels following which the products were purified and sent to a commercial company (Eurofins Scientific India Pvt. Ltd., Bengaluru, India) for Sanger sequencing in both directions. The generated sequences were edited using Sequencher v 5.4.6 (Gene Codes Corporation, USA).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDetails of the primers used for barcoding\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBarcode loci\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequences (5'-3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003erbcL\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATGCGATACTTGGTGTGA\u003c/p\u003e \u003cp\u003eR: TAGCCCCGCCTGACCTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ematK\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CCRTCATCTGGAAATGTTGGTT\u003c/p\u003e \u003cp\u003eR: GCTRTRATAATGAGAAAGATTTCTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eITS2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATGTCACCACAAACAGAAAC\u003c/p\u003e \u003cp\u003eR: TCGCATGTACCTGCAGTAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics analysis\u003c/h2\u003e \u003cp\u003eRibulose-1,5-bisphosphate carboxylase large subunit (\u003cem\u003erbcL\u003c/em\u003e), Maturase K (\u003cem\u003ematK\u003c/em\u003e) and Internal Transcribed Spacer 2 (ITS2) sequences of 18 different \u003cem\u003ePterocarpus\u003c/em\u003e species from different parts of the world were retrieved from GenBank (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"https://www.iucnredlist.org\" target=\"_blank\"\u003ewww.ncbi.nlm.nih.gov\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) along with that 30 Andaman padauk barcoding (\u003cem\u003erbcL\u003c/em\u003e, \u003cem\u003ematK\u003c/em\u003e and ITS2) sequences generated in our study and \u003cem\u003eEucalyptus globulus\u003c/em\u003e subsp. \u003cem\u003emaidenii\u003c/em\u003e (ITS2), \u003cem\u003eEucalyptus haemastoma\u003c/em\u003e (\u003cem\u003ematK\u003c/em\u003e), \u003cem\u003eEucalyptus globulus\u003c/em\u003e (\u003cem\u003erbcL\u003c/em\u003e) were used as outgroup. All the sequences aligned using ClustalW programme (Thompson et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e1997\u003c/span\u003e). in MEGAX (Kumar et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Polymorphism and population diversity parameters like number of polymorphic sites, haplotype number and diversity, nucleotide diversity and DNA divergence between populations were computed by DnaSp v 6 (Rozas et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Maximum Composite Likelihood model (Tamura et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). implemented in MEGAX was used to compute pair-wise genetic distance among different sequences. Phylogenetic relationship among the sequences was inferred using the Neighbor-Joining method (Saitou and Nei 1987). with the Tamura-Nei model (Tamura et al. 1993). as implemented in MEGAX following 1,000 bootstrap replications. Bayesian phylogenetic analysis of the sequences was established using MCMC model in BEAST v1.10.4 (Suchard et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). To determine the evolutionary relationship among different sequences, median-joining networks were constructed in PopART ver. 1.7 (Leigh and Bryant \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). with default settings. For phylogenetic tree construction, we trimmed extra nucleotides from our sequences and GenBank retrieved sequences to make a homogeneous length.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eSequence information of the three barcoding loci (ITS2 complete sequence, \u003cem\u003erbcL\u003c/em\u003e partial sequence, and \u003cem\u003ematK\u003c/em\u003e partial sequence) were generated for thirty Andaman padauk isolates from different geographical regions from all three districts of Andaman and Nicobar Islands (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). (South Andaman 9, North and Middle Andaman 20, and Nicobar 1). Two chloroplast DNA barcoding loci (\u003cem\u003ematK\u003c/em\u003e and \u003cem\u003erbcL\u003c/em\u003e) recommended by the Consortium for the Barcode of Life (CBOL) and one nuclear barcoding locus (ITS2) (Chen et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). were used for molecular DNA barcoding of Andaman padauk. The PCR amplified products of rbcL, matK, and ITS2 are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Polymorphism Analysis\u003c/h2\u003e \u003cp\u003ePolymorphism Analysis of ITS2 sequence of the 30 isolates detected in which 2 variable /polymorphic sites including one singleton variable site and one parsimony informative site were found. A total of 30 haplotypes were observed with haplotype diversity of 0.421\u0026thinsp;\u0026plusmn;\u0026thinsp;0.087 (HD\u0026thinsp;\u0026plusmn;\u0026thinsp;SD). The nucleotide diversity (Pi\u0026thinsp;\u0026plusmn;\u0026thinsp;SD) of the sequences were 0.00181\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00041. The ITS2 based polygenetic relationship is presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e (a).\u003c/p\u003e\u003cp\u003eThree well defied clusters were observed, in which two clusters were found in north and middle Andaman and the sequences under the third cluster were distributed in all the three districts of Andaman and Nicobar. The \u003cem\u003ematK\u003c/em\u003e polygenetic analysis indicate seven polymorphic sites with two singleton variable sites and five parsimony informative sites. Total of five haplotypes are detected with haplotype diversity (HD\u0026thinsp;\u0026plusmn;\u0026thinsp;SD) of 0.662\u0026thinsp;\u0026plusmn;\u0026thinsp;0.073. The nucleotide diversity (Pi\u0026thinsp;\u0026plusmn;\u0026thinsp;SD) of the sequences was 0.00233\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00036. The geographical distribution of the sequences under five haplotypes are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e (b). Five well defined clusters of each haplotype were detected, one from south Andaman specific cluster and another three clusters were from north and middle Andaman, the rest three clusters were not of any region specific. The \u003cem\u003erbcL\u003c/em\u003e based polygenetic analysis indicate only two polymorphic sites, in which both were parsimony informative sites. Total of three haplotypes were detected with haplotype diversity of (HD\u0026thinsp;\u0026plusmn;\u0026thinsp;SD) 0.480\u0026thinsp;\u0026plusmn;\u0026thinsp;0.093. Nucleotide diversity of the sequence was (Pi\u0026thinsp;\u0026plusmn;\u0026thinsp;SD) 0.00097\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00020. The geographical distribution of the haplotypes is presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e (c). No region specific clusters were found. The concatenated sequences of the three markers were detected in fifteen haplotypes, within haplotype diversity of 0.915\u0026thinsp;\u0026plusmn;\u0026thinsp;0.031. The nucleotide diversity was 0.0016\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00019. The polygenetic relationship and geographical distribution of the haplotype is presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e (d). Total of nine haplotypes were found in north and middle Andaman specific, three were south Andaman specific and rest three were not region specific.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eITS2\u003c/h2\u003e \u003cp\u003eThe neighbor-joining phylogenetic tree and Bayesian phylogenetic tree, both based on ITS2 data, demonstrate distinct species specific clusters, revealing separate groupings for different species of genus \u003cem\u003ePetrocorpus.\u003c/em\u003e shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. Phylogenetic analysis revealed the close relationship of Andaman padauk (\u003cem\u003eP.dalbergioides\u003c/em\u003e) with \u003cem\u003eP. marsupium\u003c/em\u003e from India and \u003cem\u003eP. santalinus\u003c/em\u003e from China and India. Moreover, the ITS-based network tree demonstrated distinct clustering, with all 30 Andaman isolates forming separate and identifiable clusters. \u003cem\u003eP. santalinus\u003c/em\u003e from India and China; \u003cem\u003eP. marsupium\u003c/em\u003e from Coimbatore; \u003cem\u003eP. tinctorius\u003c/em\u003e from Republic of Congo and Tanzania; \u003cem\u003eP. acapulcensis\u003c/em\u003e of Venezuela and Mexico; \u003cem\u003eP.soyauxii\u003c/em\u003e from Cameroon and Gabon; \u003cem\u003eP. indicus\u003c/em\u003e from India, Indonesia and Malaysia; \u003cem\u003eP.angolensis\u003c/em\u003e from Angola and Zimbabwe: \u003cem\u003eP. rohri\u003c/em\u003e from Columbia, Gautemala, Mexico, Brazil and Bolivia; \u003cem\u003eP. mildbraedii\u003c/em\u003e of Nigeria and Tanzania; \u003cem\u003eP.erinaceus\u003c/em\u003e of Nigeria and Ghana formed separate groupings with respective species identity with very few exception. i.e. \u003cem\u003eP. ternatus\u003c/em\u003e and \u003cem\u003eP. zehntneri\u003c/em\u003e from Brazil grouped with \u003cem\u003eP. rohri.\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ematK\u003c/h2\u003e \u003cp\u003eThe evolutionary relationship between Andaman padauk (\u003cem\u003eP.dalbergioides\u003c/em\u003e) and various \u003cem\u003ePterocarpus\u003c/em\u003e species worldwide was analyzed using \u003cem\u003ematK\u003c/em\u003e-based data, depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. The analysis revealed two major clades: The Clade 1 includes \u003cem\u003eP. dalbergioides\u003c/em\u003e and \u003cem\u003eP. santalinus\u003c/em\u003e from India and China, \u003cem\u003eP. macrocarpus\u003c/em\u003e from Thailand, \u003cem\u003eP. marsupium\u003c/em\u003e from India, \u003cem\u003eP. angolensis\u003c/em\u003e from Angola and South Africa, and other related species from diverse regions such as Myanmar, Cambodia, Malaysia, Vietnam, Indonesia, Papua New Guinea, and Puerto Rico. The Clade 2 encompasses \u003cem\u003ePterocarpus\u003c/em\u003e species like \u003cem\u003eP. acapulcensis\u003c/em\u003e, \u003cem\u003eP. tinctorius\u003c/em\u003e, \u003cem\u003eP. rohri\u003c/em\u003e, \u003cem\u003eP. soyauxii\u003c/em\u003e, \u003cem\u003eP. ternatus\u003c/em\u003e, \u003cem\u003eP. erinaceus\u003c/em\u003e, \u003cem\u003eP. officinalis\u003c/em\u003e, \u003cem\u003eP. orbiculatus\u003c/em\u003e, \u003cem\u003eP. mildbraedii\u003c/em\u003e, and others, spread across regions like Venezuela, Congo, Tanzania, Brazil, Colombia, Mexico, Guatemala, Bolivia, Zimbabwe, Mozambique, Nigeria, Ghana, Puerto Rico, and more. The specific genetic analysis showed certain Andaman padauk isolates (\u003cem\u003eP. dalbergioides\u003c/em\u003e Andaman S1, S3, S21, S30, S6, S28, and S29) to be genetically close to \u003cem\u003eP. santalinus\u003c/em\u003e from India and China. Another group of Andaman padauk isolates (\u003cem\u003eP. dalbergioides\u003c/em\u003e Andaman S7, S20, S23, S24, S25, S26, and S27) appeared genetically proximate to \u003cem\u003eP. santalinus\u003c/em\u003e of India and China, along with distinct genetic clusters observed in other isolates of \u003cem\u003eP. dalbergioides\u003c/em\u003e from the Andaman region. In the network trees depicting the relationship among \u003cem\u003ePterocarpus\u003c/em\u003e species, Andaman padauk (\u003cem\u003eP\u003c/em\u003e. \u003cem\u003edalbergioides\u003c/em\u003e) clustered with \u003cem\u003eP. santalinus\u003c/em\u003e, \u003cem\u003eP. marsupium\u003c/em\u003e, \u003cem\u003eP. indicus\u003c/em\u003e, \u003cem\u003eP. macrocarpus\u003c/em\u003e, and \u003cem\u003eP. angolensis\u003c/em\u003e. Overall, the matK-based evolutionary analysis highlighted distinct genetic groupings and relationships among various \u003cem\u003ePterocarpus\u003c/em\u003e species, elucidating the genetic closeness of Andaman padauk to specific counterparts within the \u003cem\u003ePterocarpus\u003c/em\u003e genus across different geographic locations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003erbcL\u003c/h2\u003e \u003cp\u003eA neighbor-joining tree was generated using \u003cem\u003erbcL\u003c/em\u003e gene sequences, the analysis unveiled distinct clustering patterns unlike ITS2 and \u003cem\u003ematK\u003c/em\u003e there is no clear species delineation was observed Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. Six different clusters were formed without any species-specific clusters. cluster 1 included Andaman padauk (\u003cem\u003eP.dalbergioides\u003c/em\u003e) isolates S1, S2, S9, S11, S12, S22, S23, S24, and S28, showing genetic proximity to \u003cem\u003eP.soyauxii\u003c/em\u003e of Cameroon, \u003cem\u003eP.officinalis\u003c/em\u003e of Puerto Rico, and \u003cem\u003eP. macrocarpus\u003c/em\u003e of Myanmar. Cluster 2 Isolates S29, S18, S7, S14, and S21 clustered with \u003cem\u003eP. indicus\u003c/em\u003e of Indonesia, \u003cem\u003eP. marsupium\u003c/em\u003e of India, \u003cem\u003eP. santalinus\u003c/em\u003e of India, and \u003cem\u003eP.tinctorius\u003c/em\u003e of Congo. Group 3 comprised isolates S15 and S25, closely associated with \u003cem\u003eP\u003c/em\u003e.\u003cem\u003eindicus\u003c/em\u003e of Malaysia, \u003cem\u003eP. marsupium\u003c/em\u003e of India, \u003cem\u003eP. officinalis\u003c/em\u003e of Guatemala, and \u003cem\u003eP.rohrii\u003c/em\u003e of Brazil. Cluster 4, isolates S4, S10, and S19 (Group 4) displayed genetic similarities with \u003cem\u003eP. angolensis\u003c/em\u003e of Angola and Mozambique, \u003cem\u003eP. santalinus\u003c/em\u003e of China, \u003cem\u003eP.macrocarpus\u003c/em\u003eof Myanmar, and \u003cem\u003eP.indicus\u003c/em\u003e of China. Group 5, represented by S5, S13, S20, and S30, showed close relations to \u003cem\u003eP.acapulcensis\u003c/em\u003e of Venezuela, \u003cem\u003eP.santalinus\u003c/em\u003e of India and China, \u003cem\u003eP. marsupium\u003c/em\u003e of India, and \u003cem\u003eP.indicus\u003c/em\u003eof China. Finally, Group 6 encompassing isolates S3, S8, S17, S27, S6, S16, and S26 exhibited proximity to various species including \u003cem\u003eP.indicus\u003c/em\u003e of Papua New Guinea, \u003cem\u003eP.mildbraedii\u003c/em\u003eof Nigeria, \u003cem\u003eP.orbiculatus\u003c/em\u003e of Mexico, \u003cem\u003eP.rohrii\u003c/em\u003efound across Mexico, Guatemala, Bolivia, Brazil, Colombia, and French Guiana, \u003cem\u003eP. ternatus\u003c/em\u003e of Brazil, and \u003cem\u003eP. santalinus\u003c/em\u003e of India.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe primary objective of this investigation is to elucidate the distinctiveness of the endemic Andaman padauk species (\u003cem\u003ePterocarpus dalbergioides\u003c/em\u003e) in comparison to other closely related \u003cem\u003ePterocarpus\u003c/em\u003e species, with help of DNA barcoding. DNA barcoding proves to be an ideal tool for the discriminate and identification of species. In this study, three DNA barcoding regions were employed, namely the nuclear ribosomal DNA region Internal Transcribed Spacer 2 (ITS2), and two plastid DNA barcodes, ribulose-1,5-bisphosphate carboxylase large subunit (\u003cem\u003erbcL\u003c/em\u003e) and maturase K (\u003cem\u003ematK\u003c/em\u003e). Notably, ITS2 demonstrated the highest discriminatory power among the three barcodes examined. The superior identification capabilities of the nuclear DNA region ITS2 over the plastid barcodes \u003cem\u003erbcL\u003c/em\u003e and \u003cem\u003ematK\u003c/em\u003e are in line with findings from previous studies. This reaffirms the effectiveness of ITS2 in distinguishing between closely related species within the \u003cem\u003ePterocarpus\u003c/em\u003e genus (Chen et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Shaw et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Ly et al. 2015; Yao et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Pang et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Han et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). While the chloroplast DNA regions \u003cem\u003erbcL\u003c/em\u003e and \u003cem\u003ematK\u003c/em\u003e were initially advocated as core barcodes for seed plants by the Consortium for the Barcode of Life Plant Working Group, our study revealed a lower species resolution for \u003cem\u003ePterocarpus\u003c/em\u003e when using these two regions, particularly the \u003cem\u003erbcL\u003c/em\u003e region. This observation aligns with the findings of a study conducted by (Jiao et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Despite their widespread use in phylogenetic analyses, with over 130,000 sequences available in Genbank, both \u003cem\u003erbcL\u003c/em\u003e and \u003cem\u003ematK\u003c/em\u003e exhibited limitations in accurately resolving species within the \u003cem\u003ePterocarpus\u003c/em\u003e genus. Kress et al. (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2005\u003c/span\u003e) previously demonstrated that the \u003cem\u003erbcL\u003c/em\u003e sequence evolves slowly, and this barcode is recognized for having the lowest divergence among studied plastid genes in flowering plants. Consequently, on average, it may not be sufficiently informative for species-level identification. Additionally, \u003cem\u003ematK\u003c/em\u003e has demonstrated varying success rates in discriminating species across different taxonomic groups. For instance, it effectively discriminates more than 90% of species in the Orchidaceae, but its discriminatory power falls below 49% for species in the nutmeg family. In contrast, our study highlights the superior performance of the nuclear DNA region ITS2 in providing enhanced species resolution for \u003cem\u003ePterocarpus\u003c/em\u003e. These observations emphasize the need for a careful selection of DNA barcodes based on their efficacy within specific taxonomic groups. In this context, the ITS2 loci emerge as the most suitable single barcode region for distinguishing \u003cem\u003ePterocarpus\u003c/em\u003e (Chase et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Kang et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) DNA extracted from wood of \u003cem\u003ePterocarpus\u003c/em\u003e also shows better amplification and high discrimination with ITS2 (But et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In this investigation, a comprehensive analysis was undertaken by comparing the Internal Transcribed Spacer 2 (ITS2) sequences of 30 Andaman padauk accessions with those of 16 closely related \u003cem\u003ePterocarpus\u003c/em\u003e species obtained from GenBank, originating from diverse global locations. The resulting Neighbor-Joining (NJ) tree, constructed based on the ITS2 sequence data, revealed distinct species-specific clusters. Notably, all 30 Andaman padauk accessions formed a unique cluster clearly different from other related species and similar reports were not found globally, it providing molecular evidence that supports the endemism of \u003cem\u003ePterocarpus dalbergioides\u003c/em\u003e to the Andaman and Nicobar Islands. This finding is consistent with previous research conducted by (Jaisankar et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Prasad et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Similarly, DNA barcoding techniques were employed to confirm the distinctiveness of a narrowly distributed endemic tree within the Rubiaceae family on Palau Island in Micronesia. The results indicated that this tree is likely a distinct species within the \u003cem\u003eTimonius\u003c/em\u003e genus, as revealed in the study conducted by (Costion et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Beyond its taxonomic significance, the Andaman padauk (\u003cem\u003eP. dalbergioides\u003c/em\u003e) holds ecological and economic importance as an endemic tree species with high timber value. Recognizing the critical role of DNA barcoding in species identification, this study emphasizes its potential application in curbing illegal trading and ensuring accurate species identification in the market. Illegal trading poses a substantial threat to the Andaman padauk due to its valuable timber. By leveraging DNA barcoding, a robust and reliable method for species identification, we can establish a stringent mechanism to verify the authenticity of Andaman padauk products in the market. This approach acts as a powerful deterrent against the misrepresentation of other tree species as Andaman padauk, mitigating the risk of unauthorized trade and ensuring the sustainability of the species.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, the study successfully utilized DNA barcoding to distinguish Andaman padauk (\u003cem\u003ePterocarpus dalbergioides\u003c/em\u003e) from closely related species, emphasizing the efficacy of ITS2 in species resolution. Molecular evidence supports the endemic nature of Andaman padauk, emphasising its ecological and economic significance. DNA barcoding offers a robust method for accurate species identification, crucial for conservation and trade regulation.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical approval:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis article contains no studies on human or animal objects\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors express their gratitude to Department of Environment, Forests and Climate change for approval to collect the seeds for this study. The authors are also thankful to the Director of ICAR-CIARI, Port Blair for providing Institute facilities and constant encouragement during the study period.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Department of Biotechnology (DBT), Ministry of Science \u0026amp; Technology, Government of India, India (grant number BT/PR29179/FCB/125/7/2018).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions:\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIJ conceived and supervised the overall execution of the project, PP prepared the manuscript, AKD \u0026amp; EMM assisted in analysis \u0026amp; sample collection.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eArunkumar AN, Joshi G (2014) \u003cem\u003ePterocarpus santalinus\u003c/em\u003e (Red Sanders) an Endemic, Endangered Tree of India: Current Status, Improvement and the Future. \u003cem\u003eJ. Trop. For. Sci\u003c/em\u003e 4(2) 1-10 https://doi.org/10.31357/jtfe.v4i2.2063 \u003c/li\u003e\n\u003cli\u003eBarstow M (2018) \u003cem\u003ePterocarpus dalbergioides\u003c/em\u003e. The IUCN Red List of Threatened Species:http://dx.doi.org/10.2305/IUCN.UK.2018-1.RLTS.T33261A67802958.en (assessed on 10 Oct 2017).\u003c/li\u003e\n\u003cli\u003eBut GW, Wu HY, Siu TY et al (2023) Comparison of DNA extraction methods on CITES-listed timber species and application in species authentication of commercial products using DNA barcoding. \u003cem\u003eSci. Rep.\u003c/em\u003e 13(1):151. https://doi.org/10.1038/s41598-022-27195-7 \u003c/li\u003e\n\u003cli\u003eChase MW, Cowan RS, Hollingsworth PM et al (2007) A proposal for a standardised protocol to barcode all land plants. \u003cem\u003eTaxon\u003c/em\u003e.56(2):295-9. https://doi.org/10.1002/tax.562004 \u003c/li\u003e\n\u003cli\u003eChen QD, Li XM, Zeng J, L et al (2004) Introduction status and perspectives of \u003cem\u003ePterocarpus\u003c/em\u003e in China. \u003cem\u003eSci. Technol.\u003c/em\u003e 2, 38-41.\u003c/li\u003e\n\u003cli\u003eChen S, Yao H, Han J et al (2010) Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. \u003cem\u003ePloS One\u003c/em\u003e 5(1): e8613. https://doi.org/10.1371/journal.pone.0008613 \u003c/li\u003e\n\u003cli\u003eCostion CM, Kress WJ, Crayn DM (2016) DNA barcodes confirm the taxonomic and conservation status of a species of tree on the brink of extinction in the Pacific. \u003cem\u003ePLoS One\u003c/em\u003e 11(6): e0155118. https://doi.org/10.1371/journal.pone.0155118 \u003c/li\u003e\n\u003cli\u003eDe Mattia F, Bruni I, Galimberti A et al (2011) A comparative study of different DNA barcoding markers for the identification of some members of Lamiacaea. \u003cem\u003eFood Res. Int.\u003c/em\u003e 44(3), 693-702 https://doi.org/10.1016/j.foodres.2010.12.032 .\u003c/li\u003e\n\u003cli\u003eDe Mattia F, Gentili R, Bruni I et al (2012) A multi-marker DNA barcoding approach to save time and resources in vegetation surveys. \u003cem\u003eBot. J. Linn.\u003c/em\u003e 169(3): 518-29. https://doi.org/10.1111/j.1095-8339.2012.01251.x \u003c/li\u003e\n\u003cli\u003eDormontt, EE, Boner M, Braun B et al (2015) Forensic timber identification: It\u0026apos;s time to integrate disciplines to combat illegal logging. \u003cem\u003eBiol. Conserv.\u003c/em\u003e 191: 790-8. https://doi.org/10.1016/j.biocon.2015.06.038 \u003c/li\u003e\n\u003cli\u003eFatima S, Zaidi NW, Verma N et al (2019) Comparative analysis of different DNA barcoding loci to discriminate among three Brassica species. \u003cem\u003ePlant Syst. Evol\u003c/em\u003e. 305(9): 741-750.\u003c/li\u003e\n\u003cli\u003eFord CS, Ayres KL, Toomey N et al (2009). Selection of candidate coding DNA barcoding regions for use on land plants. \u003cem\u003eBot. J. Linn.\u003c/em\u003e 159(1): 1-1. https://doi.org/10.1111/j.1095-8339.2008.00938.x \u003c/li\u003e\n\u003cli\u003eHan J, Pang X, Liao B et al (2016). An authenticity survey of herbal medicines from markets in China using DNA barcoding. \u003cem\u003eSci. Rep.\u003c/em\u003e 6(1): 18723. https://doi.org/10.1038/srep18723 \u003c/li\u003e\n\u003cli\u003eHassold S, Lowry PP, Bauert MR (2016) DNA barcoding of Malagasy rosewoods: towards a molecular identification of CITES-listed \u003cem\u003eDalbergia\u003c/em\u003e species. \u003cem\u003ePLoS One\u003c/em\u003e. 11(6): e0157881. https://doi.org/10.1371/journal.pone.0157881 \u003c/li\u003e\n\u003cli\u003eJaisankar I, Sundaram S, Jerard BA et al (2020) Seed microstructures of the Andaman padauk (\u003cem\u003ePterocarpus dalbergoides\u003c/em\u003e). \u003cem\u003eCurr. Sci.\u003c/em\u003e 119(3): 562-6. https://www.jstor.org/stable/27138894 \u003c/li\u003e\n\u003cli\u003eJansen PCM, Westphal E, Wulijarni-Soetjipto N et al (1995) Plant resources of South-East Asia 5(2). Timber trees: Minor commercial timbers. Leiden: Backhuys Publishers, 655 p. https://ui.adsabs.harvard.edu/link_gateway/1996KewBu..51..825G/doi:10.2307/4119744 \u003c/li\u003e\n\u003cli\u003eJiao L, Lu Y, He T et al (2020). DNA barcoding for wood identification: Global review of the last decade and future perspective. \u003cem\u003eIAWA J.\u003c/em\u003e 41(4): 620-43. https://doi.org/10.1163/22941932-bja10041 \u003c/li\u003e\n\u003cli\u003eJiao L, Yu M, Wiedenhoeft AC et al (2018). DNA barcode authentication and library development for the wood of six commercial \u003cem\u003ePterocarpus\u003c/em\u003e species: the critical role of \u003cem\u003eXylarium\u003c/em\u003e specimens. \u003cem\u003eSci. Rep.\u003c/em\u003e 8(1): 1945. https://doi.org/10.1038/s41598-018-20381-6 \u003c/li\u003e\n\u003cli\u003eKang Y, Deng Z, Zang R et al (2017). DNA barcoding analysis and phylogenetic relationships of tree species in tropical cloud forests. \u003cem\u003eSci. Rep.\u003c/em\u003e7(1): 12564. https://doi.org/10.1038/s41598-017-13057-0 \u003c/li\u003e\n\u003cli\u003eKress WJ, Wurdack KJ, Zimmer EA et al (2005) Use of DNA barcodes to identify flowering plants. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e 102(23): 8369-74. https://doi.org/10.1073/pnas.0503123102 \u003c/li\u003e\n\u003cli\u003eKumar S, Stecher G, Li M et al (2018) MEGA X: molecular evolutionary genetics analysis across computing platforms. \u003cem\u003eMol Biol Evol.\u003c/em\u003e 35(6): 1547. https://doi.org/10.1093%2Fmolbev%2Fmsy096 \u003c/li\u003e\n\u003cli\u003eLeigh JW, Bryant D (2015) POPART: full-feature software for haplotype network construction. \u003cem\u003eMol Biol Evol.\u003c/em\u003e 6(9): 1110-6. doi: 10.1111/2041-210X.12410 \u003c/li\u003e\n\u003cli\u003eLv T, Teng R, Shao Q et al (2015). DNA barcodes for the identification of \u003cem\u003eAnoectochilus roxburghii\u003c/em\u003e and its adulterants. \u003cem\u003ePlanta\u003c/em\u003e. 242: 1167-74. https://doi.org/10.1007/s00425-015-2353-x \u003c/li\u003e\n\u003cli\u003eMalik S, Kumar M, Kaur S, et al (2018) Barcoding of Indian Berberis species based on \u003cem\u003erbcL\u003c/em\u003e and \u003cem\u003ematK\u003c/em\u003e gene fragments. \u003cem\u003e3 Biotech\u003c/em\u003e 8(3): 160.\u003c/li\u003e\n\u003cli\u003eMondal S, Surekhalandge V (2019) Ecological Status of \u003cem\u003ePterocarpus dalbergioides\u003c/em\u003e, the Endemic Timber Tree of Andaman and Nicobar Islands: Current Status and Management Issues. \u003cem\u003eForests\u003c/em\u003e, 10(8): 712.\u003c/li\u003e\n\u003cli\u003eNg FSP (1992) \u003cem\u003ePterocarpus indicus\u003c/em\u003e-the majestic N-fixing tree, Nitrogen Fixing Tree Association (NFTA) \u003cem\u003ePterocarpus indicus\u003c/em\u003e-the majestic N-fixing tree \u003cem\u003eNFT Highlights\u003c/em\u003e (92-02).\u003c/li\u003e\n\u003cli\u003ePang X, Shi L, Song J et al (2013). Use of the potential DNA barcode ITS2 to identify herbal materials. \u003cem\u003eJ.Nat. Med.\u003c/em\u003e 67: 571-5. https://doi.org/10.1007/s11418-012-0715-2 \u003c/li\u003e\n\u003cli\u003eParkinson CE (1923) The forest flora of the Andaman Islands: An account of the trees, shrubs and principal climbers of the Islands. Superintendent, Government Central Press.\u003c/li\u003e\n\u003cli\u003ePatil UH, Dattatraya KG (2011) \u003cem\u003ePterocarpus marsupium\u003c/em\u003e: A valuable medicinal plant in diabetes management. \u003cem\u003eInt J Appl Biol Pharm\u003c/em\u003e 2 (3): 6-13.\u003c/li\u003e\n\u003cli\u003ePrasad R, Maikhuri RK, Singh K et al (2008) Conservation of \u003cem\u003ePterocarpus dalbergioides\u003c/em\u003e: A State Tree of Andaman and Nicobar Islands, India. \u003cem\u003eInt J Biodivers Sci Ecosyst Serv Manag\u003c/em\u003e, 4(3): 125-131.\u003c/li\u003e\n\u003cli\u003eRao A (1996). V. S. S. N. Flora of Andaman and Nicobar Islands. In Botanical Survey of India.\u003c/li\u003e\n\u003cli\u003eRao RS (2000) Resin tapping and oil yield of \u003cem\u003ePterocarpus dalbergioides\u003c/em\u003e Roxb. in relation to season and tree diameter. \u003cem\u003eIndian For.\u003c/em\u003e 126(9): 962-969.\u003c/li\u003e\n\u003cli\u003eRozas J, Ferrer-Mata A, S\u0026aacute;nchez-DelBarrio JC et al (2017). DnaSP 6: DNA sequence polymorphism analysis of large data sets. \u003cem\u003eMol Biol Evol.\u003c/em\u003e 34(12) : 3299-302. https://doi.org/10.1093/molbev/msx248 \u003c/li\u003e\n\u003cli\u003eSaitou N, Nei M et al (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. \u003cem\u003eMol Biol Evol.\u003c/em\u003e 4(4): 406-25. https://doi.org/10.1093/oxfordjournals.molbev.a040454 \u003c/li\u003e\n\u003cli\u003eSenthilkumar N, Baby Shalini T, Lenora et al (2020) \u003cem\u003ePterocarpus indicus\u003c/em\u003e Willd: A Lesser Known Tree Species of Medicinal Importance. \u003cem\u003eAsian J. Res. Bot.\u003c/em\u003e3(4): 20-32.\u003c/li\u003e\n\u003cli\u003eShaw J, Lickey EB, Schilling EE et al (2007) Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. \u003cem\u003eAm. J. of Bot.\u003c/em\u003e 94(3): 275-88. https://doi.org/10.3732/ajb.94.3.275 \u003c/li\u003e\n\u003cli\u003eSuchard MA, Lemey P, Baele G et al (2018). Bayesian phylogenetic and phylodynamic data integration using BEAST 1.10. \u003cem\u003eVirus Evol\u003c/em\u003e. 4(1): vey016. doi: 10.1093/ve/vey016\u003c/li\u003e\n\u003cli\u003eSukhadiya M, Dholariya C, Behera LK et al (2019). Indian kino tree (\u003cem\u003ePterocarpus\u003c/em\u003e\u003cem\u003emarsupium\u003c/em\u003e roxb.): biography of excellent timber tree species. \u003cem\u003eMFP NEWS\u003c/em\u003e 29(1): 4-8.\u003c/li\u003e\n\u003cli\u003eTamura K, Nei M (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. \u003cem\u003eMol Biol Evol.\u003c/em\u003e 10(3): 51cc2-26. https://doi.org/10.1093/oxfordjournals.molbev.a040023 \u003c/li\u003e\n\u003cli\u003eTamura K, Nei M, Kumar S (2004). Prospects for inferring very large phylogenies by using the neighbor-joining method. \u003cem\u003eProc. Natl Acad Sci. U.S.A.\u003c/em\u003e 101(30):11030-5. https://doi.org/10.1073/pnas.0404206101 \u003c/li\u003e\n\u003cli\u003eThompson JD, Gibson TJ, Plewniak F et al (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 25(24): 4876-82. https://doi.org/10.1093/nar/25.24.4876 \u003c/li\u003e\n\u003cli\u003eTittensor DP, Walpole M, Hill SL et al (2014) A mid-term analysis of progress toward international biodiversity targets. \u003cem\u003eScience\u003c/em\u003e. 346 (6206): 241-4. https://doi.org/10.1126/science.1257484 \u003c/li\u003e\n\u003cli\u003eYao H, Song J, Liu C et al (2010) Use of ITS2 region as the universal DNA barcode for plants and animals. \u003cem\u003ePloS One\u003c/em\u003e. 5(10): e13102. https://doi.org/10.1371/journal.pone.0013102\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Pterocarpus dalbergioides, DNA barcoding, ITS2, matK, rbcL, endemic species, conservation, Andaman and Nicobar Islands","lastPublishedDoi":"10.21203/rs.3.rs-4287497/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4287497/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe research investigates the genetic distinctiveness of \u003cem\u003ePterocarpus dalbergioides\u003c/em\u003e Roxb., commonly known as Andaman padauk, an endemic tree species of the Andaman and Nicobar Islands. The study employs DNA barcoding techniques, focusing on three barcode loci (ITS2, \u003cem\u003ematK\u003c/em\u003e, and \u003cem\u003erbcL\u003c/em\u003e), to discern the species from closely related counterparts within the \u003cem\u003ePterocarpus\u003c/em\u003e genus. Sampling from 30 distinct locations across the Andaman and Nicobar Islands, genomic DNA isolation, PCR amplification, and sequencing were done. Polymorphism analysis revealed varying degrees of genetic diversity across the three barcode loci, with ITS2 demonstrating the highest discriminatory power. Phylogenetic analyses based on ITS2, \u003cem\u003ematK\u003c/em\u003e, and \u003cem\u003erbcL\u003c/em\u003e sequences elucidated distinct species-specific clusters, reaffirming the endemic nature of \u003cem\u003eP. dalbergioides\u003c/em\u003e to the Andaman and Nicobar Islands. Notably, ITS2 proved superior in species resolution compared to plastid barcodes \u003cem\u003e(matK\u003c/em\u003e and \u003cem\u003erbcL\u003c/em\u003e). The study highlighted the utility of DNA barcoding in accurately identifying species, particularly in distinguishing closely related taxa within the \u003cem\u003ePterocarpus\u003c/em\u003e genus. The findings highlight the ecological and economic significance of \u003cem\u003eP. dalbergioides\u003c/em\u003e as a valuable timber species and emphasize the importance of DNA barcoding in combating illegal trade and ensuring the sustainable management of endemic tree species. Overall, the research contributes to our understanding of the genetic diversity and conservation of \u003cem\u003eP. dalbergioides\u003c/em\u003e, offering insights into its evolutionary relationships and aiding in the development of conservation strategies.\u003c/p\u003e","manuscriptTitle":"DNA barcoding of Andaman Padauk (Pterocarpus dalbergioides Roxb.,) an endemic tree species of Andaman and Nicobar Islands, India","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-26 16:35:16","doi":"10.21203/rs.3.rs-4287497/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8879d5bb-2713-4c7e-8d20-2879742267a0","owner":[],"postedDate":"April 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-06-23T23:53:20+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-26 16:35:16","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4287497","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4287497","identity":"rs-4287497","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00