Partial unidirectional translocation from 5AL to 7BS leads to dense spike in an EMS-induced wheat mutant

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background As the inflorescence of wheat, spike architecture largely determines grain productivity. Dissecting the genetic basis for spike morphology of wheat can contribute towards designation of ideal spike morphology to improve grain production. Results In this study, we characterized an EMS-induced mutant dense spike1 (ds1) from Nongda3753 (ND3753) with a dense spike and reduced plant height. Using bulked segregant analysis coupled with whole-genome sequencing (BSA-Seq) of two segregating populations, ds1 was mapped to the short arm of chromosome 7B. Further genotypic and phenotypic analyses of the residual heterozygous lines from F3 to F6 of Yong3002×ds1 revealed that there was a 0-135Mb deletion in chromosome 7B associated with the dense spike phenotype. The reads count analysis of the two bulks in BSA-Seq along with the cytological analysis of ds1, ND3753, NIL-ds1 and NIL-Y3002 confirmed the partial unidirectional translocation of 5AL (541-713Mb) to 7BS (0-135Mb) in ds1. This translocation resulted in an increase in copy number and expression of Q gene, thereby leading to the dense spike phenotype observed in ds1. Conclusion We identified a partial unidirectional translocation from 5AL to 7BS in an EMS-induced mutant ds1, which exhibiting dense spike phenotype. This research deepens our understanding of the dosage-dependent effect of Q gene on wheat spike morphology, and provides new materials with several chromosome structural variations for wheat breeding.
Full text 124,958 characters · extracted from preprint-html · click to expand
Partial unidirectional translocation from 5AL to 7BS leads to dense spike in an EMS-induced wheat mutant | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Partial unidirectional translocation from 5AL to 7BS leads to dense spike in an EMS-induced wheat mutant Xiaoyu Zhang, Yongfa Wang, Yongming Chen, Yazhou Li, Kai Guo, and 11 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4927595/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 12 Nov, 2024 Read the published version in BMC Genomics → Version 1 posted 4 You are reading this latest preprint version Abstract Background As the inflorescence of wheat, spike architecture largely determines grain productivity. Dissecting the genetic basis for spike morphology of wheat can contribute towards designation of ideal spike morphology to improve grain production. Results In this study, we characterized an EMS-induced mutant dense spike1 ( ds1 ) from Nongda3753 (ND3753) with a dense spike and reduced plant height. Using bulked segregant analysis coupled with whole-genome sequencing (BSA-Seq) of two segregating populations, ds1 was mapped to the short arm of chromosome 7B. Further genotypic and phenotypic analyses of the residual heterozygous lines from F 3 to F 6 of Yong3002× ds1 revealed that there was a 0-135Mb deletion in chromosome 7B associated with the dense spike phenotype. The reads count analysis of the two bulks in BSA-Seq along with the cytological analysis of ds1 , ND3753, NIL- ds1 and NIL-Y3002 confirmed the partial unidirectional translocation of 5AL (541-713Mb) to 7BS (0-135Mb) in ds1 . This translocation resulted in an increase in copy number and expression of Q gene, thereby leading to the dense spike phenotype observed in ds1 . Conclusion We identified a partial unidirectional translocation from 5AL to 7BS in an EMS-induced mutant ds1 , which exhibiting dense spike phenotype. This research deepens our understanding of the dosage-dependent effect of Q gene on wheat spike morphology, and provides new materials with several chromosome structural variations for wheat breeding. Triticum aestivum L. EMS-induced mutant chromosomal translocation dense spike Q gene Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Common wheat ( Triticum aestivum L.) is an important cereal crop and supplies ~ 20% of daily calorie intake for humans [ 1 ]. To sustainably support the ever-increasing world population and farming profitability, wheat productivity must increase under fewer production hectares. The spike or inflorescence is the most prominent part of cereal crops, producing carbohydrate-rich grains that are harvested for food, feed, and fiber [ 2 ]. Modifying spike with higher grain capacity is vital for wheat grain production. Spike morphology is a crucial agronomic character, depending on spike length and spikelet number, which is greatly associated with grain number and yield in wheat [ 3 ]. Therefore, dissecting the genetic basis for spike morphology of wheat can contribute towards designation of ideal spike morphology to improve grain production. Generally, spikes of wheat species can be attributed to three main morphological variants: compact, normal and speltoid [ 3 ]. The compact spike shape was identified in club wheat ( Triticum compactum Host.), possessed short and dense spike with fewer spikelets per spike, which is attributable to a dominant loci C localized on chromosome 2D close to the centromere [ 4 – 6 ]. However, the C loci remain uncharacterized at the molecular level, mainly due to its location in a low-recombination region. The key domestication gene Q was known to reside on the long arm of chromosome 5A, has been studied for decades since its important role in the regulation of spike morphology and other domestication-related characteristics in wheat [ 7 – 12 ]. The normal spike shape is widespread among the cultivated wheat species that carry the domesticated Q allele, which is responsible for the relatively short square headed parallel-sided spike. The speltoid spike was described as pyramidal spikes featuring an elongated rachis and tenacious glumes exist in spelt ( T. aestivum ssp. spelta ), which is considered to have the primitive q allele. The sequences of q and Q alleles have two main differences: the presence of the amino acid substitution at the position 329 (Val/Ile) and the single nucleotide polymorphism (SNP) at the binding site of microRNA172 (miR172) within the exon 10 (T/C). The presence of 329Ile is predicted to increase the formation of Q homodimers, which could lead to self-up regulation of Q transcription [ 13 ]. The mutation at the miR172 target site in the Q allele resulted in less effective targeting by the miRNA, which leads to increase the expression of Q [ 14 ]. Inhibition of miR172 activity by a miRNA mimic target can elevate the transcription of Q gene and cause a compact spike phenotype [ 15 ], which supporting a dosage-dependent effect of Q gene on spike shape. In addition, the cytogenetic experiments also indicated that the Q gene had a dosage effect on spike morphology. In the T. aestivum cv. Chinese Spring (CS) background, plants with different copy numbers of Q allele such as nullisomic, monosomic, disomic, trisomic, and tetrasomic for chromosome 5A, displayed the speltiod, semispeltoid, square, subcompactoid, and compactoid spikes, respectively [ 7 ]. Translocations are DNA regions that have changed location and represent an important type of genomic structural variation (SV), with significant functional and evolutionary impacts on species [ 16 ]. These chromosomal rearrangements may occur in the homologous recombination pathway at meiosis due to compromised meiotic fidelity, and can be detected by fluorescence in situ hybridization (FISH) [ 17 , 18 ]. In wheat, chromosome translocations are prevalent and play important roles in genome evolution and genetic adaptation. For instance, suppression of recombination among genes within a translocation can lead to largely independent genome evolution between derived and ancestral arrangements. This provides opportunities for the formation of novel genotypes and phenotypes, driving the divergence and speciation we observe today [ 19 ]. Besides their evolutionary significance, studies of translocations also shed light on crop breeding applications. Many natural or artificial translocations have been reported to be associated with important agronomic traits [ 20 – 22 ], and the genetic effects of several wheat-alien translocations like T6VS•6AL and T1RS•1BL, have been already identified and used in wheat breeding programs [ 23 , 24 ]. The translocations can affect the gene expression related to important agronomic and adaptive traits, by reorganizing large regulatory domains [ 25 ], modifying genetic or epigenetic environments near their breakpoints [ 26 ], and preserving linkage with regulatory elements within or near the translocated region due to suppressed recombination in heterozygotes. Therefore, discerning the frequency and distribution of beneficial translocations in populations is important for breeders to enhance and fix the inheritance of specific traits in the breeding processes. In this study, we identified an ethyl methane sulfonate (EMS)-induced dense spike mutant dense spike1 ( ds1 ), which has decreased plant height and increased spike density. Through map-based cloning, sequence comparison, cytological and expression analyses, we demonstrate that a partial unidirectional translocation (UT) from 5AL to 7BS accrued in ds1 , resulting in an increase in Q gene copy number and expression, which is responsible for the mutant phenotype. This research deepens our understanding of the dosage-dependent effect of Q gene on wheat spike morphology, and provides new insights for the potential mutational mechanisms leading to the translocation in an EMS-induced mutant. Materials and methods Wheat materials and growth conditions The mutant ( ds1 ) with increased spike density and shortened plant height was isolated from 0.4% EMS-treated common wheat ( Triticum aestivum L.) cultivar “Nongda3753 (ND3753)”. The ds1 mutant was crossed with Nongda3753 and with a spring hexaploidy wheat Yong3002 separately to produce two F 2 populations. The cross of ds1 ×Yong3002 was used for fine-mapping through selecting the plants with different heterozygous segments at each generation. The important line C2 was selected in F 2:3 to generate F 3:4 . Through marker screening and phenotype evaluating of the recombinants from F 4 to F 6 generations, the homozygous lines of the segregating plants with the smallest heterozygous interval were selected to develop the corresponding NIL pairs in F 6:7 families. NIL-Y3002 contains the normal 7B and 5A chromosomes, but the NIL- ds1 contains the unbalanced translocated 7B and 5A chromosomes. The F 2 populations of ND3753× ds1 , Y3002× ds1 and the segregating families from F 3 to F 6 generations were planted at China Agriculture University Experimental Station (Beijing, People’s Republic of China) from 2017 to 2022 years. Phenotypic analysis We first classified the genotypes of individual plants as A (long spike), H (medium), and B (dense spike). The phenotypes of import recombined plants were determined by testing their progeny in the subsequent growing season. BSA-Seq data analysis The whole-genome sequencing data of bulks was processed and filtered using fastp with the default parameters [ 41 ]. The remaining high-quality clean reads were then mapped to the Chinese Spring (CS) wheat reference genome [ 42 ], IWGSC RefSeq v2.1 [ 43 ], using BWA-MEM. Potential PCR duplicates were further removed using the software Picard. SNPs and InDels were called by the HaplotypeCaller module of GATK v3.8 in GVCF mode. Then the joint call was performed using the GenotypeGVCFs module of GATK v3.8 [ 44 ]. SNPs were preliminarily filtered using the GATK VariantFiltration function with the parameter “–filterExpression QD 60.0 || MQRankSum < − 12.5 || Read-PosRankSum 3.0 || MQ < 40.0 || DP < 3.” The filtering settings for `InDels were “QD 200.0 || ReadPosRankSum < − 20.0 || DP < 3.” Variants that did not meet the criteria were discarded. A valid variant site was further defined by having only two called alleles using vcftools. The identified variants were annotated using SnpEff tool [ 45 ]. Subsequently, the AFD between bulks for each variant was calculated using the following formulas: n_L = n_AL + n_aL, n_D = n_AD + n_aD, AFD=|n_aL⁄n_L -n_aD⁄n_D |. And a representative allele of a SNP was identified among two pools, respectively. L and D represent pools of long spike (L) and dense spike (D). n represents reads number supporting the allele. Using a 1-Mb window size, the average value of AFD in each window was calculated and visualized by sliding the window. Variants with an AFD > 0.4 were considered be significantly associated variants. Additionally, we calculated the average value of read coverage in each 1-Mb window and divided it by the average value of reads coverage in all windows to determine genomic structural variations. Genetic mapping Based on the chromosome intervals identified by BSA-Seq, insertion/deletion markers were developed to genotype the F 2 to F 6 populations of Y3002× ds1 . PCR products were separated by 10% non-denaturing polyacrylamide gel electrophoresis or 1% agarose electrophoresis. Through genotypic and phenotypic analyses of residual heterozygous lines, the candidate interval of ds1 was narrowed to the region between marker D130 and the telomere of 7B chromosome. The primers used for fine-mapping are listed in Table S3. RNA extraction, cDNA preparation, and quantitative RT-PCR Young spikes of ND3753 and ds1 were sampled at different stages with at least three plants per biological replicate for RNA extraction. The standard TRIzol RNA isolation protocol (Thermo Fisher Scientific) following the manufacturer’s instruction was used for total RNA extraction. We used the reverse transcription kit (R223, Vazyme) to remove gDNA and synthesized first-strand cDNA. RT-qPCR was performed using SYBR Green PCR Master Mix (Q121, Vazyme) with a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.). β- ACTIN was used as the internal gene control. Each experiment was repeated three times. The primers used for qRT–PCR assays are listed in Table S3. Relative expression levels were calculated using ΔΔCT (DDCT) method [ 46 ]. Cytological analyse ND-FISH analysis was performed according to the methods described by Tang et al [ 47 ]. The oligonucleotides probes used for ND-FISH were Oligo-pTa-535 (5´-AAAAACTTGACGCACGTCACGTACAAATTGGACAAACTCTTTCGGAGTATCAGGGTTTC) and Oligo-pSc119.2 (5´- CCGTTTTGTGGACTATTACTCACCGCTTTGGGGTCCCATAGCTAT) [ 48 ] Both them were synthesized and respectively 5´ labeled with labeled with 6-FAM and Tamra were synthesized by Sangon Biotech Co., Ltd. (Shanghai). Slides prepared from the same root tip were analyzed by multicolor GISH based on the methods provided by Han et al [ 49 ]. Genomic DNA of Aegilops tauschii (D genome; 200 ng/µl) and Triticum urartu (A genome; 200 ng/µl) were labeled with ATTO-488 and ATTO-550 by nick-translation using ATTO NT Labeling Kit (Jena Bioscience, Germany) as probes. Aegilops speltoides (S genome ≈ B genome) DNA (3800 ng/µl) was used as a blocker (D:A:S = 1.3:1:180). Chromosome preparations were counterstained with DAPI (4’,6-diamidino2-phenylindole) in Vectashield (Vector Laboratories, Burlingame, USA). Hybridization signals were visualized and captured using an Olympus BX-63 epifluorescence microscope equipped with a Photometric SenSys DP70 CCD camera (Olympus, Tokyo, Japan). Raw images were processed using Photoshop v.7.1 (Adobe Systems Inc., San Jose, CA, USA). Copy number variation determination The chromosome structural variations in mutant ds1 resulted in the increased copy number of Q gene. To test the copy number of Q gene in ds1 , ND3753, Y3002 and F 6:7 progenies with compact spike phenotype, the TaqMan copy number assays were performed. The wheat CONSTANS2 gene ( TaCO2 ) was used as a single-copy control [ 50 , 51 ]. Specific primers and probes were designed based on Q and TaCO2 sequences (Table S3). Amplification and fluorescence detection were performed on a CFX 96 real-time PCR system (Bio-Rad, Hercules, CA, USA) using the following program: 95℃ for 15 min, followed by 40 cycles at 95 ℃ for 3 s and 60 ℃ for 30 s. Delta Cq values were calculated and used to determine the copy number of the Q gene. The average values of six plants for each genotype were used in the analysis. Statistical analyses Data were analyzed and plotted using GraphPad Prism 8.0 (GraphPad Software, Boston, MA, USA). Chi-squared (χ²) tests for goodness-of-fit were used to compare observed and theoretically expected segregation ratio. Results Phenotypic characterization of the dense spike mutant ds1 A common wheat mutant ds1 , with dwarf plant and increased spike density (Fig. 1 a), was isolated from the EMS-treated wheat cultivar “ND3753”. In contrast to the wild-type (WT) ND3753 plant, ds1 showed decreased internode length, especially the peduncle length, causing 46.2% of reduction in plant height in ds1 compared to ND3753 (Fig. 1 a and 1 b). In addition, the average spike length of ds1 decreased by 51.6%, and with reduced spikelet number of 14.3 in ds1 compared to 16.2 in ND3753, which resulted in a higher spike density of 4.05 in ds1 than 2.21 in ND3753 (Fig. 1 b). Genetic analysis of ds1 Crossing ds1 mutant with its wild-type ND3753, the F 1 plant showed increased spike density and dwarf phenotype which was similar as ds1 (Fig. 1 a), indicating that ds1 is a dominance gene. Within the F 2 population (ND3753× ds1 ), individual spike density ranged from 1.84 to 5, and exhibited a bimodal pattern of segregation. The spike length also showed a bimodal pattern, while the plant height and peduncle length were continuously distributed with no regularity, suggesting these traits might be influenced by more than one gene (Fig. 1 c). Moreover, there were only 639 out of 1,030 plants showing compact spike in the ND3753× ds1 F 2 population. X 2 -test showed a significantly distorted segregation for spike density from the 3:1 Mendel’s ratio (Table S1 ), with dramatically fewer compact spike plants. Considering that spike density is a clear segregating phenotype, and showed a strong correlation with the plant height and spike length (Table S2 ), we decided to use spike morphology as the target trait for mapping the causative gene ds1 , pleiotropically affects plant height and spike length. ds1 was mapped to chromosome 7B by BSA-seq Bulked segregant analysis (BSA) is a rapid strategy to map genes of interest based on comparisons with traditional genetic linkage mapping [ 27 ]. In this study, the resequencing-based BSA was performed in the ND3753× ds1 F 2 population. Two bulks corresponding to long spike and dense spike phenotypes were sequenced by next-generation sequencing technology. To identify the chromosomal regions associated with dense spike phenotypes, we calculated the ΔSNP-index between long-spike- and dense-spike-bulks in 1Mb sliding windows (with a step size of 100 kbp) and scanned for genome enriched regions. The result showed that the start of chromosome 5D and the short arm of chromosome 7B (7BS) both have significant peaks (Fig. 2 a). To further verified the chromosomal location of ds1 , we also crossed ds1 with a spring wheat variety Y3002, and performed BSA-Seq analysis in the F 2 population of the Y3002× ds1 . The significant signals were specifically detected on chromosome 7B rather than 5D (Fig. 2 b). Taken together, the causal region for the ds1 phenotype was located on the short arm of chromosome 7B. Fine mapping of ds1 Considering that the abundant diversity between Y3002 and ds1 in genetic background and the spring growth habit of Y3002, we used Y3002× ds1 population to fine-map the candidate gene ds1 . F 2 individuals were identified with indel markers D153 and D552, which are located on 7BS and 7BL, respectively. We identified three types of recombinants and six additional markers were developed to genotype these recombinants. Their F 3 families were planted to verify the phenotype of the F 2 individuals, which further located ds1 between D58.7 and D252 markers (Fig. 3 a). Six additional Indel markers were developed to characterize the genotype of C2, which narrowed the ds1 to the interval of D130 to D202 markers (72-Mb physical region) (Fig. 3 b). Next, we used markers In138 and In183 which were in the heterozygous interval to screen a larger population of 1,976 plants derived from the selfing of the residual heterozygous lines. Four recombination events were identified between D138 and D183 based on the spike morphology performance and genotype of these recombinants, which allowed us to delimit the ds1 locus to a 16-Mb interval (Fig. 3 c). In addition, we noticed that the recombinant R4 and its F 4:5 family all showed dense spike phenotype, indicating that they were all homozygous at ds1 locus. Surprisingly, we cannot amplify the marker D130 located on 7BS in these R4 individuals and its F 4:5 family (Fig. 3 d). Therefore, we further developed three 7BS-specific markers D3.79, D4.18 and D105 located on the 0-135Mb region to check the recombinant R4 and its derived progenies. Similarly, all these markers couldn’t be amplified in these individuals (Fig. S1 a), revealing that there might be a large fragment deletion on the chromosome 7BS terminal in the recombinant R4 and its derived progenies. Furthermore, we selected all the F 4:5 progenies derived from other important recombinants for fine-mapping. We found that the marker D130 were absent in the individuals with the compact spike phenotype (Fig. S1 b), while target DNA bands were successfully amplified in those individuals with long-spike phenotype. Taken together, co-segregation of the dense and long-spike phenotype with markers on the 7BS (0-130 Mb) revealed that the ~ 130-Mb terminal deletion of chromosome 7BS may be associated with the dense spike phenotype in the mutant ds1 . Unidirectional translocation from 5AL to 7BS affects the dosage of Q gene leads to dense spike in the mutant ds1 To verify the structural chromosome variation of the mutant ds1 , we analyzed the relative coverage of reads based on the resequencing data of the long- and dense-spike pools in the Y3002× ds1 and ND3753× ds1 F 2 populations. We found that the coverage of reads on 7BS (0-135Mb) in the dense-spike pools was very low, which was consistent with the identification of terminal deletion from the InDel markers located on 7BS (0-135 Mb) (Fig. 4 a and S2a). Interestingly, we also found that the coverage of reads in 543-709Mb on 5AL in the dense-spike pool was probably twice as much as the long-spike pool (Fig. 4 a and S2a), indicating that there may be a segmental chromosome duplication in the terminal region of 5AL (543-709Mb). In addition, the fragment length of the deletion on 7BS was approximately equal to the terminal duplication of 5AL, which prompted us to speculate that there might be an additional 5AL terminal translocated to the 7BS. To further confirm this assumption, FISH and genomic in situ hybridization (GISH) analyses were conducted in ND3753, ds1 , and the near-isogenic line (NIL) pairs (NIL-Y3002 and NIL- ds1 ) derived from Y3002× ds1 F 6:7 family (Fig. S3). The result showed that there was a unidirectional translocation from 5AL to 7BS, designated as UT (5AL; 7BS), in which a part of chromosome segment of the 7BS terminal has been replaced by the terminal parts of the 5AL in the ds1 and NIL- ds1 (Fig. 4 b and S2b). Moreover, we also found a reciprocal translocation between chromosome 1D and 3A, designated as RT (1DL; 3AS), which resulted in new 1DL-3AS•3AL and 1DS•1DL-3AS chromosomes in the ds1 (Fig. S2 b), while they were not present in the NIL- ds1 (Fig. 4 b). Notably, the wheat domesticated gene Q was located on the 5AL terminal, and the phenotype of the increased copy number or expression of Q allele was very similar to that of ds1 [ 13 , 28 , 29 ]. Therefore, we speculated that the duplicated chromosome segment of 5AL contained the Q gene, which may lead to an increase in copy number of the Q gene and thus affecting spike morphology variation in the ds1 . To investigate the copy number of Q gene, we conducted TaqMan qPCR assay in ND3753, ds1 , NIL-Y3002 and NIL- ds1 . The duplication of Q was confirmed in ds1 and NIL -ds1 , while both ND3753 and NIL-Y3002 contained one haploid copy of Q (Fig. 5 a). In addition, the expression of Q gene was higher in the spike of ds1 compared to ND3753 at different developmental phases (Fig. 5 b). Taken together, we concluded that the unidirectional translocation of 7BS and 5AL increases the copy number and expression of Q , thus resulting in the dense spike phenotype in the mutant ds1 (Fig. 5 c). Discussion The spike morphology variation was attributed to the UT (5AL; 7BS) and increased expression of Q gene Wheat ( Triticum aestivum L.) is one of the most widely planted cereal crops in the world, accounting for approximately 20% of all food calories consumed by humans [ 30 ]. Yield improvement is an on-going endeavor in wheat breeding. The architecture of the spike plays a crucial role in determining the grain number and size, which is a key trait for improving yield in wheat [ 31 ]. Here, we identified an EMS-induced wheat mutant ds1 , which showed a compact spike and dwarf plant (Fig. 1 ). By combining BSA-Seq and genetic mapping, the candidate gene was eventually located within the short arm of chromosome 7B, which included the UT (5AL; 7BS), leading to an increase in the copy number of the Q gene (Fig. 5 c). It is reported that wheat domestication gene Q encodes an APETALA2-like transcription factor (TF) that has pleiotropic effects on many agronomic traits, such as plant height, spike morphology, threshability and heading time [ 9 , 13 ]. To further determine whether the Q gene controls the spike morphology variation in ds1 , the copy number variation and transcript level of Q were examined in ds1 . In addition, we sequenced the Q gene by the specific primers to exclude the potential mutations within the Q . However, we did not find any difference within the sequence of the Q gene amplified from ds1 and ND3753 (Fig. S4). Thus, these results showed that a higher expression level of Q in ds1 compared with ND3753 resulted in the dense spike phenotype, which was similar as the tetrasomic 5A plant and the confirmed dosage effects of Q gene on spike morphology [ 7 , 29 ]. The role of chromosome structural variations in wheat Chromosome structural variations have been observed frequently in different wheat species and have vital effects on phenotypic variation in wheat evolution and improvement. The typical chromosomes rearrangements involving 4A, 5A, and 7B in wheat evolution have been illustrated by genetic and macrocollinearity analysis [ 19 , 32 ]. In the new synthetic hexaploid, the chromosomes seem to be instable since the telosomes, deletions, and translocations are usually found in synthetic hexaploid wheats (SHWs). It has been reported that chromosomes 1B, 4D, 1D, 4B, and 5A showed more variations [ 33 ]. Combining the observation of UT (5AL-7BS) in this study, chromosomes 7B and 5A seem to be more active and easier to make translocations. There might be some specific sequences or structures on 7B and 5A, which are more prone to vary and needed further study. Unlike the UT, RT (1DL, 3AS) led chromosome rearrangement without large fragment losses and duplicates on chromosomes, which may have some positive effects on wheat agronomic traits. The polymorphic CRs were reported to be linked to plant ecologoical adaptation and crop improvement (Todesco et al., 2020). Therefore, the RT (1DL, 3AS) found in ds1 could be used for wheat breeding like the 5BS•7BS/5BL•7BL in 66% of the 538 United Kingdom wheat lines [ 17 , 20 ]. However, chromosome translocations, inversions and deletions can affect homologous recombination and change the gene order at the break points, which are significant barriers to positional cloning. Here, we crossed ds1 with the parental line ND3753, followed by the selfing of F 1 individuals to generate F 2 progenies. Using BSA-Seq, we were able to identify the candidate gene may located on chromosome 7B. We developed the single nucleotide polymorphism varieties between ds1 and ND3753 into KASP (Kompetitive Allele-Specific PCR) markers to facilitate the mapping of candidate gene. However, the KASP markers located on 0-135Mb of 7BS were difficult to design and were unstable during genotyping assay. Therefore, we used additional population of ds1 ×Y3002 to solve the problem and examine the phenotype of the ds1 through the traditional map-cloning. Therefore, based on the next generation sequencing and reads counts analysis, the present and absent structure variations, duplicate variations, and introgressions can be found, which can provide useful information. We suggest that before mapping, we should first consider the chromosome structure, since several chromosome translocations have reported in many founder wheat lines and 39.7% of 373 Chinese cultivars [ 21 , 34 ]. The putative mechanism responsible for the chromosome structure variations in EMS-induced mutant EMS is a chemical mutagen mainly induces base pair substitutions and low level of chromosome breaks in plant genomes [ 35 ]. It has been reported that EMS treatment can influence DNA methylation processes and thus impacting genomic stability [ 36 ]. The higher the EMS concentration treatment, the more chromosome aberrations were observed in cowpea [ 37 ]. However, the large chromosome structural variations, such as RT and UT, should be rare in one mutant event induced by EMS in crops [ 38 ]. Nevertheless, in this study, we obtained an EMS-induced mutant with several chromosome structural variations, which was observed the first time in wheat. In the mutant ds1 , there was not only UT (5AL; 7BS), but also RT (1DS; 3AL), which seems unlikely to happen in one EMS-induced mutant event. Considering that the low frequency of chromosome structural variation induced by EMS, we speculated that the chromosome translocations in the mutant ds1 might be induced by mutated gene(s) involved in chromosome stability, chromosome break and rearrangement, or meiotic chromosome pairing, which need further study. The mutated gene(s) may reduce meiotic fidelity, causing nonhomologous chromosomes to pair and recombine, thus may result in chromosome translocations in ds1 (Fig. 6 ). In this case, the chromosome structure may not be stable in the early generation of ds1 and the progeny lines from ds1 may still carry other chromosomes translocations. It is worthwhile to further detect the chromosome structure of the offspring derived from ds1 to find new chromosome structural variations with phenotypic effects for wheat breeding. In previous studies, the deletion mutant of Ph1 gene was used to induce homoeologous recombination [ 39 ]. The Kaixianluohanmai (KL) system, a landrace of hexoploid wheat expressing the P h-like phenotype, can induce relative higher level of recombination of the closely related chromosomes 2S v -2B [ 40 ]. In this study, we found a new material that can be used to produce nonhomologous chromosome structural variations, which provides an efficient approach to mine chromosome structure in wheat. Given the relative higher level of nonhomologous chromosome recombination of ds1 , we might be able to transfer alien chromosome segments into wheat through hybridization between ds1 and wild relatives, thereby improving the chromosome diversity of modern wheat cultivars. Conclusion This study identified an EMS-induced dense spike mutant dense spike1 ( ds1 ) with dwarf plant and increased spike density. Combined map-based cloning, sequence comparison, cytological and expression analyses, we demonstrate that a partial unidirectional translocation (UT) from 5AL to 7BS accrued in ds1 , resulting in an increase in Q gene copy number and expression, which is responsible for the mutant phenotype. Collectively, we not only found the unidirectional translocation from 5AL to 7BS, there are other chromosome structure variations in this EMS mutant population, whose potential utilization value is worth exploring for future wheat improvement. Declarations Ethics approval and consent to participate No specific permit is required for the samples in this study. We comply with relevant institutional, national, and international guidelines and legislation for plant studies. Consent for publication Not applicable Availability of data and materials The raw sequence data of two BSA-Seq analysis generated in this study have been deposited in the Sequence Read Archive under the accession code PRJNA1133897. Competing interests The authors declare no competing interests. Funding This work was supported by grants from the National Natural Science Foundation of China (31991210), the Joint Research Program for Breeding of Inner Mongolia Autonomous Region, China (YZ2023008), and the Scientific and Technological Innovation 2030 Major Project (2023ZD0402301). Author contributions HRP and MH supervised this work. HRP, MH, ZFN, and QXS. conceived this work. XYZ, YFW, PFG, and YMC performed analyses. XYZ, YZL, KG, and JX performed experiments. XYZ, YFW, YMC, MMX, ZRH, WLG, YYY, ZFN, QXS, MH, and HRP interpreted data. XYZ, TYL, and YFW wrote the manuscript, and MH and HRP revised it. All authors read and approved the final manuscript. Acknowledgements We thank Zhen Qin, Zhengzhao Yang, Xiaoming Xie and Wenxi Wang from China Agricultural University for technical support. We appreciate Mingshan You from China Agricultural University for providing the mutant material ds1 . References Zorb C, Ludewig U, Hawkesford MJ: Perspective on wheat yield and quality with reduced nitrogen supply. Trends Plant Sci . 2018;23(11):1029-1037. Jost M, Taketa S, Mascher M, Himmelbach A, Yuo T, Shahinnia F, Rutten T, Druka A, Schmutzer T, Steuernagel B et al : A Homolog of Blade-on-petiole 1 and 2 (BOP1/2) controls internode length and homeotic changes of the barley inflorescence. Plant Physiol. 2016;171(2):1113-1127. Konopatskaia I, Vavilova V, Blinov AG, Goncharov NP: Spike morphology genes in wheat species ( Triticum L.). Proceedings of the Latvian Academy of Sciences. Section B. Natural, Exact, and Applied Sciences. 2016;70:345-355. Kajla A, Schoen A, Paulson C, Yadav IS, Neelam K, Riera-Lizarazu O, Leonard J, Gill BS, Venglat P, Datla R et al : Physical mapping of the wheat genes in low-recombination regions: radiation hybrid mapping of the C-locus. Theor Appl Genet . 2023;136(7):159. Johnson EB, Nalam VJ, Zemetra RS, Riera-Lizarazu O: Mapping the compactum locus in wheat ( Triticum aestivum L.) and its relationship to other spike morphology genes of the Triticeae . Euphytica. 2008;163(2):193-201. PrabhakaraRao MV: Mapping of the compactum gene C on chromosome 2D of wheat. Wheat Information Service. 1972;35:9. Muramatsu M: Dosage effect of the spelta gene q of hexaploid wheat. Genetics. 1963;48(4):469-482. Muramatsu M: The vulgare super gene, Q : its universality in durum wheat and its phenotypic effects in tetraploid and hexaploid wheats. Can J Genet Cytol. 1986;28(1):30-41. Faris JD, Gill BS: Genomic targeting and high-resolution mapping of the domestication gene Q in wheat. Genome . 2002;45(4):706-718. Faris JD, Fellers JP, Brooks SA, Gill BS: A bacterial artificial chromosome contig spanning the major domestication locus Q in wheat and identification of a candidate gene. Genetics. 2003;164(1):311-321. Kato K, Sonokawa R, Miura H, Sawada S: Dwarfing effect associated with the threshability gene Q on wheat chromosome 5A. Plant Breed. 2003;122(6):489-492. Zhang Z, Belcram H, Gornicki P, Charles M, Just J, Huneau C, Magdelenat G, Couloux A, Samain S, Gill BS et al : Duplication and partitioning in evolution and function of homoeologous Q loci governing domestication characters in polyploid wheat. Proc Natl Acad Sci. 2011;108(46):18737-18742. Simons KJ, Fellers JP, Trick HN, Zhang Z, Tai Y, Gill BS, Faris JD: Molecular characterization of the major wheat domestication gene Q . Genetics.2006; 172(1):547-555. Greenwood JR, Finnegan EJ, Watanabe N, Trevaskis B, Swain SM: New alleles of the wheat domestication gene Q reveal multiple roles in growth and reproductive development. Development. 2017;144(11):1959-1965. Debernardi JM, Lin H, Faris JD, Dubcovsky J: microRNA172 plays a critical role in wheat spike morphology and grain threshability. Development (Cambridge). 2017. Schiessl S, Katche E, Ihien E, Chawla HS, Mason AS: The role of genomic structural variation in the genetic improvement of polyploid crops. Crop J. 2019;7(2):127-140. Lv R, Gou X, Li N, Zhang Z, Wang C, Wang R, Wang B, Yang C, Gong L, Zhang H et al : Chromosome translocation affects multiple phenotypes, causes genome-wide dysregulation of gene expression, and remodels metabolome in hexaploid wheat. Plant J. 2023;115(6):1564-1582. Nicolas SD, Mignon GL, Eber F, Coriton O, Monod H, Clouet V, Huteau V, Lostanlen A, Delourme R, Chalhoub B et al : Homeologous recombination plays a major role in chromosome rearrangements that occur during meiosis of Brassica napus haploids. Genetics. 2007;175(2):487-503. Dvorak J, Wang L, Zhu T, Jorgensen CM, Luo MC, Deal KR, Gu YQ, Gill BS, Distelfeld A, Devos KM et al : Reassessment of the evolution of wheat chromosomes 4A, 5A, and 7B. Theor Appl Genet. 2018;131(11):2451-2462. Walkowiak S, Gao L, Monat C, Haberer G, Kassa MT, Brinton J, Ramirez-Gonzalez RH, Kolodziej MC, Delorean E, Thambugala D et al : Multiple wheat genomes reveal global variation in modern breeding. Nature.2020;588(7837):277-283. Wu N, Lei Y, Pei D, Wu H, Liu X, Fang J, Guo J, Wang C, Guo J, Zhang J et al : Predominant wheat-alien chromosome translocations in newly developed wheat of China. Mol Breeding.2021;41(4). Zhao J, Zheng X, Qiao L, Yang C, Wu B, He Z, Tang Y, Li G, Yang Z, Zheng J et al : Genome-wide association study reveals structural chromosome variations with phenotypic effects in wheat ( Triticum aestivum L.). Plant J. 2022;112(6):1447-1461. Liu C, Ye X, Wang M, Li S, Lin Z: Genetic behavior of Triticum aestivum - Dasypyrum villosum translocation chromosomes T6V#4S·6DL and T6V#2S·6AL carrying powdery mildew resistance. J INTEGR AGR. 2017;16:2136-2144. Schlegel R, Korzun V: About the origin of 1RS.1BL wheat-rye chromosome translocations from Germany. Plant Breed . 1997;116(6):537-540. Naseeb S, Carter Z, Minnis D, Donaldson I, Zeef L, Delneri D: Widespread impact of chromosomal inversions on gene expression uncovers robustness via phenotypic buffering. Mol Biol Evol. 2016;33(7):1679-1696. Wesley CS, Eanes WF: Isolation and analysis of the breakpoint sequences of chromosome inversion In(3L)Payne in Drosophila melanogaster. Proc Natl Acad Sci. 1994;91(8):3132-3136. Trick M, Adamski NM, Mugford SG, Jiang C, Febrer M, Uauy C: Combining SNP discovery from next-generation sequencing data with bulked segregant analysis (BSA) to fine-map genes in polyploid wheat. BMC Plant biol. 2012;12(1):14. Förster S, Schumann E, Eberhard Weber W, Pillen K: Discrimination of alleles and copy numbers at the Q locus in hexaploid wheat using quantitative pyrosequencing. Euphytica. 2012, 186(1):207-218. Förster S, Schumann E, Baumann M, Weber WE, Pillen K: Copy number variation of chromosome 5A and its association with Q gene expression, morphological aberrations, and agronomic performance of winter wheat cultivars. Theor Appl Genet. 2013;126(12):3049-3063. Shiferaw B, Smale M, Braun H, Duveiller E, Reynolds M, Muricho G: Crops that feed the world 10. Past successes and future challenges to the role played by wheat in global food security. Food Secur. 2013;5(3):291-317. Cao S, Xu D, Hanif M, Xia X, He Z: Genetic architecture underpinning yield component traits in wheat. Theor Appl Genet. 2020;133(6):1811-1823. Chen Y, Song W, Xie X, Wang Z, Guan P, Peng H, Jiao Y, Ni Z, Sun Q, Guo W: A collinearity-incorporating homology inference strategy for connecting emerging assemblies in the Triticeae tribe as a pilot practice in the plant pangenomic era. Mol Plant. 2020;13(12):1694-1708. Zhang S, Du P, Lu X, Fang J, Wang J, Chen X, Chen J, Wu H, Yang Y, Tsujimoto H et al : Frequent numerical and structural chromosome changes in early generations of synthetic hexaploid wheat. Genome. 2021;65(4):205-217. Huang X, Zhu M, Zhuang L, Zhang S, Wang J, Chen X, Wang D, Chen J, Bao Y, Guo J et al : Structural chromosome rearrangements and polymorphisms identified in Chinese wheat cultivars by high-resolution multiplex oligonucleotide FISH. Theor Appl Genet. 2018;131(9):1967-1986. Kim Y, Schumaker KS, Zhu J: EMS mutagenesis of Arabidopsis . In: Arabidopsis Protocols. Edited by Salinas J, Sanchez-Serrano JJ. Totowa, NJ: Humana Press; 2006: 101-103. Türkoğlu A, Haliloğlu K, Tosun M, Bujak H, Eren B, Demirel F, Szulc P, Karagöz H, Selwet M, Özkan G et al : Ethyl Methanesulfonate (EMS) mutagen toxicity-induced DNA damage, cytosine methylation alteration, and iPBS-retrotransposon polymorphisms in wheat ( Triticum aestivum L.). In: Agronomy . , vol. 13;2023. Gnanamurthy S, Dhanavel D: Effect of EMS on induced morphological mutants and chromosomal variation in cowpea ( Vigna unguiculata (L.) Walp). Int Lett Nat Sci. 2014, 22:33-43. Wang D, Li Y, Wang H, Xu Y, Yang Y, Zhou Y, Chen Z, Zhou Y, Gui L, Guo Y et al : Boosting wheat functional genomics via an indexed EMS mutant library of KN9204. Plant Commun . 2023;4(4):100593. Türkösi E, Ivanizs L, Farkas A, Gaál E, Kruppa K, Kovács P, Szakács É, Szőke-Pázsi K, Said M, Cápal P et al : Transfer of the ph1b Deletion chromosome 5B from chinese spring wheat into a winter wheat line and induction of chromosome rearrangements in wheat- Aegilops biuncialis hybrids. Front Plant Sci. 2022;13. Fan C, Luo J, Sun J, Chen H, Li L, Zhang L, Chen X, Li Y, Ning S, Yuan Z et al : The KL system in wheat permits homoeologous crossing over between closely related chromosomes. Crop J. 2023;11(3):808-816. Chen S, Zhou Y, Chen Y, Gu J: fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018;34(17):i884-i890. International Wheat Genome Sequencing (IWGSC), Appels R, Eversole K, Stein N, Feuillet C, Keller B, Rogers J, Pozniak CJ, Choulet F, Distelfeld A et al : Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science. 2018;361(6403):r7191. Zhu T, Wang L, Rimbert H, Rodriguez JC, Deal KR, De Oliveira R, Choulet F, Keeble-Gagnère G, Tibbits J, Rogers J et al : Optical maps refine the bread wheat Triticum aestivum cv. Chinese Spring genome assembly. Plant J. 2021;107(1):303-314. McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M et al : The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010; 20(9):1297-1303. Cingolani P, Platts A, Wang LL, Coon M, Nguyen T, Wang L, Land SJ, Lu X, Ruden DM: A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff. Fly. 2012;6(2):80-92. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔ CT method. Methods. 2001;25(4):402-408. Tang S, Tang Z, Qiu L, Yang Z, Li G, Lang T, Zhu W, Zhang J, Fu S: Developing new oligo probes to distinguish specific chromosomal segments and the A, B, D genomes of wheat ( Triticum aestivum L.) using ND-FISH. Front Plant Sci. 2018;9. Tang Z, Yang Z, Fu S: Oligonucleotides replacing the roles of repetitive sequences pAs1, pSc119.2, pTa-535, pTa71, CCS1, and pAWRC.1 for FISH analysis. J Appl Genet. 2014;55(3):313-318. Han F, Liu B, Fedak G, Liu Z: Genomic constitution and variation in five partial amphiploids of wheat- Thinopyrum intermedium as revealed by GISH, multicolor GISH and seed storage protein analysis. Theor Appl Genet. 2004;109(5):1070-1076. Díaz A, Zikhali M, Turner AS, Isaac P, Laurie DA: Copy Number Variation Affecting the Photoperiod-B1 and Vernalization-A1 Genes Is Associated with Altered Flowering Time in Wheat ( Triticum aestivum ). PLOS ONE. 2012;7(3):e33234. Nemoto Y, Kisaka M, Fuse T, Yano M, Ogihara Y: Characterization and functional analysis of three wheat genes with homology to the CONSTANS flowering time gene in transgenic rice. Plant J. 2003;36(1):82-93. Additional Declarations No competing interests reported. Supplementary Files Additionalfile1.xlsx Additionalfile2.docx Cite Share Download PDF Status: Published Journal Publication published 12 Nov, 2024 Read the published version in BMC Genomics → Version 1 posted Editorial decision: Revision requested 20 Aug, 2024 Editor assigned by journal 19 Aug, 2024 Submission checks completed at journal 19 Aug, 2024 First submitted to journal 16 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4927595","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":342639227,"identity":"bcfba138-bbe8-4be5-8374-358436b417c0","order_by":0,"name":"Xiaoyu Zhang","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoyu","middleName":"","lastName":"Zhang","suffix":""},{"id":342639228,"identity":"1005aa12-f6fe-4e54-98e1-d9e00846fe13","order_by":1,"name":"Yongfa Wang","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yongfa","middleName":"","lastName":"Wang","suffix":""},{"id":342639230,"identity":"83140726-5e26-4f98-a80f-04df6173cfaa","order_by":2,"name":"Yongming Chen","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yongming","middleName":"","lastName":"Chen","suffix":""},{"id":342639232,"identity":"9ccf22de-03f2-4c0b-aa75-f635d67dd128","order_by":3,"name":"Yazhou Li","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yazhou","middleName":"","lastName":"Li","suffix":""},{"id":342639234,"identity":"733a49ea-8148-44bf-9d4f-04f1d537998f","order_by":4,"name":"Kai Guo","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Kai","middleName":"","lastName":"Guo","suffix":""},{"id":342639236,"identity":"f364dddf-7b22-4a3a-81f3-2a6242fad78b","order_by":5,"name":"Jin Xu","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jin","middleName":"","lastName":"Xu","suffix":""},{"id":342639238,"identity":"abce4049-0106-4e21-84d7-c71978ab3108","order_by":6,"name":"Panfeng Guan","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Panfeng","middleName":"","lastName":"Guan","suffix":""},{"id":342639239,"identity":"e9001d5c-9a6f-46e4-98c6-6450a2558018","order_by":7,"name":"Tianyu Lan","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Tianyu","middleName":"","lastName":"Lan","suffix":""},{"id":342639241,"identity":"1471474b-ca6e-456f-a0a7-34a4cadc7dd4","order_by":8,"name":"Mingming Xin","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Mingming","middleName":"","lastName":"Xin","suffix":""},{"id":342639243,"identity":"9016fabc-6e66-4aac-8c74-765232b14d3e","order_by":9,"name":"Zhaorong Hu","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zhaorong","middleName":"","lastName":"Hu","suffix":""},{"id":342639245,"identity":"11471802-24fd-4144-ae09-70578cea223c","order_by":10,"name":"Weilong Guo","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Weilong","middleName":"","lastName":"Guo","suffix":""},{"id":342639247,"identity":"7605d557-5706-4f8a-9a13-2c149d4b703d","order_by":11,"name":"Yingyin Yao","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yingyin","middleName":"","lastName":"Yao","suffix":""},{"id":342639249,"identity":"0d990abd-3c73-411b-8b85-6292c907673b","order_by":12,"name":"Zhongfu Ni","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zhongfu","middleName":"","lastName":"Ni","suffix":""},{"id":342639250,"identity":"98c1455d-8314-4eea-a557-9ca4b03ceffe","order_by":13,"name":"Qixin Sun","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Qixin","middleName":"","lastName":"Sun","suffix":""},{"id":342639251,"identity":"1bb565b7-5cbb-48a8-8399-9b6911a1b269","order_by":14,"name":"Ming Hao","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Ming","middleName":"","lastName":"Hao","suffix":""},{"id":342639252,"identity":"8f982bd8-53e0-4ac4-be0c-6e1f946b946d","order_by":15,"name":"Huiru Peng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYJACZgYGCQYG9gYwh7GBeC08B0jTAgQSCURqMWfvPfy6sM0i3+Dm44efeRhsZDccYH72AJ8Wy55zadYz2yQsN9xOM5bmYUgz3nCAzdwAnxaDGzlmxrxtEgYGt3MYgFoOJ244wMMmgVfL/TdQLTfPMP/mYfhPhJYbPMaPwVpu8LABbTlAWItlT44ZM885CQPJM2lmlnMMko1nHmYzw6vFnP2M8WeesjoDvuOHH994U2En23e8+Rl+hzEwIDsDFFTM+NRD1DB/IKBmFIyCUTAKRjoAAP7PQtOAZK0GAAAAAElFTkSuQmCC","orcid":"","institution":"China Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Huiru","middleName":"","lastName":"Peng","suffix":""}],"badges":[],"createdAt":"2024-08-17 03:23:53","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4927595/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4927595/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12864-024-11000-y","type":"published","date":"2024-11-12T15:58:17+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":64652544,"identity":"ad23f063-84b3-4b49-906b-a7ad25dde278","added_by":"auto","created_at":"2024-09-17 05:55:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":500688,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhenotypic analysis of the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003edense spike1 \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e(\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eds1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Phenotype of ND3753, F\u003csub\u003e1\u003c/sub\u003e and \u003cem\u003eds1\u003c/em\u003e at the heading stage. The scale bar in the left top was 1cm, in the left below and the right were 10cm.\u003c/p\u003e\n\u003cp\u003e(b) The plant heights, spike lengths, spikelet number per spike and spikelet densities of ND3753 and \u003cem\u003eds1\u003c/em\u003e. The data are presented as the mean, and the error bars indicate the SD.**** indicates significant differences at the 0.0001 level (Student’s \u003cem\u003et\u003c/em\u003e-test).\u003c/p\u003e\n\u003cp\u003e(c) Distribution of plant height, peduncle length, spike length and spike density in the segregating ND3753×\u003cem\u003eds1\u003c/em\u003e F\u003csub\u003e2\u003c/sub\u003e population (n = 1030).\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4927595/v1/74a406e352e1247f904d8db3.png"},{"id":64652547,"identity":"c021a8fb-b6e4-4838-ac2d-4fd3d3a1fcba","added_by":"auto","created_at":"2024-09-17 05:55:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":644914,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe BSA-seq analysis of two F\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e populations.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Allele frequency difference (AFD) graph from BSA-seq analysis of the two bulks in ND3753×\u003cem\u003eds1\u003c/em\u003e population.\u003c/p\u003e\n\u003cp\u003e(b) Allele frequency difference (AFD) graph from BSA-seq analysis of the two bulks in Y3002×\u003cem\u003eds1\u003c/em\u003e population. The horizontal red dashed lines indicate the threshold (0.4) at the overall significance level of \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 and the red arrows indicate the enrich variations peaks of chromosome 7B.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4927595/v1/764612b9364d09dd75d2cd41.png"},{"id":64652927,"identity":"cc61999a-b709-48c6-b8c6-3367c120cba4","added_by":"auto","created_at":"2024-09-17 06:03:51","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":561012,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFine-mapping of the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eds1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e gene.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Marker screening identified three recombinants between D153 and D510 in the F\u003csub\u003e2\u003c/sub\u003e population of Y3002×\u003cem\u003eds1\u003c/em\u003e including 268 individuals. Genotypes of the three representative recombinant plants were shown.\u003c/p\u003e\n\u003cp\u003e(b) Additional six Indel markers were developed to characterize the genotype of the recombinant C2.\u003c/p\u003e\n\u003cp\u003e(c) Genotypes of four recombinants between D138 and D183. An important recombinant R4 with dense spike but the marker D130 cannot amplified were shown. pink, blue and orange bars represented the genotypes from Y3002, \u003cem\u003eds1\u003c/em\u003e and heterozygous plants. The recombination break point was set in the middle between neighboring markers.\u003c/p\u003e\n\u003cp\u003e(d) Amplification for marker D130 in 20 progenies from R4. Arrows indicate polymorphic DNA bands. M, DNA Ladder 5000.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4927595/v1/e21486eca331017eddf506fe.png"},{"id":64652545,"identity":"a97ee8dc-df8c-46bb-a27a-fe3a9821ae7c","added_by":"auto","created_at":"2024-09-17 05:55:51","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":627488,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe UT (7BS; 5AL) in NIL-\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eds1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e derived from Y3002×\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eds1 \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003epopulation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) The 5A and 7B chromosomes relative reads coverages of long-spike bulk (upper) and dense-spike bulk(below) from the Y3002 and \u003cem\u003eds1\u003c/em\u003e population.\u003c/p\u003e\n\u003cp\u003e(b) Fluorescence in situ hybridization/genomic in situ hybridization illustration of NIL-Y3002 and NIL-\u003cem\u003eds1\u003c/em\u003e from Y3002×\u003cem\u003eds1\u003c/em\u003e F\u003csub\u003e6:7\u003c/sub\u003e population. The different colorful arrow bar: red, green, white and yellow point to chromosomes 1D, 3A, 5A and 7B respectively. There only has UT (7BS; 5AL) in NIL-\u003cem\u003eds1\u003c/em\u003e. UT, unidirectional translocation.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4927595/v1/8a7a9ba3b253e43ecdab83d7.png"},{"id":64653718,"identity":"f4e7de4b-2bea-4786-8c67-62844818bcc0","added_by":"auto","created_at":"2024-09-17 06:11:51","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":217119,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe copy number and expression analysis of\u003c/strong\u003e\u003cem\u003e Q\u003c/em\u003e\u003cstrong\u003e gene in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eds1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) TaqMan estimates of \u003cem\u003eQ\u003c/em\u003e haploid copy number in ND3753, \u003cem\u003eds1\u003c/em\u003e, NIL-Y3002 and NIL-\u003cem\u003eds1\u003c/em\u003e; Copy number was estimated from the \u003cem\u003eQ\u003c/em\u003e/TaCO2 signal ratio and were normalized to the ND3753 control.\u003c/p\u003e\n\u003cp\u003e(b) The relative expression levels of \u003cem\u003eQ\u003c/em\u003e from stages W4 to W6 were measured by qRT-PCR. The data are presented as the mean, and the error bars indicate the SD.**** indicates significant differences at the 0.0001 level (Student’s \u003cem\u003et\u003c/em\u003e-test).\u003c/p\u003e\n\u003cp\u003e(c) Schematic depicting the traditional 5A and 7B in ND3753 and the UT 5AL∙7BS-7BL in \u003cem\u003eds1\u003c/em\u003e. Blue chromosome model represents 5A, Pink one represents 7B.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4927595/v1/d711c7e3877ec990548c6399.png"},{"id":64652930,"identity":"58f49123-3178-4539-982b-09d5ee370dcb","added_by":"auto","created_at":"2024-09-17 06:03:51","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":346487,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic illustration of the putative mechanism responsible for CSVs in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eds1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe red rounded rectangles include the existed chromosome structural variations in the progenies of \u003cem\u003eds1\u003c/em\u003e. The rectangle with dotted lines indicted the possible chromosome structural variations in the progenies of \u003cem\u003eds1\u003c/em\u003e. CSVs, chromosome structural variations.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4927595/v1/dc985457441635d8cf9fe65a.png"},{"id":69285367,"identity":"762479d9-88d2-4444-b4f8-487d1139e0d9","added_by":"auto","created_at":"2024-11-18 19:25:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3947300,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4927595/v1/ac49b8c2-47e5-4cd1-80b9-f30f18f04d71.pdf"},{"id":64652928,"identity":"96da11da-0a8a-44f3-823a-f5690736fe7c","added_by":"auto","created_at":"2024-09-17 06:03:51","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":17598,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4927595/v1/afdfaf21a4a094a586e33736.xlsx"},{"id":64652551,"identity":"666645ca-5bad-4c1f-905e-603c597d8ebf","added_by":"auto","created_at":"2024-09-17 05:55:51","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":2436848,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile2.docx","url":"https://assets-eu.researchsquare.com/files/rs-4927595/v1/dae52c688643290765eac92b.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Partial unidirectional translocation from 5AL to 7BS leads to dense spike in an EMS-induced wheat mutant","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCommon wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.) is an important cereal crop and supplies\u0026thinsp;~\u0026thinsp;20% of daily calorie intake for humans [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. To sustainably support the ever-increasing world population and farming profitability, wheat productivity must increase under fewer production hectares. The spike or inflorescence is the most prominent part of cereal crops, producing carbohydrate-rich grains that are harvested for food, feed, and fiber [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Modifying spike with higher grain capacity is vital for wheat grain production. Spike morphology is a crucial agronomic character, depending on spike length and spikelet number, which is greatly associated with grain number and yield in wheat [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Therefore, dissecting the genetic basis for spike morphology of wheat can contribute towards designation of ideal spike morphology to improve grain production.\u003c/p\u003e \u003cp\u003eGenerally, spikes of wheat species can be attributed to three main morphological variants: compact, normal and speltoid [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The compact spike shape was identified in club wheat (\u003cem\u003eTriticum compactum\u003c/em\u003e Host.), possessed short and dense spike with fewer spikelets per spike, which is attributable to a dominant loci \u003cem\u003eC\u003c/em\u003e localized on chromosome 2D close to the centromere [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. However, the \u003cem\u003eC\u003c/em\u003e loci remain uncharacterized at the molecular level, mainly due to its location in a low-recombination region. The key domestication gene \u003cem\u003eQ\u003c/em\u003e was known to reside on the long arm of chromosome 5A, has been studied for decades since its important role in the regulation of spike morphology and other domestication-related characteristics in wheat [\u003cspan additionalcitationids=\"CR8 CR9 CR10 CR11\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The normal spike shape is widespread among the cultivated wheat species that carry the domesticated \u003cem\u003eQ\u003c/em\u003e allele, which is responsible for the relatively short square headed parallel-sided spike. The speltoid spike was described as pyramidal spikes featuring an elongated rachis and tenacious glumes exist in spelt (\u003cem\u003eT. aestivum\u003c/em\u003e ssp. \u003cem\u003espelta\u003c/em\u003e), which is considered to have the primitive \u003cem\u003eq\u003c/em\u003e allele. The sequences of \u003cem\u003eq\u003c/em\u003e and \u003cem\u003eQ\u003c/em\u003e alleles have two main differences: the presence of the amino acid substitution at the position 329 (Val/Ile) and the single nucleotide polymorphism (SNP) at the binding site of microRNA172 (miR172) within the exon 10 (T/C). The presence of 329Ile is predicted to increase the formation of \u003cem\u003eQ\u003c/em\u003e homodimers, which could lead to self-up regulation of \u003cem\u003eQ\u003c/em\u003e transcription [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The mutation at the miR172 target site in the \u003cem\u003eQ\u003c/em\u003e allele resulted in less effective targeting by the miRNA, which leads to increase the expression of \u003cem\u003eQ\u003c/em\u003e [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Inhibition of miR172 activity by a miRNA mimic target can elevate the transcription of \u003cem\u003eQ\u003c/em\u003e gene and cause a compact spike phenotype [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], which supporting a dosage-dependent effect of \u003cem\u003eQ\u003c/em\u003e gene on spike shape. In addition, the cytogenetic experiments also indicated that the \u003cem\u003eQ\u003c/em\u003e gene had a dosage effect on spike morphology. In the \u003cem\u003eT. aestivum\u003c/em\u003e cv. Chinese Spring (CS) background, plants with different copy numbers of \u003cem\u003eQ\u003c/em\u003e allele such as nullisomic, monosomic, disomic, trisomic, and tetrasomic for chromosome 5A, displayed the speltiod, semispeltoid, square, subcompactoid, and compactoid spikes, respectively [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTranslocations are DNA regions that have changed location and represent an important type of genomic structural variation (SV), with significant functional and evolutionary impacts on species [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. These chromosomal rearrangements may occur in the homologous recombination pathway at meiosis due to compromised meiotic fidelity, and can be detected by fluorescence in situ hybridization (FISH) [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In wheat, chromosome translocations are prevalent and play important roles in genome evolution and genetic adaptation. For instance, suppression of recombination among genes within a translocation can lead to largely independent genome evolution between derived and ancestral arrangements. This provides opportunities for the formation of novel genotypes and phenotypes, driving the divergence and speciation we observe today [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Besides their evolutionary significance, studies of translocations also shed light on crop breeding applications. Many natural or artificial translocations have been reported to be associated with important agronomic traits [\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], and the genetic effects of several wheat-alien translocations like T6VS\u0026bull;6AL and T1RS\u0026bull;1BL, have been already identified and used in wheat breeding programs [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The translocations can affect the gene expression related to important agronomic and adaptive traits, by reorganizing large regulatory domains [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], modifying genetic or epigenetic environments near their breakpoints [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], and preserving linkage with regulatory elements within or near the translocated region due to suppressed recombination in heterozygotes. Therefore, discerning the frequency and distribution of beneficial translocations in populations is important for breeders to enhance and fix the inheritance of specific traits in the breeding processes.\u003c/p\u003e \u003cp\u003eIn this study, we identified an ethyl methane sulfonate (EMS)-induced dense spike mutant \u003cem\u003edense spike1\u003c/em\u003e (\u003cem\u003eds1\u003c/em\u003e), which has decreased plant height and increased spike density. Through map-based cloning, sequence comparison, cytological and expression analyses, we demonstrate that a partial unidirectional translocation (UT) from 5AL to 7BS accrued in \u003cem\u003eds1\u003c/em\u003e, resulting in an increase in \u003cem\u003eQ\u003c/em\u003e gene copy number and expression, which is responsible for the mutant phenotype. This research deepens our understanding of the dosage-dependent effect of \u003cem\u003eQ\u003c/em\u003e gene on wheat spike morphology, and provides new insights for the potential mutational mechanisms leading to the translocation in an EMS-induced mutant.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eWheat materials and growth conditions\u003c/h2\u003e \u003cp\u003eThe mutant (\u003cem\u003eds1\u003c/em\u003e) with increased spike density and shortened plant height was isolated from 0.4% EMS-treated common wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.) cultivar \u0026ldquo;Nongda3753 (ND3753)\u0026rdquo;. The \u003cem\u003eds1\u003c/em\u003e mutant was crossed with Nongda3753 and with a spring hexaploidy wheat Yong3002 separately to produce two F\u003csub\u003e2\u003c/sub\u003e populations. The cross of \u003cem\u003eds1\u003c/em\u003e\u0026times;Yong3002 was used for fine-mapping through selecting the plants with different heterozygous segments at each generation. The important line C2 was selected in F\u003csub\u003e2:3\u003c/sub\u003e to generate F\u003csub\u003e3:4\u003c/sub\u003e. Through marker screening and phenotype evaluating of the recombinants from F\u003csub\u003e4\u003c/sub\u003e to F\u003csub\u003e6\u003c/sub\u003e generations, the homozygous lines of the segregating plants with the smallest heterozygous interval were selected to develop the corresponding NIL pairs in F\u003csub\u003e6:7\u003c/sub\u003e families. NIL-Y3002 contains the normal 7B and 5A chromosomes, but the NIL-\u003cem\u003eds1\u003c/em\u003e contains the unbalanced translocated 7B and 5A chromosomes. The F\u003csub\u003e2\u003c/sub\u003e populations of ND3753\u0026times;\u003cem\u003eds1\u003c/em\u003e, Y3002\u0026times;\u003cem\u003eds1\u003c/em\u003e and the segregating families from F\u003csub\u003e3\u003c/sub\u003e to F\u003csub\u003e6\u003c/sub\u003e generations were planted at China Agriculture University Experimental Station (Beijing, People\u0026rsquo;s Republic of China) from 2017 to 2022 years.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003ePhenotypic analysis\u003c/h2\u003e \u003cp\u003eWe first classified the genotypes of individual plants as A (long spike), H (medium), and B (dense spike). The phenotypes of import recombined plants were determined by testing their progeny in the subsequent growing season.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eBSA-Seq data analysis\u003c/h2\u003e \u003cp\u003eThe whole-genome sequencing data of bulks was processed and filtered using fastp with the default parameters [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The remaining high-quality clean reads were then mapped to the Chinese Spring (CS) wheat reference genome [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], IWGSC RefSeq v2.1 [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], using BWA-MEM. Potential PCR duplicates were further removed using the software Picard. SNPs and InDels were called by the HaplotypeCaller module of GATK v3.8 in GVCF mode. Then the joint call was performed using the GenotypeGVCFs module of GATK v3.8 [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. SNPs were preliminarily filtered using the GATK VariantFiltration function with the parameter \u0026ldquo;\u0026ndash;filterExpression QD\u0026thinsp;\u0026lt;\u0026thinsp;2.0 || FS\u0026thinsp;\u0026gt;\u0026thinsp;60.0 || MQRankSum\u0026thinsp;\u0026lt;\u0026thinsp;\u0026minus;\u0026thinsp;12.5 || Read-PosRankSum\u0026thinsp;\u0026lt;\u0026thinsp;\u0026minus;\u0026thinsp;8.0 || SOR\u0026thinsp;\u0026gt;\u0026thinsp;3.0 || MQ\u0026thinsp;\u0026lt;\u0026thinsp;40.0 || DP\u0026thinsp;\u0026lt;\u0026thinsp;3.\u0026rdquo; The filtering settings for `InDels were \u0026ldquo;QD\u0026thinsp;\u0026lt;\u0026thinsp;2.0 || FS\u0026thinsp;\u0026gt;\u0026thinsp;200.0 || ReadPosRankSum\u0026thinsp;\u0026lt;\u0026thinsp;\u0026minus;\u0026thinsp;20.0 || DP\u0026thinsp;\u0026lt;\u0026thinsp;3.\u0026rdquo; Variants that did not meet the criteria were discarded. A valid variant site was further defined by having only two called alleles using vcftools. The identified variants were annotated using SnpEff tool [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Subsequently, the AFD between bulks for each variant was calculated using the following formulas: n_L\u0026thinsp;=\u0026thinsp;n_AL\u0026thinsp;+\u0026thinsp;n_aL, n_D\u0026thinsp;=\u0026thinsp;n_AD\u0026thinsp;+\u0026thinsp;n_aD, AFD=|n_aL\u0026frasl;n_L -n_aD\u0026frasl;n_D |. And a representative allele of a SNP was identified among two pools, respectively. L and D represent pools of long spike (L) and dense spike (D). n represents reads number supporting the allele. Using a 1-Mb window size, the average value of AFD in each window was calculated and visualized by sliding the window. Variants with an AFD\u0026thinsp;\u0026gt;\u0026thinsp;0.4 were considered be significantly associated variants. Additionally, we calculated the average value of read coverage in each 1-Mb window and divided it by the average value of reads coverage in all windows to determine genomic structural variations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eGenetic mapping\u003c/h2\u003e \u003cp\u003eBased on the chromosome intervals identified by BSA-Seq, insertion/deletion markers were developed to genotype the F\u003csub\u003e2\u003c/sub\u003e to F\u003csub\u003e6\u003c/sub\u003e populations of Y3002\u0026times;\u003cem\u003eds1\u003c/em\u003e. PCR products were separated by 10% non-denaturing polyacrylamide gel electrophoresis or 1% agarose electrophoresis. Through genotypic and phenotypic analyses of residual heterozygous lines, the candidate interval of \u003cem\u003eds1\u003c/em\u003e was narrowed to the region between marker D130 and the telomere of 7B chromosome. The primers used for fine-mapping are listed in Table S3.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction, cDNA preparation, and quantitative RT-PCR\u003c/h2\u003e \u003cp\u003eYoung spikes of ND3753 and \u003cem\u003eds1\u003c/em\u003e were sampled at different stages with at least three plants per biological replicate for RNA extraction. The standard TRIzol RNA isolation protocol (Thermo Fisher Scientific) following the manufacturer\u0026rsquo;s instruction was used for total RNA extraction. We used the reverse transcription kit (R223, Vazyme) to remove gDNA and synthesized first-strand cDNA. RT-qPCR was performed using SYBR Green PCR Master Mix (Q121, Vazyme) with a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.). \u003cem\u003eβ-\u003c/em\u003eACTIN was used as the internal gene control. Each experiment was repeated three times. The primers used for qRT\u0026ndash;PCR assays are listed in Table S3. Relative expression levels were calculated using ΔΔCT (DDCT) method [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCytological analyse\u003c/h2\u003e \u003cp\u003eND-FISH analysis was performed according to the methods described by Tang et al [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. The oligonucleotides probes used for ND-FISH were Oligo-pTa-535 (5\u0026acute;-AAAAACTTGACGCACGTCACGTACAAATTGGACAAACTCTTTCGGAGTATCAGGGTTTC) and Oligo-pSc119.2 (5\u0026acute;- CCGTTTTGTGGACTATTACTCACCGCTTTGGGGTCCCATAGCTAT) [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e] Both them were synthesized and respectively 5\u0026acute; labeled with labeled with 6-FAM and Tamra were synthesized by Sangon Biotech Co., Ltd. (Shanghai). Slides prepared from the same root tip were analyzed by multicolor GISH based on the methods provided by Han et al [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Genomic DNA of \u003cem\u003eAegilops tauschii\u003c/em\u003e (D genome; 200 ng/\u0026micro;l) and \u003cem\u003eTriticum urartu\u003c/em\u003e (A genome; 200 ng/\u0026micro;l) were labeled with ATTO-488 and ATTO-550 by nick-translation using ATTO NT Labeling Kit (Jena Bioscience, Germany) as probes. \u003cem\u003eAegilops speltoides\u003c/em\u003e (S genome\u0026thinsp;\u0026asymp;\u0026thinsp;B genome) DNA (3800 ng/\u0026micro;l) was used as a blocker (D:A:S\u0026thinsp;=\u0026thinsp;1.3:1:180). Chromosome preparations were counterstained with DAPI (4\u0026rsquo;,6-diamidino2-phenylindole) in Vectashield (Vector Laboratories, Burlingame, USA). Hybridization signals were visualized and captured using an Olympus BX-63 epifluorescence microscope equipped with a Photometric SenSys DP70 CCD camera (Olympus, Tokyo, Japan). Raw images were processed using Photoshop v.7.1 (Adobe Systems Inc., San Jose, CA, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eCopy number variation determination\u003c/h2\u003e \u003cp\u003eThe chromosome structural variations in mutant \u003cem\u003eds1\u003c/em\u003e resulted in the increased copy number of \u003cem\u003eQ\u003c/em\u003e gene. To test the copy number of \u003cem\u003eQ\u003c/em\u003e gene in \u003cem\u003eds1\u003c/em\u003e, ND3753, Y3002 and F\u003csub\u003e6:7\u003c/sub\u003e progenies with compact spike phenotype, the TaqMan copy number assays were performed. The wheat \u003cem\u003eCONSTANS2\u003c/em\u003e gene (\u003cem\u003eTaCO2\u003c/em\u003e) was used as a single-copy control [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Specific primers and probes were designed based on \u003cem\u003eQ\u003c/em\u003e and \u003cem\u003eTaCO2\u003c/em\u003e sequences (Table S3). Amplification and fluorescence detection were performed on a CFX 96 real-time PCR system (Bio-Rad, Hercules, CA, USA) using the following program: 95℃ for 15 min, followed by 40 cycles at 95 ℃ for 3 s and 60 ℃ for 30 s. Delta Cq values were calculated and used to determine the copy number of the \u003cem\u003eQ\u003c/em\u003e gene. The average values of six plants for each genotype were used in the analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analyses\u003c/h2\u003e \u003cp\u003eData were analyzed and plotted using GraphPad Prism 8.0 (GraphPad Software, Boston, MA, USA). Chi-squared (χ\u0026sup2;) tests for goodness-of-fit were used to compare observed and theoretically expected segregation ratio.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003ePhenotypic characterization of the dense spike mutant\u003c/b\u003e \u003cb\u003eds1\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA common wheat mutant \u003cem\u003eds1\u003c/em\u003e, with dwarf plant and increased spike density (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea), was isolated from the EMS-treated wheat cultivar \u0026ldquo;ND3753\u0026rdquo;. In contrast to the wild-type (WT) ND3753 plant, \u003cem\u003eds1\u003c/em\u003e showed decreased internode length, especially the peduncle length, causing 46.2% of reduction in plant height in \u003cem\u003eds1\u003c/em\u003e compared to ND3753 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). In addition, the average spike length of \u003cem\u003eds1\u003c/em\u003e decreased by 51.6%, and with reduced spikelet number of 14.3 in \u003cem\u003eds1\u003c/em\u003e compared to 16.2 in ND3753, which resulted in a higher spike density of 4.05 in \u003cem\u003eds1\u003c/em\u003e than 2.21 in ND3753 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eGenetic analysis of\u003c/b\u003e \u003cb\u003eds1\u003c/b\u003e\u003c/p\u003e \u003cp\u003eCrossing \u003cem\u003eds1\u003c/em\u003e mutant with its wild-type ND3753, the F\u003csub\u003e1\u003c/sub\u003e plant showed increased spike density and dwarf phenotype which was similar as \u003cem\u003eds1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea), indicating that \u003cem\u003eds1\u003c/em\u003e is a dominance gene. Within the F\u003csub\u003e2\u003c/sub\u003e population (ND3753\u0026times;\u003cem\u003eds1\u003c/em\u003e), individual spike density ranged from 1.84 to 5, and exhibited a bimodal pattern of segregation. The spike length also showed a bimodal pattern, while the plant height and peduncle length were continuously distributed with no regularity, suggesting these traits might be influenced by more than one gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). Moreover, there were only 639 out of 1,030 plants showing compact spike in the ND3753\u0026times;\u003cem\u003eds1\u003c/em\u003e F\u003csub\u003e2\u003c/sub\u003e population. \u003cem\u003eX\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e-test showed a significantly distorted segregation for spike density from the 3:1 Mendel\u0026rsquo;s ratio (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e), with dramatically fewer compact spike plants. Considering that spike density is a clear segregating phenotype, and showed a strong correlation with the plant height and spike length (Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e), we decided to use spike morphology as the target trait for mapping the causative gene \u003cem\u003eds1\u003c/em\u003e, pleiotropically affects plant height and spike length.\u003c/p\u003e \u003cp\u003e \u003cb\u003eds1\u003c/b\u003e \u003cb\u003ewas mapped to chromosome 7B by BSA-seq\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBulked segregant analysis (BSA) is a rapid strategy to map genes of interest based on comparisons with traditional genetic linkage mapping [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In this study, the resequencing-based BSA was performed in the ND3753\u0026times;\u003cem\u003eds1\u003c/em\u003e F\u003csub\u003e2\u003c/sub\u003e population. Two bulks corresponding to long spike and dense spike phenotypes were sequenced by next-generation sequencing technology. To identify the chromosomal regions associated with dense spike phenotypes, we calculated the ΔSNP-index between long-spike- and dense-spike-bulks in 1Mb sliding windows (with a step size of 100 kbp) and scanned for genome enriched regions. The result showed that the start of chromosome 5D and the short arm of chromosome 7B (7BS) both have significant peaks (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). To further verified the chromosomal location of \u003cem\u003eds1\u003c/em\u003e, we also crossed \u003cem\u003eds1\u003c/em\u003e with a spring wheat variety Y3002, and performed BSA-Seq analysis in the F\u003csub\u003e2\u003c/sub\u003e population of the Y3002\u0026times;\u003cem\u003eds1\u003c/em\u003e. The significant signals were specifically detected on chromosome 7B rather than 5D (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). Taken together, the causal region for the \u003cem\u003eds1\u003c/em\u003e phenotype was located on the short arm of chromosome 7B.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFine mapping of\u003c/b\u003e \u003cb\u003eds1\u003c/b\u003e\u003c/p\u003e \u003cp\u003eConsidering that the abundant diversity between Y3002 and \u003cem\u003eds1\u003c/em\u003e in genetic background and the spring growth habit of Y3002, we used Y3002\u0026times;\u003cem\u003eds1\u003c/em\u003e population to fine-map the candidate gene \u003cem\u003eds1\u003c/em\u003e. F\u003csub\u003e2\u003c/sub\u003e individuals were identified with indel markers D153 and D552, which are located on 7BS and 7BL, respectively. We identified three types of recombinants and six additional markers were developed to genotype these recombinants. Their F\u003csub\u003e3\u003c/sub\u003e families were planted to verify the phenotype of the F\u003csub\u003e2\u003c/sub\u003e individuals, which further located \u003cem\u003eds1\u003c/em\u003e between D58.7 and D252 markers (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). Six additional Indel markers were developed to characterize the genotype of C2, which narrowed the \u003cem\u003eds1\u003c/em\u003e to the interval of D130 to D202 markers (72-Mb physical region) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). Next, we used markers In138 and In183 which were in the heterozygous interval to screen a larger population of 1,976 plants derived from the selfing of the residual heterozygous lines. Four recombination events were identified between D138 and D183 based on the spike morphology performance and genotype of these recombinants, which allowed us to delimit the \u003cem\u003eds1\u003c/em\u003e locus to a 16-Mb interval (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). In addition, we noticed that the recombinant R4 and its F\u003csub\u003e4:5\u003c/sub\u003e family all showed dense spike phenotype, indicating that they were all homozygous at \u003cem\u003eds1\u003c/em\u003e locus. Surprisingly, we cannot amplify the marker D130 located on 7BS in these R4 individuals and its F\u003csub\u003e4:5\u003c/sub\u003e family (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTherefore, we further developed three 7BS-specific markers D3.79, D4.18 and D105 located on the 0-135Mb region to check the recombinant R4 and its derived progenies. Similarly, all these markers couldn\u0026rsquo;t be amplified in these individuals (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ea), revealing that there might be a large fragment deletion on the chromosome 7BS terminal in the recombinant R4 and its derived progenies. Furthermore, we selected all the F\u003csub\u003e4:5\u003c/sub\u003e progenies derived from other important recombinants for fine-mapping. We found that the marker D130 were absent in the individuals with the compact spike phenotype (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eb), while target DNA bands were successfully amplified in those individuals with long-spike phenotype. Taken together, co-segregation of the dense and long-spike phenotype with markers on the 7BS (0-130 Mb) revealed that the ~\u0026thinsp;130-Mb terminal deletion of chromosome 7BS may be associated with the dense spike phenotype in the mutant \u003cem\u003eds1\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eUnidirectional translocation from 5AL to 7BS affects the dosage of\u003c/b\u003e \u003cb\u003eQ\u003c/b\u003e \u003cb\u003egene leads to dense spike in the mutant\u003c/b\u003e \u003cb\u003eds1\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo verify the structural chromosome variation of the mutant \u003cem\u003eds1\u003c/em\u003e, we analyzed the relative coverage of reads based on the resequencing data of the long- and dense-spike pools in the Y3002\u0026times;\u003cem\u003eds1\u003c/em\u003e and ND3753\u0026times;\u003cem\u003eds1\u003c/em\u003e F\u003csub\u003e2\u003c/sub\u003e populations. We found that the coverage of reads on 7BS (0-135Mb) in the dense-spike pools was very low, which was consistent with the identification of terminal deletion from the InDel markers located on 7BS (0-135 Mb) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea and S2a). Interestingly, we also found that the coverage of reads in 543-709Mb on 5AL in the dense-spike pool was probably twice as much as the long-spike pool (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea and S2a), indicating that there may be a segmental chromosome duplication in the terminal region of 5AL (543-709Mb). In addition, the fragment length of the deletion on 7BS was approximately equal to the terminal duplication of 5AL, which prompted us to speculate that there might be an additional 5AL terminal translocated to the 7BS.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo further confirm this assumption, FISH and genomic in situ hybridization (GISH) analyses were conducted in ND3753, \u003cem\u003eds1\u003c/em\u003e, and the near-isogenic line (NIL) pairs (NIL-Y3002 and NIL-\u003cem\u003eds1\u003c/em\u003e) derived from Y3002\u0026times;\u003cem\u003eds1\u003c/em\u003e F\u003csub\u003e6:7\u003c/sub\u003e family (Fig. S3). The result showed that there was a unidirectional translocation from 5AL to 7BS, designated as UT (5AL; 7BS), in which a part of chromosome segment of the 7BS terminal has been replaced by the terminal parts of the 5AL in the \u003cem\u003eds1\u003c/em\u003e and NIL-\u003cem\u003eds1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb and S2b). Moreover, we also found a reciprocal translocation between chromosome 1D and 3A, designated as RT (1DL; 3AS), which resulted in new 1DL-3AS\u0026bull;3AL and 1DS\u0026bull;1DL-3AS chromosomes in the \u003cem\u003eds1\u003c/em\u003e (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eb), while they were not present in the NIL-\u003cem\u003eds1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003eNotably, the wheat domesticated gene \u003cem\u003eQ\u003c/em\u003e was located on the 5AL terminal, and the phenotype of the increased copy number or expression of \u003cem\u003eQ\u003c/em\u003e allele was very similar to that of \u003cem\u003eds1\u003c/em\u003e [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Therefore, we speculated that the duplicated chromosome segment of 5AL contained the \u003cem\u003eQ\u003c/em\u003e gene, which may lead to an increase in copy number of the \u003cem\u003eQ\u003c/em\u003e gene and thus affecting spike morphology variation in the \u003cem\u003eds1\u003c/em\u003e. To investigate the copy number of \u003cem\u003eQ\u003c/em\u003e gene, we conducted TaqMan qPCR assay in ND3753, \u003cem\u003eds1\u003c/em\u003e, NIL-Y3002 and NIL-\u003cem\u003eds1\u003c/em\u003e. The duplication of \u003cem\u003eQ\u003c/em\u003e was confirmed in \u003cem\u003eds1\u003c/em\u003e and NIL\u003cem\u003e-ds1\u003c/em\u003e, while both ND3753 and NIL-Y3002 contained one haploid copy of \u003cem\u003eQ\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). In addition, the expression of \u003cem\u003eQ\u003c/em\u003e gene was higher in the spike of \u003cem\u003eds1\u003c/em\u003e compared to ND3753 at different developmental phases (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). Taken together, we concluded that the unidirectional translocation of 7BS and 5AL increases the copy number and expression of \u003cem\u003eQ\u003c/em\u003e, thus resulting in the dense spike phenotype in the mutant \u003cem\u003eds1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cb\u003eThe spike morphology variation was attributed to the UT (5AL; 7BS) and increased expression of\u003c/b\u003e \u003cb\u003eQ\u003c/b\u003e \u003cb\u003egene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.) is one of the most widely planted cereal crops in the world, accounting for approximately 20% of all food calories consumed by humans [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Yield improvement is an on-going endeavor in wheat breeding. The architecture of the spike plays a crucial role in determining the grain number and size, which is a key trait for improving yield in wheat [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Here, we identified an EMS-induced wheat mutant \u003cem\u003eds1\u003c/em\u003e, which showed a compact spike and dwarf plant (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). By combining BSA-Seq and genetic mapping, the candidate gene was eventually located within the short arm of chromosome 7B, which included the UT (5AL; 7BS), leading to an increase in the copy number of the \u003cem\u003eQ\u003c/em\u003e gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003eIt is reported that wheat domestication gene \u003cem\u003eQ\u003c/em\u003e encodes an APETALA2-like transcription factor (TF) that has pleiotropic effects on many agronomic traits, such as plant height, spike morphology, threshability and heading time [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. To further determine whether the \u003cem\u003eQ\u003c/em\u003e gene controls the spike morphology variation in \u003cem\u003eds1\u003c/em\u003e, the copy number variation and transcript level of \u003cem\u003eQ\u003c/em\u003e were examined in \u003cem\u003eds1\u003c/em\u003e. In addition, we sequenced the \u003cem\u003eQ\u003c/em\u003e gene by the specific primers to exclude the potential mutations within the \u003cem\u003eQ\u003c/em\u003e. However, we did not find any difference within the sequence of the \u003cem\u003eQ\u003c/em\u003e gene amplified from \u003cem\u003eds1\u003c/em\u003e and ND3753 (Fig. S4). Thus, these results showed that a higher expression level of \u003cem\u003eQ\u003c/em\u003e in \u003cem\u003eds1\u003c/em\u003e compared with ND3753 resulted in the dense spike phenotype, which was similar as the tetrasomic 5A plant and the confirmed dosage effects of \u003cem\u003eQ\u003c/em\u003e gene on spike morphology [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eThe role of chromosome structural variations in wheat\u003c/h2\u003e \u003cp\u003eChromosome structural variations have been observed frequently in different wheat species and have vital effects on phenotypic variation in wheat evolution and improvement. The typical chromosomes rearrangements involving 4A, 5A, and 7B in wheat evolution have been illustrated by genetic and macrocollinearity analysis [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In the new synthetic hexaploid, the chromosomes seem to be instable since the telosomes, deletions, and translocations are usually found in synthetic hexaploid wheats (SHWs). It has been reported that chromosomes 1B, 4D, 1D, 4B, and 5A showed more variations [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Combining the observation of UT (5AL-7BS) in this study, chromosomes 7B and 5A seem to be more active and easier to make translocations. There might be some specific sequences or structures on 7B and 5A, which are more prone to vary and needed further study. Unlike the UT, RT (1DL, 3AS) led chromosome rearrangement without large fragment losses and duplicates on chromosomes, which may have some positive effects on wheat agronomic traits. The polymorphic CRs were reported to be linked to plant ecologoical adaptation and crop improvement (Todesco et al., 2020). Therefore, the RT (1DL, 3AS) found in \u003cem\u003eds1\u003c/em\u003e could be used for wheat breeding like the 5BS\u0026bull;7BS/5BL\u0026bull;7BL in 66% of the 538 United Kingdom wheat lines [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHowever, chromosome translocations, inversions and deletions can affect homologous recombination and change the gene order at the break points, which are significant barriers to positional cloning. Here, we crossed \u003cem\u003eds1\u003c/em\u003e with the parental line ND3753, followed by the selfing of F\u003csub\u003e1\u003c/sub\u003e individuals to generate F\u003csub\u003e2\u003c/sub\u003e progenies. Using BSA-Seq, we were able to identify the candidate gene may located on chromosome 7B. We developed the single nucleotide polymorphism varieties between \u003cem\u003eds1\u003c/em\u003e and ND3753 into KASP (Kompetitive Allele-Specific PCR) markers to facilitate the mapping of candidate gene. However, the KASP markers located on 0-135Mb of 7BS were difficult to design and were unstable during genotyping assay. Therefore, we used additional population of \u003cem\u003eds1\u003c/em\u003e\u0026times;Y3002 to solve the problem and examine the phenotype of the \u003cem\u003eds1\u003c/em\u003e through the traditional map-cloning. Therefore, based on the next generation sequencing and reads counts analysis, the present and absent structure variations, duplicate variations, and introgressions can be found, which can provide useful information. We suggest that before mapping, we should first consider the chromosome structure, since several chromosome translocations have reported in many founder wheat lines and 39.7% of 373 Chinese cultivars [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eThe putative mechanism responsible for the chromosome structure variations in EMS-induced mutant\u003c/h2\u003e \u003cp\u003eEMS is a chemical mutagen mainly induces base pair substitutions and low level of chromosome breaks in plant genomes [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. It has been reported that EMS treatment can influence DNA methylation processes and thus impacting genomic stability [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The higher the EMS concentration treatment, the more chromosome aberrations were observed in cowpea [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. However, the large chromosome structural variations, such as RT and UT, should be rare in one mutant event induced by EMS in crops [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Nevertheless, in this study, we obtained an EMS-induced mutant with several chromosome structural variations, which was observed the first time in wheat. In the mutant \u003cem\u003eds1\u003c/em\u003e, there was not only UT (5AL; 7BS), but also RT (1DS; 3AL), which seems unlikely to happen in one EMS-induced mutant event.\u003c/p\u003e \u003cp\u003eConsidering that the low frequency of chromosome structural variation induced by EMS, we speculated that the chromosome translocations in the mutant \u003cem\u003eds1\u003c/em\u003e might be induced by mutated gene(s) involved in chromosome stability, chromosome break and rearrangement, or meiotic chromosome pairing, which need further study. The mutated gene(s) may reduce meiotic fidelity, causing nonhomologous chromosomes to pair and recombine, thus may result in chromosome translocations in \u003cem\u003eds1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). In this case, the chromosome structure may not be stable in the early generation of \u003cem\u003eds1\u003c/em\u003e and the progeny lines from \u003cem\u003eds1\u003c/em\u003e may still carry other chromosomes translocations. It is worthwhile to further detect the chromosome structure of the offspring derived from \u003cem\u003eds1\u003c/em\u003e to find new chromosome structural variations with phenotypic effects for wheat breeding. In previous studies, the deletion mutant of \u003cem\u003ePh1\u003c/em\u003e gene was used to induce homoeologous recombination [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. The Kaixianluohanmai (KL) system, a landrace of hexoploid wheat expressing the \u003cem\u003eP\u003c/em\u003eh-like phenotype, can induce relative higher level of recombination of the closely related chromosomes 2S\u003csup\u003ev\u003c/sup\u003e-2B [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In this study, we found a new material that can be used to produce nonhomologous chromosome structural variations, which provides an efficient approach to mine chromosome structure in wheat. Given the relative higher level of nonhomologous chromosome recombination of \u003cem\u003eds1\u003c/em\u003e, we might be able to transfer alien chromosome segments into wheat through hybridization between \u003cem\u003eds1\u003c/em\u003e and wild relatives, thereby improving the chromosome diversity of modern wheat cultivars.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study identified an EMS-induced dense spike mutant \u003cem\u003edense spike1\u003c/em\u003e (\u003cem\u003eds1\u003c/em\u003e) with dwarf plant and increased spike density. Combined map-based cloning, sequence comparison, cytological and expression analyses, we demonstrate that a partial unidirectional translocation (UT) from 5AL to 7BS accrued in \u003cem\u003eds1\u003c/em\u003e, resulting in an increase in \u003cem\u003eQ\u003c/em\u003e gene copy number and expression, which is responsible for the mutant phenotype. Collectively, we not only found the unidirectional translocation from 5AL to 7BS, there are other chromosome structure variations in this EMS mutant population, whose potential utilization value is worth exploring for future wheat improvement.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo specific permit is required for the samples in this study. We comply with relevant institutional, national, and international guidelines and legislation for plant studies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw sequence data of two BSA-Seq analysis generated in this study have been deposited in the Sequence Read Archive under the accession code PRJNA1133897.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from the National Natural Science Foundation of China (31991210), the Joint Research Program for Breeding of Inner Mongolia Autonomous Region, China (YZ2023008), and the Scientific and Technological Innovation 2030 Major Project (2023ZD0402301).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHRP and MH supervised this work. HRP, MH, ZFN, and QXS. conceived this work. XYZ, YFW, PFG, and YMC performed analyses. XYZ, YZL, KG, and JX performed experiments. XYZ, YFW, YMC, MMX, ZRH, WLG, YYY, ZFN, QXS, MH, and HRP interpreted data. XYZ, TYL, and YFW wrote the manuscript, and MH and HRP revised it. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Zhen Qin, Zhengzhao Yang, Xiaoming Xie and Wenxi Wang from China Agricultural University for technical support. We appreciate Mingshan You\u0026nbsp;from China Agricultural University for providing the mutant material \u003cem\u003eds1\u003c/em\u003e.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eZorb C, Ludewig U, Hawkesford MJ: Perspective on wheat yield and quality with reduced nitrogen supply. Trends Plant Sci\u003cem\u003e.\u003c/em\u003e 2018;23(11):1029-1037.\u003c/li\u003e\n\u003cli\u003eJost M, Taketa S, Mascher M, Himmelbach A, Yuo T, Shahinnia F, Rutten T, Druka A, Schmutzer T, Steuernagel B\u003cem\u003e et al\u003c/em\u003e: A Homolog of Blade-on-petiole 1 and 2 (BOP1/2) controls internode length and homeotic changes of the barley inflorescence. Plant Physiol. 2016;171(2):1113-1127.\u003c/li\u003e\n\u003cli\u003eKonopatskaia I, Vavilova V, Blinov AG, Goncharov NP: Spike morphology genes in wheat species (\u003cem\u003eTriticum\u003c/em\u003e L.). Proceedings of the Latvian Academy of Sciences. Section B. Natural, Exact, and Applied Sciences. 2016;70:345-355.\u003c/li\u003e\n\u003cli\u003eKajla A, Schoen A, Paulson C, Yadav IS, Neelam K, Riera-Lizarazu O, Leonard J, Gill BS, Venglat P, Datla R\u003cem\u003e et al\u003c/em\u003e: Physical mapping of the wheat genes in low-recombination regions: radiation hybrid mapping of the C-locus. Theor Appl Genet\u003cem\u003e.\u003c/em\u003e 2023;136(7):159.\u003c/li\u003e\n\u003cli\u003eJohnson EB, Nalam VJ, Zemetra RS, Riera-Lizarazu O: Mapping the compactum locus in wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.) and its relationship to other spike morphology genes of the \u003cem\u003eTriticeae\u003c/em\u003e. Euphytica. 2008;163(2):193-201.\u003c/li\u003e\n\u003cli\u003ePrabhakaraRao MV: Mapping of the compactum gene C on chromosome 2D of wheat. Wheat Information Service. 1972;35:9.\u003c/li\u003e\n\u003cli\u003eMuramatsu M: Dosage effect of the spelta gene \u003cem\u003eq\u003c/em\u003e of hexaploid wheat. Genetics. 1963;48(4):469-482.\u003c/li\u003e\n\u003cli\u003eMuramatsu M: The vulgare super gene, \u003cem\u003eQ\u003c/em\u003e: its universality in durum wheat and its phenotypic effects in tetraploid and hexaploid wheats. Can J Genet Cytol. 1986;28(1):30-41.\u003c/li\u003e\n\u003cli\u003eFaris JD, Gill BS: Genomic targeting and high-resolution mapping of the domestication gene \u003cem\u003eQ\u003c/em\u003e in wheat. Genome\u003cem\u003e.\u003c/em\u003e 2002;45(4):706-718.\u003c/li\u003e\n\u003cli\u003eFaris JD, Fellers JP, Brooks SA, Gill BS: A bacterial artificial chromosome contig spanning the major domestication locus \u003cem\u003eQ\u003c/em\u003e in wheat and identification of a candidate gene. Genetics. 2003;164(1):311-321.\u003c/li\u003e\n\u003cli\u003eKato K, Sonokawa R, Miura H, Sawada S: Dwarfing effect associated with the threshability gene Q on wheat chromosome 5A. Plant Breed. 2003;122(6):489-492.\u003c/li\u003e\n\u003cli\u003eZhang Z, Belcram H, Gornicki P, Charles M, Just J, Huneau C, Magdelenat G, Couloux A, Samain S, Gill BS\u003cem\u003e et al\u003c/em\u003e: Duplication and partitioning in evolution and function of homoeologous \u003cem\u003eQ\u003c/em\u003e loci governing domestication characters in polyploid wheat. Proc Natl Acad Sci. 2011;108(46):18737-18742.\u003c/li\u003e\n\u003cli\u003eSimons KJ, Fellers JP, Trick HN, Zhang Z, Tai Y, Gill BS, Faris JD: Molecular characterization of the major wheat domestication gene \u003cem\u003eQ\u003c/em\u003e. Genetics.2006; 172(1):547-555.\u003c/li\u003e\n\u003cli\u003eGreenwood JR, Finnegan EJ, Watanabe N, Trevaskis B, Swain SM: New alleles of the wheat domestication gene \u003cem\u003eQ\u003c/em\u003e reveal multiple roles in growth and reproductive development. Development. 2017;144(11):1959-1965.\u003c/li\u003e\n\u003cli\u003eDebernardi JM, Lin H, Faris JD, Dubcovsky J: microRNA172 plays a critical role in wheat spike morphology and grain threshability. Development (Cambridge). 2017.\u003c/li\u003e\n\u003cli\u003eSchiessl S, Katche E, Ihien E, Chawla HS, Mason AS: The role of genomic structural variation in the genetic improvement of polyploid crops. Crop J. 2019;7(2):127-140.\u003c/li\u003e\n\u003cli\u003eLv R, Gou X, Li N, Zhang Z, Wang C, Wang R, Wang B, Yang C, Gong L, Zhang H\u003cem\u003e et al\u003c/em\u003e: Chromosome translocation affects multiple phenotypes, causes genome-wide dysregulation of gene expression, and remodels metabolome in hexaploid wheat. Plant J. 2023;115(6):1564-1582.\u003c/li\u003e\n\u003cli\u003eNicolas SD, Mignon GL, Eber F, Coriton O, Monod H, Clouet V, Huteau V, Lostanlen A, Delourme R, Chalhoub B\u003cem\u003e et al\u003c/em\u003e: Homeologous recombination plays a major role in chromosome rearrangements that occur during meiosis of \u003cem\u003eBrassica napus\u003c/em\u003e haploids. Genetics. 2007;175(2):487-503.\u003c/li\u003e\n\u003cli\u003eDvorak J, Wang L, Zhu T, Jorgensen CM, Luo MC, Deal KR, Gu YQ, Gill BS, Distelfeld A, Devos KM\u003cem\u003e et al\u003c/em\u003e: Reassessment of the evolution of wheat chromosomes 4A, 5A, and 7B. Theor Appl Genet. 2018;131(11):2451-2462.\u003c/li\u003e\n\u003cli\u003eWalkowiak S, Gao L, Monat C, Haberer G, Kassa MT, Brinton J, Ramirez-Gonzalez RH, Kolodziej MC, Delorean E, Thambugala D\u003cem\u003e et al\u003c/em\u003e: Multiple wheat genomes reveal global variation in modern breeding. Nature.2020;588(7837):277-283.\u003c/li\u003e\n\u003cli\u003eWu N, Lei Y, Pei D, Wu H, Liu X, Fang J, Guo J, Wang C, Guo J, Zhang J\u003cem\u003e et al\u003c/em\u003e: Predominant wheat-alien chromosome translocations in newly developed wheat of China. Mol Breeding.2021;41(4).\u003c/li\u003e\n\u003cli\u003eZhao J, Zheng X, Qiao L, Yang C, Wu B, He Z, Tang Y, Li G, Yang Z, Zheng J\u003cem\u003e et al\u003c/em\u003e: Genome-wide association study reveals structural chromosome variations with phenotypic effects in wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.). Plant J. 2022;112(6):1447-1461.\u003c/li\u003e\n\u003cli\u003eLiu C, Ye X, Wang M, Li S, Lin Z: Genetic behavior of \u003cem\u003eTriticum aestivum\u003c/em\u003e-\u003cem\u003eDasypyrum villosum\u003c/em\u003e translocation chromosomes T6V#4S\u0026middot;6DL and T6V#2S\u0026middot;6AL carrying powdery mildew resistance. J INTEGR AGR. 2017;16:2136-2144.\u003c/li\u003e\n\u003cli\u003eSchlegel R, Korzun V: About the origin of 1RS.1BL wheat-rye chromosome translocations from Germany. Plant Breed\u003cem\u003e.\u003c/em\u003e 1997;116(6):537-540.\u003c/li\u003e\n\u003cli\u003eNaseeb S, Carter Z, Minnis D, Donaldson I, Zeef L, Delneri D: Widespread impact of chromosomal inversions on gene expression uncovers robustness via phenotypic buffering. Mol Biol Evol. 2016;33(7):1679-1696.\u003c/li\u003e\n\u003cli\u003eWesley CS, Eanes WF: Isolation and analysis of the breakpoint sequences of chromosome inversion In(3L)Payne in Drosophila melanogaster. Proc Natl Acad Sci. 1994;91(8):3132-3136.\u003c/li\u003e\n\u003cli\u003eTrick M, Adamski NM, Mugford SG, Jiang C, Febrer M, Uauy C: Combining SNP discovery from next-generation sequencing data with bulked segregant analysis (BSA) to fine-map genes in polyploid wheat. BMC Plant biol. 2012;12(1):14.\u003c/li\u003e\n\u003cli\u003eF\u0026ouml;rster S, Schumann E, Eberhard Weber W, Pillen K: Discrimination of alleles and copy numbers at the \u003cem\u003eQ\u003c/em\u003e locus in hexaploid wheat using quantitative pyrosequencing. Euphytica. 2012, 186(1):207-218.\u003c/li\u003e\n\u003cli\u003eF\u0026ouml;rster S, Schumann E, Baumann M, Weber WE, Pillen K: Copy number variation of chromosome 5A and its association with \u003cem\u003eQ\u003c/em\u003e gene expression, morphological aberrations, and agronomic performance of winter wheat cultivars. Theor Appl Genet. 2013;126(12):3049-3063.\u003c/li\u003e\n\u003cli\u003eShiferaw B, Smale M, Braun H, Duveiller E, Reynolds M, Muricho G: Crops that feed the world 10. Past successes and future challenges to the role played by wheat in global food security. Food Secur. 2013;5(3):291-317.\u003c/li\u003e\n\u003cli\u003eCao S, Xu D, Hanif M, Xia X, He Z: Genetic architecture underpinning yield component traits in wheat. Theor Appl Genet. 2020;133(6):1811-1823.\u003c/li\u003e\n\u003cli\u003eChen Y, Song W, Xie X, Wang Z, Guan P, Peng H, Jiao Y, Ni Z, Sun Q, Guo W: A collinearity-incorporating homology inference strategy for connecting emerging assemblies in the \u003cem\u003eTriticeae\u003c/em\u003e tribe as a pilot practice in the plant pangenomic era. Mol Plant. 2020;13(12):1694-1708.\u003c/li\u003e\n\u003cli\u003eZhang S, Du P, Lu X, Fang J, Wang J, Chen X, Chen J, Wu H, Yang Y, Tsujimoto H\u003cem\u003e et al\u003c/em\u003e: Frequent numerical and structural chromosome changes in early generations of synthetic hexaploid wheat. Genome. 2021;65(4):205-217.\u003c/li\u003e\n\u003cli\u003eHuang X, Zhu M, Zhuang L, Zhang S, Wang J, Chen X, Wang D, Chen J, Bao Y, Guo J\u003cem\u003e et al\u003c/em\u003e: Structural chromosome rearrangements and polymorphisms identified in Chinese wheat cultivars by high-resolution multiplex oligonucleotide FISH. Theor Appl Genet. 2018;131(9):1967-1986.\u003c/li\u003e\n\u003cli\u003eKim Y, Schumaker KS, Zhu J: EMS mutagenesis of \u003cem\u003eArabidopsis\u003c/em\u003e. In: \u003cem\u003eArabidopsis Protocols.\u003c/em\u003e Edited by Salinas J, Sanchez-Serrano JJ. Totowa, NJ: Humana Press; 2006: 101-103.\u003c/li\u003e\n\u003cli\u003eT\u0026uuml;rkoğlu A, Haliloğlu K, Tosun M, Bujak H, Eren B, Demirel F, Szulc P, Karag\u0026ouml;z H, Selwet M, \u0026Ouml;zkan G\u003cem\u003e et al\u003c/em\u003e: Ethyl Methanesulfonate (EMS) mutagen toxicity-induced DNA damage, cytosine methylation alteration, and iPBS-retrotransposon polymorphisms in wheat (\u003cem\u003eTriticum aestivum \u003c/em\u003eL.). In: Agronomy\u003cem\u003e.\u003c/em\u003e, vol. 13;2023.\u003c/li\u003e\n\u003cli\u003eGnanamurthy S, Dhanavel D: Effect of EMS on induced morphological mutants and chromosomal variation in cowpea (\u003cem\u003eVigna unguiculata\u003c/em\u003e (L.) Walp). Int Lett Nat Sci. 2014, 22:33-43.\u003c/li\u003e\n\u003cli\u003eWang D, Li Y, Wang H, Xu Y, Yang Y, Zhou Y, Chen Z, Zhou Y, Gui L, Guo Y\u003cem\u003e et al\u003c/em\u003e: Boosting wheat functional genomics via an indexed EMS mutant library of KN9204. Plant Commun\u003cem\u003e.\u003c/em\u003e 2023;4(4):100593.\u003c/li\u003e\n\u003cli\u003eT\u0026uuml;rk\u0026ouml;si E, Ivanizs L, Farkas A, Ga\u0026aacute;l E, Kruppa K, Kov\u0026aacute;cs P, Szak\u0026aacute;cs \u0026Eacute;, Szőke-P\u0026aacute;zsi K, Said M, C\u0026aacute;pal P\u003cem\u003e et al\u003c/em\u003e: Transfer of the ph1b Deletion chromosome 5B from chinese spring wheat into a winter wheat line and induction of chromosome rearrangements in wheat-\u003cem\u003eAegilops biuncialis\u003c/em\u003e hybrids. Front Plant Sci. 2022;13.\u003c/li\u003e\n\u003cli\u003eFan C, Luo J, Sun J, Chen H, Li L, Zhang L, Chen X, Li Y, Ning S, Yuan Z\u003cem\u003e et al\u003c/em\u003e: The KL system in wheat permits homoeologous crossing over between closely related chromosomes. Crop J. 2023;11(3):808-816.\u003c/li\u003e\n\u003cli\u003eChen S, Zhou Y, Chen Y, Gu J: fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018;34(17):i884-i890.\u003c/li\u003e\n\u003cli\u003eInternational Wheat Genome Sequencing (IWGSC), Appels R, Eversole K, Stein N, Feuillet C, Keller B, Rogers J, Pozniak CJ, Choulet F, Distelfeld A\u003cem\u003e et al\u003c/em\u003e: Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science. 2018;361(6403):r7191.\u003c/li\u003e\n\u003cli\u003eZhu T, Wang L, Rimbert H, Rodriguez JC, Deal KR, De Oliveira R, Choulet F, Keeble-Gagn\u0026egrave;re G, Tibbits J, Rogers J\u003cem\u003e et al\u003c/em\u003e: Optical maps refine the bread wheat \u003cem\u003eTriticum aestivum\u003c/em\u003e cv. Chinese Spring genome assembly. Plant J. 2021;107(1):303-314.\u003c/li\u003e\n\u003cli\u003eMcKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M\u003cem\u003e et al\u003c/em\u003e: The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010; 20(9):1297-1303.\u003c/li\u003e\n\u003cli\u003eCingolani P, Platts A, Wang LL, Coon M, Nguyen T, Wang L, Land SJ, Lu X, Ruden DM: A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff. Fly. 2012;6(2):80-92.\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2\u0026minus;\u003csup\u003e\u0026Delta;\u0026Delta;\u003c/sup\u003e\u003csup\u003eCT\u003c/sup\u003e method. Methods. 2001;25(4):402-408.\u003c/li\u003e\n\u003cli\u003eTang S, Tang Z, Qiu L, Yang Z, Li G, Lang T, Zhu W, Zhang J, Fu S: Developing new oligo probes to distinguish specific chromosomal segments and the A, B, D genomes of wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.) using ND-FISH. Front Plant Sci. 2018;9.\u003c/li\u003e\n\u003cli\u003eTang Z, Yang Z, Fu S: Oligonucleotides replacing the roles of repetitive sequences pAs1, pSc119.2, pTa-535, pTa71, CCS1, and pAWRC.1 for FISH analysis. J Appl Genet. 2014;55(3):313-318.\u003c/li\u003e\n\u003cli\u003eHan F, Liu B, Fedak G, Liu Z: Genomic constitution and variation in five partial amphiploids of wheat-\u003cem\u003eThinopyrum\u003c/em\u003e intermedium as revealed by GISH, multicolor GISH and seed storage protein analysis. Theor Appl Genet. 2004;109(5):1070-1076.\u003c/li\u003e\n\u003cli\u003eD\u0026iacute;az A, Zikhali M, Turner AS, Isaac P, Laurie DA: Copy Number Variation Affecting the Photoperiod-B1 and Vernalization-A1 Genes Is Associated with Altered Flowering Time in Wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e). PLOS ONE. 2012;7(3):e33234.\u003c/li\u003e\n\u003cli\u003eNemoto Y, Kisaka M, Fuse T, Yano M, Ogihara Y: Characterization and functional analysis of three wheat genes with homology to the \u003cem\u003eCONSTANS\u003c/em\u003e flowering time gene in transgenic rice. Plant J. 2003;36(1):82-93.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gics","sideBox":"Learn more about [BMC Genomics](http://bmcgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gics","title":"BMC Genomics","twitterHandle":"#BMCGenomics","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Triticum aestivum L., EMS-induced mutant, chromosomal translocation, dense spike, Q gene","lastPublishedDoi":"10.21203/rs.3.rs-4927595/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4927595/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eAs the inflorescence of wheat, spike architecture largely determines grain productivity. Dissecting the genetic basis for spike morphology of wheat can contribute towards designation of ideal spike morphology to improve grain production.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eIn this study, we characterized an EMS-induced mutant \u003cem\u003edense spike1\u003c/em\u003e (\u003cem\u003eds1\u003c/em\u003e) from Nongda3753 (ND3753) with a dense spike and reduced plant height. Using bulked segregant analysis coupled with whole-genome sequencing (BSA-Seq) of two segregating populations, \u003cem\u003eds1\u003c/em\u003e was mapped to the short arm of chromosome 7B. Further genotypic and phenotypic analyses of the residual heterozygous lines from F\u003csub\u003e3\u003c/sub\u003e to F\u003csub\u003e6\u003c/sub\u003e of Yong3002\u0026times;\u003cem\u003eds1\u003c/em\u003e revealed that there was a 0-135Mb deletion in chromosome 7B associated with the dense spike phenotype. The reads count analysis of the two bulks in BSA-Seq along with the cytological analysis of \u003cem\u003eds1\u003c/em\u003e, ND3753, NIL-\u003cem\u003eds1\u003c/em\u003e and NIL-Y3002 confirmed the partial unidirectional translocation of 5AL (541-713Mb) to 7BS (0-135Mb) in \u003cem\u003eds1\u003c/em\u003e. This translocation resulted in an increase in copy number and expression of \u003cem\u003eQ\u003c/em\u003e gene, thereby leading to the dense spike phenotype observed in \u003cem\u003eds1\u003c/em\u003e.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eWe identified a partial unidirectional translocation from 5AL to 7BS in an EMS-induced mutant \u003cem\u003eds1\u003c/em\u003e, which exhibiting dense spike phenotype. This research deepens our understanding of the dosage-dependent effect of \u003cem\u003eQ\u003c/em\u003e gene on wheat spike morphology, and provides new materials with several chromosome structural variations for wheat breeding.\u003c/p\u003e","manuscriptTitle":"Partial unidirectional translocation from 5AL to 7BS leads to dense spike in an EMS-induced wheat mutant","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-17 05:55:46","doi":"10.21203/rs.3.rs-4927595/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-08-20T11:24:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-08-19T23:48:39+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-08-19T23:47:34+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Genomics","date":"2024-08-17T03:22:28+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gics","sideBox":"Learn more about [BMC Genomics](http://bmcgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gics","title":"BMC Genomics","twitterHandle":"#BMCGenomics","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ac85a9e6-9a8c-46c7-a725-33d2fb87135c","owner":[],"postedDate":"September 17th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-11-18T19:19:04+00:00","versionOfRecord":{"articleIdentity":"rs-4927595","link":"https://doi.org/10.1186/s12864-024-11000-y","journal":{"identity":"bmc-genomics","isVorOnly":false,"title":"BMC Genomics"},"publishedOn":"2024-11-12 15:58:17","publishedOnDateReadable":"November 12th, 2024"},"versionCreatedAt":"2024-09-17 05:55:46","video":"","vorDoi":"10.1186/s12864-024-11000-y","vorDoiUrl":"https://doi.org/10.1186/s12864-024-11000-y","workflowStages":[]},"version":"v1","identity":"rs-4927595","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4927595","identity":"rs-4927595","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00