Establishment and application of a rapid detection system for Aspergillus fumigatus based on ERA/CRISPR-Cas12a

Establishment and application of a rapid detection system for Aspergillus fumigatus based on ERA/CRISPR-Cas12a | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Establishment and application of a rapid detection system for Aspergillus fumigatus based on ERA/CRISPR-Cas12a Qiuyang Jiang, Xiaotong Zeng, Qi Zhang, Fo Yang, Tingyao Lv, Yushuo Zhang, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7538348/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 09 Mar, 2026 Read the published version in BMC Microbiology → Version 1 posted 12 You are reading this latest preprint version Abstract Aspergillus fumigatus ( AF ) is the predominant pathogen implicated in invasive aspergillosis (IA) in humans; therefore, prompt and accurate detection is critical for the effective prevention and management of IA. This study developed a rapid detection system targeting the AF -specific anxC4 gene by integrating enzymatic recombinase amplification (ERA) with CRISPR/Cas12a. The reaction proceeds at a stable temperature of 37°C, with amplification and detection systems separately positioned in the tube lid and bottom, respectively, effectively minimizing aerosol contamination typically associated with product transfers. To enhance sensitivity, the One Pot method was optimized. Consequently, the fluorescence detection limit reached 1 fg/µL, and the sensitivity of the test strip reached 10 fg/µL, with no cross-reactivity observed against other fungi. Detection of AF was completed within 60 min, and results were visually displayed through fluorescence signals and nucleic acid test strips. Clinical practicality was further evaluated using aspergillosis samples, which demonstrated satisfactory performance. Pure culture results confirmed that out of 62 sputum samples, 32 were positive and 30 negative. Evaluation of 62 clinical samples using the One Pot ERA-CRISPR/Cas12a system demonstrated sensitivity and specificity rates of 93.75% and 93.33%, respectively, via fluorescence detection, and 90.63% sensitivity and 96.67% specificity using lateral flow strips. Aspergillosis ERA CRISPR/Cas12a One Pot method Lateral flow test strip Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Fungi are widely distributed in nature. Under normal circumstances, fungal infections generally do not occur due to human immunity. However, when the immune system is weakened, the risk of infection significantly increases. According to epidemiological data, fungal infections affect over one billion individuals worldwide [ 1 ]. Invasive fungal infections are responsible for roughly 1.5 million annual deaths and can result in higher mortality rates compared to diseases such as tuberculosis and malaria [ 2 ]. AF is a saprophytic filamentous fungus commonly found in soil and compost. It is also a pathogen causing various lung diseases in humans, birds, and other mammals [ 3 ]. It spreads via asexual spores and is the main pathogen responsible for IA. IA typically affects individuals with compromised immune systems, such as newborns and the elderly [ 4 , 5 ]. Reportedly, IA accounts for over 300,000 cases annually worldwide [ 1 ]. Due to insufficient diagnostic methods, reported cases may represent only 50%–65% of actual cases [ 6 ]. Even with timely diagnosis and treatment, mortality remains high, ranging from 30% to 80% [ 7 ]. Aspergillosis remains the most prevalent fungal infection among patients undergoing hematopoietic stem cell transplantation (HSCT) [ 8 ], while lung transplant recipients exhibit aspergillosis incidence rates of approximately 10%–15% [ 9 ]. Without timely detection and treatment, mortality rates associated with aspergillosis are exceedingly high [ 10 ]. Currently, hospitals diagnose aspergillosis through fungal culture and microscopic examination. Although this diagnostic approach is highly specific, it requires substantial time. The GM test detects galactomannan, which is commonly identified in blood and bronchoalveolar lavage fluid (BAL) of suspected cases [ 11 ]. BAL detection has higher sensitivity than serum detection [ 12 ], but yields more false-positive results [ 13 ]. Molecular diagnostic approaches, such as polymerase chain reaction (PCR) and real-time quantitative PCR, exhibit excellent specificity. However, PCR techniques require specialized instruments and trained operators, restricting their practical application in resource-limited or remote healthcare settings [ 14 ]. Therefore, developing a rapid, accurate, and easily applicable detection method for AF in primary healthcare institutions holds significant clinical value. Recently, isothermal amplification techniques, such as loop-mediated isothermal amplification (LAMP) [ 15 ] and recombinase polymerase amplification (RPA) [ 16 ], have shown great potential in pathogen detection due to their simplicity and lack of dependence on complex instrumentation. ERA technology uses recombinant enzyme-primer complexes to recognize target sequences specifically at room temperature. ERA technology, utilizing single-stranded DNA-binding proteins (SSB) and DNA polymerase, achieves nucleic acid amplification within 20 minutes, markedly reducing turnaround times. Utilizing ERA’s advantages of simplicity and convenience facilitates rapid and accurate point-of-care testing for detecting AF . Thus, establishing a rapid method for detecting AF expands diagnostic capabilities and provides both theoretical and practical foundations. The CRISPR/Cas system is widely utilized in molecular diagnostics due to its highly specific target recognition. Guided by crRNA, Cas12a recognizes target DNA and activates non-specific cleavage, indiscriminately cutting surrounding single-stranded DNA reporter molecules [ 17 ]. This feature makes CRISPR/Cas12a an ideal tool for highly sensitive fluorescence or lateral flow detection. Li [ 18 ] first combined CRISPR/Cas12a with PCR, developing a rapid and sensitive detection method termed HOLMES. Subsequently, Chen [ 17 ] established DETECTR, a CRISPR/Cas12a detection platform based on RPA, demonstrating sensitivity at the attomolar level and extremely high specificity. Biosensing systems based on CRISPR/Cas12a have subsequently been developed for detecting diverse targets, including pathogenic bacteria [ 19 , 20 ], genetically modified crops [ 21 , 22 ], SARS-CoV-2 [ 23 , 24 ], and other pathogenic viruses [ 18 , 25 ]. Integrating CRISPR/Cas12a with isothermal amplification significantly increases target abundance quickly, thus greatly enhancing detection sensitivity. In this study, the ERA-CRISPR/Cas12a system was employed to achieve rapid detection of AF . Highly specific primers and crRNA targeting the conserved anxC4 gene of AF were designed and integrated with lateral flow test strips, resulting in a visual detection platform characterized by high sensitivity and specificity. Moreover, by separating the reaction and detection components into distinct locations within a single centrifuge tube, this optimized One Pot configuration effectively mitigated common issues such as aerosol contamination and low amplification efficiency inherent in traditional methods. The reliability of this method was verified using clinical samples. The established ERA-CRISPR/Cas12a technique offers a novel diagnostic approach for early AF infection detection and presents a valuable reference for rapid identification of other fungal pathogens. Materials and Methods Materials and Instruments The AF strain (ATCC MYA-4609) utilized in this study was obtained commercially from ATCC. Conventional primers required for the experiments, along with the associated culture media reagents, were provided by Biotechnology (Shanghai) Co., Ltd. The P6 High-Fidelity Premix, LbCas12a enzyme, Cas12a High-Yield crRNA Synthesis and Purification Kit, modified ssDNA reporter probes (FAM and BHQ1 labels), and lateral flow test strips were sourced from Shanghai Tolo Harbor Biotechnology Co., Ltd. DNA purification kits were acquired from Tiangen Biotechnology (Beijing) Co., Ltd., while the ERA nucleic acid amplification kit was obtained from Suzhou Xianda Biotechnology Co., Ltd. The sputum extraction kit was purchased from Hangzhou Dilan Biotechnology Co., Ltd. A Roche LightCycler 96 system was employed for fluorescence quantitative PCR analysis, and the gel imaging equipment was sourced from Shanghai Qinxiang Scientific Instrument Co., Ltd. The fungal strains utilized in this research were preserved in our laboratory. Clinical AF sputum samples were supplied by Huaibei People's Hospital, following ethical approval by the hospital ethics committee (No. 2024-052). Cultivation of AF and Genome Extracti Cultivation of AF and Genome Extracti on AF strains were cultivated on potato dextrose agar (PDA) plates at 30°C for 4 days. Spores were then inoculated into 5 mL liquid PDA medium and incubated for 24 hours. Fungal hyphae and spores were collected, and genomic DNA was extracted following the fungal genome extraction protocol. Design of Specific Primers and crRNA The anxC4 gene of AF (GenBank accession AY598940) was selected. Using the online tool CRISPR RGEN, two high-scoring crRNA sequences (41 nt) targeting a specific amplification fragment of the anxC4 gene were designed. crRNA sequences (crRNA 1 and crRNA 2) were synthesized using the Cas12a High-Yield crRNA Synthesis and Purification Kit. One set of PCR primers (PCR-F/R) and three pairs of ERA primers (ERA-F1/R1, ERA-F2/R2, and ERA-F3/R3) were specifically designed within target regions of the crRNA sequences using Primer Premier 5 and validated via NCBI BLAST. All primer synthesis was carried out by Sangon Bioengineering (Shanghai) Co., Ltd. (Table 1 ). Table 1 Primers and crRNA used in this study. Name Sequence(5′-3′) Length PCR/F CCTCTGCGAACAACCTTT 18 PCR/R GCTCTTTGCGATCCCTTT 18 ERA/F1 CCAGTCATTCTGTCTCCTCTGCGAACAACC 30 ERA/R1 CTTCAGCTCTTTGCGATCCCTTTCATCCTT 30 ERA/F2 TCTGTCTCCTCTGCGAACAACCTTTCAGTC 30 ERA/R2 CTTCAGCTCTTTGCGATCCCTTTCATCCTT 30 ERA/F3 TCATTCTGTCTCCTCTGCGAACAACCTTTC 30 ERA/R3 CTTCAGCTCTTTGCGATCCCTTTCATCCTT 30 crRNA 1 UAAUUUCUACUAAGUGUAGAUGCGAGUGUUUCCUCCUCCCG 41 crRNA 2 UAAUUUCUACUAAGUGUAGAUAUCCUUGGACUUGUUUCGCG 41 PCR and ERA Amplification Systems The PCR reaction mixture (50 µL) contained 25 µL of P6 High-Fidelity Premix, 2 µL each of forward and reverse primers (10 µM), 2 µL genomic DNA template, and nuclease-free water. PCR amplification was conducted using an ABI PCR thermocycler. The cycling conditions included initial denaturation at 95°C for 5 min, 35 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 1 min, and final extension at 72°C for 10 min. The ERA amplification reaction (50 µL total) comprised 20 µL of dissolving reagent, 2.5 µL each of forward and reverse primers (10 µM), 2 µL of genomic DNA template, and 23.5 µL of nuclease-free water. This reaction mixture was added into tubes containing lyophilized reagents. Subsequently, 2 µL of activator was placed on the tube lid, the tube briefly centrifuged, and then incubated at 37°C. Amplified products (2.5 µL each) from PCR and ERA reactions were subsequently analyzed by agarose gel electrophoresis. CRISPR-Cas12a Detection System The CRISPR-Cas12a detection reaction (20 µL) contained 2 µL of 10× HOLMES Buffer, 0.5 µL of Cas12a, 2 µL of crRNA, 2 µL of ssDNA reporter probe, and nuclease-free water up to a final volume of 20 µL. Fluorescence measurements were conducted using the Roche LightCycler® 96 at 37°C, recording fluorescence signals every 30 s over 45 min (90 cycles). ERA Primers and crRNA Screenin g Three pairs of ERA primers were tested for amplifying AF genomic DNA, selecting the primer set yielding a single specific amplification product. Two crRNAs were individually assessed within the CRISPR/Cas12a system. Optimal ERA primer and crRNA combinations were selected by evaluating endpoint fluorescence intensities and amplification curve profiles. Nuclease-free water served as the negative control in all experiments. Each experimental condition was independently replicated three times. Establishment and Optimization of Two-Step CRISPR/Cas12a Detection System The established CRISPR/Cas12a assay incorporated two detection approaches: fluorescence-based detection and lateral flow assay (LFA). Fluorescence detection was conducted at 37°C using the quantitative PCR system, whereas lateral flow detection employed incubation at 37°C in a water bath. For LFA, reaction samples were diluted to a total volume of 50 µL using nuclease-free water, thoroughly mixed, and test strips were immersed in the solution to visually assess the results at the test line. Optimization of Fluorescence Detection System: With DNA template concentration fixed at 1 nM, Cas12a/crRNA ratios (2.5:1, 1.25:1, 1:1, 1:1.2, 1:1.6, and 1:2) and ssDNA probe concentrations (50, 100, 200, 300, 400, and 500 nM) were optimized. Nuclease-free water was the negative control. Fluorescence intensities were recorded under each condition. Optimization of Test Strip Detection System: ssDNA probe concentrations were diluted (0, 100, 200, 300, 400, 600, and 800 nM) and tested. The lowest concentration causing T-line disappearance was selected as optimal. Optimization of CRISPR/Cas12a Reaction Time: Reaction times (5, 10, 15, 20, 25, and 30 min) were evaluated for both fluorescence and strip detection. Optimal time was determined based on T-line color intensity. Sensitivity Evaluation of the Two-Step CRISPR/Cas12a Detection System Sensitivity of PCR-CRISPR/Cas12a and ERA-CRISPR/Cas12a methods was compared. DNA templates were serially diluted (10 6 to 10 0 aM) and subjected to PCR and ERA amplification, respectively. Amplification products (2 µL) were analyzed using fluorescence detection, and fluorescence curves were recorded. Genomic DNA was diluted (100 pg/µL to 0.1 fg/µL) to further validate the detection performance. Establishment of the One Pot ERA-CRISPR/Cas12a detection system The ERA reaction mixture comprised 20 µL of dissolving agent, 20 µL of nuclease-free water, and forward and reverse primers (2.5 µL each, 10 µM), ensuring complete dissolution of the lyophilized reagent powder. The Cas12a detection solution contained 0.5 µL LbCas12a (1 µM), 2 µL crRNA (300 nM), 2 µL 10× HOLMES Buffer, and 2 µL ssDNA reporter probe (300 nM). Before initiating the reaction, 0.4 µL of template DNA (100 pg/µL) was combined with 1 µL of activator, forming the final sample mixture. Four variants of the One Pot detection protocol were assessed: (1) Initially, 8.6 µL ERA mixture was placed at the bottom of a centrifuge tube, followed by adding 10 µL Cas12a detection mixture onto the lid. Subsequently, 1.4 µL of the sample mixture was rapidly transferred into the ERA mixture, and the tube was immediately sealed and incubated at 37°C for 20 min. After incubation, gentle rotation mixed the solutions, and fluorescence analysis was performed using a fluorescence quantitative PCR system (Fig. 1 A). (2) 15% glycerol was added between the ERA and Cas12a mixtures (Fig. 1 B). (3) 1.765 mg sucrose was added to the ERA mixture (Fig. 1 C). (4) ERA and Cas12a mixtures were directly combined before simultaneous amplification and detection (Fig. 1 D). Optimization of the One Pot ERA-CRISPR/Cas12a detection system The volume of genomic DNA (100 pg/µL) used in the One Pot ERA system was increased to 1 µL. The final concentration of the ssDNA FB probe was fixed at 300 nM, while the Cas12a protein concentration was optimized at 125, 250, 500, 750, and 1000 nM. The ERA reaction times tested were 5, 10, 15, 20, 25, 30, and 60 min, and detection time was set at 30 min. Sensitivity evaluation of the One Pot ERA-CRISPR/Cas12a detection system To determine the sensitivity of the established One Pot ERA-CRISPR/Cas12a assay for AF detection, serial 10-fold dilutions of genomic DNA were prepared and analyzed. Negative controls utilized nuclease-free water. Sensitivity was evaluated based on the intensity of fluorescence signals and visual presence of the T-line on lateral flow strips. Specificity evaluation of the One Pot ERA-CRISPR/Cas12a detection system Specificity was assessed by testing genomic DNA extracted from all strains listed in Table 2 , using the optimized One Pot ERA-CRISPR/Cas12a system. Nuclease-free water served as a negative control. Fluorescence signal intensities and test-strip T-line visualization were used to evaluate the specificity. Table 2 Fungal strains used in this study. Strain Source of the strain Strain quantity One Pot ERA-CRISPR/Cas12a a Aspergillus fumigatus ATCC MYA-4609 1 P Candida albicans Laboratory preservation 1 N Candida tropicalis Laboratory preservation 1 N Aspergillus niger Laboratory preservation 1 N Penicillium chrysogenum Laboratory preservation 1 N Alternaria alternata Laboratory preservation 1 N Botrytis cinerea Laboratory preservation 1 N Aspergillus cristatus Laboratory preservation 1 N a P: positive, N: negative. Clinical evaluation of the One Pot ERA-CRISPR/Cas12a detection system Sixty-two sputum samples (32 positives diagnosed with AF , 30 negatives without AF ) were collected from Huaibei People’s Hospital (approved by the hospital ethics committee). These clinical samples underwent diagnosis by pure culture, qPCR, and the One Pot ERA-CRISPR/Cas12a detection method. Results and Discussion Screening of ERA primers, PCR primers, and crRNA ERA was performed using 1 nM genomic DNA of AF and three primer sets, followed by electrophoresis. Although all ERA primer sets produced a single band, ERA primer set 2 yielded a brighter amplification band (Fig. 2 A). Optimal primer selection was performed according to band intensity from electrophoresis results, followed by crRNA screening. Fluorescence curves for crRNA1 and crRNA2 revealed that crRNA1 exhibited superior performance (Fig. 2 C, D). Although both crRNAs reached plateau signals after approximately 25 min, crRNA1 demonstrated approximately 1.5-fold greater fluorescence intensity than crRNA2. Thus, primer set F2/R2 (240 bp) and crRNA1 were selected as the optimal combination for subsequent experiments. Establishment of the Two-Step ERA-CRISPR/Cas12a detection system To optimize the Cas12a/crRNA reaction, six concentration ratios were tested. Results demonstrated maximum fluorescence accumulation at the Cas12a/crRNA ratio of 1:1.2 (Fig. 2 E, F). Therefore, a Cas12a concentration of 250 nM and a crRNA concentration of 300 nM were selected as optimal. The fluorescence detection reporter molecule (ssDNA FQ) concentration was further optimized (Fig. 2 B). Fluorescence intensity increased steadily from 50 nM up to 300 nM and reached saturation thereafter. Considering both detection cost and experimental effectiveness, 300 nM was selected as the optimal concentration. Optimization of the lateral flow test strip detection system (ssDNA FB, Fig. 2 G) showed that lower concentrations resulted in false-positive T-line bands. As ssDNA FB concentration increased, T-line band intensity decreased while C-line intensity increased. At concentrations of 300 nM and 400 nM, false-positive signals were eliminated. Considering these results, 300 nM ssDNA FB was chosen for subsequent strip-based detection. The test strip shows two visible red lines 15 minutes after the test, and clear C-line and T-line can be observed at 30 minutes. Therefore, the detection time for all subsequent test strips is set to 30 minutes (Fig. 2 H). Sensitivity test of the Two-Step ERA-CRISPR/Cas12a system The sensitivity of the Two-Step ERA-CRISPR/Cas12a detection method was compared to that of the Two-Step PCR-CRISPR/Cas12a method. AF DNA was diluted from 10 6 to 10 0 aM. PCR alone did not produce visible amplification bands below 10 2 aM (Fig. 3 A). When PCR was combined with CRISPR/Cas12a detection, sensitivity improved to 10 1 aM (Fig. 3 B, C). ERA amplification products were visible by electrophoresis at 10 0 aM (Fig. 3 D). However, fluorescence detection using ERA-CRISPR/Cas12a was not successful below 10 0 aM, setting its detection limit at 10 0 aM (Fig. 3 E, F). To further evaluate sensitivity, extracted genomic DNA was serially diluted (100 pg/µL to 0.1 fg/µL). At high DNA concentrations, the ERA-CRISPR/Cas12a fluorescence reaction proceeded rapidly, reaching saturation within 20 min. Lower concentrations reacted more slowly, did not reach saturation within 45 min, and generated lower fluore scence values. Nevertheless, even at low concentrations, fluorescence signals were significantly stronger than those of the negative control. The detection limit of this method reached 1 fg/µL, indicating excellent sensitivity (Fig. 3 H, I). The sensitivity of the Two-Step ERA-CRISPR/Cas12a method developed here exceeded that of conventional PCR-CRISPR/Cas12a. ERA was rapid and required no temperature cycling, making it more suitable for lateral flow strip visualization. The detection limit using lateral flow test strips matched the fluorescence detection method, both detecting down to 1 fg/µL (Fig. 3 G). Establishment of the One Pot ERA-CRISPR/Cas12a detection system In the Two-Step ERA-CRISPR/Cas12a method, ERA and Cas12a detection occur separately, requiring transfer of amplification products. Due to the high amplification efficiency of ERA, aerosol contamination can easily occur during transfer, leading to false-positive results. Direct mixing of the ERA and Cas12a systems for fluorescence detection significantly reduced sensitivity and fluorescence intensity (Fig. 4 A, B). Given that ERA amplification and Cas12a cleavage utilize the same DNA substrate, directly combining both reactions simultaneously in a single container negatively impacts assay sensitivity. To mitigate this, the ERA amplification reagents were initially placed at the bottom of the reaction tube, while the Cas12a reaction components were added separately onto the tube lid. Upon completion of ERA, the Cas12a mixture was centrifuged into the ERA solution, enabling subsequent reaction and detection. This approach generated clear fluorescence curves. Although glycerol and sucrose slightly improved sensitivity, their effects were less pronounced than the tube-bottom and lid separation method. Furthermore, glycerol and sucrose increased solution viscosity, hindering test strip detection and visualization. Optimization of the One Pot ERA-CRISPR/Cas12a detection system After comparing various One Pot strategies, the method of placing ERA at the tube bottom and Cas12a at the lid was chosen. Following ERA, centrifugation mixed the two solutions, eliminating aerosol contamination and avoiding substrate competition, thereby enhancing sensitivity. To further optimize sensitivity, component ratios were adjusted. The optimal Cas12a concentration was determined to be 500 nM after increasing the template volume to 1 µL at 100 pg/µL (Fig. 4 C). The optimized One Pot assay achieved a sensitivity comparable to that of the Two-Step method (Fig. 4 D), with a detection limit of 1 fg/µL by fluorescence detection (Fig. 4 E). Under identical conditions, lateral flow test strips exhibited a slightly reduced sensitivity of 10 fg/µL (Fig. 4 H), one order of magnitude lower than fluorescence detection. Amplification time optimization indicated that two distinct red lines appeared at 15 min. However, after amplification exceeded 25 min, the T-line signal weakened significantly, indicating that excessively long amplification times reduced test effectiveness (Fig. 4 G). Specificity evaluation of the One Pot ERA-CRISPR/Cas12a detection system Genomic DNA of all strains listed in Table 2 was used to evaluate specificity. Results showed (Fig. 4 F, I) that only the AF samples generated significant fluorescence signals and two clear red bands on test strips, indicating positive results. Other groups showed no obvious fluorescence, with only the C-line visible, indicating negative results. Thus, this method demonstrated excellent specificity. Table 3 Comparison of detection results between the One Pot ERA-CRISPR/Cas12a fluorescence system and qPCR qPCR Sensitivity Specificity Consistency Positive Negative Total One Pot ERA-CRISPR/Cas12aFluorescence detection system Positive 30 2 32 Negative 2 28 30 93.75% 93.33% 93.55% Total 32 30 62 Clinical evaluation of the One Pot ERA-CRISPR/Cas12a system Sixty-two sputum samples were tested using traditional culture, One Pot ERA-CRISPR/Cas12a, and fluorescence quantitative PCR methods. Results showed 32 positive and 30 negative samples. Overall, results obtained by the One Pot ERA-CRISPR/Cas12a method aligned closely with culture-based findings (Fig. 4 J). Compared to qPCR, fluorescence-based ERA-CRISPR/Cas12a demonstrated a sensitivity of 93.75% and specificity of 93.33% (Table 3 ), while lateral flow strip assays showed a sensitivity of 90.63% and specificity of 96.67% (Table 4 ). Table 4 Comparison of detection results between the One Pot ERA-CRISPR/Cas12a test strip detection system and qPCR qPCR Sensitivity Specificity Consistency Positive Negative Total One Pot ERA-CRISPR/Cas12a test strip detection system Positive 29 1 30 Negative 3 29 32 90.63% 96.67% 93.55% Total 32 30 62 Discussion Aspergillus is an opportunistic pathogenic fungus widely distributed in nature, representing an important pathogen causing respiratory infections in humans. IA, predominantly caused by AF , commonly affects immunocompromised populations. Early detection of AF remains challenging [ 26 ]. Various detection methods exist, each with distinct advantages and limitations. Currently, no single method simultaneously achieves high sensitivity, high specificity, short detection times, and simple operation. Several pathogen detection platforms utilizing CRISPR/Cas12a have been established, including those targeting SARS-CoV-2, African swine fever virus, Influenza virus, Mycoplasma pneumoniae , and Candida albicans , influenza B virus [ 27 – 30 ]. Since its introduction, PCR technology has considerably advanced clinical diagnostics and molecular biology research [ 31 ]. Unlike traditional PCR, the ERA approach amplifies nucleic acids isothermally, eliminating the need for complex thermal cycling and simplifying operation. Compared with PCR-CRISPR/Cas12a assays, ERA-CRISPR/Cas12a demonstrated a ten-fold enhancement in detection sensitivity, thus highlighting its superior performance. However, fluorescence-based detection still relies on bulky instruments. To overcome this limitation, lateral flow test strips replace fluorescence probes, allowing visual interpretation of results and enabling rapid, on-site detection without sophisticated equipment [ 32 ]. Traditional procedures require manual opening of reaction tubes after amplification, generating aerosols and potentially causing false-positive results. Additionally, premature contact of Cas12a protein with target DNA in the early amplification phase can degrade the template or primers, inhibit subsequent amplification, and cause false-negative results. To prevent this, physical separation of ERA amplification and CRISPR/Cas12a detection systems was implemented using tube lids and bottoms. By spatially separating the amplification and detection steps and subsequently mixing the two systems via centrifugation, detection can be completed in a single tube. The addition of glycerol or sucrose increases the viscosity of the reaction system, reducing molecular diffusion. This approach prevents premature interaction of Cas12a with amplification products, avoiding inhibition of amplification [ 33 , 34 ]. Although the addition of glycerol and sucrose can enhance detection sensitivity, the Cas12a enzyme may exhibit slow cleavage activity toward the target DNA during the amplification process, thereby reducing the availability of templates for subsequent amplification steps. This issue is particularly pronounced in samples with low concentrations, ultimately compromising the overall sensitivity of the reaction. In contrast, the bottom-separated approach ensures complete physical separation between the amplification system and the CRISPR detection system, preventing any premature interaction with Cas12a prior to the completion of amplification. This effectively avoids the degradation of target DNA or primers, resulting in a more reliable and sensitive detection performance compared to the use of glycerol and sucrose in One Pot assays. In this study, after evaluating multiple variants of the One Pot protocol, a rapid and visually interpretable AF detection assay based on the One Pot ERA-CRISPR/Cas12a system was successfully developed. Specifically, optimized ERA primers and crRNA sequences targeting the AF -specific anxC4 gene were designed and selected. Among the four experimental setups, positioning the ERA reaction components and Cas12a detection system separately in the bottom and lid of the tube, respectively, provided optimal results by effectively minimizing false positives caused by sample transfer contamination. By refining reaction conditions, the sensitivity of the One Pot method was improved to match the Two-Step approach. The optimized One Pot assay reached detection limits of 1 fg/µL for fluorescence-based detection and 10 fg/µL for lateral flow assay, indicating exceptional analytical sensitivity. Clinical validation revealed a specificity of 93.33% for fluorescence detection and 93.75% for lateral flow assay, confirming strong diagnostic specificity. Compared to conventional culture-based detection methods, the proposed method significantly shortened detection times, requiring only 20 min for amplification, 30 min for fluorescence detection, and 5 min for lateral flow visualization, resulting in a total process completion time of approximately 55 min. Both detection methods clearly presented results in a straightforward manner. Despite the aforementioned advantages, several limitations of this approach must be acknowledged. Firstly, the entire process relies on the extraction of genomic from samples, resulting in a disconnect between the extraction and downstream detection steps. Secondly, the current design necessitates a centrifugation step to integrate the spatially separated amplification and detection modules. This requirement for laboratory infrastructure hinders the development of a fully instrument-free operational workflow. Thirdly, the visual detection sensitivity of the lateral flow assay (10 fg/µL) is one order of magnitude lower than that of the fluorescence-based method (1 fg/µL), potentially compromising its reliability for samples with extremely low pathogen loads. Finally, although the method demonstrates high concordance with conventional culture methods, its observed sensitivity (93.75%) and specificity (93.33%) fall short of 100%. This indicates that it is best suited for preliminary screening rather than as a definitive diagnostic assay. Consequently, confirmation with the gold standard method is recommended for critical clinical cases. Future research should focus on streamlining the workflow, particularly by integrating sample preparation and detection to minimize reliance on instrumentation. Furthermore, enhancing the stability of the CRISPR/Cas12a system and optimizing the chemical properties of the lateral flow strips are expected to improve both the sensitivity and reproducibility of the visualization. In conclusion, the One Pot ERA-CRISPR/Cas12a assay developed here demonstrates outstanding speed, sensitivity, specificity, and accuracy for identifying AF in sputum samples, representing a valuable diagnostic approach for rapid AF detection in clinical practice. Declarations Ethics approval and consent to participate The studies involving clinical samples were reviewed and approved by the Huaibei Consent for publication All participants provided consent for the publication of their anonymized data. Competing interests The authors declare no competing interests. Funding This work was financially supported by the University Natural Science Research Key Projects in Anhui Province (2024AH051688, 2024AH051225), the Independent Research Projects and Open Projects of the State Key Laboratory of Agricultural Biotechnology (2020SKLAB6-3), the Anhui Province University Innovation Team Project (2023AH010045), and the "Leading Goose" R&D Program of Zhejiang (2023C03045). Author Contribution D.X., and F.L. proposed the idea. D.X. Q.J., X.Z., and F.Y. designed the research protocol. Q.J. and X.Z. conducted the experimental preparation and data analysis, while clinical samples were provided by Q.Z. The initial draft of the article was co-prepared by D.X. Q.J. and X.Z., and edited and reviewed by Q.J., X.Z., F.Y., T.L., Y.Z., and D.X. All authors have read and approved the published version of the manuscript. Acknowledgments We gratefully thank Huaibei People’s Hospital for their contribution of clinical samples. Data Availability All data generated or analyzed herein are included in this manuscript. References Bongomin F, Gago S, Oladele RO, Denning DW. Global and multi-national prevalence of fungal diseases estimate precision. J fungi. 2017;3(4):57. Brown GD, Denning DW, Gow NA, Levitz SM, Netea MG, White TC. Hidden killers: human fungal infections. Sci Transl Med. 2012;4(165):165rv13. Jiang L, Gu R, Li X, Mu D. Simple and rapid detection Aspergillus fumigatus by loop-mediated isothermal amplification coupled with lateral flow biosensor assay. J Appl Microbiol. 2021;131(5):2351–60. Latgé J-P, Chamilos G. Aspergillus fumigatus and Aspergillosis in 2019. Clin Microbiol Rev. 2019;33(1):00140–18. Pérez-Cantero A, López-Fernández L, Guarro J, Capilla J. Azole resistance mechanisms in Aspergillus : update and recent advances. Int J Antimicrob Agents. 2020;55(1):105807. Denning DW, Pleuvry A, Cole DC. Global burden of allergic bronchopulmonary aspergillosis with asthma and its complication chronic pulmonary aspergillosis in adults. Med Mycol. 2013;51(4):361–70. Kosmidis C, Denning DW. The clinical spectrum of pulmonary aspergillosis. Thorax. 2015;70(3):270–7. Neofytos D, Horn D, Anaissie E, Steinbach W, Olyaei A, Fishman J, et al. Epidemiology and outcome of invasive fungal infection in adult hematopoietic stem cell transplant recipients: analysis of Multicenter Prospective Antifungal Therapy (PATH) Alliance registry. Clin Infect Dis. 2009;48(3):265–73. Cadena J, Thompson GR, Patterson TF. Aspergillosis: epidemiology, diagnosis, and treatment. Infect Disease Clin. 2021;35(2):415–34. Hardin BD, Kelman BJ, Saxon A. Adverse human health effects associated with molds in the indoor environment. Int J Occup Environ Med. 2003;45(5):470–78. Ramanan P, Wengenack NL, Theel ES. Laboratory diagnostics for fungal infections: a review of current and future diagnostic assays. Clin Chest Med. 2017;38(3):535–54. Koo S, Bryar JM, Baden LR, Marty FM. Prognostic features of galactomannan antigenemia in galactomannan-positive invasive aspergillosis. J Clin Microbiol. 2010;48(4):1255–60. Husain S, Clancy CJ, Nguyen MH, Swartzentruber S, Leather H, LeMonte AM, et al. Performance characteristics of the platelia Aspergillus enzyme immunoassay for detection of Aspergillus galactomannan antigen in bronchoalveolar lavage fluid. Clin Vaccine Immunol. 2008;15(12):1760–3. Yu LS, Rodriguez-Manzano J, Malpartida-Cardenas K, Sewell T, Bader O, Armstrong-James D, et al. Rapid and Sensitive Detection of Azole-Resistant Aspergillus fumigatus by Tandem Repeat Loop-Mediated Isothermal Amplification. J Mol Diagn. 2019;21(2):286–95. Nguyen T, Duong BD, Wolff A. 2019 Novel Coronavirus Disease (COVID-19): paving the road for rapid setection and point-of-care diagnostics. Micromachines (Basel). 2020;11(3):306. Kitagawa Y, Orihara Y, Kawamura R, Imai K, Sakai J, Tarumoto N, et al. Evaluation of rapid diagnosis of novel coronavirus disease (COVID-19) using loop-mediated isothermal amplification. J Clin Virol. 2020;129:104446. Chen JS, Ma E, Harrington LB, Da Costa M, Tian X, Palefsky JM, et al. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science. 2018;360(6387):436–9. Li SY, Cheng QX, Wang JM, Li XY, Zhang ZL, Gao S, et al. CRISPR-Cas12a-assisted nucleic acid detection. Cell Discovery. 2018;4(1):20. Liu H, Wang J, Zeng H, Liu X, Jiang W, Wang Y, et al. RPA-Cas12a-fs: A frontline nucleic acid rapid detection system for food safety based on CRISPR-Cas12a combined with recombinase polymerase amplification. Food Chem. 2021;334:127608. Wang Y, Ke Y, Liu W, Sun Y, Ding X, et al. A one-pot toolbox based on Cas12a/crRNA enables rapid foodborne pathogen detection at attomolar level. ACS Sens. 2020;5(5):1427–35. Huang D, Qian J, Shi Z, Zhao J, Fang M, Xu Z, et al. CRISPR-Cas12a-assisted multicolor biosensor for semiquantitative point-of-use testing of the nopaline synthase terminator in genetically modified crops by unaided eyes. ACS Synth Biol. 2020;9(11):3114–23. Zhang YM, Zhang Y, Xie K. Evaluation of CRISPR/Cas12a-based DNA detection for fast pathogen diagnosis and GMO test in rice. Mol Breeding. 2020;40(1):11. Huang D, Shi Z, Qian J, Bi K, Fang M, Xu Z. A CRISPR-Cas12a-derived biosensor enabling portable personal glucose meter readout for quantitative detection of SARS. CoV-2. Biotechnol Bioeng. 2021;118(4):1587–96. Broughton JP, Deng X, Yu G, Fasching CL, Servellita V, Singh J, et al. CRISPR-Cas12-based detection of SARS-CoV-2. Nat Biotechnol. 2020;38(7):870–4. Mukama O, Yuan T, He Z, Li Z, Zeng L. A high fidelity CRISPR/Cas12a based lateral flow biosensor for the detection of HPVl6 and HPV18. Sens Actuators B. 2020;316:128119. Otu A, Kosmidis C, Mathioudakis AG, Ibe C, Denning DW. The clinical spectrum of aspergillosis in chronic obstructive pulmonary disease. Infection. 2023;51(4):813–29. Li J, Huang H, Song Z, Chen S, Xu J, Yang J, et al. Palm-sized CRISPR sensing platform for on-site Mycoplasma pneumoniae detection. Biosens Bioelectron. 2025;281:117458. Shen S, Wang W, Ma Y, Wang S, Zhang S, Cai X, et al. Affinity molecular assay for detecting Candida albicans using chitin affinity and RPA-CRISPR/Cas12a. Nat Commun. 2024;15(1):9304. Ali Z, Aman R, Mahas A, Rao GS, Tehseen M, Marsic T, et al. iSCAN: An RT-LAMP-coupled CRISPR-Cas12 module for rapid, sensitive detection of SARS-CoV-2. Virus Res. 2020;288:198129. Yin K, Ding X, Li Z, Zhao H, Cooper K, Liu C. Dynamic Aqueous Multiphase Reaction System for One-Pot CRISPR-Cas12a-Based Ultrasensitive and Quantitative Molecular Diagnosis. Anal Chem. 2020;92(12):8561–8. Ali DM, Zake LG, El Kady NK. Role of Chest Computed Tomography versus Real Time Reverse Transcription Polymerase Chain Reaction for Diagnosis of COVID-19: A Systematic Review and Meta-Analysis. Interdiscip Perspect Infect. 2021; 2021:8798575. Luppa PB, Müller C, Schlichtiger A, Schlebusch H. Point-of-care testing (POCT): Current techniques and future perspectives. Trends Analyt Chem. 2011;30(6):887–98. Lin M, Yue H, Tian T, Xiong E, Zhu D, Jiang Y, et al. Glycerol Additive Boosts 100-fold Sensitivity Enhancement for One-Pot RPA-CRISPR/Cas12a Assay. Anal Chem. 2022;94(23):8277–84. Hu JJ, Liu D, Cai MZ, Zhou Y, Yin WX, Luo CX. One-Pot Assay for Rapid Detection of Benzimidazole Resistance in Venturia carpophila by Combining RPA and CRISPR/Cas12a. J Agric Food Chem. 2023;71(3):1381–90. Additional Declarations No competing interests reported. Supplementary Files SupplementarymaterialsOriginalgelelectrophoresisimage.zip RevisedRawImagesAllBlots.pdf Cite Share Download PDF Status: Published Journal Publication published 09 Mar, 2026 Read the published version in BMC Microbiology → Version 1 posted Editorial decision: Revision requested 20 Nov, 2025 Reviews received at journal 18 Nov, 2025 Reviews received at journal 15 Nov, 2025 Reviews received at journal 10 Nov, 2025 Reviewers agreed at journal 17 Oct, 2025 Reviewers agreed at journal 16 Oct, 2025 Reviewers agreed at journal 15 Oct, 2025 Reviewers invited by journal 14 Oct, 2025 Editor assigned by journal 14 Oct, 2025 Editor invited by journal 14 Oct, 2025 Submission checks completed at journal 08 Oct, 2025 First submitted to journal 08 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7538348","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":534450452,"identity":"8eea0fc7-386c-4ef5-9f38-e35eb25c7d9f","order_by":0,"name":"Qiuyang Jiang","email":"","orcid":"","institution":"Huaibei Normal University","correspondingAuthor":false,"prefix":"","firstName":"Qiuyang","middleName":"","lastName":"Jiang","suffix":""},{"id":534450453,"identity":"9c4e00f1-7a47-4a6e-8a06-66f3a3afd8aa","order_by":1,"name":"Xiaotong Zeng","email":"","orcid":"","institution":"Huaibei Normal University","correspondingAuthor":false,"prefix":"","firstName":"Xiaotong","middleName":"","lastName":"Zeng","suffix":""},{"id":534450454,"identity":"501c4711-e074-4bf5-b25e-3f8b37801a30","order_by":2,"name":"Qi Zhang","email":"","orcid":"","institution":"The People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Qi","middleName":"","lastName":"Zhang","suffix":""},{"id":534450455,"identity":"9f78196b-157a-4fa6-9466-c5ab1408a612","order_by":3,"name":"Fo Yang","email":"","orcid":"","institution":"Huaibei Normal University","correspondingAuthor":false,"prefix":"","firstName":"Fo","middleName":"","lastName":"Yang","suffix":""},{"id":534450456,"identity":"3e9ab24c-3865-49db-bec8-4a1ce85b75a6","order_by":4,"name":"Tingyao Lv","email":"","orcid":"","institution":"Huaibei Normal University","correspondingAuthor":false,"prefix":"","firstName":"Tingyao","middleName":"","lastName":"Lv","suffix":""},{"id":534450457,"identity":"054e47fa-1e15-41e1-833d-cf199af4316f","order_by":5,"name":"Yushuo Zhang","email":"","orcid":"","institution":"Huaibei Normal University","correspondingAuthor":false,"prefix":"","firstName":"Yushuo","middleName":"","lastName":"Zhang","suffix":""},{"id":534450458,"identity":"b0fa8083-4bed-4432-9349-680fbf709334","order_by":6,"name":"Jin Wang","email":"","orcid":"","institution":"Huaibei Normal University","correspondingAuthor":false,"prefix":"","firstName":"Jin","middleName":"","lastName":"Wang","suffix":""},{"id":534450459,"identity":"45c92aeb-58bd-498c-bc8b-c94e1d4f98dd","order_by":7,"name":"Feng Li","email":"","orcid":"","institution":"Huaibei Normal University","correspondingAuthor":false,"prefix":"","firstName":"Feng","middleName":"","lastName":"Li","suffix":""},{"id":534450460,"identity":"dc9cc764-0fd3-40a2-92e5-c3d94b4ff0a5","order_by":8,"name":"Dayong Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtUlEQVRIiWNgGAWjYHACA4YPDAfALAmitTDOIFkLMw9JWgxuJG+Ttqm5k2dwgPngbR4GuzyCWiRnpJVJ5xx7VmxwgC3ZmochuZigFn6JHDPp3IbDiRsO8JhJA12Y2EBICxtIiyVYC/834rSAbWGE2MJGnBbJnmfFlj3HDifOPMxmbDnHIJmwFoPjyRtv/Kg5nNh3vPnhjTcVdoS1AAELJDqYwSYQoR6k9gNx6kbBKBgFo2DEAgBf/jty0Ke0OAAAAABJRU5ErkJggg==","orcid":"","institution":"Huaibei Normal University","correspondingAuthor":true,"prefix":"","firstName":"Dayong","middleName":"","lastName":"Xu","suffix":""}],"badges":[],"createdAt":"2025-09-04 17:38:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7538348/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7538348/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12866-026-04881-4","type":"published","date":"2026-03-09T15:57:37+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":94591084,"identity":"d755ee78-9f63-4630-9cec-5105ba6b2041","added_by":"auto","created_at":"2025-10-28 18:21:48","extension":"jpeg","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":913996,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/8f7371b7063664519cae49dc.jpeg"},{"id":94590914,"identity":"26fb6c6e-97f7-4e1a-8303-4e6823d1b28d","added_by":"auto","created_at":"2025-10-28 18:21:38","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":799435,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/16942c130847694f478b1e07.docx"},{"id":94590918,"identity":"579da470-049a-406e-8ae0-36b8ee6fb1ff","added_by":"auto","created_at":"2025-10-28 18:21:38","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":159619,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/bf8a42a15e82a65c3b46f5b3.jpg"},{"id":94591090,"identity":"a5bba9f4-8ac7-4da7-9c9f-741c976aae57","added_by":"auto","created_at":"2025-10-28 18:21:49","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17535,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/33d6be19b4ea703b5fd179af.docx"},{"id":94591294,"identity":"d9011fcf-bca6-47d1-8fe5-d7009b7f87d1","added_by":"auto","created_at":"2025-10-28 18:22:06","extension":"jpg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":201128,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/e8c78aa1d6598896fb65decd.jpg"},{"id":94590894,"identity":"e0505135-3ea6-4a59-bab7-66d8207cc3ac","added_by":"auto","created_at":"2025-10-28 18:21:37","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17736,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.docx","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/091fbf09043c577b799296a7.docx"},{"id":94591081,"identity":"137b012a-fd54-42e8-bcec-e29244197bfb","added_by":"auto","created_at":"2025-10-28 18:21:48","extension":"jpg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":235853,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/a252e42267b36d8b1f00725d.jpg"},{"id":94589901,"identity":"d0e14aec-474b-4f6e-990f-e3ee9ebdf0fd","added_by":"auto","created_at":"2025-10-28 18:20:47","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17447,"visible":true,"origin":"","legend":"","description":"","filename":"Table3.docx","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/39ccf13184958cb8dbaf5ec6.docx"},{"id":94591047,"identity":"5ad0c719-f1be-406c-91fe-2804c02ebbde","added_by":"auto","created_at":"2025-10-28 18:21:46","extension":"docx","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17431,"visible":true,"origin":"","legend":"","description":"","filename":"Table4.docx","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/51c3b0b09459665bb6c74024.docx"},{"id":94596057,"identity":"d498296b-0fe6-415d-a7e7-27f2a88beacb","added_by":"auto","created_at":"2025-10-28 18:38:16","extension":"json","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9534,"visible":true,"origin":"","legend":"","description":"","filename":"31a15e3b70b04ca1aafce4ec7c221e3f.json","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/1a47690aa39f94d2d292dac4.json"},{"id":94590913,"identity":"c9a14973-0678-4542-b483-fed88ae66072","added_by":"auto","created_at":"2025-10-28 18:21:38","extension":"pdf","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":145919,"visible":true,"origin":"","legend":"","description":"","filename":"RevisedRawImagesAllBlots.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/5c135d3f388080819a9d00be.pdf"},{"id":94591277,"identity":"d58ff6d1-f6bb-46f5-a9b8-d298456f7ab9","added_by":"auto","created_at":"2025-10-28 18:22:05","extension":"zip","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":828691,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementarymaterialsOriginalgelelectrophoresisimage.zip","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/e033ce8caa183c67b55b0377.zip"},{"id":94590915,"identity":"a5680541-692f-4f62-b655-af035f74f25d","added_by":"auto","created_at":"2025-10-28 18:21:38","extension":"xml","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":125515,"visible":true,"origin":"","legend":"","description":"","filename":"31a15e3b70b04ca1aafce4ec7c221e3f1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/c4ea2119f5608ecf7a324351.xml"},{"id":94590558,"identity":"017a771f-aa42-4f09-bc27-39432dcc713c","added_by":"auto","created_at":"2025-10-28 18:21:21","extension":"jpeg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":913996,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/5c358c740d26ff645f1e7ca8.jpeg"},{"id":94591311,"identity":"2a3f367d-f740-4ce0-846f-64d4f8f38070","added_by":"auto","created_at":"2025-10-28 18:22:07","extension":"jpg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":159619,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/e50dfe0de81122f0671475a6.jpg"},{"id":94591227,"identity":"b336cebc-b1b6-4adb-ac63-7524517e8bd9","added_by":"auto","created_at":"2025-10-28 18:21:59","extension":"jpg","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":201128,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/d8a83585d3d1748d75a5e611.jpg"},{"id":94591166,"identity":"771a0e49-3c1a-49d4-96fc-4815611d8957","added_by":"auto","created_at":"2025-10-28 18:21:55","extension":"jpg","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":235853,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/0f26de19505bc52a115b6cb2.jpg"},{"id":94590553,"identity":"d3db6ffe-860b-43a5-b387-c907f1ebea64","added_by":"auto","created_at":"2025-10-28 18:21:20","extension":"jpeg","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":139739,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/8b2176ef7d2b0bb60ee0aae1.jpeg"},{"id":94590330,"identity":"eba9fd2e-f6af-41ed-b99b-399ac3c7d2d8","added_by":"auto","created_at":"2025-10-28 18:21:06","extension":"jpeg","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":159619,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/68d85bf3680990b9da9628cc.jpeg"},{"id":94589898,"identity":"bc0ae125-d13a-46b1-8c40-d9484101661f","added_by":"auto","created_at":"2025-10-28 18:20:46","extension":"jpeg","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":201128,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/d0f45cba7532529dc7e77406.jpeg"},{"id":94591313,"identity":"e263e47e-8856-4380-ab8e-ec8b3656aca8","added_by":"auto","created_at":"2025-10-28 18:22:07","extension":"jpeg","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":235853,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/6d1e322ed6111d07223025fc.jpeg"},{"id":94591221,"identity":"4017af60-4c2c-4c45-8d20-7a93215d6ac2","added_by":"auto","created_at":"2025-10-28 18:21:57","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":113906,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/166d7147418eba5e8f94209b.png"},{"id":94590923,"identity":"cdc24151-5b9e-4472-90fb-578a81efd3a9","added_by":"auto","created_at":"2025-10-28 18:21:39","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":79345,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/0c80c3a60b65484c481e93d6.png"},{"id":94590909,"identity":"d4a092ca-45d8-43ba-b24f-71b39202c836","added_by":"auto","created_at":"2025-10-28 18:21:38","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":82402,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/8709cd4e7b78ba6ee6ad2598.png"},{"id":94591232,"identity":"1cb3bcd3-19c7-47f8-95df-32ca4c039e9b","added_by":"auto","created_at":"2025-10-28 18:21:59","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":81389,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/797829a47433467ebf1047f5.png"},{"id":94590349,"identity":"7f34c8c7-d4d3-4540-9f3b-1fab8d0aea52","added_by":"auto","created_at":"2025-10-28 18:21:07","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":40142,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/1e2d891cf5fdc41055a2312e.png"},{"id":94590605,"identity":"bfe53d41-f43c-444f-a8d3-a5a2a95a544b","added_by":"auto","created_at":"2025-10-28 18:21:23","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":79345,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/2506b77083b4e87b8d2e2f99.png"},{"id":94590634,"identity":"7633f8f4-89f6-4403-b0c7-8864bab7f166","added_by":"auto","created_at":"2025-10-28 18:21:23","extension":"png","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":82402,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/137fd9c104e761cb68568803.png"},{"id":94590917,"identity":"d97cbc48-2a33-4aaf-b88e-1d27516686d5","added_by":"auto","created_at":"2025-10-28 18:21:38","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":81389,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/7d212a2148b55ed66d6b8180.png"},{"id":94591092,"identity":"ba7d0342-a483-4b5a-baef-0be8282ec704","added_by":"auto","created_at":"2025-10-28 18:21:49","extension":"xml","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":124954,"visible":true,"origin":"","legend":"","description":"","filename":"31a15e3b70b04ca1aafce4ec7c221e3f1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/45681d01e8666f6214c45459.xml"},{"id":94596064,"identity":"ecb78ced-5ac5-467c-904d-77b5ae5fae07","added_by":"auto","created_at":"2025-10-28 18:38:18","extension":"html","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":133932,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/8f26a2190a11e28e142a36e8.html"},{"id":94591289,"identity":"47e6a632-c4b6-45ee-8108-fc2be0331ec4","added_by":"auto","created_at":"2025-10-28 18:22:05","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":913996,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic diagram of One Pot nucleic acid detection using ERA combined with CRISPR/Cas12a. (A) Diagram of the One Pot rapid nucleic acid detection platform integrating ERA, CRISPR/Cas12a, fluorescence detection, and lateral flow test strips. (B) The Cas12a detection system mixed with 15% glycerol is placed at the bottom of the tube, with the ERA mixture added on top. (C) The ERA mixture, thoroughly mixed with sucrose, is placed at the tube bottom, and the Cas12a system is placed above. (D) The ERA and Cas12a mixtures are simultaneously combined at the bottom of the tube.\u003c/p\u003e","description":"","filename":"Fig.1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/897c127deff24ea99589efdf.jpeg"},{"id":94591224,"identity":"5bd26099-b795-4340-a58a-9c83a9ab221e","added_by":"auto","created_at":"2025-10-28 18:21:59","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":159619,"visible":true,"origin":"","legend":"\u003cp\u003eOptimization of the ERA/CRISPR-Cas12a fluorescence system for detecting \u003cem\u003eAF\u003c/em\u003e. (A) Screening of ERA primers for amplification of \u003cem\u003eAF\u003c/em\u003e, with gel electrophoresis analysis. M: 2000 bp DNA Marker. (B) Optimization of ssDNA FQ concentration, showing fluorescence curves at different concentrations. (C) Screening of optimal crRNA using real-time fluorescence curves. (D) Fluorescence intensities of different crRNAs after 45 min. (E) Optimization of ERA/CRISPR-Cas12a reaction, comparing fluorescence curves at various Cas12a/crRNA ratios. (F) Fluorescence intensities of different Cas12a/crRNA ratios after 45 min. (G) Optimization of lateral flow strip detection by evaluating the effects of ssDNA FB concentrations on the detection system without target DNA. T represents the test line, and C represents the control line. (H) Effect of different CRISPR/Cas12a incubation times on test strip T-line visibility.\u003c/p\u003e","description":"","filename":"Fig.2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/006adeb20b17bfef0f114599.jpg"},{"id":94590565,"identity":"4f101bb1-a329-46d1-b35a-b1ffcfcb177c","added_by":"auto","created_at":"2025-10-28 18:21:22","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":201128,"visible":true,"origin":"","legend":"\u003cp\u003eSensitivity analysis of Two-Step CRISPR/Cas12a fluorescence detection. (A-C) 1% agarose gel electrophoresis of PCR products amplified from 10\u003csup\u003e6\u003c/sup\u003e–10\u003csup\u003e0\u003c/sup\u003e aM DNA template, CRISPR/Cas12a fluorescence detection curves of PCR products at different concentrations, and fluorescence intensities at the end of detection. (D-F) Gel electrophoresis, fluorescence detection curves, and final fluorescence intensities of ERA products at various concentrations. (G) Sensitivity of lateral flow assay (LFA) detection using genomic DNA ERA products (100 pg–0.1 fg). (H, I) Fluorescence detection curves and fluorescence intensities of ERA products amplified from genomic DNA at concentrations ranging from 100 pg to 0.1 fg using CRISPR/Cas12a.\u003c/p\u003e","description":"","filename":"Fig.3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/20f59e588cd580ab3fff641e.jpg"},{"id":94595861,"identity":"18fa1f72-0ddb-478e-aed8-e32ac20e7340","added_by":"auto","created_at":"2025-10-28 18:36:32","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":235853,"visible":true,"origin":"","legend":"\u003cp\u003eEstablishment, optimization and application of the One Pot ERA-CRISPR/Cas12a detection system. (A, B) Establishment of One Pot method: ① Fluorescence curves and values of tube-cap separation method; ②Fluorescence curves and values with glycerol added to the Cas12a system; ③Fluorescence curves and values with sucrose added to the Cas12a system; ④Fluorescence curves and values of simultaneous amplification and detection. (C) Optimization of LbCas12a concentration for the One Pot method. (D) Fluorescence curves of optimized One Pot detection. (E, H) Sensitivity evaluation of the One Pot ERA-CRISPR/Cas12a system using fluorescence and strip detection with genomic DNA concentrations from 100 pg to 0.1 fg. (F, I) Specificity analysis of the ERA/CRISPR-Cas12a fluorescence and strip detection systems: \u003cem\u003eAF\u003c/em\u003e, \u003cem\u003eCandida albicans\u003c/em\u003e(CA), \u003cem\u003eCandida tropicalis\u003c/em\u003e (CT), \u003cem\u003eA. niger\u003c/em\u003e (AN), \u003cem\u003ePenicillium chrysogenum\u003c/em\u003e (PC), \u003cem\u003eAlternaria alternata\u003c/em\u003e (AA), \u003cem\u003eBotrytis cinerea\u003c/em\u003e(BC), \u003cem\u003eAspergillus cristatus\u003c/em\u003e (AC). (G) Optimization of amplification incubation times for One Pot ERA detection. (J) Clinical sample testing results: Samples 1–32 are positive, and samples 33–62 are negative clinical samples. LFA: “+” indicates positive results, “–” indicates negative results.\u003c/p\u003e","description":"","filename":"Fig.4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/1c818380a50d642c406d4fe2.jpg"},{"id":104739305,"identity":"ce65d223-79cf-4c27-a4b5-e954443e9e63","added_by":"auto","created_at":"2026-03-16 16:01:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2614865,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/a4b9c8e2-f6f7-4a9e-b884-3e73d13ee2a6.pdf"},{"id":94591296,"identity":"c8c9aac4-9f2c-4691-b534-d46f85e955d6","added_by":"auto","created_at":"2025-10-28 18:22:06","extension":"zip","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":828691,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementarymaterialsOriginalgelelectrophoresisimage.zip","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/e96f46422cd1be34a545ecad.zip"},{"id":94590895,"identity":"c0fdcf4e-27fa-483c-930b-191ceba05e26","added_by":"auto","created_at":"2025-10-28 18:21:37","extension":"pdf","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":145919,"visible":true,"origin":"","legend":"","description":"","filename":"RevisedRawImagesAllBlots.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7538348/v1/da85c156c7804c9c323fc8ef.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Establishment and application of a rapid detection system for Aspergillus fumigatus based on ERA/CRISPR-Cas12a","fulltext":[{"header":"Introduction","content":"\u003cp\u003eFungi are widely distributed in nature. Under normal circumstances, fungal infections generally do not occur due to human immunity. However, when the immune system is weakened, the risk of infection significantly increases. According to epidemiological data, fungal infections affect over one billion individuals worldwide [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Invasive fungal infections are responsible for roughly 1.5\u0026nbsp;million annual deaths and can result in higher mortality rates compared to diseases such as tuberculosis and malaria [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cem\u003eAF\u003c/em\u003e is a saprophytic filamentous fungus commonly found in soil and compost. It is also a pathogen causing various lung diseases in humans, birds, and other mammals [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. It spreads via asexual spores and is the main pathogen responsible for IA. IA typically affects individuals with compromised immune systems, such as newborns and the elderly [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Reportedly, IA accounts for over 300,000 cases annually worldwide [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Due to insufficient diagnostic methods, reported cases may represent only 50%\u0026ndash;65% of actual cases [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Even with timely diagnosis and treatment, mortality remains high, ranging from 30% to 80% [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Aspergillosis remains the most prevalent fungal infection among patients undergoing hematopoietic stem cell transplantation (HSCT) [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], while lung transplant recipients exhibit aspergillosis incidence rates of approximately 10%\u0026ndash;15% [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Without timely detection and treatment, mortality rates associated with aspergillosis are exceedingly high [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eCurrently, hospitals diagnose aspergillosis through fungal culture and microscopic examination. Although this diagnostic approach is highly specific, it requires substantial time. The GM test detects galactomannan, which is commonly identified in blood and bronchoalveolar lavage fluid (BAL) of suspected cases [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. BAL detection has higher sensitivity than serum detection [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], but yields more false-positive results [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Molecular diagnostic approaches, such as polymerase chain reaction (PCR) and real-time quantitative PCR, exhibit excellent specificity. However, PCR techniques require specialized instruments and trained operators, restricting their practical application in resource-limited or remote healthcare settings [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Therefore, developing a rapid, accurate, and easily applicable detection method for \u003cem\u003eAF\u003c/em\u003e in primary healthcare institutions holds significant clinical value.\u003c/p\u003e\u003cp\u003eRecently, isothermal amplification techniques, such as loop-mediated isothermal amplification (LAMP) [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] and recombinase polymerase amplification (RPA) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], have shown great potential in pathogen detection due to their simplicity and lack of dependence on complex instrumentation. ERA technology uses recombinant enzyme-primer complexes to recognize target sequences specifically at room temperature. ERA technology, utilizing single-stranded DNA-binding proteins (SSB) and DNA polymerase, achieves nucleic acid amplification within 20 minutes, markedly reducing turnaround times. Utilizing ERA\u0026rsquo;s advantages of simplicity and convenience facilitates rapid and accurate point-of-care testing for detecting \u003cem\u003eAF\u003c/em\u003e. Thus, establishing a rapid method for detecting \u003cem\u003eAF\u003c/em\u003e expands diagnostic capabilities and provides both theoretical and practical foundations.\u003c/p\u003e\u003cp\u003eThe CRISPR/Cas system is widely utilized in molecular diagnostics due to its highly specific target recognition. Guided by crRNA, Cas12a recognizes target DNA and activates non-specific cleavage, indiscriminately cutting surrounding single-stranded DNA reporter molecules [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. This feature makes CRISPR/Cas12a an ideal tool for highly sensitive fluorescence or lateral flow detection. Li [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] first combined CRISPR/Cas12a with PCR, developing a rapid and sensitive detection method termed HOLMES. Subsequently, Chen [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] established DETECTR, a CRISPR/Cas12a detection platform based on RPA, demonstrating sensitivity at the attomolar level and extremely high specificity. Biosensing systems based on CRISPR/Cas12a have subsequently been developed for detecting diverse targets, including pathogenic bacteria [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], genetically modified crops [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], SARS-CoV-2 [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], and other pathogenic viruses [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Integrating CRISPR/Cas12a with isothermal amplification significantly increases target abundance quickly, thus greatly enhancing detection sensitivity.\u003c/p\u003e\u003cp\u003eIn this study, the ERA-CRISPR/Cas12a system was employed to achieve rapid detection of \u003cem\u003eAF\u003c/em\u003e. Highly specific primers and crRNA targeting the conserved \u003cem\u003eanxC4\u003c/em\u003e gene of \u003cem\u003eAF\u003c/em\u003e were designed and integrated with lateral flow test strips, resulting in a visual detection platform characterized by high sensitivity and specificity. Moreover, by separating the reaction and detection components into distinct locations within a single centrifuge tube, this optimized One Pot configuration effectively mitigated common issues such as aerosol contamination and low amplification efficiency inherent in traditional methods. The reliability of this method was verified using clinical samples. The established ERA-CRISPR/Cas12a technique offers a novel diagnostic approach for early \u003cem\u003eAF\u003c/em\u003e infection detection and presents a valuable reference for rapid identification of other fungal pathogens.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eMaterials and Instruments\u003c/h2\u003e\u003cp\u003eThe \u003cem\u003eAF\u003c/em\u003e strain (ATCC MYA-4609) utilized in this study was obtained commercially from ATCC. Conventional primers required for the experiments, along with the associated culture media reagents, were provided by Biotechnology (Shanghai) Co., Ltd. The P6 High-Fidelity Premix, LbCas12a enzyme, Cas12a High-Yield crRNA Synthesis and Purification Kit, modified ssDNA reporter probes (FAM and BHQ1 labels), and lateral flow test strips were sourced from Shanghai Tolo Harbor Biotechnology Co., Ltd. DNA purification kits were acquired from Tiangen Biotechnology (Beijing) Co., Ltd., while the ERA nucleic acid amplification kit was obtained from Suzhou Xianda Biotechnology Co., Ltd. The sputum extraction kit was purchased from Hangzhou Dilan Biotechnology Co., Ltd. A Roche LightCycler 96 system was employed for fluorescence quantitative PCR analysis, and the gel imaging equipment was sourced from Shanghai Qinxiang Scientific Instrument Co., Ltd. The fungal strains utilized in this research were preserved in our laboratory. Clinical \u003cem\u003eAF\u003c/em\u003e sputum samples were supplied by Huaibei People's Hospital, following ethical approval by the hospital ethics committee (No. 2024-052).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eCultivation of AF and Genome Extracti\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eCultivation of AF and Genome Extracti\u003cem\u003eon\u003c/em\u003e\u003c/div\u003e\u003cp\u003e\u003cem\u003eAF\u003c/em\u003e strains were cultivated on potato dextrose agar (PDA) plates at 30\u0026deg;C for 4 days. Spores were then inoculated into 5 mL liquid PDA medium and incubated for 24 hours. Fungal hyphae and spores were collected, and genomic DNA was extracted following the fungal genome extraction protocol.\u003c/p\u003e\n\u003ch3\u003eDesign of Specific Primers and crRNA\u003c/h3\u003e\n\u003cp\u003eThe \u003cem\u003eanxC4\u003c/em\u003e gene of \u003cem\u003eAF\u003c/em\u003e (GenBank accession AY598940) was selected. Using the online tool CRISPR RGEN, two high-scoring crRNA sequences (41 nt) targeting a specific amplification fragment of the \u003cem\u003eanxC4\u003c/em\u003e gene were designed. crRNA sequences (crRNA 1 and crRNA 2) were synthesized using the Cas12a High-Yield crRNA Synthesis and Purification Kit. One set of PCR primers (PCR-F/R) and three pairs of ERA primers (ERA-F1/R1, ERA-F2/R2, and ERA-F3/R3) were specifically designed within target regions of the crRNA sequences using Primer Premier 5 and validated via NCBI BLAST. All primer synthesis was carried out by Sangon Bioengineering (Shanghai) Co., Ltd. (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers and crRNA used in this study.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eName\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSequence(5\u0026prime;-3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLength\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePCR/F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCTCTGCGAACAACCTTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e18\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePCR/R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCTCTTTGCGATCCCTTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e18\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eERA/F1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCAGTCATTCTGTCTCCTCTGCGAACAACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eERA/R1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTTCAGCTCTTTGCGATCCCTTTCATCCTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eERA/F2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCTGTCTCCTCTGCGAACAACCTTTCAGTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eERA/R2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTTCAGCTCTTTGCGATCCCTTTCATCCTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eERA/F3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCATTCTGTCTCCTCTGCGAACAACCTTTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eERA/R3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTTCAGCTCTTTGCGATCCCTTTCATCCTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ecrRNA 1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eUAAUUUCUACUAAGUGUAGAUGCGAGUGUUUCCUCCUCCCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e41\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ecrRNA 2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eUAAUUUCUACUAAGUGUAGAUAUCCUUGGACUUGUUUCGCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e41\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003ePCR and ERA Amplification Systems\u003c/h3\u003e\n\u003cp\u003eThe PCR reaction mixture (50 \u0026micro;L) contained 25 \u0026micro;L of P6 High-Fidelity Premix, 2 \u0026micro;L each of forward and reverse primers (10 \u0026micro;M), 2 \u0026micro;L genomic DNA template, and nuclease-free water. PCR amplification was conducted using an ABI PCR thermocycler. The cycling conditions included initial denaturation at 95\u0026deg;C for 5 min, 35 cycles of 94\u0026deg;C for 1 min, 55\u0026deg;C for 1 min, 72\u0026deg;C for 1 min, and final extension at 72\u0026deg;C for 10 min.\u003c/p\u003e\u003cp\u003eThe ERA amplification reaction (50 \u0026micro;L total) comprised 20 \u0026micro;L of dissolving reagent, 2.5 \u0026micro;L each of forward and reverse primers (10 \u0026micro;M), 2 \u0026micro;L of genomic DNA template, and 23.5 \u0026micro;L of nuclease-free water. This reaction mixture was added into tubes containing lyophilized reagents. Subsequently, 2 \u0026micro;L of activator was placed on the tube lid, the tube briefly centrifuged, and then incubated at 37\u0026deg;C. Amplified products (2.5 \u0026micro;L each) from PCR and ERA reactions were subsequently analyzed by agarose gel electrophoresis.\u003c/p\u003e\n\u003ch3\u003eCRISPR-Cas12a Detection System\u003c/h3\u003e\n\u003cp\u003eThe CRISPR-Cas12a detection reaction (20 \u0026micro;L) contained 2 \u0026micro;L of 10\u0026times; HOLMES Buffer, 0.5 \u0026micro;L of Cas12a, 2 \u0026micro;L of crRNA, 2 \u0026micro;L of ssDNA reporter probe, and nuclease-free water up to a final volume of 20 \u0026micro;L. Fluorescence measurements were conducted using the Roche LightCycler\u0026reg; 96 at 37\u0026deg;C, recording fluorescence signals every 30 s over 45 min (90 cycles).\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eERA Primers and crRNA Screenin\u003cem\u003eg\u003c/em\u003e\u003c/h2\u003e\u003cp\u003eThree pairs of ERA primers were tested for amplifying \u003cem\u003eAF\u003c/em\u003e genomic DNA, selecting the primer set yielding a single specific amplification product. Two crRNAs were individually assessed within the CRISPR/Cas12a system. Optimal ERA primer and crRNA combinations were selected by evaluating endpoint fluorescence intensities and amplification curve profiles. Nuclease-free water served as the negative control in all experiments. Each experimental condition was independently replicated three times.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eEstablishment and Optimization of Two-Step CRISPR/Cas12a Detection System\u003c/h3\u003e\n\u003cp\u003eThe established CRISPR/Cas12a assay incorporated two detection approaches: fluorescence-based detection and lateral flow assay (LFA). Fluorescence detection was conducted at 37\u0026deg;C using the quantitative PCR system, whereas lateral flow detection employed incubation at 37\u0026deg;C in a water bath. For LFA, reaction samples were diluted to a total volume of 50 \u0026micro;L using nuclease-free water, thoroughly mixed, and test strips were immersed in the solution to visually assess the results at the test line.\u003c/p\u003e\u003cp\u003eOptimization of Fluorescence Detection System: With DNA template concentration fixed at 1 nM, Cas12a/crRNA ratios (2.5:1, 1.25:1, 1:1, 1:1.2, 1:1.6, and 1:2) and ssDNA probe concentrations (50, 100, 200, 300, 400, and 500 nM) were optimized. Nuclease-free water was the negative control. Fluorescence intensities were recorded under each condition.\u003c/p\u003e\u003cp\u003eOptimization of Test Strip Detection System: ssDNA probe concentrations were diluted (0, 100, 200, 300, 400, 600, and 800 nM) and tested. The lowest concentration causing T-line disappearance was selected as optimal.\u003c/p\u003e\u003cp\u003eOptimization of CRISPR/Cas12a Reaction Time: Reaction times (5, 10, 15, 20, 25, and 30 min) were evaluated for both fluorescence and strip detection. Optimal time was determined based on T-line color intensity.\u003c/p\u003e\n\u003ch3\u003eSensitivity Evaluation of the Two-Step CRISPR/Cas12a Detection System\u003c/h3\u003e\n\u003cp\u003eSensitivity of PCR-CRISPR/Cas12a and ERA-CRISPR/Cas12a methods was compared. DNA templates were serially diluted (10\u003csup\u003e6\u003c/sup\u003e to 10\u003csup\u003e0\u003c/sup\u003eaM) and subjected to PCR and ERA amplification, respectively. Amplification products (2 \u0026micro;L) were analyzed using fluorescence detection, and fluorescence curves were recorded. Genomic DNA was diluted (100 pg/\u0026micro;L to 0.1 fg/\u0026micro;L) to further validate the detection performance.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eEstablishment of the One Pot ERA-CRISPR/Cas12a detection system\u003c/h2\u003e\u003cp\u003eThe ERA reaction mixture comprised 20 \u0026micro;L of dissolving agent, 20 \u0026micro;L of nuclease-free water, and forward and reverse primers (2.5 \u0026micro;L each, 10 \u0026micro;M), ensuring complete dissolution of the lyophilized reagent powder. The Cas12a detection solution contained 0.5 \u0026micro;L LbCas12a (1 \u0026micro;M), 2 \u0026micro;L crRNA (300 nM), 2 \u0026micro;L 10\u0026times; HOLMES Buffer, and 2 \u0026micro;L ssDNA reporter probe (300 nM). Before initiating the reaction, 0.4 \u0026micro;L of template DNA (100 pg/\u0026micro;L) was combined with 1 \u0026micro;L of activator, forming the final sample mixture. Four variants of the One Pot detection protocol were assessed: (1) Initially, 8.6 \u0026micro;L ERA mixture was placed at the bottom of a centrifuge tube, followed by adding 10 \u0026micro;L Cas12a detection mixture onto the lid. Subsequently, 1.4 \u0026micro;L of the sample mixture was rapidly transferred into the ERA mixture, and the tube was immediately sealed and incubated at 37\u0026deg;C for 20 min. After incubation, gentle rotation mixed the solutions, and fluorescence analysis was performed using a fluorescence quantitative PCR system (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). (2) 15% glycerol was added between the ERA and Cas12a mixtures (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). (3) 1.765 mg sucrose was added to the ERA mixture (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). (4) ERA and Cas12a mixtures were directly combined before simultaneous amplification and detection (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eOptimization of the One Pot ERA-CRISPR/Cas12a detection system\u003c/h2\u003e\u003cp\u003eThe volume of genomic DNA (100 pg/\u0026micro;L) used in the One Pot ERA system was increased to 1 \u0026micro;L. The final concentration of the ssDNA FB probe was fixed at 300 nM, while the Cas12a protein concentration was optimized at 125, 250, 500, 750, and 1000 nM. The ERA reaction times tested were 5, 10, 15, 20, 25, 30, and 60 min, and detection time was set at 30 min.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eSensitivity evaluation of the One Pot ERA-CRISPR/Cas12a detection system\u003c/h2\u003e\u003cp\u003eTo determine the sensitivity of the established One Pot ERA-CRISPR/Cas12a assay for \u003cem\u003eAF\u003c/em\u003e detection, serial 10-fold dilutions of genomic DNA were prepared and analyzed. Negative controls utilized nuclease-free water. Sensitivity was evaluated based on the intensity of fluorescence signals and visual presence of the T-line on lateral flow strips.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eSpecificity evaluation of the One Pot ERA-CRISPR/Cas12a detection system\u003c/h2\u003e\u003cp\u003eSpecificity was assessed by testing genomic DNA extracted from all strains listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, using the optimized One Pot ERA-CRISPR/Cas12a system. Nuclease-free water served as a negative control. Fluorescence signal intensities and test-strip T-line visualization were used to evaluate the specificity.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eFungal strains used in this study.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStrain\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSource of the strain\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eStrain quantity\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eOne Pot ERA-CRISPR/Cas12a\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eAspergillus fumigatus\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eATCC MYA-4609\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eP\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCandida albicans\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLaboratory preservation\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eN\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCandida tropicalis\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLaboratory preservation\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eN\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eAspergillus niger\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLaboratory preservation\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eN\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ePenicillium chrysogenum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLaboratory preservation\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eN\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eAlternaria alternata\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLaboratory preservation\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eN\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eBotrytis cinerea\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLaboratory preservation\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eN\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eAspergillus cristatus\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLaboratory preservation\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eN\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003csup\u003ea\u003c/sup\u003eP: positive, N: negative.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eClinical evaluation of the One Pot ERA-CRISPR/Cas12a detection system\u003c/h2\u003e\u003cp\u003eSixty-two sputum samples (32 positives diagnosed with \u003cem\u003eAF\u003c/em\u003e, 30 negatives without \u003cem\u003eAF\u003c/em\u003e) were collected from Huaibei People\u0026rsquo;s Hospital (approved by the hospital ethics committee). These clinical samples underwent diagnosis by pure culture, qPCR, and the One Pot ERA-CRISPR/Cas12a detection method.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results and Discussion","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eScreening of ERA primers, PCR primers, and crRNA\u003c/h2\u003e\u003cp\u003eERA was performed using 1 nM genomic DNA of \u003cem\u003eAF\u003c/em\u003e and three primer sets, followed by electrophoresis. Although all ERA primer sets produced a single band, ERA primer set 2 yielded a brighter amplification band (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Optimal primer selection was performed according to band intensity from electrophoresis results, followed by crRNA screening. Fluorescence curves for crRNA1 and crRNA2 revealed that crRNA1 exhibited superior performance (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, D). Although both crRNAs reached plateau signals after approximately 25 min, crRNA1 demonstrated approximately 1.5-fold greater fluorescence intensity than crRNA2. Thus, primer set F2/R2 (240 bp) and crRNA1 were selected as the optimal combination for subsequent experiments.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eEstablishment of the Two-Step ERA-CRISPR/Cas12a detection system\u003c/h2\u003e\u003cp\u003eTo optimize the Cas12a/crRNA reaction, six concentration ratios were tested. Results\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003edemonstrated maximum fluorescence accumulation at the Cas12a/crRNA ratio of 1:1.2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, F). Therefore, a Cas12a concentration of 250 nM and a crRNA concentration of 300 nM were selected as optimal.\u003c/p\u003e\u003cp\u003eThe fluorescence detection reporter molecule (ssDNA FQ) concentration was further optimized (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Fluorescence intensity increased steadily from 50 nM up to 300 nM and reached saturation thereafter. Considering both detection cost and experimental effectiveness, 300 nM was selected as the optimal concentration.\u003c/p\u003e\u003cp\u003eOptimization of the lateral flow test strip detection system (ssDNA FB, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG) showed that lower concentrations resulted in false-positive T-line bands. As ssDNA FB concentration increased, T-line band intensity decreased while C-line intensity increased. At concentrations of 300 nM and 400 nM, false-positive signals were eliminated. Considering these results, 300 nM ssDNA FB was chosen for subsequent strip-based detection. The test strip shows two visible red lines 15 minutes after the test, and clear C-line and T-line can be observed at 30 minutes. Therefore, the detection time for all subsequent test strips is set to 30 minutes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eSensitivity test of the Two-Step ERA-CRISPR/Cas12a system\u003c/h2\u003e\u003cp\u003eThe sensitivity of the Two-Step ERA-CRISPR/Cas12a detection method was compared to that of the Two-Step PCR-CRISPR/Cas12a method. \u003cem\u003eAF\u003c/em\u003e DNA was diluted from 10\u003csup\u003e6\u003c/sup\u003e to 10\u003csup\u003e0\u003c/sup\u003e aM. PCR alone did not produce visible amplification bands below 10\u003csup\u003e2\u003c/sup\u003e aM (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). When PCR was combined with CRISPR/Cas12a detection, sensitivity improved to 10\u003csup\u003e1\u003c/sup\u003e aM (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, C). ERA amplification products were visible by electrophoresis at 10\u003csup\u003e0\u003c/sup\u003e aM (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). However, fluorescence detection using ERA-CRISPR/Cas12a was not successful below 10\u003csup\u003e0\u003c/sup\u003e aM, setting its detection limit at 10\u003csup\u003e0\u003c/sup\u003e aM (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, F).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo further evaluate sensitivity, extracted genomic DNA was serially diluted (100 pg/\u0026micro;L to 0.1 fg/\u0026micro;L). At high DNA concentrations, the ERA-CRISPR/Cas12a fluorescence reaction proceeded rapidly, reaching saturation within 20 min. Lower concentrations reacted more slowly, did not reach saturation within 45 min, and generated lower fluore\u003c/p\u003e\u003cp\u003escence values. Nevertheless, even at low concentrations, fluorescence signals were significantly stronger than those of the negative control. The detection limit of this method reached 1 fg/\u0026micro;L, indicating excellent sensitivity (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH, I). The sensitivity of the Two-Step ERA-CRISPR/Cas12a method developed here exceeded that of conventional PCR-CRISPR/Cas12a. ERA was rapid and required no temperature cycling, making it more suitable for lateral flow strip visualization. The detection limit using lateral flow test strips matched the fluorescence detection method, both detecting down to 1 fg/\u0026micro;L (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eEstablishment of the One Pot ERA-CRISPR/Cas12a detection system\u003c/h2\u003e\u003cp\u003eIn the Two-Step ERA-CRISPR/Cas12a method, ERA and Cas12a detection occur separately, requiring transfer of amplification products. Due to the high amplification efficiency of ERA, aerosol contamination can easily occur during transfer, leading to false-positive results. Direct mixing of the ERA and Cas12a systems for fluorescence detection significantly reduced sensitivity and fluorescence intensity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B). Given that ERA amplification and Cas12a cleavage utilize the same DNA substrate, directly combining both reactions simultaneously in a single container negatively impacts assay sensitivity. To mitigate this, the ERA amplification reagents were initially placed at the bottom of the reaction tube, while the Cas12a reaction components were added separately\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eonto the tube lid. Upon completion of ERA, the Cas12a mixture was centrifuged into the ERA solution, enabling subsequent reaction and detection. This approach generated clear fluorescence curves. Although glycerol and sucrose slightly improved sensitivity, their effects were less pronounced than the tube-bottom and lid separation method. Furthermore, glycerol and sucrose increased solution viscosity, hindering test strip detection and visualization.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eOptimization of the One Pot ERA-CRISPR/Cas12a detection system\u003c/h2\u003e\u003cp\u003eAfter comparing various One Pot strategies, the method of placing ERA at the tube bottom and Cas12a at the lid was chosen. Following ERA, centrifugation mixed the two solutions, eliminating aerosol contamination and avoiding substrate competition, thereby enhancing sensitivity. To further optimize sensitivity, component ratios were adjusted. The optimal Cas12a concentration was determined to be 500 nM after increasing the template volume to 1 \u0026micro;L at 100 pg/\u0026micro;L (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). The optimized One Pot assay achieved a sensitivity comparable to that of the Two-Step method (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD), with a detection limit of 1 fg/\u0026micro;L by fluorescence detection (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Under identical conditions, lateral flow test strips exhibited a slightly reduced sensitivity of 10 fg/\u0026micro;L (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH), one order of magnitude lower than fluorescence detection. Amplification time optimization indicated that two distinct red lines appeared at 15 min. However, after amplification exceeded 25 min, the T-line signal weakened significantly, indicating that excessively long amplification times reduced test effectiveness (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eSpecificity evaluation of the One Pot ERA-CRISPR/Cas12a detection system\u003c/h2\u003e\u003cp\u003eGenomic DNA of all strains listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e was used to evaluate specificity. Results showed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF, I) that only the \u003cem\u003eAF\u003c/em\u003e samples generated significant fluorescence signals and two clear red bands on test strips, indicating positive results. Other groups showed no obvious fluorescence, with only the C-line visible, indicating negative results. Thus, this method demonstrated excellent specificity.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eComparison of detection results between the One Pot ERA-CRISPR/Cas12a fluorescence system and qPCR\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"8\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c2\" namest=\"c1\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e\u003cp\u003eqPCR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eSensitivity\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eSpecificity\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eConsistency\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePositive\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNegative\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eOne Pot ERA-CRISPR/Cas12aFluorescence detection system\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePositive\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e32\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNegative\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e28\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e93.75%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e93.33%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e\u003cp\u003e93.55%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e32\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e62\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003eClinical evaluation of the One Pot ERA-CRISPR/Cas12a system\u003c/h2\u003e\u003cp\u003eSixty-two sputum samples were tested using traditional culture, One Pot ERA-CRISPR/Cas12a, and fluorescence quantitative PCR methods. Results showed 32 positive and 30 negative samples. Overall, results obtained by the One Pot ERA-CRISPR/Cas12a method aligned closely with culture-based findings (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ). Compared to qPCR, fluorescence-based ERA-CRISPR/Cas12a demonstrated a sensitivity of 93.75% and specificity of 93.33% (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), while lateral flow strip assays showed a sensitivity of 90.63% and specificity of 96.67% (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eComparison of detection results between the One Pot ERA-CRISPR/Cas12a test strip detection system and qPCR\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"8\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c2\" namest=\"c1\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e\u003cp\u003eqPCR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eSensitivity\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eSpecificity\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eConsistency\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePositive\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNegative\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eOne Pot ERA-CRISPR/Cas12a test strip detection system\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePositive\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e29\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNegative\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e29\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e32\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e90.63%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e96.67%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e\u003cp\u003e93.55%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e32\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e62\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003e\u003cem\u003eAspergillus\u003c/em\u003e is an opportunistic pathogenic fungus widely distributed in nature, representing an important pathogen causing respiratory infections in humans. IA, predominantly caused by \u003cem\u003eAF\u003c/em\u003e, commonly affects immunocompromised populations. Early detection of \u003cem\u003eAF\u003c/em\u003e remains challenging [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Various detection methods exist, each with distinct advantages and limitations. Currently, no single method simultaneously achieves high sensitivity, high specificity, short detection times, and simple operation. Several pathogen detection platforms utilizing CRISPR/Cas12a have been established, including those targeting SARS-CoV-2, African swine fever virus, Influenza virus, \u003cem\u003eMycoplasma pneumoniae\u003c/em\u003e, and \u003cem\u003eCandida albicans\u003c/em\u003e, influenza B virus [\u003cspan additionalcitationids=\"CR28 CR29\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Since its introduction, PCR technology has considerably advanced clinical diagnostics and molecular biology research [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Unlike traditional PCR, the ERA approach amplifies nucleic acids isothermally, eliminating the need for complex thermal cycling and simplifying operation. Compared with PCR-CRISPR/Cas12a assays, ERA-CRISPR/Cas12a demonstrated a ten-fold enhancement in detection sensitivity, thus highlighting its superior performance. However, fluorescence-based detection still relies on bulky instruments. To overcome this limitation, lateral flow test strips replace fluorescence probes, allowing visual interpretation of results and enabling rapid, on-site detection without sophisticated equipment [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Traditional procedures require manual opening of reaction tubes after amplification, generating aerosols and potentially causing false-positive results.\u003c/p\u003e\u003cp\u003eAdditionally, premature contact of Cas12a protein with target DNA in the early amplification phase can degrade the template or primers, inhibit subsequent amplification, and cause false-negative results. To prevent this, physical separation of ERA amplification and CRISPR/Cas12a detection systems was implemented using tube lids and bottoms. By spatially separating the amplification and detection steps and subsequently mixing the two systems via centrifugation, detection can be completed in a single tube. The addition of glycerol or sucrose increases the viscosity of the reaction system, reducing molecular diffusion. This approach prevents premature interaction of Cas12a with amplification products, avoiding inhibition of amplification [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Although the addition of glycerol and sucrose can enhance detection sensitivity, the Cas12a enzyme may exhibit slow cleavage activity toward the target DNA during the amplification process, thereby reducing the availability of templates for subsequent amplification steps. This issue is particularly pronounced in samples with low concentrations, ultimately compromising the overall sensitivity of the reaction. In contrast, the bottom-separated approach ensures complete physical separation between the amplification system and the CRISPR detection system, preventing any premature interaction with Cas12a prior to the completion of amplification. This effectively avoids the degradation of target DNA or primers, resulting in a more reliable and sensitive detection performance compared to the use of glycerol and sucrose in One Pot assays.\u003c/p\u003e\u003cp\u003eIn this study, after evaluating multiple variants of the One Pot protocol, a rapid and visually interpretable \u003cem\u003eAF\u003c/em\u003e detection assay based on the One Pot ERA-CRISPR/Cas12a system was successfully developed. Specifically, optimized ERA primers and crRNA sequences targeting the \u003cem\u003eAF\u003c/em\u003e-specific \u003cem\u003eanxC4\u003c/em\u003e gene were designed and selected. Among the four experimental setups, positioning the ERA reaction components and Cas12a detection system separately in the bottom and lid of the tube, respectively, provided optimal results by effectively minimizing false positives caused by sample transfer contamination. By refining reaction conditions, the sensitivity of the One Pot method was improved to match the Two-Step approach. The optimized One Pot assay reached detection limits of 1 fg/\u0026micro;L for fluorescence-based detection and 10 fg/\u0026micro;L for lateral flow assay, indicating exceptional analytical sensitivity. Clinical validation revealed a specificity of 93.33% for fluorescence detection and 93.75% for lateral flow assay, confirming strong diagnostic specificity. Compared to conventional culture-based detection methods, the proposed method significantly shortened detection times, requiring only 20 min for amplification, 30 min for fluorescence detection, and 5 min for lateral flow visualization, resulting in a total process completion time of approximately 55 min. Both detection methods clearly presented results in a straightforward manner.\u003c/p\u003e\u003cp\u003eDespite the aforementioned advantages, several limitations of this approach must be acknowledged. Firstly, the entire process relies on the extraction of genomic from samples, resulting in a disconnect between the extraction and downstream detection steps. Secondly, the current design necessitates a centrifugation step to integrate the spatially separated amplification and detection modules. This requirement for laboratory infrastructure hinders the development of a fully instrument-free operational workflow. Thirdly, the visual detection sensitivity of the lateral flow assay (10 fg/\u0026micro;L) is one order of magnitude lower than that of the fluorescence-based method (1 fg/\u0026micro;L), potentially compromising its reliability for samples with extremely low pathogen loads. Finally, although the method demonstrates high concordance with conventional culture methods, its observed sensitivity (93.75%) and specificity (93.33%) fall short of 100%. This indicates that it is best suited for preliminary screening rather than as a definitive diagnostic assay. Consequently, confirmation with the gold standard method is recommended for critical clinical cases. Future research should focus on streamlining the workflow, particularly by integrating sample preparation and detection to minimize reliance on instrumentation. Furthermore, enhancing the stability of the CRISPR/Cas12a system and optimizing the chemical properties of the lateral flow strips are expected to improve both the sensitivity and reproducibility of the visualization.\u003c/p\u003e\u003cp\u003eIn conclusion, the One Pot ERA-CRISPR/Cas12a assay developed here demonstrates outstanding speed, sensitivity, specificity, and accuracy for identifying \u003cem\u003eAF\u003c/em\u003e in sputum samples, representing a valuable diagnostic approach for rapid \u003cem\u003eAF\u003c/em\u003e detection in clinical practice.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003cp\u003eThe studies involving clinical samples were reviewed and approved by the Huaibei\u003c/p\u003e\u003ch2\u003eConsent for publication\u003c/h2\u003e\u003cp\u003eAll participants provided consent for the publication of their anonymized data.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis work was financially supported by the University Natural Science Research Key Projects in Anhui Province (2024AH051688, 2024AH051225), the Independent Research Projects and Open Projects of the State Key Laboratory of Agricultural Biotechnology (2020SKLAB6-3), the Anhui Province University Innovation Team Project (2023AH010045), and the \"Leading Goose\" R\u0026amp;D Program of Zhejiang (2023C03045).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eD.X., and F.L. proposed the idea. D.X. Q.J., X.Z., and F.Y. designed the research protocol. Q.J. and X.Z. conducted the experimental preparation and data analysis, while clinical samples were provided by Q.Z. The initial draft of the article was co-prepared by D.X. Q.J. and X.Z., and edited and reviewed by Q.J., X.Z., F.Y., T.L., Y.Z., and D.X. All authors have read and approved the published version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e\u003cp\u003eWe gratefully thank Huaibei People\u0026rsquo;s Hospital for their contribution of clinical samples.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eAll data generated or analyzed herein are included in this manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBongomin F, Gago S, Oladele RO, Denning DW. Global and multi-national prevalence of fungal diseases estimate precision. J fungi. 2017;3(4):57.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBrown GD, Denning DW, Gow NA, Levitz SM, Netea MG, White TC. Hidden killers: human fungal infections. Sci Transl Med. 2012;4(165):165rv13.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiang L, Gu R, Li X, Mu D. Simple and rapid detection \u003cem\u003eAspergillus fumigatus\u003c/em\u003e by loop-mediated isothermal amplification coupled with lateral flow biosensor assay. J Appl Microbiol. 2021;131(5):2351\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLatg\u0026eacute; J-P, Chamilos G. \u003cem\u003eAspergillus fumigatus\u003c/em\u003e and Aspergillosis in 2019. Clin Microbiol Rev. 2019;33(1):00140\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eP\u0026eacute;rez-Cantero A, L\u0026oacute;pez-Fern\u0026aacute;ndez L, Guarro J, Capilla J. Azole resistance mechanisms in \u003cem\u003eAspergillus\u003c/em\u003e: update and recent advances. Int J Antimicrob Agents. 2020;55(1):105807.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDenning DW, Pleuvry A, Cole DC. Global burden of allergic bronchopulmonary aspergillosis with asthma and its complication chronic pulmonary aspergillosis in adults. Med Mycol. 2013;51(4):361\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKosmidis C, Denning DW. The clinical spectrum of pulmonary aspergillosis. Thorax. 2015;70(3):270\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNeofytos D, Horn D, Anaissie E, Steinbach W, Olyaei A, Fishman J, et al. Epidemiology and outcome of invasive fungal infection in adult hematopoietic stem cell transplant recipients: analysis of Multicenter Prospective Antifungal Therapy (PATH) Alliance registry. Clin Infect Dis. 2009;48(3):265\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCadena J, Thompson GR, Patterson TF. Aspergillosis: epidemiology, diagnosis, and treatment. Infect Disease Clin. 2021;35(2):415\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHardin BD, Kelman BJ, Saxon A. Adverse human health effects associated with molds in the indoor environment. Int J Occup Environ Med. 2003;45(5):470\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRamanan P, Wengenack NL, Theel ES. Laboratory diagnostics for fungal infections: a review of current and future diagnostic assays. Clin Chest Med. 2017;38(3):535\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKoo S, Bryar JM, Baden LR, Marty FM. Prognostic features of galactomannan antigenemia in galactomannan-positive invasive aspergillosis. J Clin Microbiol. 2010;48(4):1255\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHusain S, Clancy CJ, Nguyen MH, Swartzentruber S, Leather H, LeMonte AM, et al. Performance characteristics of the platelia Aspergillus enzyme immunoassay for detection of Aspergillus galactomannan antigen in bronchoalveolar lavage fluid. Clin Vaccine Immunol. 2008;15(12):1760\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYu LS, Rodriguez-Manzano J, Malpartida-Cardenas K, Sewell T, Bader O, Armstrong-James D, et al. Rapid and Sensitive Detection of Azole-Resistant Aspergillus fumigatus by Tandem Repeat Loop-Mediated Isothermal Amplification. J Mol Diagn. 2019;21(2):286\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNguyen T, Duong BD, Wolff A. 2019 Novel Coronavirus Disease (COVID-19): paving the road for rapid setection and point-of-care diagnostics. Micromachines (Basel). 2020;11(3):306.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKitagawa Y, Orihara Y, Kawamura R, Imai K, Sakai J, Tarumoto N, et al. Evaluation of rapid diagnosis of novel coronavirus disease (COVID-19) using loop-mediated isothermal amplification. J Clin Virol. 2020;129:104446.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen JS, Ma E, Harrington LB, Da Costa M, Tian X, Palefsky JM, et al. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science. 2018;360(6387):436\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi SY, Cheng QX, Wang JM, Li XY, Zhang ZL, Gao S, et al. CRISPR-Cas12a-assisted nucleic acid detection. Cell Discovery. 2018;4(1):20.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu H, Wang J, Zeng H, Liu X, Jiang W, Wang Y, et al. RPA-Cas12a-fs: A frontline nucleic acid rapid detection system for food safety based on CRISPR-Cas12a combined with recombinase polymerase amplification. Food Chem. 2021;334:127608.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang Y, Ke Y, Liu W, Sun Y, Ding X, et al. A one-pot toolbox based on Cas12a/crRNA enables rapid foodborne pathogen detection at attomolar level. ACS Sens. 2020;5(5):1427\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang D, Qian J, Shi Z, Zhao J, Fang M, Xu Z, et al. CRISPR-Cas12a-assisted multicolor biosensor for semiquantitative point-of-use testing of the nopaline synthase terminator in genetically modified crops by unaided eyes. ACS Synth Biol. 2020;9(11):3114\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang YM, Zhang Y, Xie K. Evaluation of CRISPR/Cas12a-based DNA detection for fast pathogen diagnosis and GMO test in rice. Mol Breeding. 2020;40(1):11.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang D, Shi Z, Qian J, Bi K, Fang M, Xu Z. A CRISPR-Cas12a-derived biosensor enabling portable personal glucose meter readout for quantitative detection of SARS. CoV-2. Biotechnol Bioeng. 2021;118(4):1587\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBroughton JP, Deng X, Yu G, Fasching CL, Servellita V, Singh J, et al. CRISPR-Cas12-based detection of SARS-CoV-2. Nat Biotechnol. 2020;38(7):870\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMukama O, Yuan T, He Z, Li Z, Zeng L. A high fidelity CRISPR/Cas12a based lateral flow biosensor for the detection of HPVl6 and HPV18. Sens Actuators B. 2020;316:128119.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOtu A, Kosmidis C, Mathioudakis AG, Ibe C, Denning DW. The clinical spectrum of aspergillosis in chronic obstructive pulmonary disease. Infection. 2023;51(4):813\u0026ndash;29.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi J, Huang H, Song Z, Chen S, Xu J, Yang J, et al. Palm-sized CRISPR sensing platform for on-site Mycoplasma pneumoniae detection. Biosens Bioelectron. 2025;281:117458.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShen S, Wang W, Ma Y, Wang S, Zhang S, Cai X, et al. Affinity molecular assay for detecting Candida albicans using chitin affinity and RPA-CRISPR/Cas12a. Nat Commun. 2024;15(1):9304.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAli Z, Aman R, Mahas A, Rao GS, Tehseen M, Marsic T, et al. iSCAN: An RT-LAMP-coupled CRISPR-Cas12 module for rapid, sensitive detection of SARS-CoV-2. Virus Res. 2020;288:198129.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYin K, Ding X, Li Z, Zhao H, Cooper K, Liu C. Dynamic Aqueous Multiphase Reaction System for One-Pot CRISPR-Cas12a-Based Ultrasensitive and Quantitative Molecular Diagnosis. Anal Chem. 2020;92(12):8561\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAli DM, Zake LG, El Kady NK. Role of Chest Computed Tomography versus Real Time Reverse Transcription Polymerase Chain Reaction for Diagnosis of COVID-19: A Systematic Review and Meta-Analysis. Interdiscip Perspect Infect. 2021; 2021:8798575.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLuppa PB, M\u0026uuml;ller C, Schlichtiger A, Schlebusch H. Point-of-care testing (POCT): Current techniques and future perspectives. Trends Analyt Chem. 2011;30(6):887\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLin M, Yue H, Tian T, Xiong E, Zhu D, Jiang Y, et al. Glycerol Additive Boosts 100-fold Sensitivity Enhancement for One-Pot RPA-CRISPR/Cas12a Assay. Anal Chem. 2022;94(23):8277\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHu JJ, Liu D, Cai MZ, Zhou Y, Yin WX, Luo CX. One-Pot Assay for Rapid Detection of Benzimidazole Resistance in Venturia carpophila by Combining RPA and CRISPR/Cas12a. J Agric Food Chem. 2023;71(3):1381\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Aspergillosis, ERA, CRISPR/Cas12a, One Pot method, Lateral flow test strip","lastPublishedDoi":"10.21203/rs.3.rs-7538348/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7538348/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003eAspergillus fumigatus\u003c/em\u003e (\u003cem\u003eAF\u003c/em\u003e) is the predominant pathogen implicated in invasive aspergillosis (IA) in humans; therefore, prompt and accurate detection is critical for the effective prevention and management of IA. This study developed a rapid detection system targeting the \u003cem\u003eAF\u003c/em\u003e-specific \u003cem\u003eanxC4\u003c/em\u003e gene by integrating enzymatic recombinase amplification (ERA) with CRISPR/Cas12a. The reaction proceeds at a stable temperature of 37\u0026deg;C, with amplification and detection systems separately positioned in the tube lid and bottom, respectively, effectively minimizing aerosol contamination typically associated with product transfers. To enhance sensitivity, the One Pot method was optimized. Consequently, the fluorescence detection limit reached 1 fg/\u0026micro;L, and the sensitivity of the test strip reached 10 fg/\u0026micro;L, with no cross-reactivity observed against other fungi. Detection of \u003cem\u003eAF\u003c/em\u003e was completed within 60 min, and results were visually displayed through fluorescence signals and nucleic acid test strips. Clinical practicality was further evaluated using aspergillosis samples, which demonstrated satisfactory performance. Pure culture results confirmed that out of 62 sputum samples, 32 were positive and 30 negative. Evaluation of 62 clinical samples using the One Pot ERA-CRISPR/Cas12a system demonstrated sensitivity and specificity rates of 93.75% and 93.33%, respectively, via fluorescence detection, and 90.63% sensitivity and 96.67% specificity using lateral flow strips.\u003c/p\u003e","manuscriptTitle":"Establishment and application of a rapid detection system for Aspergillus fumigatus based on ERA/CRISPR-Cas12a","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-28 16:45:07","doi":"10.21203/rs.3.rs-7538348/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-11-20T05:48:42+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-18T20:43:57+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-15T18:52:51+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-10T14:31:24+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"138801395191614348499800759755830078249","date":"2025-10-17T07:43:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"270804359791588177798485008749635833658","date":"2025-10-16T10:22:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"5064236390030103638376587740401157189","date":"2025-10-15T13:14:27+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-14T10:46:07+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-14T10:27:56+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-10-14T09:26:47+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-08T09:38:31+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Microbiology","date":"2025-10-08T09:34:29+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9e2640ff-7019-4a8c-8d9d-24eac83f25ad","owner":[],"postedDate":"October 28th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-16T16:00:50+00:00","versionOfRecord":{"articleIdentity":"rs-7538348","link":"https://doi.org/10.1186/s12866-026-04881-4","journal":{"identity":"bmc-microbiology","isVorOnly":false,"title":"BMC Microbiology"},"publishedOn":"2026-03-09 15:57:37","publishedOnDateReadable":"March 9th, 2026"},"versionCreatedAt":"2025-10-28 16:45:07","video":"","vorDoi":"10.1186/s12866-026-04881-4","vorDoiUrl":"https://doi.org/10.1186/s12866-026-04881-4","workflowStages":[]},"version":"v1","identity":"rs-7538348","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7538348","identity":"rs-7538348","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}