Detection of reproductive interference between closely related Salvia species with small-scale separated distributions by multifaceted pollination and molecular analyses | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Detection of reproductive interference between closely related Salvia species with small-scale separated distributions by multifaceted pollination and molecular analyses Sachiko Nishida, Atsuko Takano, Yoshihisa Suyama, Satoshi Kakishima This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3998530/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 30 Aug, 2024 Read the published version in Journal of Plant Research → Version 1 posted 5 You are reading this latest preprint version Abstract Reproductive interference, an interspecific interaction in reproductive process that exerts an adverse effect, has gained attention as a contributing factor to promoting exclusive distributions between related closely species. However, detailed studies on the possibility of reproductive interference between native plants are still wanting, presumably because strong reproductive interference can rapidly realize exclusive distributions, leaving the two species apparently independent. Salvia japonica and S. lutescens are found in separate localities at small scale, although their distributions overlap at large scale. We investigated the possibility of reproductive interference between them through field surveys, hand-pollination experiments, evaluation of hybrid fertility, cpDNA and nrDNA genotyping, and genome-wide DNA analysis. The field survey results did not reveal apparent negative interaction in competition for pollinator services. Mixed pollination with conspecific pollen and counterpart pollen reduced seed set in S. japonica , and hybrid progeny produced by mixed pollination were one-fifth or less as fertile compared to the pure species. The DNA genotyping results suggested the possibility of hybridization where their distributions overlap, and the genome-wide DNA analysis results showed clear genetic differentiation between the two species as well as the existence of hybrids. These results suggest that bi-directional reproductive interference between S. japonica and S. lutescens may have led to their present separated distributions at small scale. distributional relationship hybridization reproductive interference Salvia japonica Salvia lutescens Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Reproductive interference, defined as a negative effect of interspecific sexual interactions on the fitness of either species, is one such negative interaction (Gröning and Hochkirch, 2008 ), and it is considered to be a pivotal factor influencing population dynamics, especially between closely related species (Kyogoku, 2015 ). Theoretically, two species that exert strong reproductive interference can achieve exclusive distributions locally (Ribeiro and Spielman, 1986 ; Kuno, 1992 ; Yoshimura and Clark, 1994 ; Nishida et al., 2015 ) because the species that is less abundant in a locality would suffer from severe interference and produce fewer offspring than the dominant species; in turn, the offspring would suffer from further interference and produce even fewer offspring in the following generations, with the result that the less abundant species would eventually become extinct in the locality. Hybridization has been proposed as one of the main mechanisms of reproductive interference in plants (e.g. Mitchell et al., 2009 ), because hybridization can slow the growth rate of a population if hybrid seeds are produced at the expense of conspecific seeds (i.e. interspecific ovule discounting; Levin et al., 1996 ). Nishida et al. ( 2020 ) have suggested that if hybrids occur in a region where only one of the parent plant species is present, we can infer that reproductive interference has led to the exclusion of one of the parent species, unless the hybrids were introduced to the region by a long-distance dispersal mechanism. With these considerations in mind, we focused here on a pair of wild Salvia species that are distributed in overlapping areas, but which occur separately at small scale and investigated the possibility of reproductive interference between them. Salvia japonica and S. lutescens both belong to the subgenus Glutinaria (Hu et al., 2018 ) (Fig. 1 ). Among the seven species in the subgenus, only these two have overlapping distributions and flowering times in Japan (Takano and Okada, 2011 ). However, at small scale, their distributions do not overlap (i.e. they are allotopic; Rivas, 1964 ), even when they grow along the same river systems or mountain trails (A. Takano and S. Nishida, pers. obs.; Fig. 2 ). Takano and Okada ( 2011 ) previously suggested that the two species may hybridize, but no detailed study has evaluated this possibility or the possibility that hybridization might be a mechanism of reproductive interference between the two species. In this study, we carried out fieldwork to investigate whether negative interspecific interactions are presently occurring between these two species, focusing in particular on the possibility of competition for pollinator services. We next conducted a series of hand-pollination experiments and evaluated possible effects of reproductive interference between the species, in particular, the effects of heterospecific pollen on seed set in the two species and on the fertility of offspring produced by hybridization between them. We then studied the two species genetically, using chloroplast DNA (cpDNA) haplotyping, nuclear ribosomal DNA (nrDNA) genotyping, and genome-wide DNA analyses by MIG-seq (multiplexed inter-simple sequence repeat genotyping by sequencing) (Suyama and Matsuki, 2015 ) to detect genetic relationships between them, including hybridization. Through these approaches, we aimed to answer the following questions: Are negative reproductive interactions currently occurring between these species, through hybridization or other mechanisms? Has reproductive interference, including by hybridization, occurred between the two species? Does the present observed small-scale segregation reflect reproductive interference between these two Salvia species? Materials and Methods Study species Salvia japonica Thunb. and Salvia lutescens (Koidz.) Koidz. are herbs belonging to subgenus Glutinaria of genus Salvia , Lamiaceae (Hu et al., 2018 ). In Japan, S. japonica is a perennial distributed from Honshu to the Ryukyu Islands (Fig. 2 ), and it is also found in Korea and China (Murata and Yamazaki, 1993 ). Salvia lutescens is also a perennial, but endemic to the islands of Honshu and Shikoku, Japan (Fig. 2 ). Both species have similar compound leaves and verticillaster inflorescences, but they differ in flower morphology: S. japonica has stamens and styles only slightly longer than the upper corolla lip, whereas the stamens and styles of S. lutescens are much longer than the upper corolla lip (Yonekura, 2017 ). The chromosome number of both species is n = 16 (Funamoto et al., 2000 ). Among the varieties of S. lutescens , we focused on S. lutescens var. occidentalis A. Takano in our field survey and hand-pollination experiments. This variety of S. lutescens has deep purple (rarely white) flowers, whereas S. japonica has pale purple flowers. Although in S. japonica , anthesis is reported to last from July to November, and anthesis in S. lutescens is reported to extend from June to August (Yonekura, 2017 ), at our study sites, anthesis in both species occurs from July to early September (A. Takano and S. Nishida, pers. obs.). The two species also share the same insect taxa as pollinators, mainly sweat bees (Halictidae) and hoverflies ( Betasyrphus and Bacchini ). These three insect taxa accounted for 89.2% and 86.8% of the total number of pollinator individuals visiting S. japonica and S. lutescens , respectively, during six observation days (20 July, 3, 8, 13, 27, and 30 August 2019; Y. Watanabe, A. Takano, and S. Nishida, unpublished). Although some Salvia species have been reported to be self-compatible (e.g. Haque and Ghoshal, 1981 ; Miyajima, 2001 ), the timing of the male and female stages and the flower structure of the two studied species appear to usually prevent self-pollination: pollen is released from the anthers 1 d before the stigma opens, and the anthers are about 3 mm away from the stigma when the stigma opens (S. Nishida, pers. obs.) Lever-like stamens, though often reported in Salvia (Claßen-Bockhoff et al., 2004 ), are absent in S. japonica and S. lutescens . Study area Field surveys and cpDNA haplotyping, nrDNA genotyping, and MIG-seq-based single nucleotide polymorphism (SNP) analyses were conducted on populations inhabiting two localities: Sanda, Hyogo prefecture (HS: 35°00’34”N, 135°14’05”E), and Mt. Yamato-Katsuragi, Osaka prefecture (OY: 34°27’11”N, 135°40’14” E) (Fig. 2 ). At these two sites, both Salvia species were present, but only in small, unmixed patches. The closest distance between individuals of different species was about 100 m at HS and 20 m at OY. All populations at HS and OY were found along rivers and at the edges of forests consisting of planted Cryptomeria and wild Quercus trees. To investigate present negative interaction between the two species and for comparison with the populations at HS and OY, we conducted field surveys at Azuchi (SA: 35°09’06”N, 136°08’51”E) and Otsu (SO1: 35°09’34”N, 135°51’52”E), both in Shiga prefecture, as well as cpDNA haplotyping and nrDNA genotyping on each population. The population at SA consisted of only S. japonica , and the population at SO1 consisted of only S. lutescens . Another isolated population of S. japonica at Otsu, Shiga prefecture (SO2: 35°09’15”N, 135°52’06”E), was only about 1.5 km away from the S. lutescens population at SO1, but it was confined to a small patch along a road leading to a waste incineration plant. The waste incineration plant and road were built in 1987 or 1988, and we assumed that the S. japonica population was introduced after the road was built. On the population at SO2, we performed only cpDNA haplotyping and nrDNA genotyping. We used seeds of S. japonica and S. lutescens from SA and SO1, respectively, for our hand-pollination experiment and preliminary experiment on survival and conducted these experiments at the Nagoya University Museum Botanical Garden, Nagoya University (35°09ʹ12ʺN.136°57ʹ42ʺE). The garden is within the distributional range of both species, but they do not grow in wild at the garden. We also carried out cpDNA haplotyping and nrDNA genotyping at the following six sites: Miyakonojo, Miyazaki prefecture (31°45’39”N, 130°59’13”E), Mt. Kasagata, Hyogo prefecture (35°03’49”N, 134°50’49”E), Sudogawa, Shizuoka prefecture (35°11’43”N, 138°46’19”E), Kintoki, Kanagawa prefecture (35°16’48”N, 139°00’11”E), Mt. Mikuni, Shizuoka prefecture (35°13’44”N, 138°58’44”E), and Mt. Higane, Shizuoka prefecture (35°08’00”N, 139°03’31”E) (Fig. 2 ). Among these localities, only S. japonica was distributed at Miyakonojo and Mt. Kasagata, whereas both species were distributed at the other four localities, according to data of specimens in the collections of the Museum of Nature and Environmental History, Shizuoka, and the Kanagawa Prefectural Museum of Natural History (A. Takano, pers. obs.). In this study, however, although we found both species at Mt. Mikuni, we found only S. lutescens at Mt. Higane, Kintoki, and Sudogawa. Negative interspecific interactions in the field One critical pre-pollination factor that causes negative interspecific interactions is competition for pollinator services (Mitchell et al., 2009 ). To determine whether the two studied species suffered from pollen limitation as a result of competition for pollinator services between them or with other plants, we compared the seed set following natural pollination with the seed set following conspecific hand-pollination. If eighter of the species suffers from competition for pollinator services with the counterpart species, the seed set following natural pollination would be lower than that following conspecific hand-pollination especially at the site where both species were present (HS and OY). If they do not suffer from competition for pollinator services with the counterpart species, difference between the seed set following natural pollination and that following conspecific hand-pollination would be marginal. Seed set is the result of many factors, including some abiotic factors such as water, temperature, and nutrients. However, we tried to exclude most factors other than the pollination treatments from our consideration by comparing results under similar conditions within the same study sites. Surveys were conducted at HS in August 2016, at OY in August 2015, at SA in August 2019, and at SO1 in August 2019. In the case of the HS and OY populations, data of seed set following conspecific hand-pollination were collected in the field within each study site. In the case of the SA and SO1 populations, they were collected at the Nagoya University Museum Botanical Garden. At HS, SA, and SO1, we arbitrarily selected approximately 30 individuals of each species at each site and collected one or two fruits from each individual for the data of the natural pollination. At OY, we arbitrarily selected only about 10 individuals and collected about six fruits from each individual because the number of individuals with fruits was limited. The procedure for conspecific hand-pollination is described in the next section. We brought the mature fruits, still in the sepals, to the laboratory and counted the number of normally developed seeds and undeveloped ovules in each fruit. In both species, each flower has four ovules and each fruit has a maximum of four seeds. Normally developed seeds are brown and about 2 mm long, whereas undeveloped ovules are whitish and less than about 0.5 mm long; thus, they are easy to distinguish by eye. We calculated the seed set as the proportion of normally developed seeds relative to the total number of ovules. To statistically evaluate the differences in seed set between natural pollination and conspecific hand-pollination, we used a generalized linear mixed model (GLMM; Wolfinger and O’Connell, 1993 ) with a binomial error structure and a logit link function. The response variable was normal seed development, and the explanatory variable was the pollination treatment. Individuals were incorporated as a random effect. The analysis was conducted with R version 3.5.2 software (R Core Team 2018 ). We considered the effect to be significant if the P value obtained by Wald test was less than 0.05. Effect of heterospecific pollen deposition We conducted hand-pollination experiments to investigate the effect of pollen of the counterpart species on seed set and on hybridization. We used plants from the SA and SO1 populations of S. japonica and S. lutescens , respectively, because in each these localities, only one of the two species was present. Therefore, we expected the plants in each of these populations to not have a history of interaction with the counterpart species. The experiment was carried out in September 2019 and July 2021 at the Nagoya University Museum Botanical Garden, where neither species occurs, to avoid the risk of genetic contamination by wild populations. In 2017, we collected seeds of S. japonica and S. lutescen s at SA and SO1, respectively, and planted each of the seeds in a pot with culture soil at the botanical garden. In 2019, we obtained 12 S. japonica plants and 7 S. lutescens plants with sufficient flowers for the experiments. We arbitrarily selected about 120 S. japonica flowers and 140 S. lutescens flowers and assigned them to one of two pollination treatments: conspecific pollination, in which the flowers received only pollen grains of their own species, and mixed pollination, in which the flowers received a mixture of pollen grains of their own and the counterpart species. To avoid unintended pollination by insect pollinators, we brought the plants into a shed next to the garden, where we applied the pollen, and kept them there until the next day, when all the flowers we used had finished flowering. Before each pollination treatment, we first confirmed that there were no pollen grains on the stigma. For pollen donors, we used plant individuals that were not siblings of the recipient plants. We picked up one of the donor stamens with tweezers and applied the donor pollen grains to the recipient stigma by gently brushing the stigma with the donor anther. In the mixed pollination, we applied the conspecific pollen first and the counterpart pollen immediately afterwards. In this way, we avoided overestimation of the effect of the heterospecific pollen on the stigma, which might occur if the counterpart pollen was applied before the conspecific pollen. We did not count the number of pollen grains transferred during each pollination, but we observed the similar number of pollen grains from each species on the stigma after each pollination treatment with a magnifying glass (pollen grains of the two species could be distinguished by their color). We carried out the same pollination experiments again in July 2021, using both the same plants and the offspring of the plants obtained in 2019 following conspecific pollination. In 2021, we used more individuals of each species (14 S. japonica and 19 S. lutescens ) but fewer flowers (about 30 S. japonica and 50 S. lutescens ) for the experiment compared with that in 2019. We followed the same procedure as in 2019 but avoided using not only siblings but also parent plants as pollen donors. About 20 days after the hand-pollination in each year, we collected the resulting fruits, brought them to the laboratory, counted the number of normally developed seeds and undeveloped ovules in each fruit, and calculated the seed set. We analyzed the effect of mixed pollination on seed set using a GLMM with a binomial error structure and a logit link function. We analyzed the data in each year both independently and inclusively (i.e., both years together), because insufficient data were obtained in 2021 for independent analysis. In all analyses, the response variable was normal seed development, and the explanatory variable was the pollination treatment. Individual plants were incorporated as a random effect in the independent analyses, whereas they were nested within year before being incorporated as a random effect in the inclusive analyses. The analyses were conducted with R 3.5.2 software (R Core Team, 2018 ). We considered the effect to be significant when the P value obtained by Wald test was less than 0.05. Hybrid offspring and hybrid offspring fertility To estimate the frequency of hybridization between the two species, we carried out nrDNA genotyping of the progeny obtained after mixed pollination. We collected all of the seeds obtained from the mixed pollination and sowed each seed in a pot of culture soil. Germination rates were low in both species (17.1% for S. japonica and 14.0% for S. lutescens ) and did not differ significantly between the species (Fisher’s exact test, P = 0.46, odds ratio = 0.78). We obtained 20 S. japonica seedlings and 44 S. lutescens seedlings. We collected one leaf from each seedling, extracted DNA from the leaf, and amplified the internal transcribed spacer (ITS) regions. The procedures for DNA extraction, amplification, and sequencing are described below. Among those seedlings identified as hybrid, 16 individuals flowered in 2021. We first observed their pollen grains to determine the male fertility. We picked pollen grains from an anther with tweezers, placed them in a drop of distilled water on a concave slide, gently covered them with a cover glass, and observed them under the microscope. The pollen grains of the two species could be divided by their shape into ellipsoid and roundish types. Roundish-type pollen grains were usually less than two-thirds the length of the ellipsoid-type grains and did not stain with potassium iodide, whereas the ellipsoid pollen grains usually stained with potassium iodide (S. Nishida, pers. obs.). Considering the smaller size of the roundish-type grains and the fact that they did not stain with potassium iodide, we inferred that the roundish-type pollen grains had low fertility. We counted pollen grains of both types on each slide from the 16 hybrid individuals, 6 pure S. japonica individuals, and 7 pure S. lutescens individuals. We calculated the proportion of ellipsoid-type pollen grains to total pollen grains from the hybrid and pure species and analyzed the proportional difference between hybrid and pure individuals using a GLMM with a binomial error structure and a logit link function. In this analysis, the response variable was the pollen grain type and the explanatory variable was the plant type (hybrid or pure species). Individuals were incorporated as a random effect. The analysis was conducted with R version 3.5.2 software (R Core Team, 2018 ). We considered the effect to be significant when the P value obtained by Wald test was less than 0.05. To determine female fertility, we hand-pollinated hybrid individuals. In July 2021, we arbitrarily selected a few whorls of flowers in the verticillaster-type inflorescences of the hybrids and assigned them to one of two pollination treatments: pollination with S. japonica pollen and pollination with S. lutescens pollen. The pollination procedure was the same as described above for conspecific pollination. About 20 days after the hand-pollination, we counted the number of normally developed seeds and undeveloped ovules in each fruit collected and calculated the seed set. We compared the results with the seed set data for the pure species following conspecific pollination (for details, see the previous section). We analyzed the difference in seed set between the hybrids and pure species using a GLMM with a binomial error structure and a logit link function. The response variable was normal seed development, and the explanatory variable was plant status (hybrid or pure species). Individuals were incorporated as a random effect. The analysis was conducted with R 3.5.2 software (R Core Team, 2018 ). We considered the effect to be significant when the P value obtained by Wald test was less than 0.05. cpDNA haplotyping, nrDNA genotyping, and assessment of genetic structure using MIG-seq To detect the occurrence of hybridization, we performed cpDNA haplotyping and nrDNA genotyping of individuals of S. japonica and S. lutescens and analyzed the genetic structure of the populations in which the two species coexisted using MIG-seq (Suyama and Matsuki, 2015 ). Leaf samples for cpDNA haplotyping and nrDNA genotyping were collected from all study sites (Fig. 2 ), but leaf samples for MIG-seq were collected only from study sites HS and OY, where both species were distributed. Most of the individuals sampled at HS and OY were used for all three procedures, cpDNA haplotyping, nrDNA genotyping, and MIG-seq. During sampling, we found two plants at HS and four plants at OY that appeared to be hybrids by their flower morphology, in particular, by their stamen length and petal color, which appeared to be intermediate between those of the two species. We provisionally called these plants putative hybrids. We extracted total genomic DNA from the dried sampled leaves using a modified version of the 2 × cetyltrimethylammonium bromide (CTAB) extraction protocol of Doyle and Doyle ( 1987 ). We amplified the ycf1–ycf15 region in plastid DNA using 5711f as the forward primer and rps15r as the reverse primer (Drew and Sytsma, 2011 ), and we amplified the nrDNA ITS region using ITS5 as the forward primer and ITS4 as the reverse primer (White et al., 1990 ). The protocol and conditions for the polymerase chain reaction (PCR), purification, and cycle sequencing analyses followed Takano and Okada ( 2011 ) and Takano ( 2017 ). Raw sequences were assembled and edited manually by using the BioEdit software (ver. 7.2.5; Hall, 1999). Multiple DNA sequences were aligned by using the multiple alignment method in the CLUSTALW 1.83 software package with default settings (Thompson et al., 1994 ). Gaps were deleted. For our genotyping, we used the sequences recognized by Takano ( 2017 ) as usable for distinguishing between S. japonica and S. lutescens (Table 1 ). Table 1 Sequences usable for distinguishing between Salvia japonica and S. lutescens (extracted from Takano, 2017 ). Polymorphic allele sites in the ycf1-ycf15 (cpDNA) region Haplotype 89 90 200 228 268 S. japonica A G A T C S. lutescens C T G G A Polymorphic allele sites in the nrDNA internal transcribed spacer (ITS) region Genotype 447 461 464 490 515 580 S. japonica A C C G G C S. lutescens G T T A A T MIG-seq is a PCR-based procedure for constructing highly reduced representation libraries without restriction enzyme digestion steps that involves de novo SNP discovery and genotyping by next-generation sequencing (Suyama and Matsuki, 2015 ; Suyama et al., 2022 ). For MIG-seq, we mostly used the same extracted DNA that we used for the DNA genotyping. From the DNA extracted from leaves collected from HS and OY, we used 26 and 24 S. japonica samples, respectively, 29 and 24 S. lutescens samples, respectively, and 2 and 4 putative hybrid samples, respectively. The MIG-seq library was prepared following Suyama and Matsuki ( 2015 ). Primer set 1 (Suyama and Matsuki, 2015 ) was used for the first PCR. The number of cycles for the first PCR was set to 25, as Suyama and Matsuki ( 2015 ) proposed, but the annealing temperature was decreased from 48°C to 38°C to follow the procedure recommended by Suyama et al. ( 2022 ). The second PCR products were obtained by using the first PCR products as templates and were purified by using AMPure XP beads (Beckman Coulter, Brea CA, USA). Then, 300–800-bp fragments were isolated by using the BluePippin system (Sage Science, Beverly, MA, USA). The final concentrations were measured with a Qubit 3.0 Fluorometer (Invitrogen, Carlsbad, CA, USA) and a 4200 TapeStation (Agilent, Santa Clara, CA, USA). The multiplexed library was sequenced by using an Illumina MiSeq Sequencer with MiSeq Reagent Kit v. 3 (150 cycles, Illumina, San Diego, CA, USA) and the dark cycle option, which skipped the first 17 bp of read 1 and the first 3 bp of read 2, following the original protocol (Suyama and Matsuki, 2015 ). As a result, we obtained 80-bp sequences from read 1 and 94-bp sequences from read 2. For quality control of the raw reads, the first 14 bp of read 2 were trimmed using the fastx trimmer program in the FASTX-Toolkit 0.0.14 ( http://hannonlab.cshl.edu/fastx_toolkit/ ). Then both reads 1 and 2 (80 bp each) were trimmed to remove the adapter sequences (GTCAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and CAGAGATCGGAAGAGCGTCGTGTAGGG AAAGA), the first five bases, the last base, and low-quality regions (quality value [QV] < 15 in a four-base-wide sliding window); short reads (< 74 bases) were removed by using Trimmomatic ver. 0.39 software (Bolger et al., 2014 ). Ipyrad ver. 0.9.90 software was used to assemble the reads and obtain SNP markers (Eaton and Overcast, 2020 ). The depth of coverage was set to six, and the clustering threshold was set to 0.9. Other parameters were set to their default values. The individual-based genetic structure was estimated by using the STRUCTURE 2.3.4 program (Pritchard et al., 2000 ) in the ipyrad analysis toolkit. The sample coverage with the minimum number of SNPs was set to 0.8, and 20 independent Markov Chain Monte Carlo (MCMC) runs with 100,000 iterations were performed, following a burn-in period of 100,000 steps. The number of clusters (K) was set to two under the assumption that there were just two species. Results Negative interspecific interactions in the field The seed set of the two Salvia species under natural pollination was not significantly lower than that following conspecific hand-pollination at any study sites, whether the site harbored both species (HS and OY) or only one of the species (SA, SO1)(Fig. 3 ). Effects of heterospecific pollen deposition In 2019, seed set of S. japonica following mixed pollination was about 22% lower than that following conspecific pollination, whereas seed set of S. lutescens was almost the same after conspecific and mixed pollination (Table 2 , Fig. 4 ). In 2021, seed set of both S. japonica and S. lutescens following mixed pollination was lower than seed set following conspecific pollination, but the adverse effect of mixed pollination was not significant in either species (Table 2 , Fig. 4 ). When we analyzed the results for both years together, the effect was significant in S. japonica , but not in S. lutescens (Table 2 ). Table 2 Seed set of Salvia japonica and S. lutescens following conspecific and mixed hand-pollination and GLMM analysis results for the effect of mixed pollination on seed set. Species Year Treatment n (flowers/ individuals) Seed set GLMM Coefficient ± s.e. Z P S. japonica 2019 Conspecific 52/12 0.510 -0.506 ± 0.185 -2.733 0.006 Mixed 66/12 0.398 2021 Conspecific 15/13 0.733 Mixed 18/14 0.639 S. lutescens 2019 Conspecific 69/7 0.616 -0.159 ± 0.158 -1.005 0.315 Mixed 73/7 0.616 2021 Conspecific 23/19 0.728 Mixed 23/18 0.609 Hybrid offspring and hybrid offspring fertility The nrDNA alleles of the all pollen recipients we used for the mixed pollination were homozygous and species specific, as shown in Table 1 . Of the 20 seedlings obtained from S. japonica and the 44 seedlings obtained from S. lutescens following mixed pollination, 5 (25%) and 22 (50%), respectively, were identified as hybrids because they were heterozygous in polymorphic loci in the nrDNA region (Type C/D in Table 3 ). Table 3 Polymorphic sites recognized in Salvia japonica and S. lutescens . Number of polymorphic sites in the ycf1-ycf15 (cpDNA) region Haplotype 89 90 200 228 268 Type A A G A T C Type B C T G G A Number of polymorphic sites in the nrDNA internal transcribed spacer (ITS) region Genotype 447 461 464 490 515 580 Type C A C C G G C Type D G T T A A T Type C/D G/A T/C T/C A/G A/G T/C Type C/D' A/G C C/T G/A G C Sixteen of the hybrid offspring flowered in 2021, but the proportion of pollen grains with the normal ellipsoid shape in the hybrids was significantly lower than in the pure species (Fig. 5 ; GLMM, hybrid coefficient ± SE = − 5.40 ± 0.24, Z = − 22.31, P < 0.001) and their seed set was lower as well (Fig. 6 ; GLMM: hybrid coefficient ± SE = − 3.44 ± 0.44, Z = − 7.77, P < 0.001 for seed set following pollination with S. japonica ; hybrid coefficient ± SE = − 3.16 ± 0.34, Z = − 9.20, P < 0.001 for seed set following pollination with S. lutescens ), than seed set of pure S. japonica or S. lutescens offspring. cpDNA haplotyping and ITS genotyping The cpDNA and nrDNA datasets of 219 individuals (i.e. 88 S. japonica and 131 S. lutescens individuals) contained 480 and 640 base pairs, respectively, after alignment. The sequences of all haplotypes and genotypes have been deposited in EMBL/GenBank/DDBJ (Accession Nos. LC744806–LC744811). We identified two cpDNA haplotypes, tentatively named types A and B, and four nrDNA genotypes, types C, D, C/D, and C/D’. In cpDNA, five nucleotide substitutions were found between types A and B, and in nrDNA, six nucleotide substitutions were found between types C and D (Table 3 ). Sequences of types A and C and those of types B and D were confirmed to be identical to the sequences of S. japonica and S. lutescens recognized in Takano ( 2017 ) (compare Tables 1 and 3 ). In the nrDNA results, types C/D and C/D’ were heterozygous at polymorphic sites (Table 3 ). The number of individuals of each species from which we were able to obtain haplotypes and genotypes is shown in Table 4 . As we explained in the Materials and Methods, we found only S. lutescens at Mt. Higane, Kintoki, and Sudogawa during our field surveys, although the specimen data for the museum collections indicated that both species were present at these sites. Table 4 Species presence determined from specimen data, number of individuals of each species found by field survey, and cpDNA haplotypes and ITS genotypes found by molecular analysis of Salvia japonica and S. lutescens . S. japonica S. lutescens Putative hybrids Locality Specimen cpDNA ITS Specimen cpDNA ITS Chloroplast ITS n Haplotypes n Genotypes n Haplotypes n Genotypes n Genotypes n Genotypes HS Present 26 A 24 C, C/D Present 29 A, B 29 D 2 B 2 C, C/D OY Present 24 A, B 24 C Present 24 A, B 24 C 4 A, B 4 C Mt. Mikuni Present 3 A 3 C Present 11 A 11 D - - Mt. Higane Present - - - - Present 14 A, B 14 D - - Kintoki Present - - - - Present 15 A, B 15 D - - Sudogawa Present - - - - Present 13 A 12 D, C/D' - - SO1 Absent - - - - Present 30 B 30 D - - SO2 Present 10 A 10 C Absent - - - - - - SA Present 11 A 13 C Absent - - - - - - Mt. Kasagatake Present 7 A 7 C Absent - - - - - - Miyazaki Present 10 A 9 C Absent - - - - - - The haplotypes and genotypes recognized in each locality are summarized in Table 4 , and the distributions of haplotypes and genotypes among the sites are shown in Figs. 7 and 8 , respectively. Among cpDNA haplotypes, all examined S. japonica individuals, except for six specimens from OY, had the type A haplotype (Fig. 7 A), whereas at several localities, S. lutescens specimens with both type A and type B haplotypes were found (Fig. 7 B). Among nrDNA genotypes, all examined S. japonica individuals, except for two specimens from HS, had the type C genotype in the ITS region (Fig. 8 A). The two exceptions had the type C/D genotype, in which all polymorphic sites were heterozygous with type C and type D alleles (Table 3 ). All examined S. lutescens individuals, except for the specimens from OY and three specimens from Sudogawa, had the type D genotype (Fig. 8 B). All of the OY specimens had the type C genotype, which is the typical S. japonica genotype. The three exceptions from Sudogawa had the type C/D’ genotype, in which some of the polymorphic sites were heterozygous with type C and type D alleles and the others were homozygous with type C alleles (Table 3 ). Among the putative hybrid specimens, the cpDNA of the two specimens from HS and of two of the four specimens from OY had the type B haplotype, which was the typical S. lutescens haplotype (Fig. 7 B), and their ITS regions of nrDNA had the type C genotype, which was the typical S. japonica genotype, or the C/D genotype (Fig. 8 B). Assessment of genetic structure by MIG-seq The total number of reads for all 107 samples following quality control on the raw MIG-seq data was 11,441,713, and the average number of reads per sample was 106,932. After filtering, 147 unlinked SNPs (missing rate, 0.09) were selected and used for Bayesian clustering (STRUCTURE) analyses. Two clusters were recognized with posterior probabilities of > 0.99 that matched morphologically identified S. japonica and S. lutescens , except for the two putative hybrids at HS (Fig. 9 ). This result suggests that the two putative hybrids at HS, but not the four putative hybrids at OY, had indeed resulted from recent hybridization between the species. The two hybrids at HS were growing side by side in an area where S. lutescens was also growing and about 25 m away from the nearest S. lutescens individuals (Fig. 2 ). One hybrid appeared to be genetically closer to S. japonica , whereas the other was genetically closer to S. lutescens . Discussion According to our field survey, the two closely related Salvia species, S. japonica and S. lutescens , appear at present to be free of adverse effect from the other species on their reproduction in the wild populations. Our hand-pollination results, however, showed that reproductive interference can occur between the two species: Pollen from the counterpart species could reduce seed set and lead to hybridization producing offspring with significantly low fertility. The cpDNA haplotyping and nrDNA genotyping results suggested that the two species might have a history of hybridization, and our MIG-seq analysis results detected hybrids between the two species. The number of studies focusing on plants that may be involved in reproductive interference has been increasing (e.g. Brown and Mitchell, 2001 ; Burgess et al., 2008 ; Takakura et al., 2009 ; Takakura and Fujii, 2010 ; Briscoe Runquist and Stanton, 2013 ; Eaton et al., 2012 ; Tokuda et al., 2015 ; Katsuhara and Ushimaru, 2019 ), and some have used molecular methods to investigate whether any plants were hybrids (e.g. Fukatsu et al., 2019 , Takemori et al., 2019 ; Nishida et al., 2020 ; Fei et al., 2020). However, to the best of our knowledge, no previous study has investigated the current genetic structure of populations to reveal the current state of species interaction in terms of reproductive interference, as we have done here, by the MIG-seq analysis. Moreover, our study may to be one of only few that have investigated the possibility of reproductive interference between native wild plants through fieldwork, experiments, and genotyping using different regions of DNA and genome-wide SNPs. Our field survey results showed that seed set after natural pollination (open pollination under natural conditions) was often higher than that after conspecific hand-pollination, whether the two species coexisted (HS, OY) or not (SA, SO1) (Fig. 3 ). Reasons for the relatively lower seed set after conspecific hand-pollination could be that artificial hand-pollination damaged the flowers and/or that natural pollinators visited the flowers frequently and transported pollen to the flowers more efficiently at some study sites. Considering that in three out of six experiments there was no significant difference between the results after hand-pollination and natural pollination, and that the difference was usually marginal, except for S. lutescens at OY, it is unlikely that hand-pollination caused damage to the flowers, but more likely that natural pollinators were more frequent and efficient at some study sites. The results indicate that neither pollen limitation nor conspecific pollen loss are substantial. Pollen limitation and conspecific pollen loss can be caused by competition for pollinator services, for example, if pollinators are attracted by the other plant species and visit the focal plant species less frequently, or if conspecific pollen is wasted on the flowers of the other species, thereby reducing the reproductive success of the focal plant species (Waser, 1978 ; Mitchell et al., 2009 ; Moreira-Hernández and Muchhala, 2019 ). Considering our results, we inferred that negative interactions between the two species were not at present affecting their seed set. However, how the separated small-scale distributions of the two species were realized in regions where they co-occur requires explanation (see maps of HS and OY in Fig. 2 ). At OY, for example, we observed no particular differences between the two species with respect to the altitude or riparian condition of their habitats that could explain their segregation into small patches. In a theoretical study on reproductive interference and niche specialization, Nishida et al. ( 2015 ) proposed that under moderate reproductive interference, some habitat segregation or niche specialization between members of a species pair can be expected, whereas under negligible reproductive interference, the two species might coexist locally. Our results from the hand-pollination experiments (Fig. 4 ) and in the examination of the hybrids (Figs. 5 , 6 ) suggest that some level of reproductive interference, although not detected in the field observations, may have led to their separated distributions at small scale. According to our results, both species may suffer from bidirectional reproductive interference through reductions of seed set or severe interspecific ovule discounting through the production of infertile hybrids. Ovule discounting (i.e. a reduction in fecundity when hybrid fertilization usurps ovules that would otherwise give rise to non-hybrid (conspecific) offspring; Levin, Francisco-Ortega and Jansen, 1996; Burgess and Husband, 2006 ), is an important mechanism of reproductive interference (Mitchell et al., 2009 ). In the future, other possible reasons, such as resource competition, for the separated distributions should be investigated. It should be noted that our hand-pollination experiments did not perfectly replicate pollination occurring under natural conditions, because insect pollinators were not involved in our experiments. For example, if pollen from two species is deposited on distinctly separate parts of the pollinator’s body in a manner that prevents contact with the heterospecific stigma, mixed pollination may not occur between some Salvia species pairs (Claßen-Bockhoff et al., 2004 ). If this prezygotic isolation mechanism functions in the two studied species, the adverse effects of reproductive interference would be overestimated by our experiments. However, the pollinators of both S. japonica and S. lutescens are mainly small bees and hoverflies, and on these pollinators, pollen is not deposited on separate parts of their bodies as it is for larger pollinators such as bumblebees, hummingbirds, and bats (Y. Watanabe, A. Takano, S. Nishida, personal observations). Also, lever-like stamens, which are a key factor in the mechanical isolation of some sympatric Salvia species (Claßen-Bockhoff et al., 2004 ), are absent in the two studied species. Therefore, we suggest that a prezygotic isolation mechanism is unlikely in these species, so the results of our experiments are relevant for evaluating the possibility of reproductive interference between them. In the future, however, experiments with native pollinators should be conducted to examine whether a prezygotic isolation mechanism exists in the studied species. Our cpDNA haplotyping and nrDNA genotyping results suggest that hybridization may have occurred (Figs. 7 , 8 ). We cannot exclude the possibility that these findings might be caused by polymorphic haplotypes or genotypes originally harbored by each species, especially in the case of S. lutescens . However, insofar as each species had only one haplotype/genotype in those localities where it was the only species found, we can reasonably infer that when a haplotype or genotype typical of the counterpart species occurs in the focal species, it indicates some hybridization between the two species. The STRUCTURE results also showed evidence of hybridization between the species. The two putative hybrids at HS probably resulted from a recent hybridization event (Fig. 9 ). This result indicates that some hybridization and backcrossing has occurred between the two species, supporting our inference from our cpDNA haplotyping and nrDNA genotyping results that hybridization may have occurred between these species. However, apart from these two hybrids, the STRUCTURE results indicated clear genetic differentiation between the two species (Fig. 9 ). The markedly low fertility of the hybrids in our experiments suggests that even if hybridization occurs occasionally and the hybrids continue to hybridize with both parent species, no offspring might be found. This result is consistent with our inference that the two species may not coexist for a long time within a patch, despite a history of encounter and interaction between the species in regions where they are co-distributed. Recently, Kriebel et al. ( 2019 ) and Rose et al. ( 2021 ) sought to reveal the complicated evolutionary history of Salvia species using Anchored Hybrid Enrichment, a DNA sequencing method designed to recover hundreds of unique orthologous loci (i.e., single copy, phylogenetically informative markers) from across the genome and resolve both shallow and deep-scale evolutionary relationships within non-model systems (Lemon et al., 2012; Hamilton et al., 2016 ). Kriebel et al. ( 2019 ), who used a chronogram developed from a super-matrix of genomic data that targeted sequence data from over 500 of the nearly 1000 Salvia species, suggested that multiple dispersals of the genus, including S. japonica and S. lutescens , likely occurred from mainland East Asia to Japan in the Pliocene. Rose et al. ( 2021 ) examined data from 179 Salvia species retrieved by Kriebel et al. ( 2019 ) and quantified the discordance among plastid and nuclear ribosomal loci to investigate whether the discordance could be explained by incomplete lineage sorting or by horizontal gene flow via hybridization and introgression. The results of their multiple analyses suggested that incomplete lineage sorting could not fully explain the observed gene tree discordance, although they could not exclude the possibility of error in the gene tree estimation; thus, horizontal gene flow through hybridization and introgression most likely has influenced both the deep and more recent history of Salvia . Considering the findings of Kriebel et al. ( 2019 ) and Rose et al. ( 2021 ), we think it is reasonable to infer that multiple migrations in the biogeographical history of Japanese Salvia species may have led reproductive interference through hybridization between S. japonica and S. lutescens at some time in the past. However, further biogeographical analysis with more samples is needed to reconstruct the detailed history of encounters and interactions between these species. In Salvia , a genus famous for its diversity in flower morphology and adaptation to various pollinators (Claßen-Bockhoff et al., 2004 ), our results showed a possible negative interaction mediated by shared pollinators. Given the species richness of Salvia and the wide variation in pollination mechanisms that have been documented for the genus, a number of interesting studies on pollinator syndromes in Salvia have recently appeared (e.g. Celep et al., 2020 ; Wester et al., 2020 ). Our study, by calling attention to negative interactions, provides an additional perspective on the development of diversity in this genus. Declarations Acknowledgements We are deeply grateful to Ms. Natsuko Yoshino for cultivating our samples at Nagoya University Botanical Garden. We also thank Mr. Ichiro Yamazumi, Mr. Tetsuya Nishimura and Mr. Yuta Watanabe for their assistance in our field survey. Dr. Ayumi Matsuo provided preliminary MIG-seq analysis data and informative suggestions, and two anonymous reviewers provided valuable comments to improve our manuscript. We are deeply grateful to them. Funding This work was supported by JSPS KAKENHI Grant Number JP20K06783 to S.N., JP26440227 to A.T., and JP20K06833 and JP23K05912 to S.K. The New Technology Development Foundation also supported A.T. in this study. Conflict of interest The authors declare that they have no conflict of interest. References Bolger AM, Lohse M, Usadel B (2014) Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 30:2114–2120. Briscoe Runquist R, Stanton ML (2013) Asymmetric and frequency dependent pollinator-mediated interactions may influence competitive displacement in two vernal pool plants. Ecol Lett 16:183–190 Brown BJ, Mitchell RJ (2001) Competition for pollination: effects of pollen of an invasive plant on seed set of a native congener. Oecologia 129:43–49. Burgess KS, Husband BC (2006) Habitat differentiation and the ecological costs of hybridization: the effects of introduced mulberry ( Morus alba ) on a native congener ( M. rubra ). J Ecol 94:1061–1069. Burgess KS, Morgan M, Husband BC (2008) Interspecific seed discounting and the fertility cost of hybridization in an endangered species. New Phytol 177:276–284. Celep F, Atalay Z, Dikmen F, Doğan M, Sytsma KJ, Claßen-Bockhoff R (2020) Pollination ecology, specialization, and genetic isolation in sympatric bee-pollinated Salvia (Lamiaceae). Int J Plant Sci 181:800–811. Claßen-Bockhoff R, Speck T, Tweraser E, Wester P, Thimm S, Reith M (2004) The staminal lever mechanism in Salvia L. (Lamiaceae): a key innovation for adaptive radiation? Org Divers Evol 4:189–205. DeBach P (1966) The competitive displacement and coexistence principles. Ann Rev Entomol 11:183–212. Doyle JJ, Doyle D (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19:11–15. Drew B, Sytsma KJ (2011) Testing the monophyly and placement of Lepechinia in the tribe Mentheae (Lamiaceae). Syst Bot 36:1038–1049. Eaton DAR, Fenster CB, Hereford J, Huang SQ, Ree RH (2012) Floral diversity and community structure in Pedicularis (Orobanchaceae). Ecology 93:S182–S194. Eaton DAR, Overcast I (2020) ipyrad: Interactive assembly and analysis of RADseq datasets. Bioinformatics 36:2592–2594. Fei CH, Tang SS, Shang SH, Dai J, Wang XY, Wang S, Liu WQ, Wang XF (2022) Conspecific pollen advantage mediated by the extragynoecial compitum and its potential to resist interspecific reproductive interference between two Sagittaria species. Front Ecol Evol 13. doi:10.3389/fpls.2022.956193. Fukatsu M, Horie S, Maki M, Dohzono I (2019) Hybridization, coexistence, and possible reproductive interference between native Oxalis corniculata and alien O. dillenii in Japan. Plant Syst and Evol 305:127–137. Funamoto T, Zushi M, Harana T, Nakamura T (2000) Comparative karyomorphology of the Japanese species of Salvia L. (Lamiaceae). Journ Phytogeogr Taxon 48:11–18. Gröning J, Hochkirch A (2008) Reproductive interference between animal species. Q Rev Biol 83:257–282. Hamilton CA, Lemmon AR, Lemmon EM, Bond JE (2016) Expanding anchored hybrid enrichment to resolve both deep and shallow relationships within the spider tree of life. BMC Evol Biol 16:212. Haque MdS, Ghoshal KK (1981) Floral biology and breeding system in the genus Salvia L. Proc Indian National Sci Acad 47:716–724. Hu G-X, Takano A, Drew BT, Liu ED, Soltis DE, Soltis PS, Peng H, Xiang C-L (2018) Phylogeny and staminal evolution of Salvia (Lamiaceae, Nepetoideae) in East Asia Ann Bot 122:649–668. Huang ZH, Liu HL, Huan SQ. 2015. Interspecific pollen transfer between two coflowering species was minimized by bumblebee fidelity and differential pollen placement on the bumblebee body. J Plant Ecol 8:109–115 Katsuhara KR, Ushimaru A (2019) Prior selfing can mitigate the negative effects of mutual reproductive interference between coexisting congeners. Funct Ecol 33:1504-1513. Kriebel R, Drew BT, Drummond CP, González-Gallegos JG, Celep F, Mahdjoub MM, Rose JP, Xiang CL, Hu GX, Walker JB, Lemmon EM, Lemmon AR (2019) Tracking temporal shifts in area, biomes, and pollinators in the radiation of Salvia (sages) across continents: leveraging anchored hybrid enrichment and targeted sequence data. Am J Bot 106:573–597. Kuno E (1992) Competitive exclusion through reproductive interference. Popul Ecol 34:275–284. Kyogoku D (2015) Reproductive interference: ecological and evolutionary consequences of interspecific promiscuity. Popul Ecol 57:253–260. Lemmon AR, Emme SA, Lemmon EM (2012) Anchored hybrid enrichment for massively high-throughput phylogenomics. Syst Biol 61:727–744. Levin DA, Fransisco-Ortega J, Jansen RK (1996) Hybridization and the extinction of rare plant species. Conserv Biol 10: 10–16. Mitchell RJ, Flanagan RJ, Brown BJ, Waser NM, Karron JD (2009) New frontiers in competition for pollination. Ann Bot 103:1403–1413. Miyajima D (2001) Floral variation and its effect on self-pollination in Salvia splendens . J Hortic Sci Biotechnol 76:187-194. Moreira-Hernández JI, Muchhala N (2019) Importance of pollinator-mediated interspecific pollen transfer for angiosperm evolution. Ann Rev Ecol Evol Syst 50:191–217. Muchhala N, Thomson JD (2012) Interspecific competition in pollination systems: costs to male fitness via pollen misplacement. Funct Ecol 26:476–482. Murata, G, Yamazaki T (1993) Salvia L. In: Iwatsuki, K, T. Yamazaki T, Boufford DE, Ohba H. eds. Flora of Japan IIIa. Kodansha, Tokyo, Japan, pp 302−307. Nishida S, Takakura KI, Naiki A, Nishida T (2020) Habitat partitioning in native Geranium species through reproductive interference. Ann Bot 125:651–661. Nishida T, Takakura KI, Iwao K (2015) Host specialization by reproductive interference between closely related herbivorous insects. Popul Ecol 57:273–281. Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155:945-959. Ponisio LC, Valdovinos FS, Allhoff KT, Gaiarsa MP, Barner A, Guimarães Jr. PR, Hembry DH, Morrison B, Gillespie R (2019) A network perspective for community assembly. Front Ecol Evol 7. doi:10.3389/fevo.2019.00103. R Core Team (2018) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. Ribeiro JMC, Spielman A (1986) The Satyr effect: a model predicting parapatry and species extinction. Am Nat 128:513–528. Rivas LR (1964) A reinterpretation of the concept “sympatric” and “allopatric” with proposal of the additional terms “syntopic” and “allotopic”. Syst Zool 13:42–43. Rose JP, Kriebel R, Kahan L, DiNicola A, González-Gallegos JG, Celep F, Lemmon EM, Lemmon AR, Sytsma KJ, Drew BT (2021) Sage insights into the phylogeny of Salvia : Dealing with sources of discordance within and across genomes. Front Plant Sci 12:767–478. Suyama Y, Matsuki Y (2015) MIG-seq: an effective PCR-based method for genome-wide single-nucleotide polymorphism genotyping using the next-generation sequencing platform. Sci Rep 5:16963 | DOI: 10.1038/srep16963. Suyama Y, Hirota SK, Matsuo A, Tsunamoto Y, Mitsuyuki C, Shimura A, Okano, K (2022) Complementary combination of multiplex high-throughput DNA sequencing for molecular phylogeny. Ecol Res 37:171–181. Takakura K-I, Fujii S (2010) Reproductive interference and salinity tolerance differentiate habitat use between two alien cockleburs: Xanthium occidentale and X. italicum (Compositae). Plant Ecol 206:309–319. Takakura KI, Nishida T, Matsumoto T, Nishida S (2009) Alien dandelion reduces the seed set of a native congener through frequency dependent and one-sided effects. Biol Invasions 11:973–981. Takakura KI, Matsumoto T, Nishida T, Nishida S (2011) Effective range of reproductive interference exerted by an alien dandelion, Taraxacum officinale , on a native congener. J Plant Res 124:269–276. Takano A (2017) Taxonomic study on Japanese Salvia (Lamiaceae): Phylogenetic position of S. akiensis , and polyphyletic nature of S. lutescens var. intermedia . PhytoKeys 80:87–104. Takano A, Okada H (2011) Phylogenetic relationships among subgenera, species, and varieties of Japanese Salvia L. (Lamiaceae). J Plant Res 124:245–252. Takemori A, Naiki A, Takakura KI, Kanaoka MM, Nishida S (2019) Comparison of mechanisms of reproductive interference in Taraxacum. Ann Bot 123:1017–1027. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680. Tokuda N, Hattori M, Abe K, Shinohara Y, Nagano Y, Itino T (2015) Demonstration of pollinator‐mediated competition between two native Impatiens species, Impatiens noli ‐ tangere and I. textori (Balsaminaceae). Ecol Evol 5:1271–1277. Tong ZY, Huang SQ (2016) Pre- and post-pollination interaction between six co-flowering Pedicularis species via heterospecific pollen transfer. New Phytol 211:1452–1461. Waser NM (1978) Interspecific pollen transfer and competition between co-occurring plant species. Oecologia 36:223–236. Wester P, Cairampoma L, Haag S, Schramme J, Neumeyer C, Claßen-Bockhoff R (2020) Bee exclusion in bird-pollinated Salvia flowers: the role of flower color versus flower construction. Int J Plant Sci 181:770–786. White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ. eds. PCR protocols: a guide to methods and amplifications.: Academic Press, San Diego, US, pp 315–312. Wolfinger R, O’Connell M (1993) Generalized linear mixed models: a pseudolikelihood approach. J Stat Comput Simul 4: 233–243. Yonekura K (2017) Lamiaceae. In: Ohashi H, Kadota Y, Kihara H, Murata J, Yonekura K, eds. Wildflowers of Japan. Vol. 5 . Heibonsha, Tokyo, Japan, pp 101–143. Yoshimura J, Clark CW (1994) Population dynamics of sexual and resource competition. Theor Popul Biol 45:121–131. Cite Share Download PDF Status: Published Journal Publication published 30 Aug, 2024 Read the published version in Journal of Plant Research → Version 1 posted Editorial decision: Accept but needs final editing 30 Jul, 2024 Reviewers agreed at journal 04 Mar, 2024 Reviewers invited by journal 04 Mar, 2024 Editor assigned by journal 04 Mar, 2024 First submitted to journal 29 Feb, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3998530","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":276372763,"identity":"df11da04-ac85-4865-b2d2-48fb21c8bcc5","order_by":0,"name":"Sachiko Nishida","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABEUlEQVRIie3QPUvDQBjA8ec4uCxX5+uS+BEuBFpd8lkuZOggQacuxioIGTsH9EOck7gFAslSmjVjQMgmOAWn4tNCB7WJuoncn9uO33MvACbTX4wCA8XA/rpDboaJ9wsCSHAF/fufm1pW2zRzf/YozhS9iK9sWWZMQOwDvTs85vSWT6Vah9FTGmmaFqUnVwpJEQK5zw4SmXMmgoRGukbCWRHo7LwTwDIgqeohVovkeiZ3ZIOkavCUzRCBCZJc7cgoiQNd48VIMkT4RKh16erVi85Hy8wb1w09CZYh731LVbbjt/mlI8vo4Zl3C/uoUqR+7Xzb7fmxD+HUHI63s/FK3E2/F9sW4OxnO+JnxGQymf5973l1Xv8tp4eSAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-1959-0114","institution":"Nagoya Daigaku","correspondingAuthor":true,"prefix":"","firstName":"Sachiko","middleName":"","lastName":"Nishida","suffix":""},{"id":276372764,"identity":"ae60d19f-a45b-447a-807d-79c75dffd2d1","order_by":1,"name":"Atsuko Takano","email":"","orcid":"","institution":"University of Hyogo: Hyogo Kenritsu Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Atsuko","middleName":"","lastName":"Takano","suffix":""},{"id":276372765,"identity":"17db64e5-b869-460c-84ea-7363a5170f27","order_by":2,"name":"Yoshihisa Suyama","email":"","orcid":"","institution":"Tohoku University: Tohoku Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Yoshihisa","middleName":"","lastName":"Suyama","suffix":""},{"id":276372766,"identity":"45a38d2f-215e-435d-96ad-9b7e94fb1f75","order_by":3,"name":"Satoshi Kakishima","email":"","orcid":"","institution":"Showa University: Showa Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Satoshi","middleName":"","lastName":"Kakishima","suffix":""}],"badges":[],"createdAt":"2024-02-29 04:47:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3998530/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3998530/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10265-024-01577-6","type":"published","date":"2024-08-30T15:57:44+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":52127464,"identity":"5c484fdf-2aaf-4782-87f7-0e450578034b","added_by":"auto","created_at":"2024-03-07 07:08:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":385404,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"SalviaFigure1revised202402161.png","url":"https://assets-eu.researchsquare.com/files/rs-3998530/v1/fc010239589d4773563fc10d.png"},{"id":52127159,"identity":"f05f5f52-97e0-4b46-abae-484524301a72","added_by":"auto","created_at":"2024-03-07 07:00:53","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":333357,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"SalviaFigure21.png","url":"https://assets-eu.researchsquare.com/files/rs-3998530/v1/89aff8d96b7d8ce04ae2c654.png"},{"id":52127024,"identity":"ff958278-a723-4a1e-80a5-c370a146fc89","added_by":"auto","created_at":"2024-03-07 06:52:53","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":39006,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"SalviaFigure031.png","url":"https://assets-eu.researchsquare.com/files/rs-3998530/v1/18a76298ada059362fbf6448.png"},{"id":52127022,"identity":"57d8890b-a26e-4e8e-9a8c-9671237cdf25","added_by":"auto","created_at":"2024-03-07 06:52:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":21666,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"SalviaFigure41.png","url":"https://assets-eu.researchsquare.com/files/rs-3998530/v1/9aea5070ffadaed742096615.png"},{"id":52127157,"identity":"0d63e3ac-6465-4b67-812d-59f0676a5242","added_by":"auto","created_at":"2024-03-07 07:00:53","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":12359,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"SalviaFigure51.png","url":"https://assets-eu.researchsquare.com/files/rs-3998530/v1/02ca03b1a53856f31ba6e6dd.png"},{"id":52127025,"identity":"11e905b3-1bea-4d4f-bf03-d49aef2e2335","added_by":"auto","created_at":"2024-03-07 06:52:53","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":17029,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"SalviaFigure61.png","url":"https://assets-eu.researchsquare.com/files/rs-3998530/v1/d449303ae5e825bd69ffcedb.png"},{"id":52127028,"identity":"9b45e376-ce6b-4e43-a3fc-77e01135141a","added_by":"auto","created_at":"2024-03-07 06:52:53","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":103796,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"SalviaFigure71.png","url":"https://assets-eu.researchsquare.com/files/rs-3998530/v1/3c3c57f13e97ea28f10ee84a.png"},{"id":52127026,"identity":"2942f0c7-46bf-4afa-80f7-63bd9bcc1302","added_by":"auto","created_at":"2024-03-07 06:52:53","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":101890,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"SalviaFigure81.png","url":"https://assets-eu.researchsquare.com/files/rs-3998530/v1/1a0e4c9fd0c316623fb24748.png"},{"id":52127029,"identity":"468fa070-e163-445c-beaf-fbf451cb41b1","added_by":"auto","created_at":"2024-03-07 06:52:53","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":29106,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"SalviaFigure91.png","url":"https://assets-eu.researchsquare.com/files/rs-3998530/v1/3d72d92f65eed6759295defe.png"},{"id":63821054,"identity":"8a922263-f46d-466e-9dde-274fb2b0b8b1","added_by":"auto","created_at":"2024-09-02 16:11:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1866358,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3998530/v1/bb07d2c8-2dbf-484a-b4a6-7692fea29e01.pdf"}],"financialInterests":"","formattedTitle":"Detection of reproductive interference between closely related Salvia species with small-scale separated distributions by multifaceted pollination and molecular analyses","fulltext":[{"header":"Introduction","content":"\u003cp\u003eReproductive interference, defined as a negative effect of interspecific sexual interactions on the fitness of either species, is one such negative interaction (Gr\u0026ouml;ning and Hochkirch, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), and it is considered to be a pivotal factor influencing population dynamics, especially between closely related species (Kyogoku, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Theoretically, two species that exert strong reproductive interference can achieve exclusive distributions locally (Ribeiro and Spielman, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e1986\u003c/span\u003e; Kuno, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e1992\u003c/span\u003e; Yoshimura and Clark, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e1994\u003c/span\u003e; Nishida et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) because the species that is less abundant in a locality would suffer from severe interference and produce fewer offspring than the dominant species; in turn, the offspring would suffer from further interference and produce even fewer offspring in the following generations, with the result that the less abundant species would eventually become extinct in the locality.\u003c/p\u003e \u003cp\u003eHybridization has been proposed as one of the main mechanisms of reproductive interference in plants (e.g. Mitchell et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2009\u003c/span\u003e), because hybridization can slow the growth rate of a population if hybrid seeds are produced at the expense of conspecific seeds (i.e. interspecific ovule discounting; Levin et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). Nishida et al. (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) have suggested that if hybrids occur in a region where only one of the parent plant species is present, we can infer that reproductive interference has led to the exclusion of one of the parent species, unless the hybrids were introduced to the region by a long-distance dispersal mechanism.\u003c/p\u003e \u003cp\u003eWith these considerations in mind, we focused here on a pair of wild \u003cem\u003eSalvia\u003c/em\u003e species that are distributed in overlapping areas, but which occur separately at small scale and investigated the possibility of reproductive interference between them. \u003cem\u003eSalvia japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e both belong to the subgenus \u003cem\u003eGlutinaria\u003c/em\u003e (Hu et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Among the seven species in the subgenus, only these two have overlapping distributions and flowering times in Japan (Takano and Okada, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). However, at small scale, their distributions do not overlap (i.e. they are allotopic; Rivas, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e1964\u003c/span\u003e), even when they grow along the same river systems or mountain trails (A. Takano and S. Nishida, pers. obs.; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Takano and Okada (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) previously suggested that the two species may hybridize, but no detailed study has evaluated this possibility or the possibility that hybridization might be a mechanism of reproductive interference between the two species.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn this study, we carried out fieldwork to investigate whether negative interspecific interactions are presently occurring between these two species, focusing in particular on the possibility of competition for pollinator services. We next conducted a series of hand-pollination experiments and evaluated possible effects of reproductive interference between the species, in particular, the effects of heterospecific pollen on seed set in the two species and on the fertility of offspring produced by hybridization between them. We then studied the two species genetically, using chloroplast DNA (cpDNA) haplotyping, nuclear ribosomal DNA (nrDNA) genotyping, and genome-wide DNA analyses by MIG-seq (multiplexed inter-simple sequence repeat genotyping by sequencing) (Suyama and Matsuki, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) to detect genetic relationships between them, including hybridization. Through these approaches, we aimed to answer the following questions: Are negative reproductive interactions currently occurring between these species, through hybridization or other mechanisms? Has reproductive interference, including by hybridization, occurred between the two species? Does the present observed small-scale segregation reflect reproductive interference between these two \u003cem\u003eSalvia\u003c/em\u003e species?\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy species\u003c/h2\u003e \u003cp\u003e \u003cem\u003eSalvia japonica\u003c/em\u003e Thunb. and \u003cem\u003eSalvia lutescens\u003c/em\u003e (Koidz.) Koidz. are herbs belonging to subgenus \u003cem\u003eGlutinaria\u003c/em\u003e of genus \u003cem\u003eSalvia\u003c/em\u003e, Lamiaceae (Hu et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In Japan, \u003cem\u003eS. japonica\u003c/em\u003e is a perennial distributed from Honshu to the Ryukyu Islands (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), and it is also found in Korea and China (Murata and Yamazaki, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e1993\u003c/span\u003e). \u003cem\u003eSalvia lutescens\u003c/em\u003e is also a perennial, but endemic to the islands of Honshu and Shikoku, Japan (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Both species have similar compound leaves and verticillaster inflorescences, but they differ in flower morphology: \u003cem\u003eS. japonica\u003c/em\u003e has stamens and styles only slightly longer than the upper corolla lip, whereas the stamens and styles of \u003cem\u003eS. lutescens\u003c/em\u003e are much longer than the upper corolla lip (Yonekura, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The chromosome number of both species is \u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;16 (Funamoto et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). Among the varieties of \u003cem\u003eS. lutescens\u003c/em\u003e, we focused on \u003cem\u003eS. lutescens\u003c/em\u003e var. \u003cem\u003eoccidentalis\u003c/em\u003e A. Takano in our field survey and hand-pollination experiments. This variety of \u003cem\u003eS. lutescens\u003c/em\u003e has deep purple (rarely white) flowers, whereas \u003cem\u003eS. japonica\u003c/em\u003e has pale purple flowers. Although in \u003cem\u003eS. japonica\u003c/em\u003e, anthesis is reported to last from July to November, and anthesis in \u003cem\u003eS. lutescens\u003c/em\u003e is reported to extend from June to August (Yonekura, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), at our study sites, anthesis in both species occurs from July to early September (A. Takano and S. Nishida, pers. obs.).\u003c/p\u003e \u003cp\u003eThe two species also share the same insect taxa as pollinators, mainly sweat bees (Halictidae) and hoverflies (\u003cem\u003eBetasyrphus\u003c/em\u003e and \u003cem\u003eBacchini\u003c/em\u003e). These three insect taxa accounted for 89.2% and 86.8% of the total number of pollinator individuals visiting \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e, respectively, during six observation days (20 July, 3, 8, 13, 27, and 30 August 2019; Y. Watanabe, A. Takano, and S. Nishida, unpublished). Although some \u003cem\u003eSalvia\u003c/em\u003e species have been reported to be self-compatible (e.g. Haque and Ghoshal, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e1981\u003c/span\u003e; Miyajima, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2001\u003c/span\u003e), the timing of the male and female stages and the flower structure of the two studied species appear to usually prevent self-pollination: pollen is released from the anthers 1 d before the stigma opens, and the anthers are about 3 mm away from the stigma when the stigma opens (S. Nishida, pers. obs.) Lever-like stamens, though often reported in \u003cem\u003eSalvia\u003c/em\u003e (Cla\u0026szlig;en-Bockhoff et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2004\u003c/span\u003e), are absent in \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eStudy area\u003c/h2\u003e \u003cp\u003eField surveys and cpDNA haplotyping, nrDNA genotyping, and MIG-seq-based single nucleotide polymorphism (SNP) analyses were conducted on populations inhabiting two localities: Sanda, Hyogo prefecture (HS: 35\u0026deg;00\u0026rsquo;34\u0026rdquo;N, 135\u0026deg;14\u0026rsquo;05\u0026rdquo;E), and Mt. Yamato-Katsuragi, Osaka prefecture (OY: 34\u0026deg;27\u0026rsquo;11\u0026rdquo;N, 135\u0026deg;40\u0026rsquo;14\u0026rdquo; E) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). At these two sites, both \u003cem\u003eSalvia\u003c/em\u003e species were present, but only in small, unmixed patches. The closest distance between individuals of different species was about 100 m at HS and 20 m at OY. All populations at HS and OY were found along rivers and at the edges of forests consisting of planted \u003cem\u003eCryptomeria\u003c/em\u003e and wild \u003cem\u003eQuercus\u003c/em\u003e trees.\u003c/p\u003e \u003cp\u003eTo investigate present negative interaction between the two species and for comparison with the populations at HS and OY, we conducted field surveys at Azuchi (SA: 35\u0026deg;09\u0026rsquo;06\u0026rdquo;N, 136\u0026deg;08\u0026rsquo;51\u0026rdquo;E) and Otsu (SO1: 35\u0026deg;09\u0026rsquo;34\u0026rdquo;N, 135\u0026deg;51\u0026rsquo;52\u0026rdquo;E), both in Shiga prefecture, as well as cpDNA haplotyping and nrDNA genotyping on each population. The population at SA consisted of only \u003cem\u003eS. japonica\u003c/em\u003e, and the population at SO1 consisted of only \u003cem\u003eS. lutescens\u003c/em\u003e. Another isolated population of \u003cem\u003eS. japonica\u003c/em\u003e at Otsu, Shiga prefecture (SO2: 35\u0026deg;09\u0026rsquo;15\u0026rdquo;N, 135\u0026deg;52\u0026rsquo;06\u0026rdquo;E), was only about 1.5 km away from the \u003cem\u003eS. lutescens\u003c/em\u003e population at SO1, but it was confined to a small patch along a road leading to a waste incineration plant. The waste incineration plant and road were built in 1987 or 1988, and we assumed that the \u003cem\u003eS. japonica\u003c/em\u003e population was introduced after the road was built. On the population at SO2, we performed only cpDNA haplotyping and nrDNA genotyping. We used seeds of \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e from SA and SO1, respectively, for our hand-pollination experiment and preliminary experiment on survival and conducted these experiments at the Nagoya University Museum Botanical Garden, Nagoya University (35\u0026deg;09ʹ12ʺN.136\u0026deg;57ʹ42ʺE). The garden is within the distributional range of both species, but they do not grow in wild at the garden.\u003c/p\u003e \u003cp\u003eWe also carried out cpDNA haplotyping and nrDNA genotyping at the following six sites: Miyakonojo, Miyazaki prefecture (31\u0026deg;45\u0026rsquo;39\u0026rdquo;N, 130\u0026deg;59\u0026rsquo;13\u0026rdquo;E), Mt. Kasagata, Hyogo prefecture (35\u0026deg;03\u0026rsquo;49\u0026rdquo;N, 134\u0026deg;50\u0026rsquo;49\u0026rdquo;E), Sudogawa, Shizuoka prefecture (35\u0026deg;11\u0026rsquo;43\u0026rdquo;N, 138\u0026deg;46\u0026rsquo;19\u0026rdquo;E), Kintoki, Kanagawa prefecture (35\u0026deg;16\u0026rsquo;48\u0026rdquo;N, 139\u0026deg;00\u0026rsquo;11\u0026rdquo;E), Mt. Mikuni, Shizuoka prefecture (35\u0026deg;13\u0026rsquo;44\u0026rdquo;N, 138\u0026deg;58\u0026rsquo;44\u0026rdquo;E), and Mt. Higane, Shizuoka prefecture (35\u0026deg;08\u0026rsquo;00\u0026rdquo;N, 139\u0026deg;03\u0026rsquo;31\u0026rdquo;E) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Among these localities, only \u003cem\u003eS. japonica\u003c/em\u003e was distributed at Miyakonojo and Mt. Kasagata, whereas both species were distributed at the other four localities, according to data of specimens in the collections of the Museum of Nature and Environmental History, Shizuoka, and the Kanagawa Prefectural Museum of Natural History (A. Takano, pers. obs.). In this study, however, although we found both species at Mt. Mikuni, we found only \u003cem\u003eS. lutescens\u003c/em\u003e at Mt. Higane, Kintoki, and Sudogawa.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eNegative interspecific interactions in the field\u003c/h2\u003e \u003cp\u003eOne critical pre-pollination factor that causes negative interspecific interactions is competition for pollinator services (Mitchell et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). To determine whether the two studied species suffered from pollen limitation as a result of competition for pollinator services between them or with other plants, we compared the seed set following natural pollination with the seed set following conspecific hand-pollination. If eighter of the species suffers from competition for pollinator services with the counterpart species, the seed set following natural pollination would be lower than that following conspecific hand-pollination especially at the site where both species were present (HS and OY). If they do not suffer from competition for pollinator services with the counterpart species, difference between the seed set following natural pollination and that following conspecific hand-pollination would be marginal. Seed set is the result of many factors, including some abiotic factors such as water, temperature, and nutrients. However, we tried to exclude most factors other than the pollination treatments from our consideration by comparing results under similar conditions within the same study sites. Surveys were conducted at HS in August 2016, at OY in August 2015, at SA in August 2019, and at SO1 in August 2019. In the case of the HS and OY populations, data of seed set following conspecific hand-pollination were collected in the field within each study site. In the case of the SA and SO1 populations, they were collected at the Nagoya University Museum Botanical Garden. At HS, SA, and SO1, we arbitrarily selected approximately 30 individuals of each species at each site and collected one or two fruits from each individual for the data of the natural pollination. At OY, we arbitrarily selected only about 10 individuals and collected about six fruits from each individual because the number of individuals with fruits was limited. The procedure for conspecific hand-pollination is described in the next section. We brought the mature fruits, still in the sepals, to the laboratory and counted the number of normally developed seeds and undeveloped ovules in each fruit. In both species, each flower has four ovules and each fruit has a maximum of four seeds. Normally developed seeds are brown and about 2 mm long, whereas undeveloped ovules are whitish and less than about 0.5 mm long; thus, they are easy to distinguish by eye. We calculated the seed set as the proportion of normally developed seeds relative to the total number of ovules. To statistically evaluate the differences in seed set between natural pollination and conspecific hand-pollination, we used a generalized linear mixed model (GLMM; Wolfinger and O\u0026rsquo;Connell, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e1993\u003c/span\u003e) with a binomial error structure and a logit link function. The response variable was normal seed development, and the explanatory variable was the pollination treatment. Individuals were incorporated as a random effect. The analysis was conducted with R version 3.5.2 software (R Core Team \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). We considered the effect to be significant if the \u003cem\u003eP\u003c/em\u003e value obtained by Wald test was less than 0.05.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eEffect of heterospecific pollen deposition\u003c/h2\u003e \u003cp\u003eWe conducted hand-pollination experiments to investigate the effect of pollen of the counterpart species on seed set and on hybridization. We used plants from the SA and SO1 populations of \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e, respectively, because in each these localities, only one of the two species was present. Therefore, we expected the plants in each of these populations to not have a history of interaction with the counterpart species. The experiment was carried out in September 2019 and July 2021 at the Nagoya University Museum Botanical Garden, where neither species occurs, to avoid the risk of genetic contamination by wild populations. In 2017, we collected seeds of \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. lutescen\u003c/em\u003es at SA and SO1, respectively, and planted each of the seeds in a pot with culture soil at the botanical garden. In 2019, we obtained 12 \u003cem\u003eS. japonica\u003c/em\u003e plants and 7 \u003cem\u003eS. lutescens\u003c/em\u003e plants with sufficient flowers for the experiments. We arbitrarily selected about 120 \u003cem\u003eS. japonica\u003c/em\u003e flowers and 140 \u003cem\u003eS. lutescens\u003c/em\u003e flowers and assigned them to one of two pollination treatments: conspecific pollination, in which the flowers received only pollen grains of their own species, and mixed pollination, in which the flowers received a mixture of pollen grains of their own and the counterpart species. To avoid unintended pollination by insect pollinators, we brought the plants into a shed next to the garden, where we applied the pollen, and kept them there until the next day, when all the flowers we used had finished flowering. Before each pollination treatment, we first confirmed that there were no pollen grains on the stigma. For pollen donors, we used plant individuals that were not siblings of the recipient plants. We picked up one of the donor stamens with tweezers and applied the donor pollen grains to the recipient stigma by gently brushing the stigma with the donor anther. In the mixed pollination, we applied the conspecific pollen first and the counterpart pollen immediately afterwards. In this way, we avoided overestimation of the effect of the heterospecific pollen on the stigma, which might occur if the counterpart pollen was applied before the conspecific pollen. We did not count the number of pollen grains transferred during each pollination, but we observed the similar number of pollen grains from each species on the stigma after each pollination treatment with a magnifying glass (pollen grains of the two species could be distinguished by their color).\u003c/p\u003e \u003cp\u003eWe carried out the same pollination experiments again in July 2021, using both the same plants and the offspring of the plants obtained in 2019 following conspecific pollination. In 2021, we used more individuals of each species (14 \u003cem\u003eS. japonica\u003c/em\u003e and 19 \u003cem\u003eS. lutescens\u003c/em\u003e) but fewer flowers (about 30 \u003cem\u003eS. japonica\u003c/em\u003e and 50 \u003cem\u003eS. lutescens\u003c/em\u003e) for the experiment compared with that in 2019. We followed the same procedure as in 2019 but avoided using not only siblings but also parent plants as pollen donors.\u003c/p\u003e \u003cp\u003eAbout 20 days after the hand-pollination in each year, we collected the resulting fruits, brought them to the laboratory, counted the number of normally developed seeds and undeveloped ovules in each fruit, and calculated the seed set. We analyzed the effect of mixed pollination on seed set using a GLMM with a binomial error structure and a logit link function. We analyzed the data in each year both independently and inclusively (i.e., both years together), because insufficient data were obtained in 2021 for independent analysis. In all analyses, the response variable was normal seed development, and the explanatory variable was the pollination treatment. Individual plants were incorporated as a random effect in the independent analyses, whereas they were nested within year before being incorporated as a random effect in the inclusive analyses. The analyses were conducted with R 3.5.2 software (R Core Team, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). We considered the effect to be significant when the \u003cem\u003eP\u003c/em\u003e value obtained by Wald test was less than 0.05.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eHybrid offspring and hybrid offspring fertility\u003c/h2\u003e \u003cp\u003eTo estimate the frequency of hybridization between the two species, we carried out nrDNA genotyping of the progeny obtained after mixed pollination. We collected all of the seeds obtained from the mixed pollination and sowed each seed in a pot of culture soil. Germination rates were low in both species (17.1% for \u003cem\u003eS. japonica\u003c/em\u003e and 14.0% for \u003cem\u003eS. lutescens\u003c/em\u003e) and did not differ significantly between the species (Fisher\u0026rsquo;s exact test, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.46, odds ratio\u0026thinsp;=\u0026thinsp;0.78). We obtained 20 \u003cem\u003eS. japonica\u003c/em\u003e seedlings and 44 \u003cem\u003eS. lutescens\u003c/em\u003e seedlings. We collected one leaf from each seedling, extracted DNA from the leaf, and amplified the internal transcribed spacer (ITS) regions. The procedures for DNA extraction, amplification, and sequencing are described below.\u003c/p\u003e \u003cp\u003eAmong those seedlings identified as hybrid, 16 individuals flowered in 2021. We first observed their pollen grains to determine the male fertility. We picked pollen grains from an anther with tweezers, placed them in a drop of distilled water on a concave slide, gently covered them with a cover glass, and observed them under the microscope. The pollen grains of the two species could be divided by their shape into ellipsoid and roundish types. Roundish-type pollen grains were usually less than two-thirds the length of the ellipsoid-type grains and did not stain with potassium iodide, whereas the ellipsoid pollen grains usually stained with potassium iodide (S. Nishida, pers. obs.). Considering the smaller size of the roundish-type grains and the fact that they did not stain with potassium iodide, we inferred that the roundish-type pollen grains had low fertility. We counted pollen grains of both types on each slide from the 16 hybrid individuals, 6 pure \u003cem\u003eS. japonica\u003c/em\u003e individuals, and 7 pure \u003cem\u003eS. lutescens\u003c/em\u003e individuals. We calculated the proportion of ellipsoid-type pollen grains to total pollen grains from the hybrid and pure species and analyzed the proportional difference between hybrid and pure individuals using a GLMM with a binomial error structure and a logit link function. In this analysis, the response variable was the pollen grain type and the explanatory variable was the plant type (hybrid or pure species). Individuals were incorporated as a random effect. The analysis was conducted with R version 3.5.2 software (R Core Team, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). We considered the effect to be significant when the \u003cem\u003eP\u003c/em\u003e value obtained by Wald test was less than 0.05.\u003c/p\u003e \u003cp\u003eTo determine female fertility, we hand-pollinated hybrid individuals. In July 2021, we arbitrarily selected a few whorls of flowers in the verticillaster-type inflorescences of the hybrids and assigned them to one of two pollination treatments: pollination with \u003cem\u003eS. japonica\u003c/em\u003e pollen and pollination with \u003cem\u003eS. lutescens\u003c/em\u003e pollen. The pollination procedure was the same as described above for conspecific pollination. About 20 days after the hand-pollination, we counted the number of normally developed seeds and undeveloped ovules in each fruit collected and calculated the seed set. We compared the results with the seed set data for the pure species following conspecific pollination (for details, see the previous section). We analyzed the difference in seed set between the hybrids and pure species using a GLMM with a binomial error structure and a logit link function. The response variable was normal seed development, and the explanatory variable was plant status (hybrid or pure species). Individuals were incorporated as a random effect. The analysis was conducted with R 3.5.2 software (R Core Team, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). We considered the effect to be significant when the \u003cem\u003eP\u003c/em\u003e value obtained by Wald test was less than 0.05.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003ecpDNA haplotyping, nrDNA genotyping, and assessment of genetic structure using MIG-seq\u003c/h2\u003e \u003cp\u003eTo detect the occurrence of hybridization, we performed cpDNA haplotyping and nrDNA genotyping of individuals of \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e and analyzed the genetic structure of the populations in which the two species coexisted using MIG-seq (Suyama and Matsuki, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eLeaf samples for cpDNA haplotyping and nrDNA genotyping were collected from all study sites (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), but leaf samples for MIG-seq were collected only from study sites HS and OY, where both species were distributed. Most of the individuals sampled at HS and OY were used for all three procedures, cpDNA haplotyping, nrDNA genotyping, and MIG-seq.\u0026nbsp;During sampling, we found two plants at HS and four plants at OY that appeared to be hybrids by their flower morphology, in particular, by their stamen length and petal color, which appeared to be intermediate between those of the two species. We provisionally called these plants putative hybrids.\u003c/p\u003e \u003cp\u003eWe extracted total genomic DNA from the dried sampled leaves using a modified version of the 2 \u0026times; cetyltrimethylammonium bromide (CTAB) extraction protocol of Doyle and Doyle (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1987\u003c/span\u003e). We amplified the \u003cem\u003eycf1\u0026ndash;ycf15\u003c/em\u003e region in plastid DNA using 5711f as the forward primer and rps15r as the reverse primer (Drew and Sytsma, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), and we amplified the nrDNA ITS region using ITS5 as the forward primer and ITS4 as the reverse primer (White et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e1990\u003c/span\u003e). The protocol and conditions for the polymerase chain reaction (PCR), purification, and cycle sequencing analyses followed Takano and Okada (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) and Takano (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Raw sequences were assembled and edited manually by using the BioEdit software (ver. 7.2.5; Hall, 1999). Multiple DNA sequences were aligned by using the multiple alignment method in the CLUSTALW 1.83 software package with default settings (Thompson et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). Gaps were deleted. For our genotyping, we used the sequences recognized by Takano (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) as usable for distinguishing between \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences usable for distinguishing between \u003cem\u003eSalvia japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e (extracted from Takano, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"6\" nameend=\"c7\" namest=\"c2\"\u003e \u003cp\u003ePolymorphic allele sites in the ycf1-ycf15 (cpDNA) region\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHaplotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e228\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e268\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS. lutescens\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c8\" namest=\"c2\"\u003e \u003cp\u003ePolymorphic allele sites in the nrDNA internal transcribed spacer (ITS) region\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e447\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e461\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e464\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e490\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e515\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e580\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS. lutescens\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eMIG-seq is a PCR-based procedure for constructing highly reduced representation libraries without restriction enzyme digestion steps that involves de novo SNP discovery and genotyping by next-generation sequencing (Suyama and Matsuki, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Suyama et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). For MIG-seq, we mostly used the same extracted DNA that we used for the DNA genotyping. From the DNA extracted from leaves collected from HS and OY, we used 26 and 24 \u003cem\u003eS. japonica\u003c/em\u003e samples, respectively, 29 and 24 \u003cem\u003eS. lutescens\u003c/em\u003e samples, respectively, and 2 and 4 putative hybrid samples, respectively. The MIG-seq library was prepared following Suyama and Matsuki (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Primer set 1 (Suyama and Matsuki, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) was used for the first PCR. The number of cycles for the first PCR was set to 25, as Suyama and Matsuki (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) proposed, but the annealing temperature was decreased from 48\u0026deg;C to 38\u0026deg;C to follow the procedure recommended by Suyama et al. (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The second PCR products were obtained by using the first PCR products as templates and were purified by using AMPure XP beads (Beckman Coulter, Brea CA, USA). Then, 300\u0026ndash;800-bp fragments were isolated by using the BluePippin system (Sage Science, Beverly, MA, USA). The final concentrations were measured with a Qubit 3.0 Fluorometer (Invitrogen, Carlsbad, CA, USA) and a 4200 TapeStation (Agilent, Santa Clara, CA, USA). The multiplexed library was sequenced by using an Illumina MiSeq Sequencer with MiSeq Reagent Kit v. 3 (150 cycles, Illumina, San Diego, CA, USA) and the dark cycle option, which skipped the first 17 bp of read 1 and the first 3 bp of read 2, following the original protocol (Suyama and Matsuki, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). As a result, we obtained 80-bp sequences from read 1 and 94-bp sequences from read 2. For quality control of the raw reads, the first 14 bp of read 2 were trimmed using the fastx trimmer program in the FASTX-Toolkit 0.0.14 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://hannonlab.cshl.edu/fastx_toolkit/\u003c/span\u003e\u003cspan address=\"http://hannonlab.cshl.edu/fastx_toolkit/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Then both reads 1 and 2 (80 bp each) were trimmed to remove the adapter sequences (GTCAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and CAGAGATCGGAAGAGCGTCGTGTAGGG AAAGA), the first five bases, the last base, and low-quality regions (quality value [QV]\u0026thinsp;\u0026lt;\u0026thinsp;15 in a four-base-wide sliding window); short reads (\u0026lt;\u0026thinsp;74 bases) were removed by using Trimmomatic ver. 0.39 software (Bolger et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Ipyrad ver. 0.9.90 software was used to assemble the reads and obtain SNP markers (Eaton and Overcast, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The depth of coverage was set to six, and the clustering threshold was set to 0.9. Other parameters were set to their default values. The individual-based genetic structure was estimated by using the STRUCTURE 2.3.4 program (Pritchard et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2000\u003c/span\u003e) in the ipyrad analysis toolkit. The sample coverage with the minimum number of SNPs was set to 0.8, and 20 independent Markov Chain Monte Carlo (MCMC) runs with 100,000 iterations were performed, following a burn-in period of 100,000 steps. The number of clusters (K) was set to two under the assumption that there were just two species.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eNegative interspecific interactions in the field\u003c/h2\u003e \u003cp\u003eThe seed set of the two \u003cem\u003eSalvia\u003c/em\u003e species under natural pollination was not significantly lower than that following conspecific hand-pollination at any study sites, whether the site harbored both species (HS and OY) or only one of the species (SA, SO1)(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eEffects of heterospecific pollen deposition\u003c/h2\u003e \u003cp\u003eIn 2019, seed set of \u003cem\u003eS. japonica\u003c/em\u003e following mixed pollination was about 22% lower than that following conspecific pollination, whereas seed set of \u003cem\u003eS. lutescens\u003c/em\u003e was almost the same after conspecific and mixed pollination (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In 2021, seed set of both \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e following mixed pollination was lower than seed set following conspecific pollination, but the adverse effect of mixed pollination was not significant in either species (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). When we analyzed the results for both years together, the effect was significant in \u003cem\u003eS. japonica\u003c/em\u003e, but not in \u003cem\u003eS. lutescens\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSeed set of \u003cem\u003eSalvia japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e following conspecific and mixed hand-pollination and GLMM analysis results for the effect of mixed pollination on seed set.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eYear\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003en\u003c/em\u003e (flowers/ individuals)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSeed set\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c8\" namest=\"c6\"\u003e \u003cp\u003eGLMM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCoefficient\u0026thinsp;\u0026plusmn;\u0026thinsp;s.e.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eZ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2019\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eConspecific\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e52/12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.510\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e-0.506\u0026thinsp;\u0026plusmn;\u0026thinsp;0.185\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e-2.733\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e0.006\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMixed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e66/12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.398\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2021\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eConspecific\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15/13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.733\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMixed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18/14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.639\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cem\u003eS. lutescens\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2019\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eConspecific\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e69/7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.616\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e-0.159\u0026thinsp;\u0026plusmn;\u0026thinsp;0.158\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e-1.005\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e0.315\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMixed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e73/7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.616\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2021\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eConspecific\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e23/19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.728\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMixed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e23/18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.609\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eHybrid offspring and hybrid offspring fertility\u003c/h2\u003e \u003cp\u003eThe nrDNA alleles of the all pollen recipients we used for the mixed pollination were homozygous and species specific, as shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Of the 20 seedlings obtained from \u003cem\u003eS. japonica\u003c/em\u003e and the 44 seedlings obtained from \u003cem\u003eS. lutescens\u003c/em\u003e following mixed pollination, 5 (25%) and 22 (50%), respectively, were identified as hybrids because they were heterozygous in polymorphic loci in the nrDNA region (Type C/D in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePolymorphic sites recognized in \u003cem\u003eSalvia japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"6\" nameend=\"c7\" namest=\"c2\"\u003e \u003cp\u003eNumber of polymorphic sites in the ycf1-ycf15 (cpDNA) region\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHaplotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e228\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e268\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eType A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eType B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c8\" namest=\"c2\"\u003e \u003cp\u003eNumber of polymorphic sites in the nrDNA internal transcribed spacer (ITS) region\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e447\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e461\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e464\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e490\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e515\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e580\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eType C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eType D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eType C/D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eT/C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eT/C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eA/G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eA/G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eT/C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eType C/D'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA/G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eC/T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eG/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eSixteen of the hybrid offspring flowered in 2021, but the proportion of pollen grains with the normal ellipsoid shape in the hybrids was significantly lower than in the pure species (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e; GLMM, hybrid coefficient\u0026thinsp;\u0026plusmn;\u0026thinsp;SE\u0026thinsp;=\u0026thinsp;\u0026minus;\u0026thinsp;5.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24, Z\u0026thinsp;=\u0026thinsp;\u0026minus;\u0026thinsp;22.31, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and their seed set was lower as well (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e; GLMM: hybrid coefficient\u0026thinsp;\u0026plusmn;\u0026thinsp;SE\u0026thinsp;=\u0026thinsp;\u0026minus;\u0026thinsp;3.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.44, Z\u0026thinsp;=\u0026thinsp;\u0026minus;\u0026thinsp;7.77, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for seed set following pollination with \u003cem\u003eS. japonica\u003c/em\u003e; hybrid coefficient\u0026thinsp;\u0026plusmn;\u0026thinsp;SE\u0026thinsp;=\u0026thinsp;\u0026minus;\u0026thinsp;3.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34, Z\u0026thinsp;=\u0026thinsp;\u0026minus;\u0026thinsp;9.20, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for seed set following pollination with \u003cem\u003eS. lutescens\u003c/em\u003e), than seed set of pure \u003cem\u003eS. japonica\u003c/em\u003e or \u003cem\u003eS. lutescens\u003c/em\u003e offspring.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ecpDNA haplotyping and ITS genotyping\u003c/h2\u003e \u003cp\u003eThe cpDNA and nrDNA datasets of 219 individuals (i.e. 88 \u003cem\u003eS. japonica\u003c/em\u003e and 131 \u003cem\u003eS. lutescens\u003c/em\u003e individuals) contained 480 and 640 base pairs, respectively, after alignment. The sequences of all haplotypes and genotypes have been deposited in EMBL/GenBank/DDBJ (Accession Nos. LC744806\u0026ndash;LC744811). We identified two cpDNA haplotypes, tentatively named types A and B, and four nrDNA genotypes, types C, D, C/D, and C/D\u0026rsquo;. In cpDNA, five nucleotide substitutions were found between types A and B, and in nrDNA, six nucleotide substitutions were found between types C and D (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Sequences of types A and C and those of types B and D were confirmed to be identical to the sequences of \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e recognized in Takano (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) (compare Tables\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In the nrDNA results, types C/D and C/D\u0026rsquo; were heterozygous at polymorphic sites (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The number of individuals of each species from which we were able to obtain haplotypes and genotypes is shown in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. As we explained in the Materials and Methods, we found only \u003cem\u003eS. lutescens\u003c/em\u003e at Mt. Higane, Kintoki, and Sudogawa during our field surveys, although the specimen data for the museum collections indicated that both species were present at these sites.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSpecies presence determined from specimen data, number of individuals of each species found by field survey, and cpDNA haplotypes and ITS genotypes found by molecular analysis of \u003cem\u003eSalvia japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"15\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c14\" colnum=\"14\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c15\" colnum=\"15\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"5\" nameend=\"c6\" namest=\"c2\"\u003e \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"5\" nameend=\"c11\" namest=\"c7\"\u003e \u003cp\u003e\u003cem\u003eS. lutescens\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c15\" namest=\"c12\"\u003e \u003cp\u003ePutative hybrids\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLocality\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSpecimen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003ecpDNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eITS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSpecimen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c9\" namest=\"c8\"\u003e \u003cp\u003ecpDNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003eITS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c13\" namest=\"c12\"\u003e \u003cp\u003eChloroplast\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c15\" namest=\"c14\"\u003e \u003cp\u003eITS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003en\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHaplotypes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003en\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGenotypes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003en\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eHaplotypes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cem\u003en\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eGenotypes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u003cem\u003en\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003eGenotypes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cem\u003en\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003eGenotypes\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eC, C/D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eA, B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003eB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003eC, C/D\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA, B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eA, B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003eA, B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMt. Mikuni\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMt. Higane\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eA, B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKintoki\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eA, B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSudogawa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eD, C/D'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSO1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbsent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAbsent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAbsent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMt. Kasagatake\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAbsent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMiyazaki\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePresent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAbsent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe haplotypes and genotypes recognized in each locality are summarized in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, and the distributions of haplotypes and genotypes among the sites are shown in Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e and \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e, respectively. Among cpDNA haplotypes, all examined \u003cem\u003eS. japonica\u003c/em\u003e individuals, except for six specimens from OY, had the type A haplotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA), whereas at several localities, \u003cem\u003eS. lutescens\u003c/em\u003e specimens with both type A and type B haplotypes were found (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAmong nrDNA genotypes, all examined \u003cem\u003eS. japonica\u003c/em\u003e individuals, except for two specimens from HS, had the type C genotype in the ITS region (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). The two exceptions had the type C/D genotype, in which all polymorphic sites were heterozygous with type C and type D alleles (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). All examined \u003cem\u003eS. lutescens\u003c/em\u003e individuals, except for the specimens from OY and three specimens from Sudogawa, had the type D genotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). All of the OY specimens had the type C genotype, which is the typical \u003cem\u003eS. japonica\u003c/em\u003e genotype. The three exceptions from Sudogawa had the type C/D\u0026rsquo; genotype, in which some of the polymorphic sites were heterozygous with type C and type D alleles and the others were homozygous with type C alleles (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAmong the putative hybrid specimens, the cpDNA of the two specimens from HS and of two of the four specimens from OY had the type B haplotype, which was the typical \u003cem\u003eS. lutescens\u003c/em\u003e haplotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB), and their ITS regions of nrDNA had the type C genotype, which was the typical \u003cem\u003eS. japonica\u003c/em\u003e genotype, or the C/D genotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eAssessment of genetic structure by MIG-seq\u003c/h2\u003e \u003cp\u003eThe total number of reads for all 107 samples following quality control on the raw MIG-seq data was 11,441,713, and the average number of reads per sample was 106,932. After filtering, 147 unlinked SNPs (missing rate, 0.09) were selected and used for Bayesian clustering (STRUCTURE) analyses. Two clusters were recognized with posterior probabilities of \u0026gt;\u0026thinsp;0.99 that matched morphologically identified \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e, except for the two putative hybrids at HS (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). This result suggests that the two putative hybrids at HS, but not the four putative hybrids at OY, had indeed resulted from recent hybridization between the species. The two hybrids at HS were growing side by side in an area where \u003cem\u003eS. lutescens\u003c/em\u003e was also growing and about 25 m away from the nearest \u003cem\u003eS. lutescens\u003c/em\u003e individuals (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). One hybrid appeared to be genetically closer to \u003cem\u003eS. japonica\u003c/em\u003e, whereas the other was genetically closer to \u003cem\u003eS. lutescens\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAccording to our field survey, the two closely related \u003cem\u003eSalvia\u003c/em\u003e species, \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e, appear at present to be free of adverse effect from the other species on their reproduction in the wild populations. Our hand-pollination results, however, showed that reproductive interference can occur between the two species: Pollen from the counterpart species could reduce seed set and lead to hybridization producing offspring with significantly low fertility. The cpDNA haplotyping and nrDNA genotyping results suggested that the two species might have a history of hybridization, and our MIG-seq analysis results detected hybrids between the two species.\u003c/p\u003e \u003cp\u003eThe number of studies focusing on plants that may be involved in reproductive interference has been increasing (e.g. Brown and Mitchell, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Burgess et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Takakura et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Takakura and Fujii, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Briscoe Runquist and Stanton, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Eaton et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Tokuda et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Katsuhara and Ushimaru, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), and some have used molecular methods to investigate whether any plants were hybrids (e.g. Fukatsu et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Takemori et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Nishida et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Fei et al., 2020). However, to the best of our knowledge, no previous study has investigated the current genetic structure of populations to reveal the current state of species interaction in terms of reproductive interference, as we have done here, by the MIG-seq analysis. Moreover, our study may to be one of only few that have investigated the possibility of reproductive interference between native wild plants through fieldwork, experiments, and genotyping using different regions of DNA and genome-wide SNPs.\u003c/p\u003e \u003cp\u003eOur field survey results showed that seed set after natural pollination (open pollination under natural conditions) was often higher than that after conspecific hand-pollination, whether the two species coexisted (HS, OY) or not (SA, SO1) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Reasons for the relatively lower seed set after conspecific hand-pollination could be that artificial hand-pollination damaged the flowers and/or that natural pollinators visited the flowers frequently and transported pollen to the flowers more efficiently at some study sites. Considering that in three out of six experiments there was no significant difference between the results after hand-pollination and natural pollination, and that the difference was usually marginal, except for \u003cem\u003eS. lutescens\u003c/em\u003e at OY, it is unlikely that hand-pollination caused damage to the flowers, but more likely that natural pollinators were more frequent and efficient at some study sites. The results indicate that neither pollen limitation nor conspecific pollen loss are substantial. Pollen limitation and conspecific pollen loss can be caused by competition for pollinator services, for example, if pollinators are attracted by the other plant species and visit the focal plant species less frequently, or if conspecific pollen is wasted on the flowers of the other species, thereby reducing the reproductive success of the focal plant species (Waser, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e1978\u003c/span\u003e; Mitchell et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Moreira-Hern\u0026aacute;ndez and Muchhala, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Considering our results, we inferred that negative interactions between the two species were not at present affecting their seed set.\u003c/p\u003e \u003cp\u003eHowever, how the separated small-scale distributions of the two species were realized in regions where they co-occur requires explanation (see maps of HS and OY in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). At OY, for example, we observed no particular differences between the two species with respect to the altitude or riparian condition of their habitats that could explain their segregation into small patches. In a theoretical study on reproductive interference and niche specialization, Nishida et al. (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) proposed that under moderate reproductive interference, some habitat segregation or niche specialization between members of a species pair can be expected, whereas under negligible reproductive interference, the two species might coexist locally. Our results from the hand-pollination experiments (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) and in the examination of the hybrids (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e) suggest that some level of reproductive interference, although not detected in the field observations, may have led to their separated distributions at small scale. According to our results, both species may suffer from bidirectional reproductive interference through reductions of seed set or severe interspecific ovule discounting through the production of infertile hybrids. Ovule discounting (i.e. a reduction in fecundity when hybrid fertilization usurps ovules that would otherwise give rise to non-hybrid (conspecific) offspring; Levin, Francisco-Ortega and Jansen, 1996; Burgess and Husband, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2006\u003c/span\u003e), is an important mechanism of reproductive interference (Mitchell et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). In the future, other possible reasons, such as resource competition, for the separated distributions should be investigated.\u003c/p\u003e \u003cp\u003eIt should be noted that our hand-pollination experiments did not perfectly replicate pollination occurring under natural conditions, because insect pollinators were not involved in our experiments. For example, if pollen from two species is deposited on distinctly separate parts of the pollinator\u0026rsquo;s body in a manner that prevents contact with the heterospecific stigma, mixed pollination may not occur between some \u003cem\u003eSalvia\u003c/em\u003e species pairs (Cla\u0026szlig;en-Bockhoff et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). If this prezygotic isolation mechanism functions in the two studied species, the adverse effects of reproductive interference would be overestimated by our experiments. However, the pollinators of both \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e are mainly small bees and hoverflies, and on these pollinators, pollen is not deposited on separate parts of their bodies as it is for larger pollinators such as bumblebees, hummingbirds, and bats (Y. Watanabe, A. Takano, S. Nishida, personal observations). Also, lever-like stamens, which are a key factor in the mechanical isolation of some sympatric \u003cem\u003eSalvia\u003c/em\u003e species (Cla\u0026szlig;en-Bockhoff et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2004\u003c/span\u003e), are absent in the two studied species. Therefore, we suggest that a prezygotic isolation mechanism is unlikely in these species, so the results of our experiments are relevant for evaluating the possibility of reproductive interference between them. In the future, however, experiments with native pollinators should be conducted to examine whether a prezygotic isolation mechanism exists in the studied species.\u003c/p\u003e \u003cp\u003eOur cpDNA haplotyping and nrDNA genotyping results suggest that hybridization may have occurred (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e, \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). We cannot exclude the possibility that these findings might be caused by polymorphic haplotypes or genotypes originally harbored by each species, especially in the case of \u003cem\u003eS. lutescens\u003c/em\u003e. However, insofar as each species had only one haplotype/genotype in those localities where it was the only species found, we can reasonably infer that when a haplotype or genotype typical of the counterpart species occurs in the focal species, it indicates some hybridization between the two species.\u003c/p\u003e \u003cp\u003eThe STRUCTURE results also showed evidence of hybridization between the species. The two putative hybrids at HS probably resulted from a recent hybridization event (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). This result indicates that some hybridization and backcrossing has occurred between the two species, supporting our inference from our cpDNA haplotyping and nrDNA genotyping results that hybridization may have occurred between these species. However, apart from these two hybrids, the STRUCTURE results indicated clear genetic differentiation between the two species (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). The markedly low fertility of the hybrids in our experiments suggests that even if hybridization occurs occasionally and the hybrids continue to hybridize with both parent species, no offspring might be found. This result is consistent with our inference that the two species may not coexist for a long time within a patch, despite a history of encounter and interaction between the species in regions where they are co-distributed.\u003c/p\u003e \u003cp\u003eRecently, Kriebel et al. (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) and Rose et al. (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) sought to reveal the complicated evolutionary history of \u003cem\u003eSalvia\u003c/em\u003e species using Anchored Hybrid Enrichment, a DNA sequencing method designed to recover hundreds of unique orthologous loci (i.e., single copy, phylogenetically informative markers) from across the genome and resolve both shallow and deep-scale evolutionary relationships within non-model systems (Lemon et al., 2012; Hamilton et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Kriebel et al. (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), who used a chronogram developed from a super-matrix of genomic data that targeted sequence data from over 500 of the nearly 1000 \u003cem\u003eSalvia\u003c/em\u003e species, suggested that multiple dispersals of the genus, including \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e, likely occurred from mainland East Asia to Japan in the Pliocene. Rose et al. (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) examined data from 179 \u003cem\u003eSalvia\u003c/em\u003e species retrieved by Kriebel et al. (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) and quantified the discordance among plastid and nuclear ribosomal loci to investigate whether the discordance could be explained by incomplete lineage sorting or by horizontal gene flow via hybridization and introgression. The results of their multiple analyses suggested that incomplete lineage sorting could not fully explain the observed gene tree discordance, although they could not exclude the possibility of error in the gene tree estimation; thus, horizontal gene flow through hybridization and introgression most likely has influenced both the deep and more recent history of \u003cem\u003eSalvia\u003c/em\u003e. Considering the findings of Kriebel et al. (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) and Rose et al. (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), we think it is reasonable to infer that multiple migrations in the biogeographical history of Japanese \u003cem\u003eSalvia\u003c/em\u003e species may have led reproductive interference through hybridization between \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e at some time in the past. However, further biogeographical analysis with more samples is needed to reconstruct the detailed history of encounters and interactions between these species.\u003c/p\u003e \u003cp\u003eIn \u003cem\u003eSalvia\u003c/em\u003e, a genus famous for its diversity in flower morphology and adaptation to various pollinators (Cla\u0026szlig;en-Bockhoff et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2004\u003c/span\u003e), our results showed a possible negative interaction mediated by shared pollinators. Given the species richness of \u003cem\u003eSalvia\u003c/em\u003e and the wide variation in pollination mechanisms that have been documented for the genus, a number of interesting studies on pollinator syndromes in \u003cem\u003eSalvia\u003c/em\u003e have recently appeared (e.g. Celep et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Wester et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Our study, by calling attention to negative interactions, provides an additional perspective on the development of diversity in this genus.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003eWe are deeply grateful to\u0026nbsp;Ms. Natsuko Yoshino for cultivating our samples at Nagoya University Botanical Garden. We also thank Mr. Ichiro Yamazumi, Mr. Tetsuya Nishimura and Mr. Yuta Watanabe for their assistance in our field survey.\u0026nbsp;Dr. Ayumi Matsuo provided preliminary MIG-seq analysis data and informative suggestions, and two anonymous reviewers provided valuable comments to improve our manuscript. We are deeply grateful to them.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eFunding\u003c/strong\u003e This work was supported by JSPS KAKENHI Grant Number JP20K06783 to S.N., JP26440227 to A.T., and JP20K06833 and JP23K05912 to S.K. The New Technology Development Foundation also supported A.T. in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e The authors declare that they have no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBolger AM, Lohse M, Usadel B (2014) Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 30:2114\u0026ndash;2120.\u003c/li\u003e\n\u003cli\u003eBriscoe Runquist R, Stanton ML (2013) Asymmetric and frequency dependent pollinator-mediated interactions may influence competitive displacement in two vernal pool plants. Ecol Lett 16:183\u0026ndash;190\u003c/li\u003e\n\u003cli\u003eBrown BJ, Mitchell RJ (2001) Competition for pollination: effects of pollen of an invasive plant on seed set of a native congener. Oecologia 129:43\u0026ndash;49.\u003c/li\u003e\n\u003cli\u003eBurgess KS, Husband BC (2006) Habitat differentiation and the ecological costs of\u003c/li\u003e\n\u003cli\u003ehybridization: the effects of introduced mulberry (\u003cem\u003eMorus alba\u003c/em\u003e) on a native congener (\u003cem\u003eM. rubra\u003c/em\u003e). J Ecol 94:1061\u0026ndash;1069.\u003c/li\u003e\n\u003cli\u003eBurgess KS, Morgan M, Husband BC (2008) Interspecific seed discounting and the fertility cost of hybridization in an endangered species. New Phytol 177:276\u0026ndash;284.\u003c/li\u003e\n\u003cli\u003eCelep F, Atalay Z, Dikmen F, Doğan M, Sytsma KJ, Cla\u0026szlig;en-Bockhoff R (2020) Pollination ecology, specialization, and genetic isolation in sympatric bee-pollinated \u003cem\u003eSalvia\u003c/em\u003e (Lamiaceae). Int J Plant Sci 181:800\u0026ndash;811. \u003c/li\u003e\n\u003cli\u003eCla\u0026szlig;en-Bockhoff R, Speck T, Tweraser E, Wester P, Thimm S, Reith M (2004) The staminal lever mechanism in \u003cem\u003eSalvia\u003c/em\u003e L. (Lamiaceae): a key innovation for adaptive radiation? Org Divers Evol 4:189\u0026ndash;205.\u003c/li\u003e\n\u003cli\u003eDeBach P (1966) The competitive displacement and coexistence principles. Ann Rev Entomol 11:183\u0026ndash;212.\u003c/li\u003e\n\u003cli\u003eDoyle JJ, Doyle D (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19:11\u0026ndash;15.\u003c/li\u003e\n\u003cli\u003eDrew B, Sytsma KJ (2011) Testing the monophyly and placement of \u003cem\u003eLepechinia\u003c/em\u003e in the tribe Mentheae (Lamiaceae). Syst Bot\u003cem\u003e \u003c/em\u003e36:1038\u0026ndash;1049.\u003c/li\u003e\n\u003cli\u003eEaton DAR, Fenster CB, Hereford J, Huang SQ, Ree RH (2012) Floral diversity and community structure in \u003cem\u003ePedicularis\u003c/em\u003e (Orobanchaceae). Ecology 93:S182\u0026ndash;S194.\u003c/li\u003e\n\u003cli\u003eEaton DAR, Overcast I (2020) ipyrad: Interactive assembly and analysis of RADseq datasets. Bioinformatics 36:2592\u0026ndash;2594.\u003c/li\u003e\n\u003cli\u003eFei CH, Tang SS, Shang SH, Dai J, Wang XY, Wang S, Liu WQ, Wang XF (2022) Conspecific pollen advantage mediated by the extragynoecial compitum and its potential to resist interspecific reproductive interference between two \u003cem\u003eSagittaria \u003c/em\u003especies. Front Ecol Evol 13. doi:10.3389/fpls.2022.956193. \u003c/li\u003e\n\u003cli\u003eFukatsu M, Horie S, Maki M, Dohzono I (2019) Hybridization, coexistence, and possible reproductive interference between native\u003cem\u003e Oxalis corniculata\u003c/em\u003e and alien \u003cem\u003eO. dillenii\u003c/em\u003e in Japan. Plant Syst and Evol 305:127\u0026ndash;137.\u003c/li\u003e\n\u003cli\u003eFunamoto T, Zushi M, Harana T, Nakamura T (2000) Comparative karyomorphology of the Japanese species of \u003cem\u003eSalvia \u003c/em\u003eL. (Lamiaceae). Journ Phytogeogr Taxon 48:11\u0026ndash;18.\u003c/li\u003e\n\u003cli\u003eGr\u0026ouml;ning J, Hochkirch A (2008) Reproductive interference between animal species. Q Rev Biol 83:257\u0026ndash;282.\u003c/li\u003e\n\u003cli\u003eHamilton CA, Lemmon AR, Lemmon EM, Bond JE (2016) Expanding anchored hybrid enrichment to resolve both deep and shallow relationships within the spider tree of life. BMC Evol Biol 16:212.\u003c/li\u003e\n\u003cli\u003eHaque MdS, Ghoshal KK (1981) Floral biology and breeding system in the genus \u003cem\u003eSalvia\u003c/em\u003e L. Proc Indian National Sci Acad 47:716\u0026ndash;724.\u003c/li\u003e\n\u003cli\u003eHu G-X, Takano A, Drew BT, Liu ED, Soltis DE, Soltis PS, Peng H, Xiang C-L (2018) Phylogeny and staminal evolution of\u003cem\u003e Salvia\u003c/em\u003e (Lamiaceae, Nepetoideae) in East Asia Ann Bot\u003cem\u003e \u003c/em\u003e122:649\u0026ndash;668.\u003c/li\u003e\n\u003cli\u003eHuang ZH, Liu HL, Huan SQ. 2015. Interspecific pollen transfer between two coflowering species was minimized by bumblebee fidelity and differential pollen placement on the bumblebee body. J Plant Ecol 8:109\u0026ndash;115\u003c/li\u003e\n\u003cli\u003eKatsuhara KR, Ushimaru A (2019) Prior selfing can mitigate the negative effects of mutual reproductive interference between coexisting congeners.\u003cem\u003e \u003c/em\u003eFunct Ecol 33:1504-1513.\u003c/li\u003e\n\u003cli\u003eKriebel R, Drew BT, Drummond CP, Gonz\u0026aacute;lez-Gallegos JG, Celep F, Mahdjoub MM, Rose JP, Xiang CL, Hu GX, Walker JB, Lemmon EM, Lemmon AR (2019) Tracking temporal shifts in area, biomes, and pollinators in the radiation of Salvia (sages) across continents: leveraging anchored hybrid enrichment and targeted sequence data. Am J Bot\u003cem\u003e \u003c/em\u003e106:573\u0026ndash;597.\u003c/li\u003e\n\u003cli\u003eKuno E (1992) Competitive exclusion through reproductive interference. Popul Ecol 34:275\u0026ndash;284.\u003c/li\u003e\n\u003cli\u003eKyogoku D (2015) Reproductive interference: ecological and evolutionary consequences of interspecific promiscuity. Popul Ecol 57:253\u0026ndash;260.\u003c/li\u003e\n\u003cli\u003eLemmon AR, Emme SA, Lemmon EM (2012) Anchored hybrid enrichment for massively high-throughput phylogenomics. Syst Biol 61:727\u0026ndash;744.\u003c/li\u003e\n\u003cli\u003eLevin DA, Fransisco-Ortega J, Jansen RK (1996) Hybridization and the extinction of rare plant species. Conserv Biol 10: 10\u0026ndash;16.\u003c/li\u003e\n\u003cli\u003eMitchell RJ, Flanagan RJ, Brown BJ, Waser NM, Karron JD (2009) New frontiers in competition for pollination. Ann Bot\u003cem\u003e \u003c/em\u003e103:1403\u0026ndash;1413.\u003c/li\u003e\n\u003cli\u003eMiyajima D (2001) Floral variation and its effect on self-pollination in \u003cem\u003eSalvia splendens\u003c/em\u003e. J Hortic Sci Biotechnol 76:187-194.\u003c/li\u003e\n\u003cli\u003eMoreira-Hern\u0026aacute;ndez JI, Muchhala N (2019) Importance of pollinator-mediated interspecific pollen transfer for angiosperm evolution. Ann Rev Ecol Evol Syst 50:191\u0026ndash;217.\u003c/li\u003e\n\u003cli\u003eMuchhala N, Thomson JD (2012) Interspecific competition in pollination systems: costs to male fitness via pollen misplacement. Funct Ecol 26:476\u0026ndash;482.\u003c/li\u003e\n\u003cli\u003eMurata, G, Yamazaki T (1993) \u003cem\u003eSalvia\u003c/em\u003e L. In: Iwatsuki, K, T. Yamazaki T, Boufford DE, Ohba H. eds. Flora of Japan IIIa. Kodansha, Tokyo, Japan, pp 302\u0026minus;307.\u003c/li\u003e\n\u003cli\u003eNishida S, Takakura KI, Naiki A, Nishida T (2020) Habitat partitioning in native \u003cem\u003eGeranium\u003c/em\u003e species through reproductive interference. Ann Bot 125:651\u0026ndash;661.\u003c/li\u003e\n\u003cli\u003eNishida T, Takakura KI, Iwao K (2015) Host specialization by reproductive interference between closely related herbivorous insects. Popul Ecol 57:273\u0026ndash;281.\u003c/li\u003e\n\u003cli\u003ePritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155:945-959.\u003c/li\u003e\n\u003cli\u003ePonisio LC, Valdovinos FS, Allhoff KT, Gaiarsa MP, Barner A, Guimar\u0026atilde;es Jr. PR, Hembry DH, Morrison B, Gillespie R (2019) A network perspective for community assembly. Front Ecol Evol 7. doi:10.3389/fevo.2019.00103.\u003c/li\u003e\n\u003cli\u003eR Core Team (2018) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria.\u003c/li\u003e\n\u003cli\u003eRibeiro JMC, Spielman A (1986) The Satyr effect: a model predicting parapatry and species extinction. Am Nat 128:513\u0026ndash;528.\u003c/li\u003e\n\u003cli\u003eRivas LR (1964) A reinterpretation of the concept \u0026ldquo;sympatric\u0026rdquo; and \u0026ldquo;allopatric\u0026rdquo; with proposal of the additional terms \u0026ldquo;syntopic\u0026rdquo; and \u0026ldquo;allotopic\u0026rdquo;. Syst Zool 13:42\u0026ndash;43.\u003c/li\u003e\n\u003cli\u003eRose JP, Kriebel R, Kahan L, DiNicola A, Gonz\u0026aacute;lez-Gallegos JG, Celep F, Lemmon EM, Lemmon AR, Sytsma KJ, Drew BT (2021) Sage insights into the phylogeny of \u003cem\u003eSalvia\u003c/em\u003e: Dealing with sources of discordance within and across genomes. Front Plant Sci 12:767\u0026ndash;478.\u003c/li\u003e\n\u003cli\u003eSuyama Y, Matsuki Y (2015) MIG-seq: an effective PCR-based method for genome-wide single-nucleotide polymorphism genotyping using the next-generation sequencing platform. Sci Rep 5:16963 | DOI: 10.1038/srep16963.\u003c/li\u003e\n\u003cli\u003eSuyama Y, Hirota SK, Matsuo A, Tsunamoto Y, Mitsuyuki C, Shimura A, Okano, K (2022) Complementary combination of multiplex high-throughput DNA sequencing for molecular phylogeny. Ecol Res 37:171\u0026ndash;181.\u003c/li\u003e\n\u003cli\u003eTakakura K-I, Fujii S (2010) Reproductive interference and salinity tolerance differentiate habitat use between two alien cockleburs: \u003cem\u003eXanthium occidentale\u003c/em\u003e and \u003cem\u003eX. italicum\u003c/em\u003e (Compositae). Plant Ecol 206:309\u0026ndash;319.\u003c/li\u003e\n\u003cli\u003eTakakura KI, Nishida T, Matsumoto T, Nishida S (2009) Alien dandelion reduces the seed set of a native congener through frequency dependent and one-sided effects. Biol Invasions\u003cem\u003e \u003c/em\u003e11:973\u0026ndash;981.\u003c/li\u003e\n\u003cli\u003eTakakura KI, Matsumoto T, Nishida T, Nishida S (2011) Effective range of reproductive interference exerted by an alien dandelion, \u003cem\u003eTaraxacum officinale\u003c/em\u003e, on a native congener. J Plant Res 124:269\u0026ndash;276. \u003c/li\u003e\n\u003cli\u003eTakano A (2017) Taxonomic study on Japanese \u003cem\u003eSalvia\u003c/em\u003e (Lamiaceae): Phylogenetic position of \u003cem\u003eS. akiensis\u003c/em\u003e, and polyphyletic nature of \u003cem\u003eS. lutescens\u003c/em\u003e var. \u003cem\u003eintermedia\u003c/em\u003e. PhytoKeys 80:87\u0026ndash;104.\u003c/li\u003e\n\u003cli\u003eTakano A, Okada H (2011) Phylogenetic relationships among subgenera, species, and varieties of Japanese \u003cem\u003eSalvia \u003c/em\u003eL. (Lamiaceae). J Plant Res 124:245\u0026ndash;252.\u003c/li\u003e\n\u003cli\u003eTakemori A, Naiki A, Takakura KI, Kanaoka MM, Nishida S (2019) Comparison of mechanisms of reproductive interference in Taraxacum. Ann Bot 123:1017\u0026ndash;1027.\u003c/li\u003e\n\u003cli\u003eThompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673\u0026ndash;4680.\u003c/li\u003e\n\u003cli\u003eTokuda N, Hattori M, Abe K, Shinohara Y, Nagano Y, Itino T (2015) Demonstration of pollinator‐mediated competition between two native \u003cem\u003eImpatiens \u003c/em\u003especies, \u003cem\u003eImpatiens noli\u003c/em\u003e\u003cem\u003e‐\u003c/em\u003e\u003cem\u003etangere \u003c/em\u003eand \u003cem\u003eI. textori\u003c/em\u003e (Balsaminaceae). Ecol Evol 5:1271\u0026ndash;1277.\u003c/li\u003e\n\u003cli\u003eTong ZY, Huang SQ (2016) Pre- and post-pollination interaction between six co-flowering \u003cem\u003ePedicularis\u003c/em\u003e species via heterospecific pollen transfer. New Phytol 211:1452\u0026ndash;1461.\u003c/li\u003e\n\u003cli\u003eWaser NM (1978) Interspecific pollen transfer and competition between co-occurring plant species.\u003cem\u003e \u003c/em\u003eOecologia 36:223\u0026ndash;236.\u003c/li\u003e\n\u003cli\u003eWester P, Cairampoma L, Haag S, Schramme J, Neumeyer C, Cla\u0026szlig;en-Bockhoff R (2020) Bee exclusion in bird-pollinated \u003cem\u003eSalvia\u003c/em\u003e flowers: the role of flower color versus flower construction. Int J Plant Sci 181:770\u0026ndash;786.\u003c/li\u003e\n\u003cli\u003eWhite TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ. eds. PCR protocols: a guide to methods and amplifications.: Academic Press, San Diego, US, pp 315\u0026ndash;312.\u003c/li\u003e\n\u003cli\u003eWolfinger R, O\u0026rsquo;Connell M (1993) Generalized linear mixed models: a pseudolikelihood approach. J Stat Comput Simul 4: 233\u0026ndash;243.\u003c/li\u003e\n\u003cli\u003eYonekura K (2017) Lamiaceae. In: Ohashi H, Kadota Y, Kihara H, Murata J, Yonekura K, eds.\u003cem\u003e \u003c/em\u003eWildflowers of Japan. Vol. 5\u003cem\u003e.\u003c/em\u003e Heibonsha, Tokyo, Japan, pp 101\u0026ndash;143.\u003c/li\u003e\n\u003cli\u003eYoshimura J, Clark CW (1994) Population dynamics of sexual and resource competition. Theor Popul Biol 45:121\u0026ndash;131.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"journal-of-plant-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jpre","sideBox":"Learn more about [Journal of Plant Research](http://link.springer.com/journal/10265)","snPcode":"10265","submissionUrl":"https://www.editorialmanager.com/jpre/default2.aspx","title":"Journal of Plant Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"distributional relationship, hybridization, reproductive interference, Salvia japonica, Salvia lutescens","lastPublishedDoi":"10.21203/rs.3.rs-3998530/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3998530/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eReproductive interference, an interspecific interaction in reproductive process that exerts an adverse effect, has gained attention as a contributing factor to promoting exclusive distributions between related closely species. However, detailed studies on the possibility of reproductive interference between native plants are still wanting, presumably because strong reproductive interference can rapidly realize exclusive distributions, leaving the two species apparently independent.\u003c/p\u003e \u003cp\u003e \u003cem\u003eSalvia japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e are found in separate localities at small scale, although their distributions overlap at large scale. We investigated the possibility of reproductive interference between them through field surveys, hand-pollination experiments, evaluation of hybrid fertility, cpDNA and nrDNA genotyping, and genome-wide DNA analysis.\u003c/p\u003e \u003cp\u003eThe field survey results did not reveal apparent negative interaction in competition for pollinator services. Mixed pollination with conspecific pollen and counterpart pollen reduced seed set in \u003cem\u003eS. japonica\u003c/em\u003e, and hybrid progeny produced by mixed pollination were one-fifth or less as fertile compared to the pure species. The DNA genotyping results suggested the possibility of hybridization where their distributions overlap, and the genome-wide DNA analysis results showed clear genetic differentiation between the two species as well as the existence of hybrids. These results suggest that bi-directional reproductive interference between \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. lutescens\u003c/em\u003e may have led to their present separated distributions at small scale.\u003c/p\u003e","manuscriptTitle":"Detection of reproductive interference between closely related Salvia species with small-scale separated distributions by multifaceted pollination and molecular analyses","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-07 06:44:44","doi":"10.21203/rs.3.rs-3998530/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Accept but needs final editing","date":"2024-07-30T18:28:23+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2024-03-05T00:11:20+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-03-05T00:01:55+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-03-04T07:45:52+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Plant Research","date":"2024-02-29T18:16:35+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"journal-of-plant-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jpre","sideBox":"Learn more about [Journal of Plant Research](http://link.springer.com/journal/10265)","snPcode":"10265","submissionUrl":"https://www.editorialmanager.com/jpre/default2.aspx","title":"Journal of Plant Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"d7c587ae-eaa3-4097-8671-dbd3a1c1630e","owner":[],"postedDate":"March 7th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-09-02T16:02:37+00:00","versionOfRecord":{"articleIdentity":"rs-3998530","link":"https://doi.org/10.1007/s10265-024-01577-6","journal":{"identity":"journal-of-plant-research","isVorOnly":false,"title":"Journal of Plant Research"},"publishedOn":"2024-08-30 15:57:44","publishedOnDateReadable":"August 30th, 2024"},"versionCreatedAt":"2024-03-07 06:44:44","video":"","vorDoi":"10.1007/s10265-024-01577-6","vorDoiUrl":"https://doi.org/10.1007/s10265-024-01577-6","workflowStages":[]},"version":"v1","identity":"rs-3998530","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3998530","identity":"rs-3998530","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.