Levofloxacin Ameliorates Atherosclerosis By Regulating Lipid Metabolism

Levofloxacin Ameliorates Atherosclerosis By Regulating Lipid Metabolism | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 17 September 2025 V1 Latest version Share on Levofloxacin Ameliorates Atherosclerosis By Regulating Lipid Metabolism Authors : Qing-hua Sheng , Xiao-yong Ren , Hong-da Zhuang , Jin-hua Zhou , Tong Rong , Kun Wang , Ying Qin , Hao-nan Zhao , Li-zhen Chen , Min Zeng , Fen-fen Zhou , and Yong Chen [email protected] Authors Info & Affiliations https://doi.org/10.22541/au.175814478.86847010/v1 138 views 97 downloads Contents Abstract Supplementary Material Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract not-yet-known not-yet-known not-yet-known unknown Atherosclerosis (AS) is a prevalent cardiovascular disease with complex pathogenesis. The pathogenesis of AS encompasses various cellular activities, including endothelial damage, inflammatory responses, oxidative stress, and lipid metabolism, culminating in subintimal lipid deposition in the aorta and its branches. Against the backdrop of existing studies demonstrating that Chlamydia pneumoniae is present in atherosclerotic plaques and that levofloxacin (LEV) can reduce carotid artery cholesterol levels in patients infected with Chlamydia pneumoniae, this study hypothesized that LEV exerts an independent anti-atherosclerotic effect and conducted experimental verification to test this hypothesis. The aim of this study is to provide experimental evidence for the potential application of LEV in the prevention and treatment of AS, while also enriching the theoretical research direction of pharmacological interventions for AS. This study aims to investigate the therapeutic effects of LEV on AS and the potential underlying mechanism mainly by using ApoE-knockout（ApoE -/-）mice fad a high-fat diet. In vivo animal experiments and in vitro cellular experiment on lipid deposition confirm that LEV could effectively reduce blood lipids level, atherosclerotic lesion in aorta, and lipid deposition in cultured macrophages, thereby delaying AS progression. Further research on genes related to hepatic lipid metabolism has revealed that LEV significantly affects the expression of lipid metabolism-related genes, including LDLR, LRP1, SR-BI, HMGCR, ABCA1, ABCG5, and ABCG8. This study not only verifies and reveals LEV’s potential for AS treatment and related mechanisms, but also enriches the theoretical research direction of AS pharmacological interventions not-yet-known not-yet-known not-yet-known unknown Introduction Atherosclerosis (AS) is a chronic inflammatory disease characterized by the accumulation of lipids, primarily cholesterol, beneath the intimal membrane of arteries and their branches, forming plaques. The development of AS is a protracted process that can lead to severe cardiovascular and cerebrovascular diseases, such as myocardial infarction and stroke[1-3]. The primary triggers for AS include environmental factors like high-fat diets, sedentary lifestyles, and chronic alcohol consumption, as well as genetic factors involving lipoprotein metabolism[4, 5]. The latest data from the World Health Organization indicate that in 2021, 20.5 million deaths were attributed to cardiovascular diseases, accounting for nearly one-third of global mortality, with atherosclerotic cardiovascular diseases being the most significant. Lipid metabolism disorder and intracellular lipid deposition (or foam cell formation) are major contributors of atherogenesis. Despite a profound understanding of atherosclerosis mechanisms, it remains one of the diseases with the highest morbidity and mortality rates worldwide[6-11]. Levofloxacin (LEV) is widely used clinically due to its high bioavailability, low protein binding rate, potent antibacterial activity, and superior tissue penetration, particularly for diseases caused by bacteria such as lower respiratory tract infections, urogenital infections, skin infections, acute maxillary sinusitis, acute pyelonephritis, eye infections, recurrent pulmonary tuberculosis, and typhoid fever[12]. Liuba et al. studies have confirmed that Chlamydia pneumoniae can induce endothelial dysfunction in ApoE-knockout (ApoE-/-) mice [13] and that Chlamydia pneumoniae is present in AS plaques[14]. Yasunori et al. demonstrated that in patients infected with Chlamydia pneumoniae, the combination of LEV and probucol can reduce carotid atherosclerosis and cholesterol levels[15], implying an anti-atherosclerotic possibility of LEV which is presently unclear. To verify the potential of LEV in treating AS, we primarily utilized a murine AS model to evaluate the effects of LEV on delaying the progression of AS. Moreover, by profiling lipid-metabolism-related genes in mouse liver, we investigated how LEV modulates hepatic lipid metabolism. From the perspective of hepatic lipid metabolism, we elucidate how LEV influences AS and the underlying mechanisms. Materials and methods Animals Male ApoE-knockout (ApoE-/-) mice were purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd., license number: SCXK (Beijing) 2016-0011(Beijing, China). All mice were housed with free access to diet and water in plastic cage at room temperature (24-26 °C) and kept on a 12 h light/dark cycle in a specific pathogen-free environment. The animal experiments were strictly performed in accordance with the Guide for the Care and Use of Laboratory Animals. All experimental procedures were approved by the Animal Ethics Committee of Nanchang University (approval number: NCULAE-20220726005). not-yet-known not-yet-known not-yet-known unknown Mouse AS model and LEV treatment After a 5-day adaptation period, mice were randomly divided into the following four groups: (1) Control group (n = 8), which received a chow diet (Hunan Slick Jingda Co., Ltd, Hunan, China ) and injected with 100 μL PBS every 48 hours; (2) Model group (n = 8), which received a high-fat diet (Hunan Slick Jingda Co., Ltd.) and injected with 100 μL PBS every 48 hours; (3) Low-dose LEV ( Aladdin Co., Ltd, Shanghai, China) group (n=8), which received a high-fat diet and an intravenous injection of 20 mg/kg LEV every 48 hours. (4) High-dose LEV group (n = 8), which received a high-fat diet and an intravenous injection of 120 mg/kg LEV every 48 hours. After 14 weeks, tissues were collected and stored at -80°C until further analysis. Determination of Blood Lipids, Lactate Dehydrogenase (LDH), Aspartate Aminotransferase (AST), and Alanine Aminotransferase (ALT) Blood was collected from the retro-orbital sinus of mice and placed in a 1.5 mL EP tube containing an anticoagulant. After standing at room temperature for 2 hours, it was centrifuged at 10,000 rpm for 10 minutes using a benchtop centrifuge to collect the upper layer of light yellow serum. Four blood lipids, including total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), and triglycerol (TG), were detected using a fully automatic biochemical analyzer (Beckman Coulter, Pasadena, USA). LDH detection kit (Elabscience, article number: EBC-K046-M, Wuhan, China), AST detection kit (Nanjing Jiancheng, article number: C0102 -1, Nanjing, China), and ALT detection kit (Nanjing Jiancheng, article number: C009 -2-1, Nanjing, China) were used to measure LDH, AST, and ALT levels in blood, respectively. not-yet-known not-yet-known not-yet-known unknown Tissue Staining Oil Red O Staining of the Entire Length of Mouse Aorta The entire length of the aorta was cut longitudinally and placed in PBS, then placed in 60% isopropanol for differentiation for 3 minutes. After differentiation, Oil Red O staining solution (Solarbio, article number: O8010, Beijing, China) was added to stain in the light for 20 minutes and decolorized in 60% isopropanol for 45 seconds. This step was repeated twice before taking photos to detect lipid deposition. Oil Red O-Hematoxylin Staining of Frozen Sections of Mouse Aortic Valve The aortic valve sections were eluted with the embedding agent in distilled water for 30 minutes. After washing, the water was drained, and they were immersed in hematoxylin dye solution (Solarbio, article number: G1120, Beijing, China) for staining for 10 minutes, and the excess dye was washed away with distilled water. The sections were then immersed in 1% hydrochloric acid alcohol to differentiate for 8 seconds. After differentiation, they were quickly immersed in a 65°C water bath to return to blue with warm water for 15 minutes. They were then immersed in Oil Red O dye solution for staining for 20 minutes in the dark. After staining, excess dye was washed off, and the sections were drained. They were then immersed in 60% isopropanol to remove non-specifically bound Oil Red O dye from the tissue. Photos were taken after sealing with neutral resin to detect lipid deposition and cell damage. Hematoxylin-Eosin Staining of Frozen Sections of Mouse Aortic Valve Hematoxylin-stained sections of the aortic valve were performed on aortic valve sections, and the staining procedure was the same as that of hematoxylin-stained sections of the mouse aortic valve. The washed and drained sections were then immersed in the eosin staining tank, taken out after 5 seconds, and quickly transferred to distilled water to wash off excess dye, completing the eosin staining. Samples were taken after sealing with neutral resin to detect tissue lesions. Paraffinized Sections of Mouse Liver, Spleen, Lung, and Kidney Tissues and Hematoxylin-Eosin Staining (H&E staining) After embedding the sections according to conventional procedures, they were dewaxed in xylene using conventional methods and then hydrated with gradient alcohol. After hydration, they were rinsed with running water and stained with hematoxylin for 5 minutes. After successful hematoxylin staining, they were rinsed with running water and dehydrated with gradient alcohol. After dehydration, eosin staining was performed for 1 minute. The sections were sealed with neutral resin and photographed to detect drug toxicity. Cell Culture Raw264.7/ HepG-2 Cells (Chinese Academy of Sciences Cell Bank in Shanghai, China) were cultured in DMEM high glucose medium mixed with 10% fetal bovine serum (BI, catalog number: C04001-500, Israel), and a mixture of 100 U/mL penicillin and 100 mg/mL streptomycin (Solarbio, catalog number: G1120, Beijing, China), in a 37°C, 5% CO2 incubator (SANYO, model: MCO-15AC, Osaka, Japan). In Vitro Lipid Deposition Assay and Oil Red O Staining Raw264.7/HepG-2 cells were cultured for 12 hours and then starved for 12 hours, followed by the addition of 50 μg/mL ox-LDL and gradient concentrations of LEV (0.05 mg/mL, 0.1 mg/mL, 0.2 mg/mL), and cultured in the incubator for 24 hours. After washing with PBS, the cells were fixed with 4% paraformaldehyde at 37°C for 30 minutes. After fixation, the cells were washed and stained with Oil Red O at 37°C in the dark for 30 minutes. Finally, the Oil Red O was discarded, the cells were rinsed with 60% isopropanol for 5-10 seconds, and quickly washed 2-3 times with PBS. The staining results were observed and photographed under an inverted microscope. Detection of plasma PCSK9 Levels Mouse plasma was extracted according to the above steps, and the plasma PCSK9 level was detected using a mouse PCSK9 enzyme-linked immunoassay kit (ELISA, item number: MM-0748M1, Wuhan, China). RNA Isolation, cDNA Synthesis, and Real-Time quantitative PCR Total RNA was isolated from liver tissue using the TRIzol method (Invitrogen, MA, USA), followed by DNase treatment. Fluorescence quantitative PCR detection was performed using the Ultra SYBR Mixture kit (Kangwei Century, CW2569M, Taizhou, China) on an Eppendorf real-time PCR system. The primer sequences are provided in Table 1 . Western Blotting (WB) Western blotting was conducted by lysing cells or tissues in RIPA buffer (0.5% NP-40, 0.1% sodium deoxycholate, 150 mM NaCl, 50 mM Tris-Cl, pH 7.5). The lysate was centrifuged at 13,000 r/min at 4°C for 10 minutes, protein concentrations were determined by BCA method, and samples were prepared. Proteins were separated by SDS-PAGE, transferred to NC membranes, and probed with the indicated antibodies（β-actin: Cell Sign aling Technology, Massachusetts, USA, Cas No. 4967S; LDLR: Affinity Biosciences, Cincinnati, Ohio, USA, Cas No. DF7696; ABCG5, Proteintech, Wuhan, China, Cas No. 27722-1-AP; MTTP: Affinity Biosciences, Cincinnati, Ohio, USA; Cas No. DF6591; CD36:Abcam, Cambridge, UK; Cas No. ab17044; CPT1-α: Proteintech, Wuhan, China, Cas No.15184-1-AP). not-yet-known not-yet-known not-yet-known unknown Statistical analysis Statistical analysis was performed by Prism 8 (GraphPad, CA, USA), and data were presented as the means ± SEM. Statistical differences were assessed by one-way or two-way analysis of variance (ANOVA) test. * denotes significant difference from Model group (*P ≤ 0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001); # denotes significant difference from Ctrl group (#P≤0.05, ##P≤0.01, ###P≤0.001, ####P≤0.0001). Results LEV decreased atherosclerotic lesion in the aorta of ApoE-/- mice fed a high-fat diet This study successfully constructed an AS model in ApoE-knockout (ApoE-/-) mice fed a high-fat diet. The aortas of mice were extracted to detect the lipid deposition in the aortas. The results showed that after LEV administration, the lipid deposition in the aortas of mice was significantly reduced, and this reduction exhibited dose-dependent differences or trends ( Figure 1 ). Lipid plaque deposition under the intima of the artery and its branches was observed microscopically, with significantly lowered deposition in the low- and high-dose LEV groups compared to the model group (Figure 1A) . Oil Red O staining and quantitative analysis demonstrate that the low- and high-dose LEV groups significantly decreased full-length lipid deposition in the aorta, (Figure 1B) . Hematoxylin-Oil Red O staining and quantitative analysis show that low- and high-dose LEV groups significantly reduced lipid deposition at the aortic root (Figure 1C) . Additionally, Aortic valve H&E staining showed that the low and high dose groups of LEV significantly improved fibrous tissue thickening (Figure 6A) . Hepatic lipid metabolic capacity modulates systemic lipid homeostasis, thereby influencing lipid accumulation in the aortic intima. Liver H&E staining showed a decrease in the number of lipid droplet vacuoles in the LEV low- and high-dose LEV groups (the red arrow points to the part in the figure) (Figure 6B) . These results suggest that LEV delays AS progression by reducing lipid deposition at lesion sites. Lipid-lowering effects of LEV in blood of AS mice and in ox-LDL/ Oleic Acid -stimulated cells Elevated blood lipid levels are a direct cause of AS, leading to lipid deposition, foam cell formation, and increased hepatic lipid uptake. In this study, we measured four major blood lipid parameters in mice and investigated the effects of LEV on foam cell formation and lipid uptake in vitro. The results of four plasma lipid tests reveal that compared to the model group, the low- and high-dose LEV groups had significantly reduced levels of TG, TC, LDL-C, and HDL-C in blood, exhibiting a significant dose-dependence (Figure 2A) . In vitro studies indicated that LEV can inhibit ox-LDL-induced foaming of Raw264.7 cells and significantly reduce lipid deposition in HepG-2 cells induced by oleic acid, with a certain degree of dose dependence (Figure 2B, C) . These results indicate that LEV can reduce lipid levels in the blood and lipid deposition in vessel cells (e.g., macrophages). It is possible to reduce the uptake or deposition of lipids in the liver. LEV increased the expression of lipoprotein receptor-related genes in the liver Abnormal blood lipid levels are the direct factor leading to AS. The primary mechanism by which lipid-lowering drugs reduce blood lipid levels is to achieve a balance of blood lipids in the body and inhibit AS by adjusting TG and TC levels in the blood. As the main organ of lipid metabolism, the liver plays a vital role in maintaining blood lipid levels. This study tested the expression of lipoprotein receptor-related genes in the liver. The results showed that in the low- and high-dose LEV groups LEV significantly increased the expression levels of lipoprotein receptor-related genes LDLR, LRP1, and SR-BI at the mRNA level (Figure 3A) . The effect of LEV on LDLR protein expression, although not statistically significant, is consistent with the trend of mRNA expression (Figure 3B) . The content of PCSK9 in plasma was positively correlated with blood lipid levels. The data show that, although the difference was not statistically significant, the level of PCSK9 decreased after treatment. (Figure 3c) . The above results indicate that LEV can stimulate the liver to increase the expression of lipoprotein receptor genes on the liver surface. This phenomenon may promote the liver’s uptake of blood lipids, thereby reducing lipid levels and delaying the occurrence of AS. The impact of LEV on the expression of genes associated with cholesterol and triglyceride metabolism in the liver This study detected the expression of TC and TG metabolism-related genes in the mouse liver to determine the effect of LEV on TC and TG metabolism in the liver. The results showed that the low-dose LEV significantly increased the expression of TC synthesis-related genes HMGCR, and transportation-related genes ABCA1, ABCG5, CYP7A1, and ABCG8 at the mRNA level, while the expression levels of HMGCR, ABCG5, CYP7A1, and ABCG8 in the high-dose group also increased but were not significantly different (Figure 4A) . At the protein level, the expression trend of TC transport-related protein ABCG5 was consistent with the RNA expression trend (Figure 4B) . The results of testing the expression of TG synthesis and VLDL secretion-related genes DGAT1 and MTTP in the liver showed that although there was an increasing trend in LEV groups compared to the Model and Control groups, there was no significant difference (Figure 4C) . The above results show that low-dose LEV can significantly increase the expression of TC synthesis, metabolism, and transportation-related genes in the liver, thereby affecting TC content in the liver, while high-dose LEV has no significant effect on the expression. Moreover low and high doses of LEV had little effect on TG synthesis and transport. not-yet-known not-yet-known not-yet-known unknown Effect of LEV on Gene Expression Related to Fatty Acid Metabolism As the core of lipid metabolism, fatty acids play a vital role in the metabolism of TG and TC in the liver. This study tested the expression of genes related to fatty acid metabolism. The results showed that LEV at a relatively low dose significantly increased the expression of fatty acid (FA) synthesis-related genes ACC1 and FASn at the mRNA level (Figure 5A) . At the protein level, high dose LEV could significantly reduce the expression of fatty acid transport and fatty acid oxidation-related genes CD36 and CPT1-α (Figure 5B, C) . The above results show that LEV impairs hepatic β-oxidation and reduces the uptake FA, while simultaneously enhancing lipogenesis. LEV at a relatively high dose caused side effects The study not only confirmed the ability of LEV to delay AS, but also verified the safety of LEV in the treatment of atherosclerosis. We extracted mouse liver, kidney, lung, spleen, and aortic valve for H&E staining. The results showed that in the aortic valve, the thickening range of the inner wall of the vessel was reduced in both the low and high-dose groups of LEV. Compared with the low-dose group, the thickening range of the inner wall of the aortic valve and the phenomenon of nuclear aggregation were significantly increased in the high-dose group (Figure 6A) . In the liver structure in the low-dose LEV group was relatively intact, while the liver structure in the high-dose group was severely damaged, and the liver cords were disorganized as indicated by the yellow arrows in Figure 6B . In the spleen, the tissue structure in the low-dose LEV group was clear and intact, in the high-dose group, however, severe lesions, increased white pulps (as well as the blurred boundary of red and white pulps), damaged spleen cord and corpuscle (as indicated by the red arrow in Figure 6B ) were observed. The tissue structure of the kidney and lung was intact, and no significant histomorphological lesions (Figure 6B) appeared. The results of the serum biochemical tests showed that the levels of AST, ALT, and LDH in the plasma of mice significantly increased after the administration of LEV (Figure 6c) . The above results show that although LEV has the effect of delaying AS, it has certain side effects on the heart, liver, spleen, and blood vessels. Discussion The most significant contribution of this study is the first-time demonstration that LEV exerts a pronounced inhibitory effect on AS. Additionally, this study further elucidates the underlying mechanism by which LEV can alleviate AS through the regulation of gene expression related to hepatic cholesterol metabolism. Finally, this study has conducted a preliminary investigation into the safety of LEV use, revealing that high doses of LEV can induce certain toxic side effects on the body. These findings provide an important reference for the safety assessment of LEV in clinical applications. AS is primarily characterized by the formation of lipid plaques beneath the intima of arteries and their branches, as well as vascular remodeling and luminal narrowing. Macrophages widely infiltrate the arterial wall and transform into foam cells, which is an indispensable role in the pathogenesis of AS [16, 17] . Dysregulation of lipid metabolism and abnormal levels of blood lipids are direct pathogenic factors for AS [18, 19] . In our study, LEV significantly reduced lipid deposition in the aortas of AS mice and improved the abnormality of blood lipid levels (Figure 1, Figure 2A) . This indicates that LEV has the ability to ameliorate abnormal blood lipid levels and reduce lipid deposition in the aorta. Moreover, through lipid deposition (foam cell formation) assays in Raw264.7 and HepG2 cells, we found that LEV can improve macrophage foam cell formation and enhance the liver’s lipid metabolism capacity (Figure 2B, C) . The liver maintains lipid homeostasis through FA, TG, and TC metabolism (including endogenous, exogenous, and reverse transport pathways) [20-22] . As the core regulator of blood lipid levels, hepatic lipid metabolism capacity was targeted in this study to explore the effect of LEV on the expression of genes related to hepatic lipid metabolism (Figure 7) , thereby clarifying its lipid-regulating mechanism. LEV significantly upregulated the expression of hepatic lipoprotein receptors (LRP1, LDLR, SR-BI) and the TC synthesis gene HMGCR (Figure 3A, B, 4A) , suggesting that it can promote hepatic lipid uptake and endogenous TC synthesis. Meanwhile, the expression of TC efflux-related genes (ABCA1, CYP7A1, ABCG5, ABCG8) was also significantly increased, indicating that LEV maintains hepatic TC metabolic balance through bidirectional regulation, laying a foundation for improving dyslipidemia (Figure 4A, B) . In atherosclerotic mice, LEV had minimal effects on the expression of genes related to TG synthesis and very low-density lipoprotein (VLDL) secretion (DGAT1, MTTP) (Figure 4C) . After low-dose LEV treatment, the expression of hepatic FA uptake protein CD36 and β-oxidation gene CPT1-α remained unchanged, while the expression of FA synthesis genes (ACC1, FASn) was significantly upregulated (Figure 5A-C) , reflecting its selective regulation of FA metabolism and weak impact on TG metabolism. Furthermore, proprotein convertase subtilisin/kexin type 9 (PCSK9) is a secretory protein negatively correlated with LDLR expression, and its inhibitors have been confirmed to reduce serum LDL-C levels [23, 24] . In this study, although LEV did not cause a significant difference in serum PCSK9 levels in mice, PCSK9 levels showed a significant downward trend with increasing LEV doses (Figure 3C) . This suggests that LEV can downregulate PCSK9 in a dose-dependent manner, weaken its inhibitory effect on LDLR, and enhance hepatic LDL-C uptake to delay AS progression. In conclusion, LEV regulates blood lipids mainly by upregulating lipoprotein receptors to enhance lipid uptake, promoting FA synthesis, and strengthening reverse TC transport. Its effect is concentrated on the total TC metabolic pathway and has little correlation with the TG metabolic pathway. This study provides molecular mechanism support for the application of LEV in dyslipidemia and AS-related diseases. Although this study first confirmed the potential of LEV to delay AS, its toxic and side effects on the body cannot be ignored (Figure 6) . Both pathological section staining and serum biochemical tests have shown the toxicity of LEV to the heart, liver, and spleen, which is an issue that cannot be ignored when LEV is applied to the treatment of AS. In clinical medication, addressing the toxic and side effects of drugs is a matter of great importance and a consistent research direction for scientists. Cyclodextrin is a cyclic structure with a hydrophobic cavity, and its subtype β-cyclodextrin, with a cavity of moderate size, is widely used. It has the advantages of increasing the solubility, bioavailability, and stability of inclusion complexes, as well as reducing the toxic and side effects of drugs, and is commonly used to form drug carriers through complexation [25, 26] . Our previous work has demonstrated that cyclodextrin can reduce drug toxicity and enhance therapeutic efficacy [27] . Building on this, we will next investigate the feasibility of a cyclodextrin-encapsulated levofloxacin formulation for atherosclerosis treatment, aiming to advance research in this field. Conflict of Interest No conflicts of interest. The manuscript has been seen and approved by all authors. Acknowledgements This study was supported by the Natural Science Foundation of Jiangxi Province of China (20212ACB206035). Data Availability The data that support the findings of this study are available from the corresponding author upon reasonable request. Some data may not be made available because of privacy or ethical restrictions. References 1. Allahverdian S,Ortega CFrancis G A (2022) Smooth Muscle Cell-Proteoglycan-Lipoprotein Interactions as Drivers of Atherosclerosis. Handb Exp Pharmacol 270:335-358. doi: 10.1007/164_2020_364.2. Cainzos-Achirica M,Glassner K,Zawahir H S,Dey A K,Agrawal T,Quigley E M M,Abraham B P,Acquah I,Yahya T,Mehta N NNasir K (2020) Inflammatory Bowel Disease and Atherosclerotic Cardiovascular Disease: JACC Review Topic of the Week. J Am Coll Cardiol 76:2895-2905. doi: 10.1016/j.jacc.2020.10.027.3. Yin K,Liang S,Tang X,Li M,Yuan J,Wu M,Li HChen Z (2021) The relationship between intracranial arterial dolichoectasia and intracranial atherosclerosis. Clin Neurol Neurosurg 200:106408. doi: 10.1016/j.clineuro.2020.106408.4. Buja L M (2020) Innovators in atherosclerosis research: A historical review. Int J Cardiol 307:8-14. doi: 10.1016/j.ijcard.2020.02.016.5. Lusis A J (2000) Atherosclerosis. Nature 407:233-41. doi: 10.1038/35025203.6. Baaten C,Nagy M,Bergmeier W,Spronk H M HVan Der Meijden P E J (2024) Platelet biology and function: plaque erosion vs. rupture. Eur Heart J 45:18-31. doi: 10.1093/eurheartj/ehad720.7. Balling M,Afzal S,Davey Smith G,Varbo A,Langsted A,Kamstrup P RNordestgaard B G (2023) Elevated LDL Triglycerides and Atherosclerotic Risk. J Am Coll Cardiol 81:136-152. doi: 10.1016/j.jacc.2022.10.019.8. Björkegren J L MLusis A J (2022) Atherosclerosis: Recent developments. Cell 185:1630-1645. doi: 10.1016/j.cell.2022.04.004.9. Susser L IRayner K J (2022) Through the layers: how macrophages drive atherosclerosis across the vessel wall. J Clin Invest 132:doi: 10.1172/jci157011.10. Wang X,Shen Y,Shang M,Liu XMunn L L (2023) Endothelial mechanobiology in atherosclerosis. Cardiovasc Res 119:1656-1675. doi: 10.1093/cvr/cvad076.11. Weber C,Habenicht A J RVon Hundelshausen P (2023) Novel mechanisms and therapeutic targets in atherosclerosis: inflammation and beyond. Eur Heart J 44:2672-2681. doi: 10.1093/eurheartj/ehad304.12. Wimer S M,Schoonover LGarrison M W (1998) Levofloxacin: a therapeutic review. Clin Ther 20:1049-70. doi: 10.1016/s0149-2918(98)80104-5.13. Liuba P,Karnani P,Pesonen E,Paakkari I,Forslid A,Johansson L,Persson K,Wadström TLaurini R (2000) Endothelial dysfunction after repeated Chlamydia pneumoniae infection in apolipoprotein E-knockout mice. Circulation 102:1039-44. doi: 10.1161/01.cir.102.9.1039.14. Zamorano J,Suarez A,Garcia Tejada J,Culebras E,Castañón J,Picazo J,Moreno RSanchez-Harguindey L (2003) Prevalence of Chlamydia pneumoniae in the atherosclerotic plaque of patients with unstable angina and its relation with serology. Int J Cardiol 89:273-9. doi: 10.1016/s0167-5273(02)00507-7.15. Sawayama Y,Tatsukawa M,Kikuchi K,Maeda S,Ohnishi H,Furusyo NHayashi J (2007) Effect on carotid atherosclerosis of probucol plus levofloxacin for Chlamydia pneumoniae infection. J Infect Chemother 13:92-8. doi: 10.1007/s10156-007-0510-2.16. Do T H,Ma F,Andrade P R,Teles R,De Andrade Silva B J,Hu C,Espinoza A,Hsu J E,Cho C S,Kim M,Xi J,Xing X,Plazyo O,Tsoi L C,Cheng C,Kim J,Bryson B D,O’neill A M,Colonna M,Gudjonsson J E,Klechevsky E,Lee J H,Gallo R L,Bloom B R,Pellegrini MModlin R L (2022) TREM2 macrophages induced by human lipids drive inflammation in acne lesions. Sci Immunol 7:eabo2787. doi: 10.1126/sciimmunol.abo2787.17. Fernandez D M,Rahman A H,Fernandez N F,Chudnovskiy A,Amir E D,Amadori L,Khan N S,Wong C K,Shamailova R,Hill C A,Wang Z,Remark R,Li J R,Pina C,Faries C,Awad A J,Moss N,Bjorkegren J L M,Kim-Schulze S,Gnjatic S,Ma’ayan A,Mocco J,Faries P,Merad MGiannarelli C (2019) Single-cell immune landscape of human atherosclerotic plaques. Nat Med 25:1576-1588. doi: 10.1038/s41591-019-0590-4.18. Fidler T P,Xue C,Yalcinkaya M,Hardaway B,Abramowicz S,Xiao T,Liu W,Thomas D G,Hajebrahimi M A,Pircher J,Silvestre-Roig C,Kotini A G,Luchsinger L L,Wei Y,Westerterp M,Snoeck H W,Papapetrou E P,Schulz C,Massberg S,Soehnlein O,Ebert B,Levine R L,Reilly M P,Libby P,Wang NTall A R (2021) The AIM2 inflammasome exacerbates atherosclerosis in clonal haematopoiesis. Nature 592:296-301. doi: 10.1038/s41586-021-03341-5.19. Williams K JTabas I (1995) The response-to-retention hypothesis of early atherogenesis. Arterioscler Thromb Vasc Biol 15:551-61. doi: 10.1161/01.atv.15.5.551.20. Aguchem R N,Okagu I U,Okorigwe E M,Uzoechina J O,Nnemolisa S CEzeorba T P C (2024) Role of CETP, PCSK-9, and CYP7-alpha in cholesterol metabolism: Potential targets for natural products in managing hypercholesterolemia. Life Sci 351:122823. doi: 10.1016/j.lfs.2024.122823.21. Qi L,Liu D,Qu Y,Chen B,Meng H,Zhu L,Li L,Wang S,Liu C,Zheng G,Lian Q,Yin G,Lv L,Lu D,Chen X,Xue F,An P,Li H,Deng H,Li L,Qian LHuo Y (2023) Tafolecimab in Chinese Patients With Hypercholesterolemia (CREDIT-4): A Randomized, Double-Blind, Placebo-Controlled Phase 3 Trial. JACC Asia 3:636-645. doi: 10.1016/j.jacasi.2023.04.011.22. Ray K K,Wright R S,Kallend D,Koenig W,Leiter L A,Raal F J,Bisch J A,Richardson T,Jaros M,Wijngaard P L JKastelein J J P (2020) Two Phase 3 Trials of Inclisiran in Patients with Elevated LDL Cholesterol. N Engl J Med 382:1507-1519. doi: 10.1056/NEJMoa1912387.23. Alves-Bezerra MCohen D E (2017) Triglyceride Metabolism in the Liver. Compr Physiol 8:1-8. doi: 10.1002/cphy.c170012.24. Houten S MWanders R J (2010) A general introduction to the biochemistry of mitochondrial fatty acid β-oxidation. J Inherit Metab Dis 33:469-77. doi: 10.1007/s10545-010-9061-2.25. Granero G E,Maitre M M,Garnero CLonghi M R (2008) Synthesis, characterization and in vitro release studies of a new acetazolamide-HP-beta-CD-TEA inclusion complex. Eur J Med Chem 43:464-70. doi: 10.1016/j.ejmech.2007.03.037.26. Wu J,Li J,Shao W,Hu Y,Chen H,Chen Y,Chen Y,Liu QAo M (2024) Cyclodextrins as therapeutic drugs for treating lipid metabolism disorders. Obes Rev 25:e13687. doi: 10.1111/obr.13687.27. Li Y,Zhou J,Gu J,Shao QChen Y (2022) Enhanced antibacterial activity of levofloxacin/hydroxypropyl-β-cyclodextrin inclusion complex: In vitro and in vivo evaluation. Colloids Surf B Biointerfaces 215:112514. doi: 10.1016/j.colsurfb.2022.112514. not-yet-known not-yet-known not-yet-known unknown Table1 Primer sequence not-yet-known not-yet-known not-yet-known unknown LDLR TGACTCAGACGAACAAGGCTG ATCTAGGCAATCTCGGTCTCC LRP1 ACTATGGATGCCCCTAAAACTTG GCAATCTCTTTCACCGTCACA SR-BI GGAGCATTCCTTGTTCCTA TGCCCTTGACAGATTTGAT HMGC CAGGATGCAGCACAGAATGT CTTTGCATGCTCCTTGAACA SREBP-2 AAGCTGGGCGATGGATGAG ATCTCGTCGATGTCCCCG ABCA1 AAAACCGCAGACATCCTTCAG CATACCGAAACTCGTTCACCC ABCG5 AGGGCCTCACATCAACAGAG GCTGACGCTGTAGGACACAT ABCG8 CTGTGGAATGGGACTGTACTTC GTTGGACTGACCACTGTAGGT CYP7A1 CTGTCATACCACAAAGTCTTATGTCA ATGCTTCTGTGTCCAAATGCC DGAT1 TCCGTCCAGGGTGGTAGTG TGAACAAAGAATCTTGCAGACG MTTP CTCTTGGCAGTGCTTTTTCTCT GAGCTTGTATAGCCGCTCATT ACC1 GATGAACCATCTCCGTTGGC GACCCAATTATGAATCGGGAGTG Fasn GGCATCATTGGGCACTCCTT GCTGCAAGCACAGCCTCTCT SREBP-1 GCAGCCACCATCTAGCCTG CAGCAGTGAGTCTGCCTTGAT Supplementary Material File (figures.docx) Download 3.65 MB Information & Authors Information Version history V1 Version 1 17 September 2025 Copyright This work is licensed under a Non Exclusive No Reuse License. Authors Affiliations Qing-hua Sheng Nanchang University View all articles by this author Xiao-yong Ren Nanchang University View all articles by this author Hong-da Zhuang Nanchang University View all articles by this author Jin-hua Zhou Nanchang University View all articles by this author Tong Rong Nanchang University View all articles by this author Kun Wang Nanchang University View all articles by this author Ying Qin Nanchang University View all articles by this author Hao-nan Zhao Nanchang University View all articles by this author Li-zhen Chen Nanchang University View all articles by this author Min Zeng Nanchang University View all articles by this author Fen-fen Zhou Nanchang University View all articles by this author Yong Chen [email protected] Nanchang University View all articles by this author Metrics & Citations Metrics Article Usage 138 views 97 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Qing-hua Sheng, Xiao-yong Ren, Hong-da Zhuang, et al. Levofloxacin Ameliorates Atherosclerosis By Regulating Lipid Metabolism. Authorea . 17 September 2025. DOI: https://doi.org/10.22541/au.175814478.86847010/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.175814478.86847010/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9fed1641b91ce2c5',t:'MTc3OTI5ODQxMQ=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();