Fungal endophytes promote wheat (Triticum aestivum L., genotype-PBW-343) growth and enhance salt tolerance through improvement of ascorbate-glutathione cycle and gene expression

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background and aims Wheat (Triticum aestivum L.) faces considerable challenges in terms of growth and productivity due to soil salinity, which is a major constraint to agricultural success. This study investigated the potential of fungal endophytes to enhance wheat growth and improve salt tolerance by influencing the ascorbate-glutathione cycle and gene expression. Methods Experiments were conducted, usingwheat seedlings (PBW-343) inoculated with endophytic fungi (Cladosporium parahalotolerant and Aspergillus medius)isolated from salt-tolerant wheat genotypes (KRL-210, KRL-213 and KRL-19) fromthe previous study. Endophytic fungi were used individually and in combination. Fifteen days seedlings exposed to 100 mM NaCl in the presence and absence of fungal endophytes. To elucidate the molecular mechanism, gene expression analysis was performed on key genesAPX, SOD, GR, DHAR, and MDHAR. Results Seedlings treated with endophytic fungi (consortia form)significantly enhanced the sugar, protein, chlorophyll, carotenoid content, and chlorophyll fluorescence (Fv/Fm)compared to control under salt stress. The O2- and lipid peroxidation levels were significantly reduced in plants inoculated with fungal endophytes. Salt stress increased APX, SOD activities and decreased GR, MDHARand DHAR activities.Endophytic fungi inoculated with salt-stressed seedlings enhanced the above-mentioned indicators compared to the salt-stressed plants without fungal endophytes, as well as in the ratios of AsA/DHA and GSH/GSSG.Endophytic fungienhanced the transcript levels of SOD, DHAR, APX, GR, and MDHAR genes compared to the control Conclusions The present study found that the expression levels of several genes associated with the ascorbate-glutathione cycle were upregulated in endophyte-inoculated plants, indicating a more efficient antioxidant system capable of scavenging reactive oxygen species.
Full text 203,648 characters · extracted from preprint-html · click to expand
Fungal endophytes promote wheat (Triticum aestivum L., genotype-PBW-343) growth and enhance salt tolerance through improvement of ascorbate-glutathione cycle and gene expression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Fungal endophytes promote wheat (Triticum aestivum L., genotype-PBW-343) growth and enhance salt tolerance through improvement of ascorbate-glutathione cycle and gene expression RAVINDRA NATH KHARWAR, Priyanka Prajapati, Prashasti Pandey, Deepak Kumar This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4874583/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background and aims Wheat (Triticum aestivum L.) faces considerable challenges in terms of growth and productivity due to soil salinity, which is a major constraint to agricultural success. This study investigated the potential of fungal endophytes to enhance wheat growth and improve salt tolerance by influencing the ascorbate-glutathione cycle and gene expression. Methods Experiments were conducted, usingwheat seedlings (PBW-343) inoculated with endophytic fungi (Cladosporium parahalotolerant and Aspergillus medius)isolated from salt-tolerant wheat genotypes (KRL-210, KRL-213 and KRL-19) fromthe previous study. Endophytic fungi were used individually and in combination. Fifteen days seedlings exposed to 100 mM NaCl in the presence and absence of fungal endophytes. To elucidate the molecular mechanism, gene expression analysis was performed on key genesAPX, SOD, GR, DHAR, and MDHAR. Results Seedlings treated with endophytic fungi (consortia form)significantly enhanced the sugar, protein, chlorophyll, carotenoid content, and chlorophyll fluorescence (Fv/Fm)compared to control under salt stress. The O2- and lipid peroxidation levels were significantly reduced in plants inoculated with fungal endophytes. Salt stress increased APX, SOD activities and decreased GR, MDHARand DHAR activities.Endophytic fungi inoculated with salt-stressed seedlings enhanced the above-mentioned indicators compared to the salt-stressed plants without fungal endophytes, as well as in the ratios of AsA/DHA and GSH/GSSG.Endophytic fungienhanced the transcript levels of SOD, DHAR, APX, GR, and MDHAR genes compared to the control Conclusions The present study found that the expression levels of several genes associated with the ascorbate-glutathione cycle were upregulated in endophyte-inoculated plants, indicating a more efficient antioxidant system capable of scavenging reactive oxygen species. Triticum aestivum L. Fungal endophyte Salt stress Reactive oxygen species (ROS) Ascorbate-glutathione cycle Defensive system gene expression Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Wheat ( Triticum aestivum L.) is one of the world’s most essential cereal crops, constituting a significant portion of the global food supply and serving as a staple for millions of people. However, its productivity is severely affected by various environmental stresses, among which soil salinity is a critical challenge. Soil salinity as a major abiotic stress factor adversely affects plant growth, leading to reduced yield and economic losses in agricultural systems worldwide (Elbagory 2023; Kaya et al. 2023; Munns and Tester 2008; Sharma 2023; Wang et al. 2023). As global climate change continues to exacerbate soil salinization, it is imperative to develop sustainable strategies to enhance crop tolerance and improve agricultural productivity. At present, salt affects over 6% of the world's arable land primarily in the dry and semiarid regions (Bui 2013). Thus, food security and the sustainability of agriculture worldwide are gravely threatened. It is imperative, therefore, to devise effective and efficient methods for mitigating the detrimental effects of salt stress on plant growth and development. Although novel cultivars with better salt resistance have been created using conventional breeding and transgenic technology, breeding for salt tolerance has not been successful (Phang et al. 2008). Difficulties arise because of the lengthy breeding cycle and low breeding efficiency of the quantitative trait. Using transgenic technology, salt-tolerant genes can be introduced in new plant materials (Lu et al. 2007; Otaibi et al. 2024; Sairam and Tyagi 2004; Sahi et al. 2006), but it has been criticized due to gene loss, high cost, and other regulatory concerns (Glick 2007). The use of exogenous compounds to counteract the negative effects of abiotic stress increases the plant tolerance to salt stress. Examples of such compounds include chitooligosaccharides (Zou et al. 2015), oligochitosan (Ma et al. 2012), nitric oxide and calcium nitrate (Tian et al. 2015), jasmonic acid (Qiu et al. 2014), gibberellic acid and calcium chloride in linseed ( Linum usitatissimum ; Khan et al. 2010), and ascorbic acid in broad beans ( Vicia faba ; Younis et al. 2010). It has been demonstrated that these exogenous substances increase the ability of plants to withstand salt stress; however, the precise physiological processes involved remain unclear. The use of bacteria and fungi that promotes plant development to induce tolerance to abiotic stress is a novel and highly recent technology that has garnered much interest. This is a useful strategy for increasing plant resistance to salt stress and could aid in the creation of sustainable agricultural systems.In recent years, plant-microbe interactions have become a viable approach for solving the problems caused by salt in the soil. Among these interactions, the symbiotic association between plants and fungal endophytes has gained significant attention because of its potential to promote plant growth and confer tolerance to abiotic stresses including salinity (Chowdhary et al. 2024; Chauhan et al. 2024; Koudadaria et al. 2023; Prajapati et al, 2024; Rodriguez et al. 2008). Microorganisms, known as fungal endophytes, live inside plant tissues and have a significant impact on host plant physiology and stress responses, without exhibiting any outward signs of disease (Pertini 1991). Fungal endophytes have various beneficial effects on host plants, including nutrient acquisition, enhanced water uptake, and protection against pathogens and herbivores (Compant et al. 2010). Additionally, they play a crucial role in regulating plant responses to abiotic stress by inducing stress-related genes and modulating antioxidant defence systems (Asaf et al. 2023; Aizaz et al. 2023; Cao et al. 2023; EL-Sayed et al. 2022; Lubna et al. 2022; Rodriguez et al. 2009; Shen et al. 2023; Zhang et al. 2016; Zou et al. 2023). One of the most important antioxidant defence mechanisms in plants is the ascorbate-glutathione cycle, which scavenges reactive oxygen species (ROS) generated under stressful conditions and preserves cellular redox homeostasis (Noctor et al. 2012; Popovic et al. 2024). Salt stress causes plant cells to produce ROS, including superoxide, hydrogen peroxide, and hydroxyl radicals (Mittler 2002). An overabundance of ROS can cause oxidative damage to proteins, lipids, and nucleic acids, ultimately hindering the growth and development of plants (Foyer and Noctor 2005). In order to resist the oxidative damage brought out by salt stress, plants need a robust antioxidant system(Foyer and Kunert 2024; Liu et al. 2024). In a previous study (Ghorai et al. 2023;Khan et al. 2015; Li et al. 2023; Ren et al. 2021; Sadeghi et al. 2019; Wang et al. 2017), fungal endophytes are involved in improving the ascorbate-glutathione cycle in plants under abiotic stress conditions. Endophytes can affect the activity of important AsA-GSH cycle enzymes including superoxide dismutase (SOD), ascorbate peroxidase (APX), glutathione reductase (GR), dehydroascorbate reductase (DHAR), and monodehydroascorbate reductase (MDHAR). This can result in an increased ability to scavenge reactive oxygen species (ROS) (Li et al. 2023; Rong et al. 2022; Waqas et al. 2012; Wang et al. 2023; Zou et al. 2023). Furthermore, fungal endophytes can modulate gene expression in host plants, thereby influencing various physiological processes including stress responses. Several studies have reported changes in the expression of stress-responsive genes such as those encoding heat shock proteins, late embryogenesis abundant (LEA) proteins, and various transcription factors in endophyte-inoculated plants under salt stress conditions (Varma et al. 2012). These changes in gene expression likely contribute to the enhanced stress tolerance observed in endophyte-associated plants (Aizaz et al. 2023; Zhan et al. 2016; Zou et al. 2023). Despite a growing body of research on the beneficial effects of endophytic fungi in enhancing plant development and stress tolerance, there is still a knowledge gap regarding their specific roles in promoting wheat growth and conferring salt tolerance. The present study is, thus, aimed to address this gap by investigating the effects of selected fungal endophytes on wheat plants grown under saline conditions. We hypothesized that these endophytes could improve wheat growth and enhance salt tolerance by positively modulating the ascorbate-glutathione cycle and regulating stress-responsive gene expression. Material and methods Endophytic fungi We previously isolated and identified endophytic fungi from tissues of salt-tolerant wheat genotypes (KRL-19, KRL-213 and KRL-210), such as leaves, stems, and roots, in our laboratory. Two out of 20 fungal endophytes were found potential, that are, C.parahalotolerant L. isolate KRL213/150 (accession number: ON714989) and A.medius isolate KRL-19/200 (accession number: ON753782). For the purposes of this study, these two isolates were used individually and in combination (Prajapati et al. 2024). Endophyte inoculum preparation A. medius and C. parahalotolerant were inoculated on PDA and conidial suspensions were prepared using the method described by Zhang et al. (2014). Two-week-old culture plates were flooded with 10 ml of sterile distilled water consisting of 0.1per cent (v/v) Tween 80 to maintain a final suspension of 1.0x10 8 spores ml -1 , which was stored at 4 o C. Plant material and treatment conditions Under ideal humidity, temperature and light conditions (25°C, 60 percent relative humidity, and 600 molm -2 s -1 ) the experiment was conducted in a glasshouse chamber during the wheat growing season (November-February). Eight groups were formed for the experiment: a control group that did not receive any treatment from the fungus or the 100 mM NaCl solution; a negative control group that received treatment from the 100 mM NaCl solution; three positive control groups comprised of C . parahalotolerant, A. medius , and C. parahalotolerant + A. medius ; and a stressed group that received treatment from the fungus and 100 mM NaCl and contained C. parahalotolerant + A. medius and C. parahalotolerant + NaCl, A. medius + NaCl. Wheat seeds were collected from an endophyte spore solution and left to dry in the open after being submerged overnight. Twenty fungal-coated seeds were placed in a perforated pot filled with autoclaved soil, all of which had three replicates, and were organized in a completely randomized block arrangement. After a week of wheat plant growth, NaCl treatment was initiated in accordance with previously described methodology (Prajapati et al. 2024; Sheng et al. 2008). To prevent salts from interfering with the growth of different endophytic fungi and causing osmotic shock to the roots of the plants, 50 ml of a solution containing the recommended concentration of NaCl was applied to the soil every seven days in each pot. Plants were routinely irrigated with distilled water twice a week (Fig. 1). Endophytic fungi establishment in inoculated plants To verify the presence of endophytic fungi in the plants, tissue samples (stems, leaves, and roots) from ten plants were collected 16 d after inoculation. The same reference was used for the identification and isolation of fungal endophytes (Prajapati et al. 2024). Quantification of photosynthetic pigments By extracting 0.5 g of leaf material in 10 ml of 80 per cent acetone, chlorophyll (Chl) and carotenoids (Car) were measured spectrophotometrically using the method described by Agrawal and Rathore (2007). Measurement of chlorophyll fluorescence The photochemical effectiveness of photosystem II (PSII) was determined by measuring the variable fluorescence to maximum fluorescence (Fv/Fm) ratio of chlorophyll fluorescence using a portable fluorometer (Pocket PEA, Hansatech, England)as summarized by Rivero et al. (2009)., Measurement of malondialdehyde (MDA) level The Hodges et al. (1999) procedure was used to measure the MDA levels in the leaves. Two hundred mg of leaf powder and 2.5 mL of 0.1 percent TCA (Trichloroacetic Acid) were combined, and the mixture was centrifuged at 10,000×g for 15 min at 4 o C. Then, 4 ml of 0.5 per cent TBA (Thiobarbituric acid) and 1 mL of 20 per cent TCA were mixed with the supernatant. The blend was cooled in an ice bath for approximately 20 min in a water bath at 90°C. The mixture was then centrifuged for 10 min at 15,000 × g, and 532 nm was used to calculate the absorbance. O 2 - deposition detection using nitrobluetetrazolium (NBT) staining Wang et al. (2007) stated that the detection of O 2 - requires the ability to decrease Nitro Blue Tetrazolium (NBT). Under salt stress conditions, wheat leaves were treated with fungal endophytes. After 15 days, the NaCl-treated and control samples were used to monitor O 2 - buildup. The leaf samples were submerged in an amber-colored vial that contained 100 mg of NBT in 0.05M sodium phosphate buffer (pH 7.5). The NBT solution (0.2%) was prepared by adding 50 mL to the final volume, and the sample was stored for 8h in a dark environment. After eight hours of incubation, the leaves were placed on a filter paper and cooked in 96 per cent ethanol to eliminate chlorophyll. Superoxide anion (O 2 - ) accumulation was visible in the dark blue color of the leaf tissue when viewed using an Olympus compound microscope. Three replicates of each treatment were maintained andthe experiments were conducted in triplicate. Soluble sugar and protein content To determine the soluble protein and sugar contents in the leaves of wheat seedlings, the leaf samples obtained from the treatment and control groups were cut into small pieces and thoroughly cleaned with distilled water thrice. Next, the tiny wheat seedling leaf fragments were dried, weighed, and placed one at a time into glass vials containing 10 mL of 80% (v/v) ethanol. The vials were heated in a water bath for 30 min at 60°C. The filtered extracts were diluted with the 80 per cent (v/v) ethanol to a final volume of 20 ml. According to Giannakoula et al. (2008), the amount of soluble sugar present in the extract was determined by comparing its content with a standard curve and glucose criteria. The soluble protein content was assayed using the Bradford method (1976). To ascertain the amount of soluble protein present in wheat seedlings leaves, the Coomassie Brilliant Blue G-250 reagent containing BSA was utilized as the standard. Assay of antioxidant metabolites The ASA content was determined according to the procedure described by Gillespie and Ainsworth (2007). 2.5 mL of 6% (w/v) TCA was combined with 50 mg of leaf powder and centrifuged at 10,000g for 10 min at 4°C. The amount of oxidized ascorbate (DHA) was calculated by subtracting the concentration of AsA from that of tASA, while the GSH and GSSG contents were assessed using the method described by Rahman et al. (2006). Following the addition of 50 mg of frozen leaf powder to an extraction buffer of 2.5 mL (which contained 50 mM potassium phosphate, 23mM sulfosalicylic acid, pH 8.0, and 5mM EDTA), the mixture was centrifuged at 10,000×g for the time of 10 min at 4°C temp. The GSSG concentration was subtracted from the total glutathione (tGSH) to estimate the concentration of GSH. Assay of antioxidant enzyme activities The leaf powder (500 mg per antioxidant enzyme) was homogenized in an extraction buffer containing 1% (w/v) polyvinylpyrrolidone (PVP) and 50 mM potassium phosphate buffer at 7.5 pH. The mixture was centrifuged at 10,000×g for 15 min at 4°C. Antioxidant enzymes were tested in the supernatant. The ability of superoxide dismutase SOD (EC 1.15.1.11) to prevent photoreduction of NBT was used to evaluate its activity, as described by Becana et al. (1986). To a 50 μl of enzyme extract, 1 mL reaction mixture, 14.3 mM methionine, 50 mM K 3 PO 4 buffer (pH 7.5), 0.1mM EDTA (Ethylenediamine tetraacetic acid), 82.5 mM NBT and 2.2 mM riboflavin were added. Fluorescent tungsten bulb (15 W) was used to illuminate the process. Ten minutes later, the reaction was terminated And the absorbance was measured at 560 nm. Ascorbate peroxidase activity (EC 1.11.1.11) was measured using the protocol described by Asada (1984). To the reaction mixture (1.0 mL) consisting of 33 μL of enzyme extract, 0.17 mM ascorbate, and 50 mM K 3 PO 4 buffer (pH 7.0), addition of 5 mM H 2 O 2 started the reaction. For three minutes, the absorbance was determined at 290 nm (ε=2.8 mM -1 cm -1 ). The activity of monodehydroascorbate reductase (MDHAR, EC 1.6.5.4) which is based on MDHA-dependent oxidation of NADH was evaluated using Drew et al. (2007). One hundred microliters of enzyme extract, 50 mM K 3 PO 4 , 0.128 units of ascorbate oxidase and 2.5 mM ascorbate were included in the standard reaction mixture (1.0mL). The reaction was initiated by the addition of 0.2 mM) And the absorbance was measured at 340 nm. The Asada (1984) method was used to assess the dehydroascorbate reductase activity (DHAR, EC 1.8.5.1). The standard reaction mixture (1.0 mL) was comprised of 50 mM K 3 PO 4 buffer (pH 7.5), 5 mM GSH, 75 μL enzyme extract, and 0.11 mM EDTA. 0.5 mM DHA was then added to initiate the reaction. The quantity of enzyme required to produce one mol of ascorbate per minute at 25°C was measured and designated as one DHAR unit. Absorbance was measured at 265 nm (ε =14.5 mM -1 cm -1 ). The glutathione activity (EC 1.6.4.2) was measured using the methodology described by Smith et al. (1988). Fifty mM K 3 PO 4 (potassium phosphate) buffer (pH 7.5), 1mM GSSG, 100 μL crude enzyme extract, and 0.75mM DTNB (5,5′-dithiobis-(2-nitrobenzoic acid) were all present in the reaction mixture (1.0 mL). The reaction was initiated by adding 0.1 mM NADPH. At 412 nm (ε = 14.15mM -1 cm -1 ), the increase in absorbance resulting from the production of TNB (5-thio-2-nitrobenzoic acid) was measured. Extraction of total RNA and analysis of gene expression by quantitative real-time reverse transcriptase-PCR (qRT-PCR) The100 mg leaves were taken separately from 15-days-old stressed and unstressed wheat seedlings, instantly frozen in liquid N2 and stored at -80°C for use in subsequent studies. The leaves were finely ground and TRIzol (Invitrogen) was used to extract total RNA. The SuperScriptTM III First-Strand Synthesis System (Invitrogen, USA) was used to synthesize cDNA from the extracted RNA, according to the manufacturer’s protocol. Synthesized cDNA was used as a template for qPCR. The NCBI candidate protein wheat EST sequences (Qiu et al. 2014; Zou et al. 2015)” were used to design specific primers. Table 1 lists the DNA sequences of primers used for SOD, APX, MDHAR, DHAR, and GR. The reaction was carried out with Lightcycler 480 SYBR green Master mix, 2X-10 μl (Roche, USA); PCR primers (Forward and Reverse), 10 mM-1μl each; 40 ng/μl-5μl; cDNA template, and PCR grade water-3 μl by utilizing a C1000TM Thermal Cycler CFX96TM Real-Time System (BIO-RAD, USA). At the conclusion of each PCR, melting curve analysis of the amplified products was performed to verify that a single PCR product was amplified. Gene expression was measured by using the delta-delta Ct method in relation to each sample's level of actin expression, an internal reference gene (Livak and Schmittgen 2001). Each reaction was performed in triplicate. Statistical analyses GraphPad Prism 8.0 was used to evaluate the data that were collected for each experimental variety. The data were subjected to a statistical analysis of the SD using IBM SPSS STATISTICS 20. The mean values have been then compared using Duncan's multiple range test (DMRT) at P < 0.05 (ANOVA SAS release 9, SAS Cary, North Carolina). PCA (Principal component analysis) was carried out by utilizing the XLSTAT software, version 2016 (www.xlstat.com, Addinsoft SARL). Results Chlorophyll (Chl) and carotenoid (Car) contents The levels of carotenoid and chlorophyll reduced in comparison to the control values of plants after treatment with 100 mM NaCl (Table 2). Irrespective of whether endophyte-associated plants were subjected to salt stress, their chlorophyll content enhanced (p < 0.05) (Table 2). Compared to the endophyte-free plants (control), the plants inoculated with a combination of the two fungal endophytes ( C. parahalotolerant + A. medius ) showed a higher chlorophyll content under salt stress conditions, with values of 51.72% and 49.34%, respectively (Table 2). The maximum increase in chlorophyll content was observed after inoculation with a combination of A. medius and C. parahalotolerant in comparison to the control. Similar to chlorophyll, the amount of carotenoids decreased as the salt stress levels increased. Also, plants that were inoculated with endophytes had higher carotenoid contents than those not inoculated with the endophytes (Table 2). Plants treated with C. parahalotolerant and A. medius fungal endophytes exhibited the highest carotenoids content with 57.14% and 50% differences from the control groups, respectively. Chlorophyll fluorescence The highest possible photochemical efficiency or potential quantum yield of PSII was determined by using the Fv/Fm ratio. Both, endophyte colonization and salt stress affected the Fv/Fm ratio. Plants inoculated with a mixture of the two fungal endophytes showed the highest Fv/Fm ratio, with a deviation of 35.71% compared to the control group (Table 2). Soluble sugar and protein contents Compared to the control, the application of fungal endophytes ( A. medius and C. parahalotolerant ) increased the amounts of protein and soluble sugar in wheat seedlings grown under salt stress and non-saline stress. However, following the application of NaCl alone, the protein and soluble sugar levels of the wheat seedlings dramatically decreased (Table 2). In contrast to the NaCl-stressed plants, the soluble sugar and protein contents in the wheat leaves increased by 44.99%, 47.76%, 60.05%, and 63.67% when treated with C. parahalotolerant and A. medius in isolation, and by 32.26%, 35.24%, 41.58%, and 44.63%, respectively when treated with A. medius and C. parahalotolerant in combination with 100 mM NaCl. The levels of soluble sugar and protein in wheat seedlings increased by priming with C. parahalotolerant and A. medius , the impact on soluble protein content being higher than that on the soluble sugar content (Table 2). MDA content The concentrations of MDA and O 2 - in the wheat seedlings were significantly elevated by salt stress (Fig. 2). When exposed to salt stress, plants primed with fungal endophytes showed distinct reaction patterns. Plants under salt stress and those free of endophytes exhibited the highest MDA contents (control). The consortia application of the two fungal endophytes ( A. medius + C. parahalotolerant ) decreased MDA concentrations by 25.16%, 43.13%, and 28.15% (Fig. 2). O 2 - deposition detection in leaves The formation of a dark blue formazan color due to the reduction of NBT is indicative of the concentration of superoxide anion (O 2 - ). The dark blue color of the formazan compound was more noticeable on leaves that had been treated with salt than with fungi. Superoxide anion deposition was greatest in stressed samples, followed by A. medius, C. parahalotolerant , and C. parahalotolerant + A. medius treated samples under stress conditions (Fig. 3). Contents of ascorbate and glutathione Salt stress dramatically reduced the levels of the antioxidant molecules (GSH and AsA) in wheat plants (Table 3). Treatment with the two fungal endophytes considerably boosted the AsA and DHA contents even under salt stress. Under salt stress conditions, the most successful therapy colonization with the two fungal endophytes substantially (p < 0.05) increased the AsA/DHA ratio by 57.81% compared to endophyte-free plants. Salt stress also significantly increased the GSH and GSSG levels (Table 3). In contrast, plants inoculated with fungal endophytes exhibited reduced GSSG levels and increased GSH levels. The plants underwent considerable reduction in the GSH/GSSG ratio upon exposure to extreme salt stress (100 mM). However, in comparison to salt-stressed plants alone, plants colonized with the two fungal endophytes showed a considerable improvement in the GSH/GSSG ratio by 74.17% (Table 3). Activities of antioxidant enzymes Antioxidant enzyme activities vary in several ways when plants are exposed to salt stress. As shown in Fig 4, plants under stress exhibited decreased MDHAR, DHAR and GR (Fig. 4-c,d,e) activities, but higher SOD and APX (Fig 4, a,b) activities compared to control. Under salt stress, there was a positive correlation between SOD and APX activities. Fungal endophytes treated with salt stress showed elevated activities of SOD, DHAR, APX, MDHAR, and GR. The most effective treatment i.e. colonizing plants with both fungal endophytes substantially raised SOD activity in wheat leaves by 23.63%, 8.83%, and 5.47% (Fig. 4A), APX activity by 51.3%, 21.3%, and 39.4% (Fig. 4B), MDHAR activity by 13.3%, 29.3%, and 53.2% (Fig. 4C, DHAR activity by 9.6%, 29.45%, and 41.4% (Fig. 4D), and the GR activity by 19.6%, 32.85%, and 79.1%, respectively (Fig. 4E) in comparison to non-colonized plants. Antioxidants differentially react to the intensity of salt stress and endophyte inoculation PCA was carried out for the different factors considered to identify the largest variability components to better understand the antioxidant variations related to endophyte inoculation as well as to the salt intensity (Fig. 5 A). Two components were identified by all parameter analyses in relation to the endophyte inoculation and salt stress conditions (Fig. 5, A). PC1 accounted for 66.04% of the overall variance, whereas PC2 accounted for 18.02% of the variance. Significant correlations were observed among SOD, GSH, MDHAR, GR, GSH/GSSG, APX, AsA, DHAR, ASA/DHA and GSSG under salt stress (Fig. 5, A). While DHA, ASA, SOD, GSH, MDHAR, GR, GSH/GSSG, APX, AsA, DHAR, ASA/DHA and GSSG were found to be linked to component 1 in PCA (Fig. 5, A), MDA, DHA, ASA/DHA, GR, SOD, MDHAR, and GSH/GSSG were linked to component 2. The PCA score plots (Fig. 5, B) showed a distinct separation of plants under salt stress. Plants that were not inoculated with endophytes showed high MDA and GSSG values, whereas those colonized by fungal endophytes showed higher levels of APX, SOD, MDHAR, DHAR, and GR (Fig. 5,B). Fungal-endophyte-colonized plants exhibited high ASA/DHA and GSH/GSSG ratios (Fig. 5, B). Measurements of the transcript levels in salt-stressed wheat seedlings using quantitative real-time PCR (qPCR) of the five genes encoding ASA-GSH cycle enzymes In this study, five genes encoded by the AsA-GSH cycle enzymes were measured in salt-stressed wheat seedlings to explore the influence of fungal endophytes on the AsA-GSH cycle at the molecular level. Transcript levels of SOD and APX genes increased under salt stress conditions as compared to the control [Fig. 6 (A and B)]. In contrast, the transcript levels of DHAR, MDHAR and GR genes decreased under salt stress conditions and all other treatments compared to the control. Under salt stress, the fungal endophyte treatment significantly increased the transcript levels of SOD, DHAR, APX, GR and MDHAR genes compared to the control (Figure 6, A, B, C, D, and E). Plants treated with both endophytic fungi significantly upregulated transcript levels of SOD, APX, MDHAR, DHAR and GR genes compared to plants treated with individual fungus. Discussion According to earlier studies (Chauhan et al. 2024; Mahmood et al. 2012; Otaibi et al. 2024; Prajapati et al. 2022; Prajapati et al. 2024; Zhang et al. 2016), higher salinity levels are among the primary environmental stressors that affect plant’s biochemically, restrict plant growth and reduce plant productivity. The potential of these symbionts to produce broad-spectrum resistance to plant diseases and their amazing interactions with host plants are well-known (Harman et al. 2004; Naseby et al. 2000; Yedidia et al. 2003; Zhang et al. 2016). Fungal endophytes have been shown to be capable of boosting plant growth and systemic reactions in plants when they are exposed to salt stress. Our findings showed that after 15 days, NaCl treatment dramatically reduced the growth and development of wheat seedlings, and this effect was greatly mitigated by the inoculation of fungal endophytes. To the best of our knowledge, this study is the 1st to identify the function of the plant growth-promoting fungi A. medius and C. parahalotolerant in increasing the salt stress tolerance of wheat seedlings. Additionally, our investigation identified a potential mechanism by which A. medius and C. parahalotolerant mitigated the detrimental effects of NaCl stress on wheat seedlings. The physiological, biochemical, and molecular resistance of wheat seedlings to salt stress was increased by the application of endophytic fungi. In the present study, we discovered that inoculation with a fungal endophyte enhanced plant growth under salt stress conditions compared to non-inoculated plants. According to our earlier research, the most commonly observed response to endophyte inoculation in wheat plants is an increase in root and shoot system growth (Prajapati et al. 2024). Endophytes secrete secondary metabolites to protect themselves from biotic and abiotic stressors. Host plants develop significantly more when exposed to secondary metabolites released by fungi, particularly hormones such as gibberellins and auxins (Bilal et al. 2018; Gul et al. 2023; Jan et al. 2019; Lubna et al. 2022; Nanda et al. 2018; Prajapati et al 2024; Waqas et al. 2012). Our research indicated that the increasing levels of salt stress are correlated with decreasing amounts of carotenoids and chlorophyll. Chlorophyll breakdown and pigment photooxidation may be the cause of this oxidative stress indicator. Photosynthetic capacity is affected by decrease in chlorophyll content because it is a necessary component of photosynthesis. Stimulation of the net photosynthetic rate was observed in the C. parahalotolerant and A. medius endophyte-treated plants. Similar outcomes were observed in NaCl-stressed wheat ( Triticum aestivum L.), tomato ( Lycopersicum ), soybean ( Glycine max ), cotton ( Gossypium spp.), pepper ( Capsicum annuum ), and mung bean ( Vigna radiata L.) seedlings by other researchers (Chauhan et al. 2024; Liu et al. 2014; Moghaddam et al. 2021; Simaei et al. 2011; Zhang et al. 2016; Zou et al. 2023). Tariq et al. (2011) discovered that the instability of the pigment-protein complex under salt stress conditions and the oxidation of chloroplasts and chlorophyll pigments were the likely causes of the decrease in chlorophyll content in wheat seedling leaves subjected to salinity stress. Regardless of whether wheat seedlings experienced salt stress, we found that the application of fungal endophytes dramatically increased their chlorophyll content. Subsequent application may prevent ROS accumulation and production in plant tissues. Qi et al. (2012) reported comparable results in cucumber ( Cucumis sativus ) seedlings treated with NaCl. Carotenoids act as radical scavengers and singlet oxygen quenchers while also maintaining and shielding the lipid phase (Bu et al. 2012). Wheat treated with endophytes may be more resistant to salt stress because of their increased carbohydrate content. Fv/Fm ratios are frequently used as markers to demonstrate the induction of stress in plants. A plant is considered healthy and free of photosynthetic stress if its Fv/Fm ratio is 0.7 or higher (Bu et al. 2012; Ogbe et al. 2023; Sadeghi et al. 2020). Salt stress resulted in a decrease in the Fv/Fm ratio, which indicated a reduction in PSII activity and maximal quantum yield. Inactivation of the PSII donor side and certain structural alterations in PSII centers may be connected to the decline in the Fv/Fm ratio (Azad and Kaminskyj 2016; Irshad et al. 2023; Tóth et al. 2005). It has been discovered that Fv/Fm is dramatically increased in endophyte-colonized wheat and other crop plants under severe salt stress, although the potential interactions between chlorophyll fluorescence and fungal endophytes are still poorly understood (Siddiqui et al. 2022). Our findings showed that the maximum fungal endophyte inoculation increased quantum yield and PSII activity. In the present study, colonization by fungal endophytes inhibited lipid peroxidation at all stress levels, whereas salt stress led to a significant increase in MDA concentration (lipid peroxidation). This might be due to the fact that endophytes protect plants from oxidative stress by preventing membrane damage and eliciting antioxidant responses. Comparable outcomes of endophyte treatment on various agricultural plants have also been reported (Azad and Kaminskyj 2016; Gul et al. 2023; Li et al. 2023; Prajapati et al. 2024; Siddiqui et al. 2022; Zhang et al. 2016). The accumulation of O 2 - following NaCl treatment, as demonstrated by the findings of the histochemical experiments, indicated the deposition of blue coloration and dark brown coloration on the surface of leaves. Owing to the extensive buildup of ROS, blue and dark brown diformazan precipitates were much more noticeable in the leaves under NaCl stress. Plants treated with fungal endophytes showed a considerable reduction in ROS accumulation after 15 days. Similar results have been observed under abiotic stress conditions in crops treated with fungal endophytes (Cao et al. 2023; Chowdhury et al. 2024; Sadeghi et al. 2020; Zou et al. 2023). Superoxide radicals (O 2 - ) are neutralized by SOD to O 2 - and H 2 O, which serves as the first line of defence against ROS (Azad and Kaminskyj 2016). Osmotic molecules such as soluble carbohydrates and proteins are generally acknowledged as significant markers of plant responses to abiotic stress (Alscher et al. 2002; Azevedo-Neto et al. 2006). An extremely effective defensemechanism against oxidative damage caused by high salinity and drought stress in plant environments is usually demonstrated by increased levels of sucrose and glucose accumulation in plants. (Bartels and Sunkar 2005; Chauhan et al. 2024; Ogbe et al. 2023;Murakeozy et al. 2003; Zhang et al. 2016). However, the majority of earlier studies have identified the physiological functions of soluble sugars and their uptake by plants. We discovered that, in both salt stress and non-saline environments, fungal endophytes had a significant impact on the amount of soluble protein and sugar in wheat seedlings. The primary defence mechanism of the chloroplasts, cytosol, mitochondria, peroxisomes and apoplasts against the harmful effects of ROS is the AsA-GSH cycle. The AsA-GSH cycle, which is an efficient detoxification process against oxidative stress, contains five enzymes: SOD, DHAR, APX, GR, and MDHAR, in addition to GSH, AsA and NADPH (Asada 1999; Gill et al. 2013). SOD converted superoxide to H 2 O 2 in this cycle. APX, by decreasing H 2 O 2 to water with AsA oxidation to MDHA, decreases to AsA via the monodehydroascorbate reductase (MDHAR) enzyme and disproportionates nonenzymatically to AsA and DHA. DHAR, which uses GSH as a reductant to convert DHA to AsA (Ahmad et al.2008). As a result, GSSG is produced and the GR can convert it back to GSH. (Gill et al. 2013) (Fig. 7). Under salt stress, the AsA content, DHA and AsA/DHA ratio drastically decreased in plants. Chen and Gallie (2006) also reported that reducing DHAR and MDHAR activity in salt-stressed plants led to greater DHA levels consistent with less AsA recycling; this, in turn, led to a low (i.e., more oxidized) AsA redox state. However, Table 3 clearly demonstrates that the reduction in the AsA/DHA ratio caused by salt stress was greatly reduced by inoculation with fungal endophytes. According to our study, fungal endophytes control the redox state of AsA to induce salt tolerance in wheat plants. Increasing the antioxidant enzyme activity of the AsA-GSH cycle may increase the amount of decreased AsA in the cells and its redox state. The AsA-GSH cycle plays a role in either direct or indirect elimination of ROS while GSH is a non-enzymatic antioxidant similar to AsA (Noctor and Foyer 2011). Table 3 shows that despite the decrease in the ratio of GSH to GSSG, GSSG concentration increased under salt stress conditions. However, inoculation of plants under salt stress with fungal endophytes causes the GSH pool to be transformed into reduced forms, which greatly increases the GSH/GSSG ratio. The stressed plants appeared to take up a sizable amount of GSH, which corrected the redox status, most likely triggered cellular defence systems, and prevented cellular damage. As previously stated, boosting the antioxidant enzyme activity in the AsA-GSH cycle in stressed plants might help to maintain levels of glutathione and ascorbate, the two essential antioxidants against ROS-damaging effects. Earlier studies on fungal-treated crops such as onion, maize, and wheat (Harman et al. 2004; González-Teuber as al. 2022; Prajapati et al. 2022 ) , have demonstrated similar results. According to Rawat et al. (2011), metabolites produced by Trichoderma inoculation function as quenchers during ROS generation under environmental stress, thereby protecting the plant from oxidative damage. Our results are corroborated by earlier studies described by Bagheri et al. 2013; Hamilton et al. 2012;Irshad et al. 2023; Kumar et al. 2009; Li et al. 2023; Lubna et al. 2022; Moghaddam et al. 2021; Nath et al. 2016; Popovic et al. 2024; Sadeghi et al. 2020. In the current study, salinity stress increased the SOD and APX activities, while reducing MDHAR, DHAR, and GR activities in a dose-dependent manner. In other studies, Cao et al. (2023), Chaudhry et al. (2021), Lubna et al. (2022), Popovic et al. (2024), Wang et al. (2023), Zhang et al. (2016), Zou et al. (2023) illustrated that the expression of antioxidant enzyme genes provides tolerance to abiotic stresses, including salinity by reducing the oxidative stress caused by ROS in Citrus trifoliate , Piper nigrum , Poncirus trifoliata , Glycine max L., Triticum aestivum L., and A. cepa cultivars. These results are consistent with earlier researches on Brassica parachinensis (Kamran et al. 2020) and Brassica juncea (Ahmad et al. 2015). According to researches on Fragaria sp. (Christou et al. 2014), further salinity-induced reductions in MDHAR, GR, and DHAR activities may be caused by reduced transcription of these genes, whereas decreased GR activity may be caused by NADPH deficiency under extreme stress (Gupta and Seth 2020; Prajapati et al. 2022). Comparing the same activities to those that were solely influenced by salinity, fungal endophytes enhanced APX, SOD, GR, MDHAR, and DHAR. This may be due to the overexpression of transcription and the gene translation responsible for synthesis, as observed under various abiotic stress conditions in Solanum melongena , Solanum lycopersicum (Singh and Prasad 2019), and Triticum aestivum (Sun et al. 2015; Zhang et al. 2016).Notably, MDHAR and DHAR work together to preserve the concentration of AsA and the redox state during stressful situations (Kaya et al. 2020). In contrast to the treatments using salt alone, the current study’s findings on the effects of fungal supplementation on MDHAR and DHAR activities have been found associated with an increase in AsA levels. A higher GSH/GSSG ratio is necessary for the DHAR and other GSH-dependent enzymes associated to the antioxidant defence mechanisms and fungal inoculation increasing GR activity under salinity stress contributed to this maintenance (Fig. 7). Our results corroborate the increased AsA-GSH cycle upregulation resulting from fungal endophyte inoculation, as observed in Triticum aestivum (Zhang et al. 2016; Tripathi et al. 2017), and Citrus reticulata L. (Sadeghi et al. 2020) under various abiotic stresses. Under biotic and abiotic stresses, fungal endophytes can cause significant alterations in gene expression in several plant species (Zhang et al. 2016). According to the current study, elevated ROS levels in stressed plants may be the cause of elevated APX and SOD activities because they increase the expression of genes that code for these enzymes (Bowler et al.1992; Shekhawat et al. 2010). Thus, we assessed the possible influence of fungal endophytes on the expression of genes encoding antioxidant enzymes (APX, SOD, GR, MDHAR and DHAR). We found that the expression of genes encoding APX, SOD, DHAR, MDHAR and GR led to the elevated transcription levels, which correlated with an increase in the activity of the corresponding enzymes and augmentation of APX, SOD, MDHAR, DHAR and GR. According to earlier studies (Bailey et al. 2006; Alfano et al. 2007; Zhang et al. 2016; Wang et al.2023; Popovic et al. 2024), plants treated with fungal endophytes exhibited higher expression levels of genes related to plant defense against abiotic stresses. However, comprehensive research on gene expression in fungal-endophyte-treated wheat seedlings is lacking. We have also shown that increased transcription and activity of ROS-scavenging enzymes under salt stress are correlated with ROS generation in wheat plants treated with fungal endophytes, indicating that ROS are important for regulating plant acclimation and detoxifying cellular survival (Miller et al. 2010). Furthermore, ROS serve as vital signaling molecules for cell survival and multiplication. Similar studies indicate that salinity is an environmental factor that can alter the normal homeostasis of plant cells and increase ROS production in plants. According to Miller et al. (2010), ROS are hazardous byproducts of stress metabolism and play a key role in signaling transduction molecules that are activated in response to salt stress. Conclusion Our research concluded that A. medius and C. parahalotolerant , the two endophytic fungi, have a remarkable ability to mitigate the detrimental effects of salt stress on the development and growth of wheat seedlings. Using a variety of experiments, this study enabled us to investigate the potential physiological and molecular processes by which fungal endophytes mitigate the suppressive effects of salt stress. The mechanisms could be (i) fungal endophytes boosting the antioxidative defense system activity of wheat seedlings to withstand salt stress, or (ii) elevating the relative expression levels of antioxidant genes in stressed plants. Future researches must address a few difficulties, such as the effectiveness of endophytic fungi against other plant species and abiotic pressures. Further comprehensive investigations are required to ascertain as to which substance functions as a signaling component in endophytic fungi, causing systemic modifications in the expression of genes and antioxidant enzymes that encode them. Abbreviations APX Ascorbate peroxidase SOD Superoxide dismutase GR Glutathione reductase MDHAR Monodehydroascorbate reductase DHAR Dehydroascorbate reductase AsA Ascorbate GSH Glutathione DHA Dihydroascorbic acid GSSG Oxidized glutathione ROS Reactive oxygen species TCA Trichloroacetic acid TBA Thiobarbituric acid NBT Nitrobluetetrazolium test Declarations Declaration of competing interest The writers affirm that there is no conflict of interest between them. Acknowledgments The Head and Coordinator, CAS and DST-FIST in Botany, Institute of Science, BHU, Varanasi, India, are gratefully acknowledged by the authors for providing necessary research facilities. The Institute of eminence (IoE) (R/Dev/IoE/ Incentive/2021-22/32181), BHU, Varanasi, is gratefully acknowledged by RNK for its financial support. PP is grateful to the BHU administration for financial assistance in the form of a BHU RET fellowship. Prashasti acknowledges Prime Minister Research fellowship (PMRF) for financial support in the form of fellowship. References Agrawal SB, Rathore D (2007) Changes in oxidative stress defense in wheat ( Triticum aestivum L.) and mung bean ( Vigna radiata L.) cultivars grown with and without mineral nutrients and irradiated by supplementalUltraviolet-B. Environ Exp Bot 59 (1): 21-33.https://doi.org/10.1016/j.envexpbot.2005.09.009 Ahmad P, Hashem A, Abd-Allah EF, Alqarawi AA, John R, Egamberdieva D, Gucel S (2015) Role of Trichoderma harzianum in mitigating NaCl stress in Indian mustard ( Brassica juncea L) through antioxidative defense system. Front Plant Sci 6:868. https://doi.org/10.3389/fpls.2015.00868 Ahmad P, Sarwat M, Sharma S (2008) Reactive oxygen species, antioxidants and signaling in plants. J Plant Biol 51 (3):167-173. Alfano G, Ivey MLL, Cakir C, Bos JIB, Miller SA, Madden LV (2007) Systemic modulation of gene expression in tomato by Trichoderma hamatum 382. Phytopathol 97:429-437. https://doi.org/10.1094/PHYTO-97-4-0429 Alscher RG, Erturk N, Heath LS (2002) Role of superoxide dismutases (SODs) in controlling oxidative stress in plants. J Exp Bot 53(372):1331-1341. https://doi.org/10.1093/jexbot/53.372.1331 Asada K (1984) Chloroplasts-formation of active oxygen species. Methods Enzymol 105:422-429. https://doi.org/10.1016/S0076-6879(84)05059-X Asada K (1999) The water-water cycle in chloroplasts: scavenging of active oxygen and dissipation of excess photons. Annu Plant Mol Biol 50: 601-639. https://doi.org/10.1146/annurev.arplant.50.1.601 Asaf S, Jan R, Khan MA, Khan AL, Asif S, Bilal S, Lee IJ (2023) Unraveling the mutualistic interaction between endophytic Curvularialunata CSL1 and tomato to mitigate cadmium (Cd) toxicity via transcriptomic insights. Sci Total Environ 861:160542. https://doi.org/10.1016/j.scitotenv.2022.160542 Azad K, Kaminskyj S (2016) A fungal endophyte strategy for mitigating the effect of salt and drought stress on plant growth. Symbiosis 68:73-78. https://doi 10.1007/s13199-015-0370-y Azevedo-Neto AD, Prisco JT, Enéas-Filho J, Abreu CEB, GomesFilho E (2006) Effect of salt stress on antioxidative enzymes and lipid peroxidation in leaves and roots of salt-tolerant and salt-sensitive maize genotypes. Environ Exp Bot 56:87-94. https://doi.org/10.1016/j.envexpbot.2005.01.008 Bagheri AA, Saadatmand S, Niknam V, Nejadsatari T, Babaeizad V (2013) Effect of endophytic fungus, Piriformospora indica , on growth and activity of antioxidant enzymes of rice ( Oryza sativa L.) under salinity stress. Int J Adv Biol Biomed Res 1(11):1337-1350. Bartels D, Sunkar R (2005) Drought and salt tolerance in plants. Crit Rev Plant Sci 24:23-58. https://doi.org/10.1080/07352680590910410 Becana M, Aparicio-Tejo P, Irigoyan JJ, Sanchez-Diaz M (1986) Some enzymes of hydrogen peroxide metabolism in leaves and root nodules of Medicago sativa. Plant Physiol 82:1169-1171. https://doi.org/10.1104/pp.82.4.1169 Bilal L, Asaf S, Hamayun M, Gul H, Iqbal A, Ullah I, Hussain A (2018) Plant growth promoting endophytic fungi Asprgillus fumigatus TS1 and Fusarium proliferatum BRL1 produce gibberellins and regulates plant endogenous hormones. Symbiosis 76:117-127.https://doi.org/10.1007/s13199-018-0545-4 Bowler C, Van Montagu M, Inze D (1992) Superoxide dismutase and stress tolerance. Annu Rev Plant Physiol Plant Mol Biol 43:83-116 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-254. https://doi.org/10.1016/0003-2697(76)90527-3 Bu N, Li X, Li Y, Ma C, Ma L, Zhang C (2012) Effects of Na 2 CO 3 stress on photosynthesis and antioxidative enzymes in endophyte infected and non-infected rice. Ecotox Environ Safe 78: 35-40. https://doi.org/10.1016/j.ecoenv.2011.11.007 Bui E (2013) Possible role of soil alkalinity in plant breeding for salt-tolerance. Biollett 9(5):20130566. https://doi.org/10.1098/rsbl.2013.0566 Cao JL, He WX, Zou YN, Wu QS (2023) An endophytic fungus, Piriformospora indica , enhances drought tolerance of trifoliate orange by modulating the antioxidant defense system and composition of fatty acids. Tree Physiol 43(3): 452-466. https://doi.org/10.1093/treephys/tpac126 Chance B, Maehly AC (1955) Assay of catalase and peroxidases. Methods Enzymol 2: 764-775. http://doi: 10.1002/9780470110171.ch14 Chauhan P, Singh M, Sharma A, Singh M, Chadha P, Kaur A (2024) Halotolerant and plant growth-promoting endophytic fungus Aspergillus terreus CR7 alleviates salt stress and exhibits genoprotective effect in Vigna radiata . Front Microbiol 15:1336533.https://doi.org/10.3389/fmicb.2024.1336533 Chen Z, Gallie DR (2006) Dehydroascorbate reductase affects leaf growth, development, and function. Plant Physiol 142: 775-787. https://doi.org/10.1104/pp.106.085506 Cheng L, Xu Z, Zhou X (2023) Application of Trichoderma species increases plant salinity resistance: a bibliometric analysis and a meta-analysis. J Soils Sediments 23(7): 2641-2653. https://doi.org/10.1007/s11368-023-03557-0 Chowdhury MZH, Mostofa MG, Mim MF, Haque MA, Karim MA, Sultana R, Islam SMN (2024) The fungal endophyte Metarhizium anisopliae (MetA1) coordinates salt tolerance mechanisms of rice to enhance growth and yield. Plant PhysiolBiochem 207:108328. https://doi.org/10.1016/j.plaphy.2023.108328 Christou A, Manganaris GA, Fotopoulos V (2014) Systemic mitigation of salt stress by hydrogen peroxide and sodium nitroprusside in strawberry plants via transcriptional regulation of enzymatic and nonenzymatic antioxidants. Environ Exp Bot 107:46-54. https://doi.org/10.1016/j.envexpbot.2014.05.009 Compant S, Duffy B, Nowak J, Clement C, Barka EA (2010) Use of plant growth-promoting bacteria for biocontrol of plant diseases: principles, mechanisms of action, and future prospects. Appl Environ Microbiol 71(9): 4951-4959. https://doi.org/10.1128/AEM.71.9.4951-4959.2005 Drew DP, Lunde C, Lahnstein J, Fincher GB (2007) Heterologous expression of cDNAs encoding monodehydroascorbate reductases from the moss, Physcomitrella patens and characterization of the expressed enzymes. Planta 225: 945-954. http:// doi.org/10.1007/s00425-006-0394-x Elbagory M (2023) Reducing the adverse effects of salt stress by utilizing compost tea and effective microorganisms to enhance the growth and yield of wheat ( Triticum aestivum L.) plants. Agron 13(3): 823. https://doi.org/10.3390/agronomy13030823 El-Sayed ASA, Deif HES, Hashe ESA, Fawza S (2022) Seed biopriming with Phanerochaetechrysosporium enhances tolerance of wheat to salt stress through improvement of TAEXPB23 expression. J Anim Plant Sci 32(6):1744-1753. https://doi.org/10.36899/JAPS.2022.6.0582 Foyer CH, Kunert K (2024) The ascorbate/glutathione cycle coming of age. J Exp Bot 75(9):2682-2699. https://doi.org/10.1093/jxb/erae023 Foyer CH, Noctor G (2005) Redox homeostasis and antioxidant signaling: a metabolic interface between stress perception and physiological responses. The Plant Cell 17(7): 1866-1875. https://doi.org/10.1105/tpc.105.033589 Ghorai S (2023) Endophytic fungi: a tool for managing abiotic stress in plants. In Plant metabolites under environmental stress. Apple Academic press, 1-24. Giannakoula A, Moustakas M, Mylona P, Ioannis P, Traianos Y (2008) Aluminium tolerance in maize is correlated with increased levels of mineral nutrients, carbohydrates and proline and decreased levels of lipid peroxidation and Al accumulation. J Plant Physiol 165: 385-396. https://doi.org/10.1016/j.jplph.2007.01.014 Gill SS, Tajrishi M, Madan M, Tuteja N (2013) A DESD-box helicase functions in salinity stress tolerance by improving photosynthesis and antioxidant machinery in rice ( Oryza sativa L. cv. PB1). Plant Mol Biol 82:1-22. http:// doi.org/10.1007/s11103-013-0031-6 Gillespie KM, Ainsworth EA (2007) Measurement of reduced, oxidized and total ascorbate content in plants. Nat Protoc 2:871-874. Glick BR (2007) Promotion of plant growth by bacterial ACC deaminase. Crit Rev Plant Sci 26: 227-242. https://doi.org/10.1080/07352680701572966 González-Teuber M, Contreras RA, Zúñiga GE, Barrera D, Bascuñán-Godoy L (2022) Synergistic association with root endophytic fungi improves morpho-physiological and biochemical responses of Chenopodium quinoa to salt stress. Front EcolEvol 9:787318. https://doi.org/10.3389/fevo.2021.787318 Gul H, Ali R, Rauf M, Hamayun M, Arif M, Khan SA, Lee IJ (2023) Aspergillus welwitschiae BK isolate ameliorates the physicochemical characteristics and mineral profile of maize under salt stress. Plants 12(8):1703. https://doi.org/10.3390/plants12081703 Gul Jan F, Hamayun M, Hussain A, Jan G, Iqbal A, Khan A, Lee IJ (2019) An endophytic isolate of the fungus Yarrowialipolytica produces metabolites that ameliorate the negative impact of salt stress on the physiology of maize. BMC Microbiol 19:1-10. https://doi.org/10.1186/s12866-018-1374-6 Harman GE, Howell CR, Viterbo A, Chet L, Lorito M (2004) Trichoderma species opportunistic, avirulent plant symbionts (enlínea). Nat Rev 2 (1): 43-56 Hodges DM, DeLong JM, Forney CF, Prange RK (1999) Improving the thiobarbituric acid-reactive-substances containing anthocyanin and other interfering compounds. Planta 207:(4) 604-611 Irshad K, Shaheed Siddiqui Z, Chen J, Rao Y, Wei X (2023) Bio-priming with salt tolerant endophytes improved crop tolerance to salt stress via modulating photosystem II and antioxidant activities in a sub-optimal environment. Front Plant Sci 14:1082480. https://doi.org/10.3389/fpls.2023.1082480 Kamran M, Xie K, Sun J, Wang D, Shi C, Lu Y, Xu P (2020) Modulation of growth performance and coordinated induction of ascorbate-glutathione and methylglyoxal detoxification systems by salicylic acid mitigates salt toxicity in choysum ( Brassica parachinensis L.). Ecotoxicol Environ Saf 188:109877. https://doi.org/10.1016/j.ecoenv.2019.109877 Kaya C, Ugurlar F, Ashraf M, Alam P, Ahmad P (2023) Nitric oxide and hydrogen sulfide work together to improve tolerance to salinity stress in wheat plants by upraising the AsA-GSH cycle. Plant PhysiolBiochem 194: 651-663. https://doi.org/10.1016/j.plaphy.2022.11.041 Khan AL, Waqas M, Khan AR, Hussain J, Kang SM, Gilani SA, Lee IJ (2015) Fungal endophyte Penicillium janthinellum LK5 improves growth of ABA-deficient tomato under salinity. World J MicrobBiot 31(2): 265-275. http://doi.org/10.1007/s11274-013-1378-1 Khan MN, Siddiqui MH, Mohammad F, Naeem M, Khan MMA (2010) Calcium chloride and gibberellic acid protect linseed ( Linum usitatissimum L.) from NaCl stress by inducing antioxidative defence system and osmoprotectant accumulation. Acta Physiol Plant 32: 121-132. http://doi 10.1007/s11738-009-0387-z Kouadria R, Bouzouina M, Lotmani B, Soualem S (2023) Unraveling the role of endophytic fungi in barley salt-stress tolerance. Hell Plant Prot J 16(1):12-22. https://sciendo.com/article/10.2478/hppj-2023-0002 Kubis J (2008) Exogenous spermidine differentially alters activities of some scavenging system enzymes, H 2 O 2 and superoxide radical levels in water stressed cucumber leaves. J Plant Physiol 165:397-406 Li MF, Sun BG, Xiao ZZ, Sun L (2013). First characterization of a teleost Epstein-Barr virus-induced gene 3 (EBI3) reveals a regulatory effect of EBI3 on the innate immune response of peripheral blood leukocytes. Dev Comp Immunol 41:514-522. https://doi.org/10.1016/j.dci.2013.07.022 Li, X, Sun HF, Fan JH, Li YY, Ma LJ, Wang LL, Li XM (2023) Endophyte Enhanced the Antioxidant Capacity of Rice ( Oryza sativa L.) under Drought Stress. Pol J Environ Stud 32(2). https://doi.org/10.15244/pjoes/156356 Liu S, Dong Y, Xu L, Kong J (2014) Effects of foliar applications of nitric oxide and salicylic acid on salt-induced changes in photosynthesis and antioxidative metabolism of cotton seedlings. Plant Growth Regul 73: 67-68 Liu Y, Zheng J, Ge L, Tang H, Hu J, Li X, Shi Q (2024) Integrated metabolomic and transcriptomic analyses reveal the roles of alanine, aspartate and glutamate metabolism and glutathione metabolism in response to salt stress in tomato. Sci Hortic 328:112911.https://doi.org/10.1016/j.scienta.2024.112911 Lu Z, Liu D, Liu S (2007) Two rice cytosolic ascorbate peroxidases differentially improve salt tolerance in transgenic Arabidopsis . Plant Cell Rep 26:1909-1917. http:// doi.org/10.1007/s00299-007-0395-7 Lubna Khan MA, Asaf S, Jan R, Waqas M, Kim KM, Lee IJ (2022) Endophytic fungus Bipolaris sp. CSL-1 induces salt tolerance in Glycine max . L via modulating its endogenous hormones, antioxidative system and gene expression. J Plant Interact 17(1): 319-332. https://doi.org/10.1080/17429145.2022.2036836 Ma LJ, Li YY, Yu CM, Wang Y, Li XM, Li N (2012) Alleviation of exogenous oligochitosan on wheat seedlings growth under salt stress. Protoplasma 249:393-399. http:// doi.org.10.1007/s00709-011- 0290-5 Mahmood M, Bidabadi SS, Ghobadi C, Gray DJ (2012) Effect of methyl jasmonate treatments on alleviation of polyethylene glycol mediated water stress in banana ( Musa acuminata cv. ‘Berangan’, AAA) shoot tip cultures. Plant Growth Regul 68:161-169. http:// doi.org.10.1007/s10725-012-9702-6 Miller G, Suzuki N, Ciftci-Yilmaz S, Mittler R (2010) Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ 33:453-467.https://doi.org/10.1111/j.1365-3040.2009.02041.x Miranda V, Silva-Castro GA, Ruiz-Lozano JM, Fracchia S, García-Romera I (2023) Fungal endophytes enhance wheat and tomato drought tolerance in terms of plant growth and biochemical parameters. J Fungus 9(3):384. https://doi.org/10.3390/jof9030384 Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7(9): 405-410. https://doi.org/10.1016/S1360-1385(02)02312-9 Moghaddam MSH, Safaie N, Soltani J, Hagh-Doust N (2021) Desert-adapted fungal endophytes induce salinity and drought stress resibstance in model crops. Plant PhysiolBiochem 160: 225-238. https://doi.org/10.1016/j.plaphy.2021.01.022 Munns R, Tester M (2008) Mechanisms of salinity tolerance. Annu Rev Plant Biol 59:651-68. https://doi.org/10.1146/annurev.arplant.59.032607.092911 Nanda S, Mohanty B, Joshi RK (2018) Endophyte-mediated host stress tolerance as a means for crop improvement. Endophyte Secon Metabol 2:1-25 Nath M, Bhatt D, Prasad R, Gill SS, Anjum NA, Tuteja N (2016) Reactive oxygen species generation-scavenging and signaling during plant-arbuscular mycorrhizal and Piriformospora indica interaction under stress condition. Front Plant Sci 7:1574. https://doi.org/10.3389/fpls.2016.01574 Noctor G, Foyer CH (2011) Ascorbate and glutathione: the heart of the redox hub. Plant Physiol 155: 2-18. https://doi.org/10.1104/pp.110.167569 Noctor G, Mhamdi A, Foyer CH (2012) Oxidative stress and antioxidative systems: recipes for successful data collection and interpretation. Plant Cell Environ 35(2): 214- 221. https://doi.org/10.1111/pce.12726 Ogbe AA, Gupta S, Stirk WA, Finnie JF, Staden J (2024). Endophyte inoculation enhances growth, secondary metabolites and biological activity of Endostemon obtusifolius grown under drought stress. J Plant Growth Regul 43(4): 1103-1117. https://doi.org/10.1007/s00344-023-11167-w Otaibi AI, Alghamdi SA, Abo-Elyousr KA (2024) The Influence of Salinity on Plant Growth and Amendment Strategies. Sohag J Sci 9(3): 261-267. https://doi.org/10.21608/sjsci.2024.258471.1168 Peng LiG, Wei X, Kang LG (2013) Salicylic acid increases the contents of glutathione and ascorbate and temporally regulates the related gene expression in salt-stressed wheat seedlings. Gene 529(2): 321-325. https://doi.org/10.1016/j.gene.2013.07.093 Petrini O (1991). Fungal endophytes of tree leaves. In Microbial ecology of leaves (pp. 179-197). New York, NY: Springer New York Phang TH, Shao GH, Lam HM (2008) Salt tolerance in soybean. J Integr Plant Biol 50:1196-1212. https://doi.org/10.1111/j.1744-7909.2008.00760.x Popović AV, Čamagajevac IŠ, Vuković R, Matić M, Velki M, Gupta DK, Lončarić Z (2024) Biochemical and molecular responses of the ascorbate-glutathione cycle in wheat seedlings exposed to different forms of selenium. Plant PhysiolBiochem 208:108460. https://doi.org/10.1016/j.plaphy.2024.108460 Prajapati P, Yadav M, Nishad JH, Gautam VS, Kharwar RN (2024) Salt tolerant fungal endophytes alleviate the growth and yield of saline-affected wheat genotype PBW-343. Microbiol Res 278:127514. https://doi.org/10.1016/j.micres.2023.127514 Qi WZ, Zhao L (2013) Study of the siderophore-producing Trichoderma asperellum Q1 on cucumber growth promotion under salt stress. J Basic Microbiol 53:355-364. https://doi.org/10.1002/jobm.201200031 Qiu ZB, Guo JL, Zhu AJ, Zhang L, Zhang MM (2014) Exogenous jasmonic acid can enhance tolerance of wheat seedlings to salt stress. Ecotoxicol Environ Saf 104:202-208. https://doi.org/10.1016/j.ecoenv.2014.03.014 Rahman I, Kode A, Biswas SK (2006) Assay for quantitative determination of glutathione and glutathione disulfide levels using enzymatic recycling method. Nat Protoc 1:3159-3165 Rahman KU, Ali K, Rauf M, Arif M (2023) Aspergillus nomiae and fumigatus Ameliorating the Hypoxic Stress Induced by Waterlogging through Ethylene Metabolism in Zea mays L. Microorganisms 11(8):2025. https://doi.org/10.3390/microorganisms11082025 Rawat L, Singh Y, Shukla N, Kumar J (2011) Alleviation of the adverse effects of salinity stress in wheat ( Triticum aestivum L.) by seed biopriming with salinity tolerant isolates of Trichoderma harzianum . Plant Soil 347(1-2):387. http:// doi.org.10.1007/s11104-011-0858-z Ren XN, Shan Y, Li X, Wang LL, Li YY, Ma LJ, Li XM (2021) Endophytic infection programs the ascorbate-glutathione cycle in rice ( Oryza sativa L.) under Na 2 CO 3 stress. Appl Ecol Environ Res 19(3):1895-907 Rodriguez RJ, Henson J, Van Volkenburgh E, Hoy M, Wright L, Beckwith F, Redman RS (2008) Stress tolerance in plants via habitat-adapted symbiosis. The ISME Journal 2(4):404-416. https://doi.org/10.1038/ismej.2007.106 Rodriguez RJ, White Jr, JF, Arnold AE, Redman RS (2009) Fungal endophytes: diversity and functional roles. New Phytologist 182(2): 314-330. https://doi.org/10.1111/j.1469-8137.2009.02773.x Rong ZY, Jiang DJ, Cao JL, Hashem A Abd, Allah EF Alsayed MF, Wu QS (2022) Endophytic fungus Serendipita indica accelerates ascorbate-glutathione cycle of white clover in response to water stress. Front Microbiol 13:967851. https://doi.org/10.3389/fmicb.2022.967851 Sadeghi F, Samsampour D, Seyahooei MA, Bagheri A, Soltani J (2020) Fungal endophytes alleviate drought-induced oxidative stress in mandarin ( Citrus reticulata L.): toward regulating the ascorbate-glutathione cycle. Sci Hortic 261:108991. https://doi.org/10.1016/j.scienta.2019.108991 Sahi C, Singh A, Kumar K, Blumwald E, Grover A (2006) Salt stress response in rice: genetics, molecular biology, and comparative genomics. Func Integr Genomics 6:263-284. http:// doi.org.10.1007/s10142-006-0032-5 Sairam RK, Tyagi A (2004) Physiology and molecular biology of salinity stress tolerance in plants. Current science 86 (3):407-421. https://www.jstor.org/stable/24108735 Sharma MK (2023) Plants Stress: Salt Stress and Mechanisms of Stress Tolerance. Current Agriculture Research Journal, 11(2). http://dx.doi.org/10.12944/CARJ.11.2.03 Shekhawat GS, Verma K, Jana S, Singh K, Teotia P, Prasad A (2010). In vitro biochemical evaluation of cadmium tolerance mechanism in callus and seedlings of Brassica juncea. Protoplasma 239:31-38.http://doi.org. 10.1007/s00709-009-0079-y Shen J, Chen Y (2023) Serendipita indica : A Biostimulant Enhancing Low-Temperature Tolerance and Active Constituent Levels in Polygonum cuspidatum . Agriculture 14(1): 7. https://doi.org/10.3390/agriculture14010007 Sheng M, Tang M, Chan H, Yang B, Zhang F, Huang Y (2008) Influence of arbuscular mycorrhizae on photosynthesis and water status of maize plants under salt stress. Mycorrhiza 18: 287-296. http:// doi.org.10.1007/s00572-008-0180-7. http://doi.org.10.1007/s00572-008-0180-7 Shi Q, Simpson WR, LiY Xu C, De K, Li X (2024) Epichloëbromicola Enhances Elymus dahucirus Plant Growth and Antioxidant Capacity under Cadmium Stress. Agronomy14 (2):365. https://doi.org/10.3390/agronomy14020365 Siddiqui ZS, Wei X, Umar M, Abideen Z, Zulfiqar F Chen J, Yasmeen R (2022) Scrutinizing the application of saline endophyte to enhance salt tolerance in rice and maize plants. Front Plant Sci 12: 770084. https://doi.org/10.3389/fpls.2021.770084 Simaei M, Khavarinejad RA, Saadatmand S, Bernard F, Fahimi H (2011) Interactive effects of salicylic acid and nitric oxide on soybean plants under NaCl salinity. Russ J Plant Physiol 58: 783-790. http:// doi.org.10.1134/S1021443711050220 Smith IK, Vierheller TL, Thorne CA (1988) Assay of glutathione-reductase in crude tissue-homogenates using 5,5′-dithiobis (2-nitrobenzoic acid). Anal Biochem 175: 408-413. https://doi.org/10.1016/0003-2697(88)90564-7 Suryanarayanan TS (1992) Light-incubation: a neglected procedure in mycology. Mycologist 6: 144 Tariq A, Masroor M, Khan A, Jaime A, Teixeira S, Mohd I (2011) Role of salicylic acid in promoting salt stress tolerance and enhanced artemisinin production in Artemisia annua L. J Plant Growth Regul 30:425-435. https://doi.org/10.1007/s00344-011-9205-0 Tian XY, He MR, Wang ZL, Zhang JW, Song YL, He ZL (2015) Application of nitric oxide and calcium nitrate enhances tolerance of wheat seedlings to salt stress. Plant Growth Regul 77: 343-356. http://doi.org.10.1007/s10725-015-0069-3 Tóth SZ, Schansker G, Kissimon J, Kovács L, Strasser RJ (2005) Biophysical studies of photosystemII-related recovery processes after a heat pulse in barley seedlings ( Hordeum vulgare L.). J Plant Physiol 162:181-194. https://doi.org/10.1016/j.jplph.2004.06.010 Varma A, Verma S, Sahay N, Bütehorn B, Franken P (2012) Piriformospora indica, a cultivable plant-growth-promoting root endophyte. Appl Environ Microbiol 65(6): 2741-2744. https://doi.org/10.1128/AEM.65.6.2741-2744.1999 Wang CF, Huang LL, Buchenauer H, Han QM, Zhang HC, Kang ZS (2007) Histochemical studies on the accumulation of reactive oxygen species (O 2 and H 2 O 2 ) in the incompatible and compatible interaction of wheat- Puccinia striiformis f. sp. tritici. Physiol Mol Plant Pathol 71(4-6):230-239. https://doi.org/10.1016/j.pmpp.2008.02.006 Wang FY, Lin XG, Yin R, Huang XF, LiH X, Li Z (2017). Induced maize salt tolerance by endophytic fungus Penicillium oxalicum and its mechanisms. Pedosphere 27(1): 112-121. https://doi.org/10.1080/01490451.2023.2272620 Wang L, Qin L, Sun X, Zhao S, Yu L, Chen S, Wang M (2023) Salt stress-induced changes in soil metabolites promote cadmium transport into wheat tissues. J Environ Sci 127:577-588.https://doi.org/10.1016/j.jes.2022.06.017 Wang Y, Cao JL, Hashem A, Abd_Allah EF, Wu QS (2023) Serendipita indica mitigates drought-triggered oxidative burst in trifoliate orange by stimulating antioxidant defense systems. Front Plant Sci 14:1247342.https://doi.org/10.3389/fpls.2023.1247342 Waqas M, Khan AL, Kamran M, Hamayun M, Kang SM, Kim YH, Lee IJ (2012) Endophytic fungi produce gibberellins and indoleacetic acid and promotes host-plant growth during stress. Molecules 17(9):10754-10773. https://doi.org/10.3390/molecules170910754 Younis ME, Hasaneen MNA, Kazamel AMS (2010) Exogenously applied ascorbic acid ameliorates detrimental effects of NaCl and mannitol stress in Vicia faba seedlings. Protoplasma 239:39-48. http://doi.org. 10.1007/s00709-009-0080-5 Zhang S, Gan Y, Xu B (2016) Application of plant-growth-promoting fungi Trichoderma longibrachiatum T6 enhances tolerance of wheat to salt stress through improvement of antioxidative defense system and gene expression. Front Plant Sci 7:217856. https://doi.org/10.3389/fpls.2016.01405 Zhang SW, Gan YT, Xue YY, Xu BL (2014) The parasitic and lethal effects of Trichoderma longibrachiatum against Heteroderaavenae . Biol Control 72:1-8. https://doi.org/10.1016/j.biocontrol.2014.01.009 Zou P, Li K C, Liu S, Xing RG, Qin YK, Yu HH (2015) Effect of chitooligosaccharides with different degrees of acetylation on wheat seedlings under salt stress. CarbohydrPolym 126: 62-69. https://doi.org/10.1016/j.carbpol.2015.03.028 Zou Y, Zhang L, Liu R, He L, Hu Z, Liang Y, Zhou Y (2023) Endophytic fungus Falciphora oryzae enhances salt tolerance by modulating ion homeostasis and antioxidant defense systems in pepper. Physiol Plant 175(6):14059.https://doi.org/10.1111/ppl.14059 Tables Table 1. DNA sequences of PCR primers were used for qPCR determination of the five AsA-GSH biosynthesis related gene in wheat seedlings, F, Forward primer, R, reverse primer Gene Accession number Primer pairs Expected amplification size (bp) SOD JQ613154.1(GenBank, Zhang et al. 2016) Forward: CATTGTCGATAGCCAGATTCCTTT Reverse: AGTCTTCCACCAGCATTTCCAGTA 138 APX EF55121.1 (GenBank, Popovic et al., 2024) Forward: TGGAAGACGTGATTCGTCAG Reverse: TCAAACCCAGACCTTTCAGG 174 MDHAR AK371371(GenBank, Li et al. 2013) Forward: AGAAGTTTACGCCCTTCGGC Reverse: TTGGAATGTCATCGCCATC 132 DHAR AYO74784(GenBank, Li et al. 2013) Forward: GTGCCTGTGTATAACGGTG Reverse: ACAAGTGATGGAGTTGGGT 94 GR TC84151(GenBank, Popovic et al. 2024) Forward: TGCGTCCCGAAGAAGATACT Reverse: GTTGATGTCCCCGTTGATCT 96 Table 2. Changes in Sugar, Protein content, total chlorophyll (mg/g FW), Carotenoid (mg/g FW) and chlorophyll fluorescence (Fv/Fm) in wheat seedlings inoculated with endophytic fungi, Cladosporium parahalotolerant and Aspergillus medius inoculation individually and in combination with each other, under salt stress condition (100 mM NaCl). Control was treated with sterile water Treatments Soluble sugar (mg/g FW) Protein (mg/g FW) Total chlorophyll (mg/g FW) Carotenoid (mg/g FW) Fv/Fm Control 14.37 e ± 0.51 6.59 e ± 0.58 7.51 e ± 0.28 0.33 d ± 0.00 0.64 d ± 0.02 NaCl 10.16 f ± 0.41 4.13 f ± 0.21 5.45 f ± 0.10 0.21 e ± 0.01 0.54 e ± 0.01 C. parahalotolerant 18.47 c ± 0.26 10.34 c ± 0.48 11.29 b ± 0.69 0.49 b ± 0.06 0.74 b,c ± 0.02 C. parahalotolerant +NaCl 15.0 d,e ± 0.86 7.07 d,e ± 0.26 8.31 d ± 0.24 0.38 c,d ± 0.00 0.64 d ± 0.02 Medius 19.45 b ± 0.21 11.37 b ± 0.30 10.76 b ± 0.64 0.42 c ± 0.03 0.73 c ± 0.01 A. medius +NaCl 15.69 d ± 0.15 7.46 d ± 0.13 7.82 d,e ± 0.16 0.36 d ± 0.00 0.67 d ± 0.02 C. parahalotolerant + A. medius 22.12 a ± 0.14 16.23 a ± 0.23 12.71 a ± 0.38 0.68 a ± 0.03 0.84 a ± 0.02 C. parahalotolerant + A. medius +NaCl 18.42 c ± 0.22 11.18 b + 0.17 9.27 c ± 0.06 0.48 b ± 0.02 0.763 b ± 0.02 Table 3. Change pattern of glutathione (GSH), oxidized glutathione (GSSG), ascorbate (AsA), and dehydroascorbate (DHA) and the ratios of GSH/GSSG and AsA/DHA in wheat seedlings inoculated with endophytic fungi, C. parahalotolerant and A. medius individually and in combination with each other under salt stress (100 mM NaCl). Control was treated with sterile water Treatments AsA(µg/g FW) DHA(µg/g FW) AsA/DHA GSH(µg/g FW) GSSG(µg/g FW) GSH/GSSG Control 1.96 f ± 0.21 1.33 a ± 0.11 1.48± 0.17 0.83 g ± 0.03 0.43 b ± 0.07 1.96 ± 0.43 NaCl 1.36 h ± 0.31 1.03± 0.12 1.35± 0.47 0.72 h ± 0.02 0.46 a ± 0.01 1.57 ± 0.03 C. parahalotolerant 2.16 e ± 0.25 1.46± 0.23 2.7± 1.13 1.3 b ± 0.06 0.30 c ± 0.09 4.64 ± 1.44 C.parahalotolerant +NaCl 1.56 g ± 0.31 1.33 a ± 0.55 1.46± 1.08 1.21 d ± 0.05 0.21 f ± 0.05 5.84 ± 1.77 A. medius 3.43 b ± 0.21 1.36 a ± 0.45 2.75± 1.13 1.20 e ±0.02 0.27 d,e ± 0.02 4.52 ± 0.28 A. medius +NaCl 2.33 d ± 0.25 1.33± 0.32 1.83± 0.52 1.09 f ± 0.04 0.19 h ± 0.04 5.70 ± 1.21 C. parahalotolerant+ A. medius 3.9 a ± 0.10 1.56± 0.31 3.20± 0.81 1.47 a ± 0.03 0.24 d,e ± 0.01 6.04 ± 0.21 C. parahalotolerant+ A. medius +NaCl 3.16 c ± 0.31 1.43± 0.26 2.51± 0.58 1.30 c ± 0.02 0.20 g ± 0.03 6.64 ± 1.09 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4874583","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":342337773,"identity":"d53ddc6f-419b-4d1d-90c2-929d09c99183","order_by":0,"name":"RAVINDRA NATH KHARWAR","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYFACNjYILQHEHxsOQDgJRGphbJxJspZmXpgWfMB8dlvag597Dsubz24+/th2x53EBvbDDxge7sCtRebOseOGPc8OG865cyyxOffMs8QGnjQDhsQzuLVISKS3SfAcuM04QyLHsDm37XBiA0MOA0NiG34tkn8O3LYHa7EEaeF/Q0hL2jFpoC2JYC2MIC0SBG1JS5OWOfA/eYbMscSZvWcOG7dJPDM4QECLmeSbA2m2M6SbD3z4ueOwbD9/8sOHP/FowQSgaDpAioZRMApGwSgYBZgAAPNeV4Naa5PTAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0001-8792-6380","institution":"Banaras Hindu University","correspondingAuthor":true,"prefix":"","firstName":"RAVINDRA","middleName":"NATH","lastName":"KHARWAR","suffix":""},{"id":342337774,"identity":"7fb1978c-2f45-46bd-a13d-e575cd9a8375","order_by":1,"name":"Priyanka Prajapati","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Priyanka","middleName":"","lastName":"Prajapati","suffix":""},{"id":342337775,"identity":"e7c72672-dc7f-4851-afb7-c258e353f869","order_by":2,"name":"Prashasti Pandey","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Prashasti","middleName":"","lastName":"Pandey","suffix":""},{"id":342337776,"identity":"33e20a96-1e12-46f4-9121-4822a467b761","order_by":3,"name":"Deepak Kumar","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Deepak","middleName":"","lastName":"Kumar","suffix":""}],"badges":[],"createdAt":"2024-08-07 12:07:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4874583/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4874583/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":64654706,"identity":"76184813-4fdf-4cc0-88bb-1ddcec405c2e","added_by":"auto","created_at":"2024-09-17 06:29:43","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":453639,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of salt stress and \u003cem\u003eCladosporium (C.) parahalotolerant\u003c/em\u003eand \u003cem\u003eAspergillus (A.) medius\u003c/em\u003e on wheat seedling growth. \u003cstrong\u003eControl \u003c/strong\u003erepresents wheat seedlings grown under normal condition, \u003cstrong\u003eNaCl\u003c/strong\u003e represents wheat seedlings treated with 100 mM NaCl, \u003cem\u003e\u003cstrong\u003eC. parahalotolerant\u003c/strong\u003e\u003c/em\u003e and \u003cem\u003e\u003cstrong\u003eA. medius\u003c/strong\u003e\u003c/em\u003e represent wheat seeds primed with\u003cem\u003eC. parahalotolerant\u003c/em\u003e and \u003cem\u003eA. medius\u003c/em\u003erepresent for 12 h before planting without NaCl treatment, \u003cem\u003e\u003cstrong\u003eC. parahalotolerant\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e + NaCl\u003c/strong\u003e and \u003cem\u003e\u003cstrong\u003eA. medius\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e+ NaCl\u003c/strong\u003erepresent wheat seeds primed with \u003cem\u003eC. parahalotolerant\u003c/em\u003e + NaCl and \u003cem\u003eA. medius\u003c/em\u003e+ NaCl for 12 h before planting and treated with 100 mM NaCl, \u003cem\u003e\u003cstrong\u003eC. parahalotolerant\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e + \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. medius\u003c/strong\u003e\u003c/em\u003erepresent wheat seeds primed with \u003cem\u003eC. parahalotolerant\u003c/em\u003e + \u003cem\u003eA. medius\u003c/em\u003erepresent for 12 h before planting without NaCl treatment, \u003cem\u003e\u003cstrong\u003eC. parahalotolerant\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e + \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. medius\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e + NaCl\u003c/strong\u003e represent wheat seeds primed with \u003cem\u003eC. parahalotolerant\u003c/em\u003e + \u003cem\u003eA. medius +\u003c/em\u003e NaCl represent for 12 h before planting and treated with NaCl\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4874583/v1/6f1c766f6fee9810d010f894.png"},{"id":64654708,"identity":"b044cad6-f691-4483-9091-a69262458f6a","added_by":"auto","created_at":"2024-09-17 06:29:43","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":77632,"visible":true,"origin":"","legend":"\u003cp\u003eChanges in the contents of malondialdehyde (MDA) in the \u003cem\u003eTriticum aestivum \u003c/em\u003eL. seedlings treated with \u003cem\u003eC. parahalotolerant\u003c/em\u003eand \u003cem\u003eA. medius\u003c/em\u003ein the presence and absence of salinity stress. Vertical bars represent the means and standard errors (Means ± SE) of three replicates (n=3). Different lower-case letters represent statistical difference at \u003cem\u003eP≤0.05 \u003c/em\u003eaccording to Duncan’s multiple range test\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4874583/v1/39150540a503f261d7f0338c.png"},{"id":64654710,"identity":"e23f13c5-26a5-41a5-95e8-ecde95d180f3","added_by":"auto","created_at":"2024-09-17 06:29:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":359260,"visible":true,"origin":"","legend":"\u003cp\u003ePicture showing \u003cem\u003ein-situ \u003c/em\u003evisualization of superoxide in leaves stained and decolorized by NBT and ethanol, respectively. The dark spots represents the site of superoxide production. (a, i). Control, (b, j). Pre-treated with 100 mM NaCl, (c,k). Pre-treated with \u003cem\u003eC. parahalotolerant\u003c/em\u003e, (d, l). Pretreated with \u003cem\u003eC. parahalotolerant\u003c/em\u003e+NaCl, (e,m). Pretreated with \u003cem\u003eA. medius\u003c/em\u003e, (f,n). Pretreated with \u003cem\u003eA. medius\u003c/em\u003e+ NaCl, (g, o). Pretreated with \u003cem\u003eC. parahalotolerant\u003c/em\u003e+ \u003cem\u003eA. medius, \u003c/em\u003e(h, p). Pretreated with \u003cem\u003eC. parahalotolerant\u003c/em\u003e+ \u003cem\u003eA. medius\u003c/em\u003e+ NaCl\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4874583/v1/9fd35edf651df3fac41c650f.png"},{"id":64654709,"identity":"ae3772a9-bf49-4415-9ad3-ad547c9ebf79","added_by":"auto","created_at":"2024-09-17 06:29:44","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":275580,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of \u003cem\u003eC. parahalotolerant\u003c/em\u003e and \u003cem\u003eA. medius\u003c/em\u003e on activities of (A) SOD, (B) APX, (C) MDHAR, (D) DHAR and (E) GR in the leaves of wheat (PBW-343) seedlings under the salt stress. Small bars represent the standard errors of the means (n= 24). Different lowercase letters indicate significant differences at P \u0026lt; 0.05 in Duncan’s multiple range test using one-way ANOVA. The treatment names are detailed in the fig 1\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4874583/v1/90d545e914602eb04f4616b1.png"},{"id":64654707,"identity":"70396415-5299-47cf-9a39-154a09d93292","added_by":"auto","created_at":"2024-09-17 06:29:43","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":81727,"visible":true,"origin":"","legend":"\u003cp\u003eA and B showing graphicals representations of principal component analysis (PCA) obtained from the evaluation of antioxidants and oxidative stress markers studied in wheat seedlings under salt stress and fungal endophytes treatment conditions\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4874583/v1/b1215c69188844009dd80afa.png"},{"id":64654713,"identity":"0f111de5-f867-4d01-8010-0ff504a25b0a","added_by":"auto","created_at":"2024-09-17 06:29:44","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":284145,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of \u003cem\u003eC. parahalotolerant\u003c/em\u003e and \u003cem\u003eA. medius\u003c/em\u003e on gene(s) expression of (A) SOD, (B) APX, (C) MDHAR, (D) DHAR and (E) GR in leaves of wheat (PBW-343) seedlings under the salt stress. Small bars represent the standard errors of the means (n= 24). Different lowercase letters indicate significant differences at P \u0026lt; 0.05 in Duncan’s multiple range test using one-way ANOVA. The treatment names are detailed in the fig 1\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4874583/v1/15867a871aecd9160ef6f0c8.png"},{"id":64654980,"identity":"298c80c5-2094-44cd-b73b-765ffe19cfdb","added_by":"auto","created_at":"2024-09-17 06:37:44","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":162118,"visible":true,"origin":"","legend":"\u003cp\u003eProposed model, Reactive oxygen species (ROS), Ascorbate-glutathione (AsA-GSH), Hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e), Monodehydroascorbate (MDHA), Dehydroascorbic acid (DHA), Oxidized glutathione (GSSG), Ascorbate peroxidase (APX), Monodehydroascorbate reductase (MDHAR), Dehydroascorbate reductase (DHAR), Glutathione reductase (GR), Reduced ascorbic acid (AsA), Reduced glutathione (GSH)\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4874583/v1/672451eb594bb2ea41b00b84.png"},{"id":66629251,"identity":"78f78723-9e15-4b02-a1a9-0d73f3c69f1f","added_by":"auto","created_at":"2024-10-15 04:28:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3110801,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4874583/v1/50b0f5c7-9579-4e5d-96cd-fff863e2f40d.pdf"}],"financialInterests":"","formattedTitle":"Fungal endophytes promote wheat (Triticum aestivum L., genotype-PBW-343) growth and enhance salt tolerance through improvement of ascorbate-glutathione cycle and gene expression","fulltext":[{"header":"Introduction","content":"\u003cp\u003eWheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.) is one of the world\u0026rsquo;s most essential cereal crops, constituting a significant portion of the global food supply and serving as a staple for millions of people. However, its productivity is severely affected by various environmental stresses, among which soil salinity is a critical challenge. Soil salinity as a major abiotic stress factor adversely affects plant growth, leading to reduced yield and economic losses in agricultural systems worldwide (Elbagory 2023; Kaya et al. 2023; Munns and Tester 2008; \u0026nbsp;Sharma 2023; Wang et al. 2023). As global climate change continues to exacerbate soil salinization, it is imperative to develop sustainable strategies to enhance crop tolerance and improve agricultural productivity.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAt present, salt affects over 6% of the world\u0026apos;s arable land primarily in the dry and semiarid regions (Bui 2013). Thus, food security and the sustainability of agriculture worldwide are gravely threatened. It is imperative, therefore, \u0026nbsp;to devise effective and efficient methods for mitigating the detrimental effects of salt stress on plant growth and development. Although novel cultivars with better salt resistance have been created using conventional breeding and transgenic technology, breeding for salt tolerance has not been successful (Phang et al. 2008). Difficulties arise because of the lengthy breeding cycle and low breeding efficiency of the quantitative trait. Using transgenic technology, salt-tolerant genes can be introduced in new plant materials (Lu et al. 2007; Otaibi et al. 2024; Sairam and Tyagi 2004; Sahi et al. 2006), but it has been criticized due to gene loss, high cost, and other regulatory concerns (Glick 2007).\u003c/p\u003e\n\u003cp\u003eThe use of exogenous compounds to counteract the negative effects of abiotic stress increases the plant tolerance to salt stress. Examples of such compounds include chitooligosaccharides (Zou et al. 2015), oligochitosan (Ma et al. 2012), nitric oxide and calcium nitrate (Tian et al. 2015), jasmonic acid (Qiu et al. 2014), gibberellic acid and calcium chloride in linseed (\u003cem\u003eLinum usitatissimum\u003c/em\u003e; Khan et al. 2010), and ascorbic acid in broad beans (\u003cem\u003eVicia faba\u003c/em\u003e; Younis et al. 2010). It has been demonstrated that these exogenous substances increase the ability of plants to withstand salt stress; however, the precise physiological processes involved remain unclear. The use of bacteria and fungi that promotes plant development to induce tolerance to abiotic stress is a novel and highly recent technology that has garnered much interest. This is a useful strategy for increasing plant resistance to salt stress and could aid in the creation of sustainable agricultural systems.In recent years, plant-microbe interactions have become a viable approach for solving the problems caused by salt in the soil. Among these interactions, the symbiotic association between plants and fungal endophytes has gained significant attention because of its potential to promote plant growth and confer tolerance to abiotic stresses including salinity (Chowdhary et al. 2024; Chauhan et al. 2024; Koudadaria et al. 2023; Prajapati et al, 2024; Rodriguez et al. 2008). Microorganisms, known as fungal endophytes, live inside plant tissues and have a significant impact on host plant physiology and stress responses, without exhibiting any outward signs of disease (Pertini 1991).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFungal endophytes have various beneficial effects on host plants, including nutrient acquisition, enhanced water uptake, and protection against pathogens and herbivores (Compant et al. 2010). Additionally, they play a crucial role in regulating plant responses to abiotic stress by inducing stress-related genes and modulating antioxidant defence systems (Asaf et al. 2023; Aizaz et al. 2023; Cao et al. 2023; EL-Sayed et al. 2022; Lubna et al. 2022; Rodriguez et al. 2009; Shen et al. 2023; Zhang et al. 2016; Zou et al. 2023). One of the most important antioxidant defence mechanisms in plants is the ascorbate-glutathione cycle, which scavenges reactive oxygen species (ROS) generated under stressful conditions and preserves cellular redox homeostasis (Noctor et al. 2012; Popovic et al. 2024). Salt stress causes plant cells to produce ROS, including superoxide, hydrogen peroxide, and hydroxyl radicals (Mittler 2002). An overabundance of ROS can cause oxidative damage to proteins, lipids, and nucleic acids, ultimately hindering the growth and development of plants (Foyer and Noctor 2005).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn order to resist the oxidative damage brought out by salt stress, plants need a robust antioxidant system(Foyer and Kunert 2024; Liu et al. 2024). In a previous study (Ghorai et al. 2023;Khan et al. 2015; Li et al. 2023; Ren et al. 2021; Sadeghi et al. 2019; Wang et al. 2017), fungal endophytes are involved in improving the ascorbate-glutathione cycle in plants under abiotic stress conditions. Endophytes can affect the activity of important AsA-GSH cycle enzymes including superoxide dismutase (SOD), ascorbate peroxidase (APX), glutathione reductase (GR), dehydroascorbate reductase (DHAR), and monodehydroascorbate reductase (MDHAR). This can result in an increased ability to scavenge reactive oxygen species (ROS) (Li et al. 2023; Rong et al. 2022; Waqas et al. 2012; Wang et al. 2023; Zou et al. 2023).\u003c/p\u003e\n\u003cp\u003eFurthermore, fungal endophytes can modulate gene expression in host plants, thereby influencing various physiological processes including stress responses. Several studies have reported changes in the expression of stress-responsive genes such as those encoding heat shock proteins, late embryogenesis abundant (LEA) proteins, and various transcription factors in endophyte-inoculated plants under salt stress conditions (Varma et al. 2012). These changes in gene expression likely contribute to the enhanced stress tolerance observed in endophyte-associated plants (Aizaz et al. 2023; Zhan et al. 2016; Zou et al. 2023). Despite a growing body of research on the beneficial effects of endophytic fungi in enhancing plant development and stress tolerance, there is still a knowledge gap regarding their specific roles in promoting wheat growth and conferring salt tolerance. The present study is, thus, aimed to address this gap by investigating the effects of selected fungal endophytes on wheat plants grown under saline conditions. We hypothesized that these endophytes could improve wheat growth and enhance salt tolerance by positively modulating the ascorbate-glutathione cycle and regulating stress-responsive gene expression.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cp\u003e\u003cstrong\u003eEndophytic fungi\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe previously isolated and identified endophytic fungi from tissues of salt-tolerant wheat genotypes (KRL-19, KRL-213 and KRL-210), such as leaves, stems, and roots, in our laboratory. Two out of 20 fungal endophytes were found\u0026nbsp;potential, that are, \u003cem\u003eC.parahalotolerant\u003c/em\u003e L. isolate KRL213/150 (accession number: ON714989) and \u003cem\u003eA.medius\u003c/em\u003e isolate KRL-19/200 (accession number: ON753782). For the purposes of this study, these two isolates were used individually and in combination (Prajapati et al. 2024).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEndophyte inoculum preparation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eA. medius\u003c/em\u003e and \u003cem\u003eC. parahalotolerant\u003c/em\u003e were inoculated on PDA and conidial suspensions were prepared using the method described by Zhang et al. (2014). Two-week-old culture plates were flooded with 10 ml of sterile distilled water consisting of 0.1per cent (v/v) Tween 80 to maintain a final suspension of 1.0x10\u003csup\u003e8\u003c/sup\u003e spores ml\u003csup\u003e-1\u003c/sup\u003e, which was stored at 4\u003csup\u003eo\u003c/sup\u003eC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Plant material and treatment conditions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUnder ideal humidity, temperature and light conditions (25°C, 60 percent relative humidity, and 600 molm\u003csup\u003e-2\u003c/sup\u003es\u003csup\u003e-1\u003c/sup\u003e) the experiment was conducted in a glasshouse chamber during the wheat growing season (November-February). Eight groups were formed for the experiment: a control group that did not receive any treatment from the fungus or the 100 mM NaCl solution; a negative control group that received treatment from the 100 mM NaCl solution; three positive control groups comprised of C\u003cem\u003e. parahalotolerant, A. medius\u003c/em\u003e, and \u003cem\u003eC. parahalotolerant\u003c/em\u003e + \u003cem\u003eA. medius\u003c/em\u003e; and a stressed group that received treatment from the fungus and 100 mM NaCl and contained \u003cem\u003eC. parahalotolerant\u003c/em\u003e + \u003cem\u003eA. medius\u003c/em\u003e and \u003cem\u003eC. parahalotolerant\u003c/em\u003e+ NaCl, \u003cem\u003eA. medius\u003c/em\u003e + NaCl.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWheat seeds were collected from an endophyte spore solution and left to dry in the open after being submerged overnight. Twenty fungal-coated seeds were placed in a perforated pot filled with autoclaved soil, all of which had three replicates, and were organized in a completely randomized block arrangement. After a week of wheat plant growth, NaCl treatment was initiated in accordance with previously described methodology (Prajapati et al. 2024; Sheng et al. 2008). To prevent salts from interfering with the growth of different endophytic fungi and causing osmotic shock to the roots of the plants, 50 ml of a solution containing the recommended concentration of NaCl was applied to the soil every seven days in each pot. Plants were routinely irrigated with distilled water twice a week (Fig. 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEndophytic fungi establishment in inoculated plants\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo verify the presence of endophytic fungi in the plants, tissue samples (stems, leaves, and roots) from ten plants were collected 16 d after inoculation. The same reference was used for the identification and isolation of fungal endophytes (Prajapati et al. 2024).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantification of photosynthetic pigments\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBy extracting 0.5 g of leaf material in 10 ml of 80 per cent acetone, chlorophyll (Chl) and carotenoids (Car) were measured spectrophotometrically using the method described by Agrawal and Rathore (2007).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurement of chlorophyll fluorescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe photochemical effectiveness of photosystem II (PSII) was determined by measuring the variable fluorescence to maximum fluorescence (Fv/Fm) ratio of chlorophyll fluorescence using a portable fluorometer (Pocket PEA, Hansatech, England)as \u0026nbsp;summarized by Rivero et al. (2009).,\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurement of malondialdehyde (MDA) level\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Hodges et al. (1999) procedure was used to measure the MDA levels in the leaves. Two hundred mg of leaf powder and 2.5 mL of 0.1 percent TCA (Trichloroacetic Acid) were combined, and the mixture was centrifuged at 10,000×g for 15 min at 4\u003csup\u003eo\u003c/sup\u003eC. Then, 4 ml of 0.5 per cent TBA (Thiobarbituric acid) and 1 mL of 20 per cent TCA were mixed with the supernatant. The blend was cooled in an ice bath for approximately 20 min in a water bath at 90°C. The mixture was then centrifuged for 10 min at 15,000 × g, and 532 nm was used to calculate the absorbance.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eO\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u003c/sup\u003e deposition detection using\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003enitrobluetetrazolium (NBT) staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWang et al. (2007) stated that the detection of O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u003c/sup\u003erequires the ability to decrease Nitro Blue Tetrazolium (NBT). Under salt stress conditions, wheat leaves were treated with fungal endophytes. After 15 days, the NaCl-treated and control samples were used to monitor O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u003c/sup\u003e buildup. The leaf samples were submerged in an amber-colored vial that contained 100 mg of NBT in 0.05M sodium phosphate buffer (pH 7.5). The NBT solution (0.2%) was prepared by adding 50 mL to the final volume, and the sample was stored for 8h in a dark environment. After eight hours of incubation, the leaves were placed on a filter paper and cooked in 96 per cent ethanol to eliminate chlorophyll. Superoxide anion (O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u003c/sup\u003e) accumulation was visible in the dark blue color of the leaf tissue when viewed using an Olympus compound microscope. Three replicates of each treatment were maintained andthe experiments were conducted in triplicate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSoluble sugar and protein content\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo determine the soluble protein and sugar contents in the leaves of wheat seedlings, the leaf samples obtained from the treatment and control groups were cut into small pieces and thoroughly cleaned with distilled water thrice. Next, the tiny wheat seedling leaf fragments were dried, weighed, and placed one at a time into glass vials containing 10 mL of 80% (v/v) ethanol. The vials were heated in a water bath for 30 min at 60°C. The filtered extracts were diluted with the 80 per cent (v/v) ethanol to a final volume of 20 ml. According to Giannakoula et al. (2008), the amount of soluble sugar present in the extract was determined by comparing its content with a standard curve and glucose criteria. The soluble protein content was assayed using the Bradford method (1976). To ascertain the amount of soluble protein present in wheat seedlings leaves, the Coomassie Brilliant Blue G-250 reagent containing BSA was \u0026nbsp;utilized as the standard.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAssay of antioxidant metabolites\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe ASA content was determined according to the procedure described by Gillespie and Ainsworth (2007). 2.5 mL of 6% (w/v) TCA was combined with 50 mg of leaf powder and centrifuged at 10,000g for 10 min at 4°C. The amount of oxidized ascorbate (DHA) was calculated by subtracting the concentration of AsA from that of tASA, while \u0026nbsp;the GSH and GSSG contents were assessed using the method described by Rahman et al. (2006). Following the addition of 50 mg of frozen leaf powder to an extraction buffer of 2.5 mL (which contained 50 mM potassium phosphate, 23mM sulfosalicylic acid, pH 8.0, and 5mM EDTA), the mixture was centrifuged at 10,000×g for the time of 10 min at 4°C temp. The GSSG concentration was subtracted from the total glutathione (tGSH) to estimate the concentration of GSH.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAssay of antioxidant enzyme activities\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe leaf powder (500 mg per antioxidant enzyme) was homogenized in an extraction buffer containing 1% (w/v) polyvinylpyrrolidone (PVP) and 50 mM potassium phosphate buffer at 7.5 pH. The mixture was centrifuged at 10,000×g for 15 min at 4°C. Antioxidant enzymes were tested in the supernatant.\u003c/p\u003e\n\u003cp\u003eThe ability of superoxide dismutase SOD (EC 1.15.1.11) to prevent photoreduction of NBT was used to evaluate its activity, as described by Becana et al. (1986). To a 50 μl of enzyme extract, 1 mL reaction mixture, 14.3 mM methionine, 50 mM K\u003csub\u003e3\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e buffer (pH 7.5), 0.1mM EDTA (Ethylenediamine tetraacetic acid), 82.5 mM NBT and 2.2 mM riboflavin were added. Fluorescent tungsten bulb (15 W) was used to illuminate the process. Ten minutes later, the reaction was terminated And the absorbance was measured at 560 nm.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAscorbate peroxidase activity (EC 1.11.1.11) was measured using the protocol described by Asada (1984). To the reaction mixture (1.0 mL) consisting of 33 μL of enzyme extract, 0.17 mM ascorbate, and 50 mM K\u003csub\u003e3\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e buffer (pH 7.0), addition of 5 mM H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e started the reaction. For three minutes, the absorbance was determined at 290 nm (ε=2.8 mM\u003csup\u003e-1\u003c/sup\u003e cm\u003csup\u003e-1\u003c/sup\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe activity of monodehydroascorbate reductase (MDHAR, EC 1.6.5.4) which is based on MDHA-dependent oxidation of NADH was evaluated using Drew et al. (2007). One hundred microliters of enzyme extract, 50 mM K\u003csub\u003e3\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 0.128 units of ascorbate oxidase and 2.5 mM ascorbate were included in the standard reaction mixture (1.0mL). The reaction was initiated by the addition of 0.2 mM) And the absorbance was measured at 340 nm.\u003c/p\u003e\n\u003cp\u003eThe Asada (1984) method was used to assess the dehydroascorbate reductase activity (DHAR, EC 1.8.5.1). The standard reaction mixture (1.0 mL) was comprised of 50 mM K\u003csub\u003e3\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e buffer (pH 7.5), 5 mM GSH, 75 μL enzyme extract, and 0.11 mM EDTA. 0.5 mM DHA was then added to initiate the reaction. The quantity of enzyme required to produce one mol of ascorbate per minute at 25°C was measured and designated as one DHAR unit. Absorbance was measured at 265 nm (ε =14.5 mM\u003csup\u003e-1\u003c/sup\u003e cm\u003csup\u003e-1\u003c/sup\u003e).\u003c/p\u003e\n\u003cp\u003eThe glutathione activity (EC 1.6.4.2) was measured using the methodology described by Smith et al. (1988). Fifty mM K\u003csub\u003e3\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e (potassium phosphate) buffer (pH 7.5), 1mM GSSG, 100 μL crude enzyme extract, and 0.75mM DTNB (5,5′-dithiobis-(2-nitrobenzoic acid) were all present in the reaction mixture (1.0 mL). The reaction was initiated by adding 0.1 mM NADPH. At 412 nm (ε = 14.15mM\u003csup\u003e-1\u003c/sup\u003ecm\u003csup\u003e-1\u003c/sup\u003e), the increase in absorbance resulting from the production of TNB (5-thio-2-nitrobenzoic acid) was measured.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExtraction of total RNA and analysis of gene expression by quantitative real-time reverse transcriptase-PCR (qRT-PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe100 mg leaves were taken separately from 15-days-old stressed and unstressed wheat seedlings, instantly frozen in liquid N2 and stored at -80°C for use in subsequent studies. The leaves were finely ground and TRIzol (Invitrogen) was used to extract total RNA. The SuperScriptTM III First-Strand Synthesis System (Invitrogen, USA) was used to synthesize cDNA from the extracted RNA, according to the manufacturer’s protocol. Synthesized cDNA was used as a template for qPCR. The NCBI candidate protein wheat EST sequences (Qiu et al. 2014; Zou et al. 2015)” were used to design specific primers. Table 1 lists the DNA sequences of primers used for SOD, APX, MDHAR, DHAR, and GR. The reaction was carried out with Lightcycler 480 SYBR green Master mix, 2X-10 μl (Roche, USA); PCR primers (Forward and Reverse), 10 mM-1μl each; 40 ng/μl-5μl; cDNA template, and PCR grade water-3 μl by utilizing a C1000TM Thermal Cycler CFX96TM Real-Time System (BIO-RAD, USA). At the conclusion of each PCR, melting curve analysis of the amplified products was performed to verify that a single PCR product was amplified. Gene expression was measured by using the delta-delta Ct method in relation to each sample's level of actin expression, an internal reference gene (Livak and Schmittgen 2001). Each reaction was performed in triplicate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analyses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGraphPad Prism 8.0 was used to evaluate the data that were collected for each experimental variety. The data were subjected to a statistical analysis of the SD using IBM SPSS STATISTICS 20. The mean values have been then compared using Duncan's multiple range test (DMRT) at P \u0026lt; 0.05 (ANOVA SAS release 9, SAS Cary, North Carolina). PCA (Principal component analysis) was \u0026nbsp;carried out by utilizing the XLSTAT software, version 2016 (www.xlstat.com, Addinsoft SARL).\u003c/p\u003e"},{"header":"Results ","content":"\u003cp\u003e\u003cstrong\u003eChlorophyll (Chl) and carotenoid (Car) contents\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe levels of carotenoid and chlorophyll reduced in comparison to the control values of plants after treatment with 100 mM NaCl (Table 2). Irrespective of whether endophyte-associated plants were subjected to salt stress, their chlorophyll content enhanced (p \u0026lt; 0.05) (Table 2). Compared to the endophyte-free plants (control), the plants inoculated with a combination of the two fungal endophytes (\u003cem\u003eC. parahalotolerant\u003c/em\u003e + \u003cem\u003eA. medius\u003c/em\u003e) showed a higher chlorophyll content under salt stress conditions, with values of 51.72% and 49.34%, respectively (Table 2).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe maximum increase in chlorophyll content was observed after inoculation with a combination of \u003cem\u003eA. medius\u003c/em\u003e and \u003cem\u003eC. parahalotolerant\u003c/em\u003e in comparison to the control. Similar to chlorophyll, the amount of carotenoids decreased as the salt stress levels increased. Also, plants that were inoculated with endophytes had higher carotenoid contents than those \u0026nbsp;not \u0026nbsp; inoculated with the endophytes (Table 2). Plants treated with \u003cem\u003eC. parahalotolerant\u003c/em\u003e and \u003cem\u003eA. medius\u003c/em\u003e fungal endophytes exhibited the highest carotenoids content with 57.14% and 50% differences from the control groups, respectively.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eChlorophyll fluorescence\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe highest possible photochemical efficiency or potential quantum yield of PSII was determined by using the Fv/Fm ratio. Both, endophyte colonization and salt stress affected the Fv/Fm ratio. Plants inoculated with a mixture of the two fungal endophytes showed the highest Fv/Fm ratio, with a deviation of 35.71% compared to the control group (Table 2).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSoluble sugar and protein contents\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCompared to the control, the application of fungal endophytes (\u003cem\u003eA. medius\u003c/em\u003e and \u003cem\u003eC. parahalotolerant\u003c/em\u003e) increased the amounts of protein and soluble sugar in wheat seedlings grown under salt stress and non-saline stress. However, following the application of NaCl alone, the protein and soluble sugar levels of the wheat seedlings dramatically decreased (Table 2). In contrast to the NaCl-stressed plants, the soluble sugar and protein contents in the wheat leaves increased by 44.99%, 47.76%, 60.05%, and 63.67% when treated with \u003cem\u003eC. parahalotolerant\u003c/em\u003e and \u003cem\u003eA. medius\u003c/em\u003e in isolation, and by 32.26%, 35.24%, 41.58%, and 44.63%, respectively when treated with \u003cem\u003eA. medius\u003c/em\u003e and \u003cem\u003eC. parahalotolerant\u003c/em\u003e in combination with 100 mM NaCl. The levels of soluble sugar and protein in wheat seedlings increased by priming with \u003cem\u003eC. parahalotolerant\u003c/em\u003e and \u003cem\u003eA. medius\u003c/em\u003e, the impact on soluble protein content being higher than that on the soluble sugar content (Table 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMDA content\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe concentrations of MDA and O\u003csub\u003e2\u003c/sub\u003e- in the wheat seedlings were significantly elevated by salt stress (Fig. 2). When exposed to salt stress, plants primed with fungal endophytes showed distinct reaction patterns. Plants under salt stress and those free of endophytes exhibited the highest MDA contents (control). The consortia application of the two fungal endophytes (\u003cem\u003eA. medius\u003c/em\u003e + \u003cem\u003eC. parahalotolerant\u003c/em\u003e) decreased MDA concentrations by 25.16%, 43.13%, and 28.15% (Fig. 2).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eO\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003csup\u003e-\u003c/sup\u003e\u003cstrong\u003edeposition detection in leaves\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe formation of a dark blue formazan color due to the reduction of NBT is indicative of the concentration of superoxide anion (O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u003c/sup\u003e). The dark blue color of the formazan compound was more noticeable on leaves that had been treated with salt than with fungi. Superoxide anion deposition was greatest in stressed samples, followed by \u003cem\u003eA. medius, C. parahalotolerant\u003c/em\u003e, and \u003cem\u003eC. parahalotolerant + A. medius\u003c/em\u003e treated samples under stress conditions (Fig. 3).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContents of ascorbate and glutathione\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSalt stress dramatically reduced the levels of the antioxidant molecules (GSH and AsA) in wheat plants (Table 3). Treatment with the two fungal endophytes considerably boosted the AsA and DHA contents even under salt stress. Under salt stress conditions, the most successful therapy colonization with the two fungal endophytes substantially (p \u0026lt; 0.05) increased the AsA/DHA ratio by 57.81% compared to endophyte-free plants. Salt stress also significantly increased the GSH and GSSG levels (Table 3).\u003c/p\u003e\n\u003cp\u003eIn contrast, plants inoculated with fungal endophytes exhibited reduced GSSG levels and increased GSH levels. The plants underwent considerable reduction in the GSH/GSSG ratio upon exposure to extreme salt stress (100 mM). However, in comparison to salt-stressed plants alone, plants colonized with the two fungal endophytes showed a considerable improvement in the GSH/GSSG ratio by 74.17% (Table 3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eActivities of antioxidant enzymes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAntioxidant enzyme activities vary in several ways when plants are exposed to salt stress. As shown in Fig 4, plants under stress exhibited decreased MDHAR, DHAR and GR (Fig. 4-c,d,e) activities, but higher SOD and APX (Fig 4, a,b) activities \u0026nbsp;compared to control. Under salt stress, there was a positive correlation between SOD and APX activities. Fungal endophytes treated with salt stress showed elevated activities of SOD, DHAR, APX, MDHAR, and GR. The most effective treatment i.e. colonizing plants with both fungal endophytes substantially raised SOD activity in wheat leaves by 23.63%, 8.83%, and 5.47% (Fig. 4A), APX activity by 51.3%, 21.3%, and 39.4% (Fig. 4B), MDHAR activity by 13.3%, 29.3%, and 53.2% (Fig. 4C, DHAR activity by 9.6%, 29.45%, and 41.4% (Fig. 4D), and the GR activity by 19.6%, 32.85%, and 79.1%, respectively \u0026nbsp;(Fig. 4E) in comparison to non-colonized plants.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntioxidants differentially react to the intensity of salt stress and endophyte inoculation\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePCA was carried out for the different factors considered to identify the largest variability components to better understand the antioxidant variations related to endophyte inoculation as well as to the salt intensity (Fig. 5 A). Two components were identified by all parameter analyses in relation to the endophyte inoculation and salt stress conditions (Fig. 5, A). PC1 accounted for 66.04% of the overall variance, whereas PC2 accounted for 18.02% of the variance. Significant correlations were observed among SOD, GSH, MDHAR, GR, GSH/GSSG, APX, AsA, DHAR, ASA/DHA and GSSG under salt stress (Fig. 5, A).\u003c/p\u003e\n\u003cp\u003eWhile DHA, ASA, SOD, GSH, MDHAR, GR, GSH/GSSG, APX, AsA, DHAR, ASA/DHA and GSSG \u0026nbsp;were found to be linked to component 1 in PCA (Fig. 5, A), MDA, DHA, ASA/DHA, GR, SOD, MDHAR, and GSH/GSSG were linked to component 2. The PCA score plots (Fig. 5, B) showed a distinct separation of plants under salt stress. Plants that were not inoculated with endophytes showed high MDA and GSSG values, whereas those colonized by fungal endophytes showed higher levels of APX, SOD, MDHAR, DHAR, and GR (Fig. 5,B). Fungal-endophyte-colonized plants exhibited high ASA/DHA and GSH/GSSG ratios (Fig. 5, B).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurements of the transcript levels in salt-stressed wheat seedlings using quantitative real-time PCR (qPCR) of the five genes encoding ASA-GSH cycle enzymes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, five genes encoded by the AsA-GSH cycle enzymes were measured in salt-stressed wheat seedlings to explore the influence of fungal endophytes on the AsA-GSH cycle at the molecular level. Transcript levels of SOD and APX genes increased under salt stress conditions as compared to the control [Fig. 6 (A and B)]. In contrast, the transcript levels of DHAR, MDHAR and GR genes decreased under salt stress conditions and all other treatments compared to the control. Under salt stress, the fungal endophyte treatment significantly increased the transcript levels of SOD, DHAR, APX, GR and MDHAR genes compared to the control (Figure 6, A, B, C, D, and E). Plants treated with both endophytic fungi significantly upregulated transcript levels of SOD, APX, MDHAR, DHAR and GR genes compared to plants treated with individual fungus.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAccording to earlier studies (Chauhan et al. 2024; Mahmood et al. 2012; Otaibi et al. 2024; Prajapati et al. 2022; Prajapati et al. 2024; Zhang et al. 2016), higher salinity levels are among the primary environmental stressors that affect plant’s biochemically, restrict plant growth and reduce plant productivity. The potential of these symbionts to produce broad-spectrum resistance to plant diseases and their amazing interactions with host plants are well-known (Harman et al. 2004; Naseby et al. 2000; Yedidia et al. 2003; Zhang et al. 2016). Fungal endophytes have been shown to be capable of boosting plant growth and systemic reactions in plants when they are exposed to salt stress.\u003c/p\u003e\n\u003cp\u003eOur findings showed that after 15 days, NaCl treatment dramatically reduced the growth and development of wheat seedlings, and this effect was greatly mitigated by the inoculation of fungal endophytes. To the best of our knowledge, this study is the 1st to identify the function of the plant growth-promoting fungi \u003cem\u003eA. medius\u003c/em\u003e and \u003cem\u003eC. parahalotolerant\u003c/em\u003e in increasing the salt stress tolerance of wheat seedlings. Additionally, our investigation identified a potential mechanism by which \u003cem\u003eA. medius\u003c/em\u003e and \u003cem\u003eC. parahalotolerant\u003c/em\u003e mitigated the detrimental effects of NaCl stress on wheat seedlings. The physiological, biochemical, and molecular resistance of wheat seedlings to salt stress was increased by the application of endophytic fungi.\u003c/p\u003e\n\u003cp\u003eIn the present study, we discovered that inoculation with a fungal endophyte enhanced plant growth under salt stress conditions compared to non-inoculated plants. According to our earlier research, the most commonly observed response to endophyte inoculation in wheat plants is an increase in root and shoot system growth (Prajapati et al. 2024). Endophytes secrete secondary metabolites to protect themselves from biotic and abiotic stressors. Host plants develop significantly more when exposed to secondary metabolites released by fungi, particularly hormones such as gibberellins and auxins (Bilal et al. 2018; Gul et al. 2023; Jan et al. 2019; Lubna et al. 2022; Nanda et al. 2018; Prajapati et al 2024; Waqas et al. 2012).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOur research indicated that the increasing levels of salt stress are correlated with decreasing amounts of carotenoids and chlorophyll. Chlorophyll breakdown and pigment photooxidation may be the cause of this oxidative stress indicator. Photosynthetic capacity is affected by \u0026nbsp;decrease in chlorophyll content because it is a necessary component of photosynthesis. Stimulation of the net photosynthetic rate was observed in the \u003cem\u003eC. parahalotolerant\u003c/em\u003e and \u003cem\u003eA. medius\u003c/em\u003e endophyte-treated plants. Similar outcomes were observed in NaCl-stressed wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.), tomato (\u003cem\u003eLycopersicum\u003c/em\u003e), soybean (\u003cem\u003eGlycine max\u003c/em\u003e), cotton (\u003cem\u003eGossypium\u003c/em\u003e spp.), pepper (\u003cem\u003eCapsicum annuum\u003c/em\u003e), and mung bean (\u003cem\u003eVigna radiata\u003c/em\u003e L.) seedlings by other researchers (Chauhan et al. 2024; Liu et al. 2014; Moghaddam et al. 2021; Simaei et al. 2011; Zhang et al. 2016; Zou et al. 2023).\u003c/p\u003e\n\u003cp\u003eTariq et al. (2011) discovered that the instability of the pigment-protein complex under salt stress conditions and the oxidation of chloroplasts and chlorophyll pigments were the likely causes of the decrease in chlorophyll content in wheat seedling leaves subjected to salinity stress. Regardless of whether wheat seedlings experienced salt stress, we found that the application of fungal endophytes dramatically increased their chlorophyll content. Subsequent application may prevent ROS accumulation and production in plant tissues. Qi et al. (2012) reported comparable results in cucumber (\u003cem\u003eCucumis sativus\u003c/em\u003e) seedlings treated with NaCl. Carotenoids act as radical scavengers and singlet oxygen quenchers while also maintaining and shielding the lipid phase (Bu et al. 2012).\u003c/p\u003e\n\u003cp\u003eWheat treated with endophytes may be more resistant to salt stress because of their increased carbohydrate content. Fv/Fm ratios are frequently used as markers to demonstrate the induction of stress in plants. A plant is considered healthy and free of photosynthetic stress if its Fv/Fm ratio is 0.7 or higher (Bu et al. 2012; Ogbe et al. 2023; Sadeghi et al. 2020). Salt stress resulted in a decrease in the Fv/Fm ratio, which indicated a reduction in PSII activity and maximal quantum yield. Inactivation of the PSII donor side and certain structural alterations in PSII centers may be connected to the decline in the Fv/Fm ratio (Azad and Kaminskyj 2016; Irshad et al. 2023; Tóth et al. 2005). It has been discovered that Fv/Fm is dramatically increased in endophyte-colonized wheat and other crop plants under severe salt stress, although the potential interactions between chlorophyll fluorescence and fungal endophytes are still poorly understood (Siddiqui et al. 2022). Our findings showed that the maximum fungal endophyte inoculation increased quantum yield and PSII activity.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn the present study, colonization by fungal endophytes inhibited lipid peroxidation at all stress levels, whereas salt stress led to a significant increase in MDA concentration (lipid peroxidation). This might be due to the fact that \u0026nbsp;endophytes protect plants from oxidative stress by preventing membrane damage and eliciting antioxidant responses. Comparable outcomes of endophyte treatment on various agricultural plants have also been reported (Azad and Kaminskyj 2016; Gul et al. 2023; Li et al. 2023; Prajapati et al. 2024; Siddiqui et al. 2022; Zhang et al. 2016).\u003c/p\u003e\n\u003cp\u003eThe accumulation of O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u003c/sup\u003e following NaCl treatment, as demonstrated by the findings of the histochemical experiments, indicated the deposition of blue coloration and dark brown coloration on the surface of leaves. Owing to the extensive buildup of ROS, \u0026nbsp;blue and dark brown diformazan precipitates were much more noticeable in the leaves under NaCl stress. Plants treated with fungal endophytes showed a considerable reduction in ROS accumulation after 15 days. Similar results have been observed under abiotic stress conditions in crops treated with fungal endophytes (Cao et al. 2023; Chowdhury et al. 2024; Sadeghi et al. 2020; Zou et al. 2023). Superoxide radicals (O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u003c/sup\u003e) are neutralized by SOD to O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u003c/sup\u003e and H\u003csub\u003e2\u003c/sub\u003eO, which serves as the first line of defence against ROS (Azad and Kaminskyj 2016).\u003c/p\u003e\n\u003cp\u003eOsmotic molecules such as soluble carbohydrates and proteins are generally acknowledged as significant markers of plant responses to abiotic stress (Alscher et al. 2002; Azevedo-Neto et al. 2006). An extremely effective defensemechanism against oxidative damage caused by high salinity and drought stress in plant environments is usually demonstrated by increased levels of sucrose and glucose accumulation in plants. (Bartels and Sunkar 2005; Chauhan et al. 2024; Ogbe et al. 2023;Murakeozy et al. 2003; Zhang et al. 2016). However, the majority of earlier studies have identified the physiological functions of soluble sugars and their uptake by plants. We discovered that, in both salt stress and non-saline environments, fungal endophytes had a significant impact on the amount of soluble protein and sugar in wheat seedlings.\u003c/p\u003e\n\u003cp\u003eThe primary defence mechanism of the chloroplasts, cytosol, mitochondria, peroxisomes and apoplasts against the harmful effects of ROS is the AsA-GSH cycle. The AsA-GSH cycle, which is an efficient detoxification process against oxidative stress, contains five enzymes: SOD, DHAR, APX, GR, and MDHAR, in addition to GSH, AsA and NADPH (Asada 1999; Gill et al. 2013). SOD converted superoxide to H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in this cycle. APX, by decreasing H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e to water with AsA oxidation to MDHA, decreases to AsA via the monodehydroascorbate reductase (MDHAR) enzyme and disproportionates nonenzymatically to AsA and DHA. DHAR, which uses GSH as a reductant to convert DHA to AsA (Ahmad et al.2008). As a result, GSSG is produced and the GR can convert it back to GSH. (Gill et al. 2013) (Fig. 7).\u003c/p\u003e\n\u003cp\u003eUnder salt stress, the AsA content, DHA and AsA/DHA ratio drastically decreased in plants. Chen and Gallie (2006) also reported that reducing DHAR and MDHAR activity in salt-stressed plants led to greater DHA levels consistent with less AsA recycling; this, in turn, led to a low (i.e., more oxidized) AsA redox state. However, Table 3 clearly demonstrates that the reduction in the AsA/DHA ratio caused by salt stress was greatly reduced by inoculation with fungal endophytes. According to our study, fungal endophytes control the redox state of AsA to induce salt tolerance in wheat plants. Increasing the antioxidant enzyme activity of the AsA-GSH cycle may increase the amount of decreased AsA in the cells and its redox state. The AsA-GSH cycle plays a role in either direct or indirect elimination of ROS while GSH is a non-enzymatic antioxidant similar to AsA (Noctor and Foyer 2011).\u003c/p\u003e\n\u003cp\u003eTable 3 shows that despite the decrease in the ratio of GSH to GSSG, GSSG concentration increased under salt stress conditions. However, inoculation of plants under salt stress with fungal endophytes causes the GSH pool to be transformed into reduced forms, which greatly increases the GSH/GSSG ratio. The stressed plants appeared to take up a sizable amount of GSH, which corrected the redox status, most likely triggered cellular defence systems, and prevented cellular damage. As previously stated, boosting the antioxidant enzyme activity in the AsA-GSH cycle in stressed plants might help to maintain levels of glutathione and ascorbate, the two essential antioxidants against ROS-damaging effects.\u003c/p\u003e\n\u003cp\u003eEarlier studies on fungal-treated crops such as onion, maize, and wheat (Harman et al. 2004; González-Teuber as al. 2022; Prajapati et al. 2022\u003cstrong\u003e)\u003c/strong\u003e, have demonstrated similar results. According to Rawat et al. (2011), metabolites produced by \u003cem\u003eTrichoderma\u003c/em\u003e inoculation function as quenchers during ROS generation under environmental stress, thereby protecting the plant from oxidative damage. Our results are corroborated by earlier \u0026nbsp;studies described by\u0026nbsp;Bagheri et al. 2013; Hamilton et al. 2012;Irshad et al. 2023; Kumar et al. 2009; Li et al. 2023; Lubna et al. 2022; Moghaddam et al. 2021; Nath et al. 2016; Popovic et al. 2024; Sadeghi et al. 2020.\u003c/p\u003e\n\u003cp\u003eIn the current study, salinity stress increased the SOD and APX activities, while\u0026nbsp;reducing MDHAR, DHAR,\u0026nbsp;and GR activities in a dose-dependent manner. In other studies, Cao et al. (2023), Chaudhry et al. (2021), Lubna et al. (2022), Popovic et al. (2024), Wang et al. (2023), Zhang et al. (2016), Zou et al. (2023) illustrated that the\u0026nbsp;expression of\u0026nbsp;antioxidant enzyme genes provides tolerance to abiotic stresses, including salinity by reducing the oxidative stress caused by ROS in \u003cem\u003eCitrus trifoliate\u003c/em\u003e, \u003cem\u003ePiper nigrum\u003c/em\u003e, \u003cem\u003ePoncirus trifoliata\u003c/em\u003e, \u003cem\u003eGlycine max\u003c/em\u003e L.,\u0026nbsp;\u003cem\u003eTriticum aestivum\u0026nbsp;\u003c/em\u003eL., and\u0026nbsp;\u003cem\u003eA. cepa\u003c/em\u003e cultivars. These results are consistent with earlier researches on \u003cem\u003eBrassica parachinensis\u003c/em\u003e (Kamran et al. 2020) and \u003cem\u003eBrassica juncea\u003c/em\u003e (Ahmad et al. 2015).\u0026nbsp;According to researches on \u003cem\u003eFragaria\u003c/em\u003e sp. (Christou et al. 2014), further salinity-induced reductions in MDHAR, GR, and DHAR activities may be caused by reduced transcription of these genes, whereas decreased GR activity may be caused by NADPH deficiency under extreme stress (Gupta and Seth 2020; Prajapati et al. 2022).\u003c/p\u003e\n\u003cp\u003eComparing the same activities to those that were solely influenced by salinity, fungal endophytes enhanced APX, SOD, GR, MDHAR, and DHAR. This may be due to the overexpression of transcription and the gene translation responsible for synthesis, as observed under various abiotic stress conditions in \u003cem\u003eSolanum melongena\u003c/em\u003e, \u003cem\u003eSolanum lycopersicum\u003c/em\u003e (Singh and Prasad 2019), and \u003cem\u003eTriticum aestivum\u003c/em\u003e (Sun et al. 2015; Zhang et al. 2016).Notably, MDHAR and DHAR work together to preserve the concentration of AsA and the redox state during stressful situations (Kaya et al. 2020). In contrast to the treatments using salt alone, the current study’s findings on the effects of fungal supplementation on MDHAR and DHAR activities have been found associated with an increase in AsA levels. A higher GSH/GSSG ratio is necessary for the DHAR and other GSH-dependent enzymes associated to the antioxidant defence mechanisms and fungal inoculation increasing GR activity under salinity stress contributed to this maintenance (Fig. 7). Our results corroborate the increased AsA-GSH cycle upregulation resulting from fungal endophyte inoculation, as observed in \u003cem\u003eTriticum aestivum\u003c/em\u003e (Zhang et al. 2016; Tripathi et al. 2017), and \u003cem\u003eCitrus reticulata\u003c/em\u003e L. (Sadeghi et al. 2020) under various abiotic stresses. Under biotic and abiotic stresses, fungal endophytes can cause significant alterations in gene expression in several plant species (Zhang et al. 2016). According to the current study, elevated ROS levels in stressed plants may be the cause of elevated APX and SOD activities because they increase the expression of genes that code for these enzymes (Bowler et al.1992; Shekhawat et al. 2010). Thus, we assessed the possible influence of fungal endophytes on the expression of genes encoding antioxidant enzymes (APX, SOD, GR, MDHAR and DHAR).\u003c/p\u003e\n\u003cp\u003eWe found that the expression of genes encoding APX, SOD, DHAR, MDHAR and GR led to the elevated transcription levels, which correlated with an increase in the activity of the corresponding enzymes and augmentation of APX, SOD, MDHAR, DHAR and GR. According to earlier studies (Bailey et al. 2006; Alfano et al. 2007; Zhang et al. 2016; Wang et al.2023; Popovic et al. 2024), plants treated with fungal endophytes exhibited higher expression levels of genes related to plant defense against abiotic stresses. However, comprehensive research on gene expression in fungal-endophyte-treated wheat seedlings is lacking. We have also shown that increased transcription and activity of ROS-scavenging enzymes under salt stress are correlated with ROS generation in wheat plants treated with fungal endophytes, indicating that ROS are important for regulating plant acclimation and detoxifying cellular survival (Miller et al. 2010).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFurthermore, ROS serve as vital signaling molecules for cell survival and multiplication. Similar studies indicate that salinity is an environmental factor that can alter the normal homeostasis of plant cells and increase ROS production in plants. According to Miller et al. (2010), ROS are hazardous byproducts of stress metabolism and play a key role in signaling transduction molecules that are activated in response to salt stress.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur research concluded that \u003cem\u003eA. medius\u003c/em\u003e and \u003cem\u003eC. parahalotolerant\u003c/em\u003e, the two endophytic fungi, have a remarkable ability to mitigate the detrimental effects of salt stress on the development and growth of wheat seedlings. Using a variety of experiments, this study enabled us to investigate the potential physiological and molecular processes by which fungal endophytes mitigate the suppressive effects of salt stress. The mechanisms could be (i) fungal endophytes boosting the antioxidative defense system activity of wheat seedlings to withstand salt stress, or (ii) elevating the relative expression levels of antioxidant genes in stressed plants. Future researches must address a few difficulties, such as the effectiveness of endophytic fungi against other plant species and abiotic pressures. Further comprehensive investigations are required to ascertain as to which substance functions as a signaling component in endophytic fungi, causing systemic modifications in the expression of genes and antioxidant enzymes that encode them.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAPX \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Ascorbate peroxidase\u003c/p\u003e\n\u003cp\u003eSOD \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Superoxide dismutase\u003c/p\u003e\n\u003cp\u003eGR \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Glutathione reductase\u003c/p\u003e\n\u003cp\u003eMDHAR \u0026nbsp; Monodehydroascorbate reductase\u003c/p\u003e\n\u003cp\u003eDHAR \u0026nbsp; \u0026nbsp; \u0026nbsp;Dehydroascorbate reductase\u003c/p\u003e\n\u003cp\u003eAsA \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Ascorbate\u003c/p\u003e\n\u003cp\u003eGSH \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Glutathione\u003c/p\u003e\n\u003cp\u003eDHA \u0026nbsp; \u0026nbsp; \u0026nbsp; Dihydroascorbic acid\u003c/p\u003e\n\u003cp\u003eGSSG \u0026nbsp; \u0026nbsp; Oxidized glutathione\u003c/p\u003e\n\u003cp\u003eROS \u0026nbsp; \u0026nbsp; \u0026nbsp; Reactive oxygen species\u003c/p\u003e\n\u003cp\u003eTCA \u0026nbsp; \u0026nbsp; \u0026nbsp;Trichloroacetic acid\u003c/p\u003e\n\u003cp\u003eTBA \u0026nbsp; \u0026nbsp; \u0026nbsp;Thiobarbituric acid\u003c/p\u003e\n\u003cp\u003eNBT \u0026nbsp; \u0026nbsp; \u0026nbsp;Nitrobluetetrazolium test\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe writers affirm that there is no conflict of interest between them.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Head and Coordinator, CAS and DST-FIST in Botany, Institute of Science, BHU, Varanasi, India, are gratefully acknowledged by the authors for providing necessary research facilities. The Institute of eminence (IoE) (R/Dev/IoE/ Incentive/2021-22/32181), BHU, Varanasi, is gratefully acknowledged by RNK for its financial support. PP is grateful to the BHU administration for financial assistance in the form of a BHU RET fellowship. Prashasti acknowledges Prime Minister Research fellowship (PMRF) for financial support in the form of fellowship.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAgrawal SB, Rathore D (2007) Changes in oxidative stress defense in wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.) and mung bean (\u003cem\u003eVigna radiata\u003c/em\u003e L.) cultivars grown with and without mineral nutrients and irradiated by supplementalUltraviolet-B. Environ Exp Bot 59 (1): 21-33.https://doi.org/10.1016/j.envexpbot.2005.09.009\u003c/li\u003e\n\u003cli\u003eAhmad P, Hashem A, Abd-Allah EF, Alqarawi AA, John R, Egamberdieva D, Gucel S (2015) Role of \u003cem\u003eTrichoderma harzianum\u003c/em\u003e in mitigating NaCl stress in Indian mustard (\u003cem\u003eBrassica juncea\u003c/em\u003e L) through antioxidative defense system. Front Plant Sci 6:868. https://doi.org/10.3389/fpls.2015.00868\u003c/li\u003e\n\u003cli\u003eAhmad P, Sarwat M, Sharma S (2008) Reactive oxygen species, antioxidants and signaling in plants. J Plant Biol 51 (3):167-173. \u003c/li\u003e\n\u003cli\u003eAlfano G, Ivey MLL, Cakir C, Bos JIB, Miller SA, Madden LV (2007) Systemic modulation of gene expression in tomato by \u003cem\u003eTrichoderma hamatum\u003c/em\u003e 382. Phytopathol 97:429-437. https://doi.org/10.1094/PHYTO-97-4-0429\u003c/li\u003e\n\u003cli\u003eAlscher RG, Erturk N, Heath LS (2002) Role of superoxide dismutases (SODs) in controlling oxidative stress in plants. J Exp Bot 53(372):1331-1341. https://doi.org/10.1093/jexbot/53.372.1331\u003c/li\u003e\n\u003cli\u003eAsada K (1984) Chloroplasts-formation of active oxygen species. Methods Enzymol 105:422-429. https://doi.org/10.1016/S0076-6879(84)05059-X\u003c/li\u003e\n\u003cli\u003eAsada K (1999) The water-water cycle in chloroplasts: scavenging of active oxygen and dissipation of excess photons. Annu Plant Mol Biol 50: 601-639. https://doi.org/10.1146/annurev.arplant.50.1.601\u003c/li\u003e\n\u003cli\u003eAsaf S, Jan R, Khan MA, Khan AL, Asif S, Bilal S, Lee IJ (2023) Unraveling the mutualistic interaction between endophytic \u003cem\u003eCurvularialunata\u003c/em\u003e CSL1 and tomato to mitigate cadmium (Cd) toxicity via transcriptomic insights. Sci Total Environ 861:160542. https://doi.org/10.1016/j.scitotenv.2022.160542\u003c/li\u003e\n\u003cli\u003eAzad K, Kaminskyj S (2016) A fungal endophyte strategy for mitigating the effect of salt and drought stress on plant growth. Symbiosis 68:73-78. https://doi 10.1007/s13199-015-0370-y\u003c/li\u003e\n\u003cli\u003eAzevedo-Neto AD, Prisco JT, En\u0026eacute;as-Filho J, Abreu CEB, GomesFilho E (2006) Effect of salt stress on antioxidative enzymes and lipid peroxidation in leaves and roots of salt-tolerant and salt-sensitive maize genotypes. Environ Exp Bot 56:87-94. https://doi.org/10.1016/j.envexpbot.2005.01.008\u003c/li\u003e\n\u003cli\u003eBagheri AA, Saadatmand S, Niknam V, Nejadsatari T, Babaeizad V (2013) Effect of endophytic fungus, \u003cem\u003ePiriformospora indica\u003c/em\u003e, on growth and activity of antioxidant enzymes of rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.) under salinity stress. Int J Adv Biol Biomed Res 1(11):1337-1350.\u003c/li\u003e\n\u003cli\u003eBartels D, Sunkar R (2005) Drought and salt tolerance in plants. Crit Rev Plant Sci 24:23-58. https://doi.org/10.1080/07352680590910410\u003c/li\u003e\n\u003cli\u003eBecana M, Aparicio-Tejo P, Irigoyan JJ, Sanchez-Diaz M (1986) Some enzymes of hydrogen peroxide metabolism in leaves and root nodules of \u003cem\u003eMedicago sativa.\u003c/em\u003e Plant Physiol 82:1169-1171. https://doi.org/10.1104/pp.82.4.1169\u003c/li\u003e\n\u003cli\u003eBilal L, Asaf S, Hamayun M, Gul H, Iqbal A, Ullah I, Hussain A (2018) Plant growth promoting endophytic fungi \u003cem\u003eAsprgillus fumigatus\u003c/em\u003e TS1 and \u003cem\u003eFusarium proliferatum\u003c/em\u003e BRL1 produce gibberellins and regulates plant endogenous hormones. Symbiosis 76:117-127.https://doi.org/10.1007/s13199-018-0545-4\u003c/li\u003e\n\u003cli\u003eBowler C, Van Montagu M, Inze D (1992) Superoxide dismutase and stress tolerance. Annu Rev Plant Physiol Plant Mol Biol 43:83-116\u003c/li\u003e\n\u003cli\u003eBradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-254. https://doi.org/10.1016/0003-2697(76)90527-3\u003c/li\u003e\n\u003cli\u003eBu N, Li X, Li Y, Ma C, Ma L, Zhang C (2012) Effects of Na\u003csub\u003e2\u003c/sub\u003eCO\u003csub\u003e3\u003c/sub\u003e stress on photosynthesis and antioxidative enzymes in endophyte infected and non-infected rice. Ecotox Environ Safe 78: 35-40. https://doi.org/10.1016/j.ecoenv.2011.11.007\u003c/li\u003e\n\u003cli\u003eBui E (2013) Possible role of soil alkalinity in plant breeding for salt-tolerance. Biollett 9(5):20130566. https://doi.org/10.1098/rsbl.2013.0566\u003c/li\u003e\n\u003cli\u003eCao JL, He WX, Zou YN, Wu QS (2023) An endophytic fungus, \u003cem\u003ePiriformospora indica\u003c/em\u003e, enhances drought tolerance of trifoliate orange by modulating the antioxidant defense system and composition of fatty acids. Tree Physiol 43(3): 452-466. https://doi.org/10.1093/treephys/tpac126\u003c/li\u003e\n\u003cli\u003eChance B, Maehly AC (1955) Assay of catalase and peroxidases. Methods Enzymol 2: 764-775. http://doi: 10.1002/9780470110171.ch14\u003c/li\u003e\n\u003cli\u003eChauhan P, Singh M, Sharma A, Singh M, Chadha P, Kaur A (2024) Halotolerant and plant growth-promoting endophytic fungus \u003cem\u003eAspergillus terreus\u003c/em\u003e CR7 alleviates salt stress and exhibits genoprotective effect in \u003cem\u003eVigna radiata\u003c/em\u003e. Front Microbiol 15:1336533.https://doi.org/10.3389/fmicb.2024.1336533\u003c/li\u003e\n\u003cli\u003eChen Z, Gallie DR (2006) Dehydroascorbate reductase affects leaf growth, development, and function. Plant Physiol 142: 775-787. https://doi.org/10.1104/pp.106.085506\u003c/li\u003e\n\u003cli\u003eCheng L, Xu Z, Zhou X (2023) Application of \u003cem\u003eTrichoderma \u003c/em\u003especies increases plant salinity resistance: a bibliometric analysis and a meta-analysis. J Soils Sediments 23(7): 2641-2653. https://doi.org/10.1007/s11368-023-03557-0\u003c/li\u003e\n\u003cli\u003eChowdhury MZH, Mostofa MG, Mim MF, Haque MA, Karim MA, Sultana R, Islam SMN (2024) The fungal endophyte \u003cem\u003eMetarhizium anisopliae\u003c/em\u003e (MetA1) coordinates salt tolerance mechanisms of rice to enhance growth and yield. Plant PhysiolBiochem 207:108328. https://doi.org/10.1016/j.plaphy.2023.108328\u003c/li\u003e\n\u003cli\u003eChristou A, Manganaris GA, Fotopoulos V (2014) Systemic mitigation of salt stress by hydrogen peroxide and sodium nitroprusside in strawberry plants via transcriptional regulation of enzymatic and nonenzymatic antioxidants. Environ Exp Bot 107:46-54. https://doi.org/10.1016/j.envexpbot.2014.05.009\u003c/li\u003e\n\u003cli\u003eCompant S, Duffy B, Nowak J, Clement C, Barka EA (2010) Use of plant growth-promoting bacteria for biocontrol of plant diseases: principles, mechanisms of action, and future prospects. Appl Environ Microbiol 71(9): 4951-4959. https://doi.org/10.1128/AEM.71.9.4951-4959.2005\u003c/li\u003e\n\u003cli\u003eDrew DP, Lunde C, Lahnstein J, Fincher GB (2007) Heterologous expression of cDNAs encoding monodehydroascorbate reductases from the moss, \u003cem\u003ePhyscomitrella patens\u003c/em\u003e and characterization of the expressed enzymes. Planta 225: 945-954. http:// doi.org/10.1007/s00425-006-0394-x\u003c/li\u003e\n\u003cli\u003eElbagory M (2023) Reducing the adverse effects of salt stress by utilizing compost tea and effective microorganisms to enhance the growth and yield of wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.) plants. Agron 13(3): 823. https://doi.org/10.3390/agronomy13030823\u003c/li\u003e\n\u003cli\u003eEl-Sayed ASA, Deif HES, Hashe ESA, Fawza S (2022) Seed biopriming with \u003cem\u003ePhanerochaetechrysosporium\u003c/em\u003e enhances tolerance of wheat to salt stress through improvement of TAEXPB23 expression. J Anim Plant Sci 32(6):1744-1753. https://doi.org/10.36899/JAPS.2022.6.0582\u003c/li\u003e\n\u003cli\u003eFoyer CH, Kunert K (2024) The ascorbate/glutathione cycle coming of age. J Exp Bot 75(9):2682-2699. https://doi.org/10.1093/jxb/erae023\u003c/li\u003e\n\u003cli\u003eFoyer CH, Noctor G (2005) Redox homeostasis and antioxidant signaling: a metabolic interface between stress perception and physiological responses. The Plant Cell 17(7): 1866-1875. https://doi.org/10.1105/tpc.105.033589\u003c/li\u003e\n\u003cli\u003eGhorai S (2023) Endophytic fungi: a tool for managing abiotic stress in plants. In Plant metabolites under environmental stress. Apple Academic press, 1-24. \u003c/li\u003e\n\u003cli\u003eGiannakoula A, Moustakas M, Mylona P, Ioannis P, Traianos Y (2008) Aluminium tolerance in maize is correlated with increased levels of mineral nutrients, carbohydrates and proline and decreased levels of lipid peroxidation and Al accumulation. J Plant Physiol 165: 385-396. https://doi.org/10.1016/j.jplph.2007.01.014\u003c/li\u003e\n\u003cli\u003eGill SS, Tajrishi M, Madan M, Tuteja N (2013) A DESD-box helicase functions in salinity stress tolerance by improving photosynthesis and antioxidant machinery in rice (\u003cem\u003eOryza sativa\u003c/em\u003e L. cv. PB1). Plant Mol Biol 82:1-22. http:// doi.org/10.1007/s11103-013-0031-6\u003c/li\u003e\n\u003cli\u003eGillespie KM, Ainsworth EA (2007) Measurement of reduced, oxidized and total ascorbate content in plants. Nat Protoc 2:871-874. \u003c/li\u003e\n\u003cli\u003eGlick BR (2007) Promotion of plant growth by bacterial ACC deaminase. Crit Rev Plant Sci 26: 227-242. https://doi.org/10.1080/07352680701572966\u003c/li\u003e\n\u003cli\u003eGonz\u0026aacute;lez-Teuber M, Contreras RA, Z\u0026uacute;\u0026ntilde;iga GE, Barrera D, Bascu\u0026ntilde;\u0026aacute;n-Godoy L (2022) Synergistic association with root endophytic fungi improves morpho-physiological and biochemical responses of \u003cem\u003eChenopodium quinoa\u003c/em\u003e to salt stress. Front EcolEvol 9:787318. https://doi.org/10.3389/fevo.2021.787318\u003c/li\u003e\n\u003cli\u003eGul H, Ali R, Rauf M, Hamayun M, Arif M, Khan SA, Lee IJ (2023) \u003cem\u003eAspergillus welwitschiae\u003c/em\u003eBK isolate ameliorates the physicochemical characteristics and mineral profile of maize under salt stress. Plants 12(8):1703. https://doi.org/10.3390/plants12081703\u003c/li\u003e\n\u003cli\u003eGul Jan F, Hamayun M, Hussain A, Jan G, Iqbal A, Khan A, Lee IJ (2019) An endophytic isolate of the fungus \u003cem\u003eYarrowialipolytica\u003c/em\u003e produces metabolites that ameliorate the negative impact of salt stress on the physiology of maize. BMC Microbiol 19:1-10. https://doi.org/10.1186/s12866-018-1374-6\u003c/li\u003e\n\u003cli\u003eHarman GE, Howell CR, Viterbo A, Chet L, Lorito M (2004) \u003cem\u003eTrichoderma\u003c/em\u003e species opportunistic, avirulent plant symbionts (enl\u0026iacute;nea). Nat Rev 2 (1): 43-56\u003c/li\u003e\n\u003cli\u003eHodges DM, DeLong JM, Forney CF, Prange RK (1999) Improving the thiobarbituric acid-reactive-substances containing anthocyanin and other interfering compounds. Planta 207:(4) 604-611\u003c/li\u003e\n\u003cli\u003eIrshad K, Shaheed Siddiqui Z, Chen J, Rao Y, Wei X (2023) Bio-priming with salt tolerant endophytes improved crop tolerance to salt stress via modulating photosystem II and antioxidant activities in a sub-optimal environment. Front Plant Sci 14:1082480. https://doi.org/10.3389/fpls.2023.1082480\u003c/li\u003e\n\u003cli\u003eKamran M, Xie K, Sun J, Wang D, Shi C, Lu Y, Xu P (2020) Modulation of growth performance and coordinated induction of ascorbate-glutathione and methylglyoxal detoxification systems by salicylic acid mitigates salt toxicity in choysum (\u003cem\u003eBrassica parachinensis\u003c/em\u003e L.). Ecotoxicol Environ Saf 188:109877. https://doi.org/10.1016/j.ecoenv.2019.109877\u003c/li\u003e\n\u003cli\u003eKaya C, Ugurlar F, Ashraf M, Alam P, Ahmad P (2023) Nitric oxide and hydrogen sulfide work together to improve tolerance to salinity stress in wheat plants by upraising the AsA-GSH cycle. Plant PhysiolBiochem 194: 651-663. https://doi.org/10.1016/j.plaphy.2022.11.041\u003c/li\u003e\n\u003cli\u003eKhan AL, Waqas M, Khan AR, Hussain J, Kang SM, Gilani SA, Lee IJ (2015) Fungal endophyte \u003cem\u003ePenicillium janthinellum\u003c/em\u003e LK5 improves growth of ABA-deficient tomato under salinity. World J MicrobBiot 31(2): 265-275. http://doi.org/10.1007/s11274-013-1378-1\u003c/li\u003e\n\u003cli\u003eKhan MN, Siddiqui MH, Mohammad F, Naeem M, Khan MMA (2010) Calcium chloride and gibberellic acid protect linseed (\u003cem\u003eLinum usitatissimum\u003c/em\u003e L.) from NaCl stress by inducing antioxidative defence system and osmoprotectant accumulation. Acta Physiol Plant 32: 121-132. http://doi 10.1007/s11738-009-0387-z\u003c/li\u003e\n\u003cli\u003eKouadria R, Bouzouina M, Lotmani B, Soualem S (2023) Unraveling the role of endophytic fungi in barley salt-stress tolerance. Hell Plant Prot J 16(1):12-22. https://sciendo.com/article/10.2478/hppj-2023-0002\u003c/li\u003e\n\u003cli\u003eKubis J (2008) Exogenous spermidine differentially alters activities of some scavenging system enzymes, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and superoxide radical levels in water stressed cucumber leaves. J Plant Physiol 165:397-406\u003c/li\u003e\n\u003cli\u003eLi MF, Sun BG, Xiao ZZ, Sun L (2013). First characterization of a teleost Epstein-Barr virus-induced gene 3 (EBI3) reveals a regulatory effect of EBI3 on the innate immune response of peripheral blood leukocytes. Dev Comp Immunol 41:514-522. https://doi.org/10.1016/j.dci.2013.07.022\u003c/li\u003e\n\u003cli\u003eLi, X, Sun HF, Fan JH, Li YY, Ma LJ, Wang LL, Li XM (2023) Endophyte Enhanced the Antioxidant Capacity of Rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.) under Drought Stress. Pol J Environ Stud 32(2). https://doi.org/10.15244/pjoes/156356\u003c/li\u003e\n\u003cli\u003eLiu S, Dong Y, Xu L, Kong J (2014) Effects of foliar applications of nitric oxide and salicylic acid on salt-induced changes in photosynthesis and antioxidative metabolism of cotton seedlings. Plant Growth Regul 73: 67-68\u003c/li\u003e\n\u003cli\u003eLiu Y, Zheng J, Ge L, Tang H, Hu J, Li X, Shi Q (2024) Integrated metabolomic and transcriptomic analyses reveal the roles of alanine, aspartate and glutamate metabolism and glutathione metabolism in response to salt stress in tomato. Sci Hortic 328:112911.https://doi.org/10.1016/j.scienta.2024.112911\u003c/li\u003e\n\u003cli\u003eLu Z, Liu D, Liu S (2007) Two rice cytosolic ascorbate peroxidases differentially improve salt tolerance in transgenic \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Cell Rep 26:1909-1917. http:// doi.org/10.1007/s00299-007-0395-7\u003c/li\u003e\n\u003cli\u003eLubna Khan MA, Asaf S, Jan R, Waqas M, Kim KM, Lee IJ (2022) Endophytic fungus \u003cem\u003eBipolaris\u003c/em\u003e sp. CSL-1 induces salt tolerance in \u003cem\u003eGlycine max\u003c/em\u003e. L via modulating its endogenous hormones, antioxidative system and gene expression. J Plant Interact 17(1): 319-332. https://doi.org/10.1080/17429145.2022.2036836\u003c/li\u003e\n\u003cli\u003eMa LJ, Li YY, Yu CM, Wang Y, Li XM, Li N (2012) Alleviation of exogenous oligochitosan on wheat seedlings growth under salt stress. Protoplasma 249:393-399. http:// doi.org.10.1007/s00709-011- 0290-5\u003c/li\u003e\n\u003cli\u003eMahmood M, Bidabadi SS, Ghobadi C, Gray DJ (2012) Effect of methyl jasmonate treatments on alleviation of polyethylene glycol mediated water stress in banana (\u003cem\u003eMusa acuminata\u003c/em\u003e cv. \u0026lsquo;Berangan\u0026rsquo;, AAA) shoot tip cultures. Plant Growth Regul 68:161-169. http:// doi.org.10.1007/s10725-012-9702-6\u003c/li\u003e\n\u003cli\u003eMiller G, Suzuki N, Ciftci-Yilmaz S, Mittler R (2010) Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ 33:453-467.https://doi.org/10.1111/j.1365-3040.2009.02041.x\u003c/li\u003e\n\u003cli\u003eMiranda V, Silva-Castro GA, Ruiz-Lozano JM, Fracchia S, Garc\u0026iacute;a-Romera I (2023) Fungal endophytes enhance wheat and tomato drought tolerance in terms of plant growth and biochemical parameters. J Fungus 9(3):384. https://doi.org/10.3390/jof9030384\u003c/li\u003e\n\u003cli\u003eMittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7(9): 405-410. https://doi.org/10.1016/S1360-1385(02)02312-9\u003c/li\u003e\n\u003cli\u003eMoghaddam MSH, Safaie N, Soltani J, Hagh-Doust N (2021) Desert-adapted fungal endophytes induce salinity and drought stress resibstance in model crops. Plant PhysiolBiochem 160: 225-238. https://doi.org/10.1016/j.plaphy.2021.01.022\u003c/li\u003e\n\u003cli\u003eMunns R, Tester M (2008) Mechanisms of salinity tolerance. Annu Rev Plant Biol 59:651-68. https://doi.org/10.1146/annurev.arplant.59.032607.092911\u003c/li\u003e\n\u003cli\u003eNanda S, Mohanty B, Joshi RK (2018) Endophyte-mediated host stress tolerance as a means for crop improvement. Endophyte Secon Metabol 2:1-25\u003c/li\u003e\n\u003cli\u003eNath M, Bhatt D, Prasad R, Gill SS, Anjum NA, Tuteja N (2016) Reactive oxygen species generation-scavenging and signaling during plant-arbuscular mycorrhizal and \u003cem\u003ePiriformospora indica\u003c/em\u003e interaction under stress condition. Front Plant Sci 7:1574. https://doi.org/10.3389/fpls.2016.01574\u003c/li\u003e\n\u003cli\u003eNoctor G, Foyer CH (2011) Ascorbate and glutathione: the heart of the redox hub. Plant Physiol 155: 2-18. https://doi.org/10.1104/pp.110.167569\u003c/li\u003e\n\u003cli\u003eNoctor G, Mhamdi A, Foyer CH (2012) Oxidative stress and antioxidative systems: recipes for successful data collection and interpretation. Plant Cell Environ 35(2): 214- 221. https://doi.org/10.1111/pce.12726\u003c/li\u003e\n\u003cli\u003eOgbe AA, Gupta S, Stirk WA, Finnie JF, Staden J (2024). Endophyte inoculation enhances growth, secondary metabolites and biological activity of \u003cem\u003eEndostemon obtusifolius\u003c/em\u003e grown under drought stress. J Plant Growth Regul 43(4): 1103-1117. https://doi.org/10.1007/s00344-023-11167-w\u003c/li\u003e\n\u003cli\u003eOtaibi AI, Alghamdi SA, Abo-Elyousr KA (2024) The Influence of Salinity on Plant Growth and Amendment Strategies. Sohag J Sci 9(3): 261-267. https://doi.org/10.21608/sjsci.2024.258471.1168\u003c/li\u003e\n\u003cli\u003ePeng LiG, Wei X, Kang LG (2013) Salicylic acid increases the contents of glutathione and ascorbate and temporally regulates the related gene expression in salt-stressed wheat seedlings. Gene 529(2): 321-325. https://doi.org/10.1016/j.gene.2013.07.093\u003c/li\u003e\n\u003cli\u003ePetrini O (1991). Fungal endophytes of tree leaves. In Microbial ecology of leaves (pp. 179-197). New York, NY: Springer New York\u003c/li\u003e\n\u003cli\u003ePhang TH, Shao GH, Lam HM (2008) Salt tolerance in soybean. J Integr Plant Biol 50:1196-1212. https://doi.org/10.1111/j.1744-7909.2008.00760.x\u003c/li\u003e\n\u003cli\u003ePopović AV, Čamagajevac I\u0026Scaron;, Vuković R, Matić M, Velki M, Gupta DK, Lončarić Z (2024) Biochemical and molecular responses of the ascorbate-glutathione cycle in wheat seedlings exposed to different forms of selenium. Plant PhysiolBiochem 208:108460. https://doi.org/10.1016/j.plaphy.2024.108460\u003c/li\u003e\n\u003cli\u003ePrajapati P, Yadav M, Nishad JH, Gautam VS, Kharwar RN (2024) Salt tolerant fungal endophytes alleviate the growth and yield of saline-affected wheat genotype PBW-343. Microbiol Res 278:127514. https://doi.org/10.1016/j.micres.2023.127514\u003c/li\u003e\n\u003cli\u003eQi WZ, Zhao L (2013) Study of the siderophore-producing \u003cem\u003eTrichoderma asperellum\u003c/em\u003e Q1 on cucumber growth promotion under salt stress. J Basic Microbiol 53:355-364. https://doi.org/10.1002/jobm.201200031\u003c/li\u003e\n\u003cli\u003eQiu ZB, Guo JL, Zhu AJ, Zhang L, Zhang MM (2014) Exogenous jasmonic acid can enhance tolerance of wheat seedlings to salt stress. Ecotoxicol Environ Saf 104:202-208. https://doi.org/10.1016/j.ecoenv.2014.03.014\u003c/li\u003e\n\u003cli\u003eRahman I, Kode A, Biswas SK (2006) Assay for quantitative determination of glutathione and glutathione disulfide levels using enzymatic recycling method. Nat Protoc 1:3159-3165\u003c/li\u003e\n\u003cli\u003eRahman KU, Ali K, Rauf M, Arif M (2023) \u003cem\u003eAspergillus nomiae\u003c/em\u003e and fumigatus Ameliorating the Hypoxic Stress Induced by Waterlogging through Ethylene Metabolism in \u003cem\u003eZea mays\u003c/em\u003e L. Microorganisms 11(8):2025. https://doi.org/10.3390/microorganisms11082025\u003c/li\u003e\n\u003cli\u003eRawat L, Singh Y, Shukla N, Kumar J (2011) Alleviation of the adverse effects of salinity stress in wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.) by seed biopriming with salinity tolerant isolates of \u003cem\u003eTrichoderma harzianum\u003c/em\u003e. Plant Soil 347(1-2):387. http:// doi.org.10.1007/s11104-011-0858-z\u003c/li\u003e\n\u003cli\u003eRen XN, Shan Y, Li X, Wang LL, Li YY, Ma LJ, Li XM (2021) Endophytic infection programs the ascorbate-glutathione cycle in rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.) under Na\u003csub\u003e2\u003c/sub\u003eCO\u003csub\u003e3\u003c/sub\u003e stress. Appl Ecol Environ Res 19(3):1895-907\u003c/li\u003e\n\u003cli\u003eRodriguez RJ, Henson J, Van Volkenburgh E, Hoy M, Wright L, Beckwith F, Redman RS (2008) Stress tolerance in plants via habitat-adapted symbiosis. The ISME Journal 2(4):404-416. https://doi.org/10.1038/ismej.2007.106\u003c/li\u003e\n\u003cli\u003eRodriguez RJ, White Jr, JF, Arnold AE, Redman RS (2009) Fungal endophytes: diversity and functional roles. New Phytologist 182(2): 314-330. https://doi.org/10.1111/j.1469-8137.2009.02773.x\u003c/li\u003e\n\u003cli\u003eRong ZY, Jiang DJ, Cao JL, Hashem A Abd, Allah EF Alsayed MF, Wu QS (2022) Endophytic fungus \u003cem\u003eSerendipita indica\u003c/em\u003e accelerates ascorbate-glutathione cycle of white clover in response to water stress. Front Microbiol 13:967851. https://doi.org/10.3389/fmicb.2022.967851\u003c/li\u003e\n\u003cli\u003eSadeghi F, Samsampour D, Seyahooei MA, Bagheri A, Soltani J (2020) Fungal endophytes alleviate drought-induced oxidative stress in mandarin (\u003cem\u003eCitrus reticulata\u003c/em\u003e L.): toward regulating the ascorbate-glutathione cycle. Sci Hortic 261:108991. https://doi.org/10.1016/j.scienta.2019.108991\u003c/li\u003e\n\u003cli\u003eSahi C, Singh A, Kumar K, Blumwald E, Grover A (2006) Salt stress response in rice: genetics, molecular biology, and comparative genomics. Func Integr Genomics 6:263-284. http:// doi.org.10.1007/s10142-006-0032-5\u003c/li\u003e\n\u003cli\u003eSairam RK, Tyagi A (2004) Physiology and molecular biology of salinity stress tolerance in plants. Current science 86 (3):407-421. https://www.jstor.org/stable/24108735\u003c/li\u003e\n\u003cli\u003eSharma MK (2023) Plants Stress: Salt Stress and Mechanisms of Stress Tolerance. Current Agriculture Research Journal, 11(2). http://dx.doi.org/10.12944/CARJ.11.2.03\u003c/li\u003e\n\u003cli\u003eShekhawat GS, Verma K, Jana S, Singh K, Teotia P, Prasad A (2010). In vitro biochemical evaluation of cadmium tolerance mechanism in callus and seedlings of \u003cem\u003eBrassica juncea.\u003c/em\u003eProtoplasma 239:31-38.http://doi.org. 10.1007/s00709-009-0079-y\u003c/li\u003e\n\u003cli\u003eShen J, Chen Y (2023) \u003cem\u003eSerendipita indica\u003c/em\u003e: A Biostimulant Enhancing Low-Temperature Tolerance and Active Constituent Levels in \u003cem\u003ePolygonum cuspidatum\u003c/em\u003e. Agriculture 14(1): 7. https://doi.org/10.3390/agriculture14010007\u003c/li\u003e\n\u003cli\u003eSheng M, Tang M, Chan H, Yang B, Zhang F, Huang Y (2008) Influence of arbuscular mycorrhizae on photosynthesis and water status of maize plants under salt stress. Mycorrhiza 18: 287-296. http:// doi.org.10.1007/s00572-008-0180-7. http://doi.org.10.1007/s00572-008-0180-7\u003c/li\u003e\n\u003cli\u003eShi Q, Simpson WR, LiY Xu C, De K, Li X (2024) \u003cem\u003eEpichlo\u0026euml;bromicola\u003c/em\u003e Enhances \u003cem\u003eElymus dahucirus\u003c/em\u003e Plant Growth and Antioxidant Capacity under Cadmium Stress. Agronomy14 (2):365. https://doi.org/10.3390/agronomy14020365\u003c/li\u003e\n\u003cli\u003eSiddiqui ZS, Wei X, Umar M, Abideen Z, Zulfiqar F Chen J, Yasmeen R (2022) Scrutinizing the application of saline endophyte to enhance salt tolerance in rice and maize plants. Front Plant Sci 12: 770084. https://doi.org/10.3389/fpls.2021.770084\u003c/li\u003e\n\u003cli\u003eSimaei M, Khavarinejad RA, Saadatmand S, Bernard F, Fahimi H (2011) Interactive effects of salicylic acid and nitric oxide on soybean plants under NaCl salinity. Russ J Plant Physiol 58: 783-790. http:// doi.org.10.1134/S1021443711050220\u003c/li\u003e\n\u003cli\u003eSmith IK, Vierheller TL, Thorne CA (1988) Assay of glutathione-reductase in crude tissue-homogenates using 5,5\u0026prime;-dithiobis (2-nitrobenzoic acid). Anal Biochem 175: 408-413. https://doi.org/10.1016/0003-2697(88)90564-7\u003c/li\u003e\n\u003cli\u003eSuryanarayanan TS (1992) Light-incubation: a neglected procedure in mycology. Mycologist 6: 144\u003c/li\u003e\n\u003cli\u003eTariq A, Masroor M, Khan A, Jaime A, Teixeira S, Mohd I (2011) Role of salicylic acid in promoting salt stress tolerance and enhanced artemisinin production in \u003cem\u003eArtemisia annua\u003c/em\u003e L. J Plant Growth Regul 30:425-435. https://doi.org/10.1007/s00344-011-9205-0\u003c/li\u003e\n\u003cli\u003eTian XY, He MR, Wang ZL, Zhang JW, Song YL, He ZL (2015) Application of nitric oxide and calcium nitrate enhances tolerance of wheat seedlings to salt stress. Plant Growth Regul 77: 343-356. http://doi.org.10.1007/s10725-015-0069-3\u003c/li\u003e\n\u003cli\u003eT\u0026oacute;th SZ, Schansker G, Kissimon J, Kov\u0026aacute;cs L, Strasser RJ (2005) Biophysical studies of photosystemII-related recovery processes after a heat pulse in barley seedlings (\u003cem\u003eHordeum vulgare\u003c/em\u003e L.). J Plant Physiol 162:181-194. https://doi.org/10.1016/j.jplph.2004.06.010\u003c/li\u003e\n\u003cli\u003eVarma A, Verma S, Sahay N, B\u0026uuml;tehorn B, Franken P (2012) \u003cem\u003ePiriformospora indica,\u003c/em\u003e a cultivable plant-growth-promoting root endophyte. Appl Environ Microbiol 65(6): 2741-2744. https://doi.org/10.1128/AEM.65.6.2741-2744.1999\u003c/li\u003e\n\u003cli\u003eWang CF, Huang LL, Buchenauer H, Han QM, Zhang HC, Kang ZS (2007) Histochemical studies on the accumulation of reactive oxygen species (O\u003csub\u003e2\u003c/sub\u003e and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) in the incompatible and compatible interaction of wheat-\u003cem\u003ePuccinia striiformis\u003c/em\u003e f. sp. tritici. Physiol Mol Plant Pathol 71(4-6):230-239. https://doi.org/10.1016/j.pmpp.2008.02.006\u003c/li\u003e\n\u003cli\u003eWang FY, Lin XG, Yin R, Huang XF, LiH X, Li Z (2017). Induced maize salt tolerance by endophytic fungus \u003cem\u003ePenicillium oxalicum\u003c/em\u003e and its mechanisms. Pedosphere 27(1): 112-121. https://doi.org/10.1080/01490451.2023.2272620\u003c/li\u003e\n\u003cli\u003eWang L, Qin L, Sun X, Zhao S, Yu L, Chen S, Wang M (2023) Salt stress-induced changes in soil metabolites promote cadmium transport into wheat tissues. J Environ Sci 127:577-588.https://doi.org/10.1016/j.jes.2022.06.017\u003c/li\u003e\n\u003cli\u003eWang Y, Cao JL, Hashem A, Abd_Allah EF, Wu QS (2023) \u003cem\u003eSerendipita indica\u003c/em\u003e mitigates drought-triggered oxidative burst in trifoliate orange by stimulating antioxidant defense systems. Front Plant Sci 14:1247342.https://doi.org/10.3389/fpls.2023.1247342\u003c/li\u003e\n\u003cli\u003eWaqas M, Khan AL, Kamran M, Hamayun M, Kang SM, Kim YH, Lee IJ (2012) Endophytic fungi produce gibberellins and indoleacetic acid and promotes host-plant growth during stress. Molecules 17(9):10754-10773. https://doi.org/10.3390/molecules170910754\u003c/li\u003e\n\u003cli\u003eYounis ME, Hasaneen MNA, Kazamel AMS (2010) Exogenously applied ascorbic acid ameliorates detrimental effects of NaCl and mannitol stress in \u003cem\u003eVicia faba\u003c/em\u003e seedlings. Protoplasma 239:39-48. http://doi.org. 10.1007/s00709-009-0080-5\u003c/li\u003e\n\u003cli\u003eZhang S, Gan Y, Xu B (2016) Application of plant-growth-promoting fungi \u003cem\u003eTrichoderma longibrachiatum\u003c/em\u003e T6 enhances tolerance of wheat to salt stress through improvement of antioxidative defense system and gene expression. Front Plant Sci 7:217856. https://doi.org/10.3389/fpls.2016.01405\u003c/li\u003e\n\u003cli\u003eZhang SW, Gan YT, Xue YY, Xu BL (2014) The parasitic and lethal effects of \u003cem\u003eTrichoderma longibrachiatum\u003c/em\u003e against \u003cem\u003eHeteroderaavenae\u003c/em\u003e. Biol Control 72:1-8. https://doi.org/10.1016/j.biocontrol.2014.01.009\u003c/li\u003e\n\u003cli\u003eZou P, Li K C, Liu S, Xing RG, Qin YK, Yu HH (2015) Effect of chitooligosaccharides with different degrees of acetylation on wheat seedlings under salt stress. CarbohydrPolym 126: 62-69. https://doi.org/10.1016/j.carbpol.2015.03.028\u003c/li\u003e\n\u003cli\u003eZou Y, Zhang L, Liu R, He L, Hu Z, Liang Y, Zhou Y (2023) Endophytic fungus \u003cem\u003eFalciphora oryzae\u003c/em\u003e enhances salt tolerance by modulating ion homeostasis and antioxidant defense systems in pepper. Physiol Plant 175(6):14059.https://doi.org/10.1111/ppl.14059\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1.\u0026nbsp;\u003c/strong\u003eDNA sequences of PCR primers were used for qPCR determination of the five AsA-GSH biosynthesis related gene in wheat seedlings, F, Forward primer, R, reverse primer\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"718\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eAccession number\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer pairs\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eExpected amplification size (bp)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eSOD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eJQ613154.1(GenBank, Zhang et al. 2016)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eForward: CATTGTCGATAGCCAGATTCCTTT\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;Reverse: AGTCTTCCACCAGCATTTCCAGTA\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e138\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eAPX\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eEF55121.1 (GenBank, Popovic et al., 2024)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eForward: TGGAAGACGTGATTCGTCAG\u003c/p\u003e\n \u003cp\u003eReverse: TCAAACCCAGACCTTTCAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e174\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eMDHAR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eAK371371(GenBank, Li et al. 2013)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eForward: AGAAGTTTACGCCCTTCGGC\u003c/p\u003e\n \u003cp\u003eReverse: TTGGAATGTCATCGCCATC\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e132\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eDHAR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eAYO74784(GenBank, Li et al. 2013)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eForward: GTGCCTGTGTATAACGGTG\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;Reverse: ACAAGTGATGGAGTTGGGT\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e94\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eGR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eTC84151(GenBank, Popovic et al. 2024)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eForward: TGCGTCCCGAAGAAGATACT\u003c/p\u003e\n \u003cp\u003eReverse: GTTGATGTCCCCGTTGATCT\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e96\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u003c/strong\u003e Changes in Sugar, Protein content, total chlorophyll (mg/g FW), Carotenoid (mg/g FW) and chlorophyll fluorescence (Fv/Fm) in wheat seedlings inoculated with endophytic fungi, \u003cem\u003eCladosporium parahalotolerant\u003c/em\u003e and \u003cem\u003eAspergillus medius\u003c/em\u003e inoculation individually and in combination with each other, under salt stress condition (100 mM NaCl). Control was treated with sterile water\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"660\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.428571428571427%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eTreatments\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.78115501519757%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eSoluble sugar (mg/g FW)\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.589665653495441%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eProtein (mg/g FW)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.109422492401215%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eTotal chlorophyll (mg/g FW)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.653495440729483%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eCarotenoid (mg/g FW)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.437689969604863%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eFv/Fm\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.428571428571427%\" valign=\"top\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.78115501519757%\" valign=\"top\"\u003e\n \u003cp\u003e14.37\u003csup\u003ee\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.51\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.589665653495441%\" valign=\"top\"\u003e\n \u003cp\u003e6.59\u003csup\u003ee\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.58\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.109422492401215%\" valign=\"top\"\u003e\n \u003cp\u003e7.51\u003csup\u003ee\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.28\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.653495440729483%\" valign=\"top\"\u003e\n \u003cp\u003e0.33\u003csup\u003ed\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.00\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.437689969604863%\" valign=\"top\"\u003e\n \u003cp\u003e0.64\u003csup\u003ed\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.02\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.428571428571427%\" valign=\"top\"\u003e\n \u003cp\u003eNaCl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.78115501519757%\" valign=\"top\"\u003e\n \u003cp\u003e10.16\u003csup\u003ef\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.41\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.589665653495441%\" valign=\"top\"\u003e\n \u003cp\u003e4.13\u003csup\u003ef\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.21\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.109422492401215%\" valign=\"top\"\u003e\n \u003cp\u003e5.45\u003csup\u003ef\u0026nbsp;\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.10\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.653495440729483%\" valign=\"top\"\u003e\n \u003cp\u003e0.21\u003csup\u003ee\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.01\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.437689969604863%\" valign=\"top\"\u003e\n \u003cp\u003e0.54\u003csup\u003ee\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.01\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.428571428571427%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eC. parahalotolerant\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.78115501519757%\" valign=\"top\"\u003e\n \u003cp\u003e18.47\u003csup\u003ec\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.26\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.589665653495441%\" valign=\"top\"\u003e\n \u003cp\u003e10.34\u003csup\u003ec\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.48\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.109422492401215%\" valign=\"top\"\u003e\n \u003cp\u003e11.29\u003csup\u003eb\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.69\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.653495440729483%\" valign=\"top\"\u003e\n \u003cp\u003e0.49\u003csup\u003eb\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.06\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.437689969604863%\" valign=\"top\"\u003e\n \u003cp\u003e0.74\u003csup\u003eb,c\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.02\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.428571428571427%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eC. parahalotolerant\u003c/em\u003e+NaCl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.78115501519757%\" valign=\"top\"\u003e\n \u003cp\u003e15.0\u003csup\u003ed,e\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.86\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.589665653495441%\" valign=\"top\"\u003e\n \u003cp\u003e7.07\u003csup\u003ed,e\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.26\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.109422492401215%\" valign=\"top\"\u003e\n \u003cp\u003e8.31\u003csup\u003ed\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.24\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.653495440729483%\" valign=\"top\"\u003e\n \u003cp\u003e0.38\u003csup\u003ec,d\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.00\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.437689969604863%\" valign=\"top\"\u003e\n \u003cp\u003e0.64\u003csup\u003ed\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.02\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.428571428571427%\" valign=\"top\"\u003e\n \u003col start=\"1\" type=\"A\"\u003e\n \u003cli\u003e\u003cem\u003eMedius\u003c/em\u003e\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.78115501519757%\" valign=\"top\"\u003e\n \u003cp\u003e19.45\u003csup\u003eb\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.21\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.589665653495441%\" valign=\"top\"\u003e\n \u003cp\u003e11.37\u003csup\u003eb\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.30\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.109422492401215%\" valign=\"top\"\u003e\n \u003cp\u003e10.76\u003csup\u003eb\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.64\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.653495440729483%\" valign=\"top\"\u003e\n \u003cp\u003e0.42\u003csup\u003ec\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.03\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.437689969604863%\" valign=\"top\"\u003e\n \u003cp\u003e0.73\u003csup\u003ec\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.01\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.428571428571427%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eA. medius\u003c/em\u003e+NaCl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.78115501519757%\" valign=\"top\"\u003e\n \u003cp\u003e15.69\u003csup\u003ed\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.15\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.589665653495441%\" valign=\"top\"\u003e\n \u003cp\u003e7.46\u003csup\u003ed\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.13\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.109422492401215%\" valign=\"top\"\u003e\n \u003cp\u003e7.82\u003csup\u003ed,e\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.16\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.653495440729483%\" valign=\"top\"\u003e\n \u003cp\u003e0.36\u003csup\u003ed\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.00\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.437689969604863%\" valign=\"top\"\u003e\n \u003cp\u003e0.67\u003csup\u003ed\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.02\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.428571428571427%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eC. parahalotolerant\u003c/em\u003e+ \u003cem\u003eA. medius\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.78115501519757%\" valign=\"top\"\u003e\n \u003cp\u003e22.12\u003csup\u003ea\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.14\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.589665653495441%\" valign=\"top\"\u003e\n \u003cp\u003e16.23\u003csup\u003ea\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.23\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.109422492401215%\" valign=\"top\"\u003e\n \u003cp\u003e12.71\u003csup\u003ea\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.38\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.653495440729483%\" valign=\"top\"\u003e\n \u003cp\u003e0.68\u003csup\u003ea\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.03\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.437689969604863%\" valign=\"top\"\u003e\n \u003cp\u003e0.84\u003csup\u003ea\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.02\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.428571428571427%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eC. parahalotolerant\u003c/em\u003e +\u003cem\u003eA. medius\u003c/em\u003e+NaCl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.78115501519757%\" valign=\"top\"\u003e\n \u003cp\u003e18.42\u003csup\u003ec\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.22\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.589665653495441%\" valign=\"top\"\u003e\n \u003cp\u003e11.18\u003csup\u003eb\u003c/sup\u003e+ 0.17\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.109422492401215%\" valign=\"top\"\u003e\n \u003cp\u003e9.27\u003csup\u003ec\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.06\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.653495440729483%\" valign=\"top\"\u003e\n \u003cp\u003e0.48\u003csup\u003eb\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.02\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.437689969604863%\" valign=\"top\"\u003e\n \u003cp\u003e0.763\u003csup\u003eb\u003c/sup\u003e\u0026plusmn;\u0026nbsp;0.02\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3.\u003c/strong\u003e Change pattern of glutathione (GSH), oxidized glutathione (GSSG), ascorbate (AsA), and dehydroascorbate (DHA) and the ratios of GSH/GSSG and AsA/DHA in wheat seedlings inoculated with endophytic fungi, \u003cem\u003eC. parahalotolerant\u003c/em\u003e and \u003cem\u003eA. medius\u003c/em\u003eindividually and in combination with each other under salt stress (100 mM NaCl). Control was treated with sterile water\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"718\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.05997210599721%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTreatments\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.249651324965132%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAsA(\u0026micro;g/g FW)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.715481171548117%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eDHA(\u0026micro;g/g FW)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.576011157601116%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAsA/DHA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.297071129707113%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGSH(\u0026micro;g/g FW)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.341701534170154%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGSSG(\u0026micro;g/g FW)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.760111576011157%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGSH/GSSG\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.05997210599721%\" valign=\"top\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.249651324965132%\" valign=\"top\"\u003e\n \u003cp\u003e1.96\u003csup\u003ef\u003c/sup\u003e \u0026plusmn; 0.21\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.715481171548117%\" valign=\"top\"\u003e\n \u003cp\u003e1.33\u003csup\u003ea\u003c/sup\u003e\u0026plusmn; 0.11\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.576011157601116%\" valign=\"top\"\u003e\n \u003cp\u003e1.48\u0026plusmn; 0.17\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.297071129707113%\" valign=\"top\"\u003e\n \u003cp\u003e0.83\u003csup\u003eg\u003c/sup\u003e\u0026plusmn; 0.03\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.341701534170154%\" valign=\"top\"\u003e\n \u003cp\u003e0.43\u003csup\u003eb\u003c/sup\u003e \u0026plusmn; 0.07\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.760111576011157%\" valign=\"top\"\u003e\n \u003cp\u003e1.96 \u0026plusmn; 0.43\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.05997210599721%\" valign=\"top\"\u003e\n \u003cp\u003eNaCl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.249651324965132%\" valign=\"top\"\u003e\n \u003cp\u003e1.36\u003csup\u003eh\u003c/sup\u003e \u0026plusmn; 0.31\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.715481171548117%\" valign=\"top\"\u003e\n \u003cp\u003e1.03\u0026plusmn; 0.12\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.576011157601116%\" valign=\"top\"\u003e\n \u003cp\u003e1.35\u0026plusmn; 0.47\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.297071129707113%\" valign=\"top\"\u003e\n \u003cp\u003e0.72\u003csup\u003eh\u003c/sup\u003e\u0026plusmn; 0.02\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.341701534170154%\" valign=\"top\"\u003e\n \u003cp\u003e0.46\u003csup\u003ea\u003c/sup\u003e \u0026plusmn; 0.01\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.760111576011157%\" valign=\"top\"\u003e\n \u003cp\u003e1.57 \u0026plusmn; 0.03\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.05997210599721%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eC. parahalotolerant\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.249651324965132%\" valign=\"top\"\u003e\n \u003cp\u003e2.16\u003csup\u003ee\u003c/sup\u003e \u0026plusmn; 0.25\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.715481171548117%\" valign=\"top\"\u003e\n \u003cp\u003e1.46\u0026plusmn; 0.23\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.576011157601116%\" valign=\"top\"\u003e\n \u003cp\u003e2.7\u0026plusmn; 1.13\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.297071129707113%\" valign=\"top\"\u003e\n \u003cp\u003e1.3\u003csup\u003eb\u003c/sup\u003e\u0026plusmn; 0.06\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.341701534170154%\" valign=\"top\"\u003e\n \u003cp\u003e0.30\u003csup\u003ec\u003c/sup\u003e \u0026plusmn; 0.09\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.760111576011157%\" valign=\"top\"\u003e\n \u003cp\u003e4.64 \u0026plusmn; 1.44\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.05997210599721%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eC.parahalotolerant\u003c/em\u003e+NaCl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.249651324965132%\" valign=\"top\"\u003e\n \u003cp\u003e1.56\u003csup\u003eg\u003c/sup\u003e \u0026plusmn; 0.31\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.715481171548117%\" valign=\"top\"\u003e\n \u003cp\u003e1.33\u003csup\u003ea\u003c/sup\u003e\u0026plusmn; 0.55\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.576011157601116%\" valign=\"top\"\u003e\n \u003cp\u003e1.46\u0026plusmn; 1.08\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.297071129707113%\" valign=\"top\"\u003e\n \u003cp\u003e1.21\u003csup\u003ed\u003c/sup\u003e\u0026plusmn; 0.05\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.341701534170154%\" valign=\"top\"\u003e\n \u003cp\u003e0.21\u003csup\u003ef\u003c/sup\u003e \u0026plusmn; 0.05\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.760111576011157%\" valign=\"top\"\u003e\n \u003cp\u003e5.84 \u0026plusmn; 1.77\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.05997210599721%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eA. medius\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.249651324965132%\" valign=\"top\"\u003e\n \u003cp\u003e3.43\u003csup\u003eb\u003c/sup\u003e \u0026plusmn; 0.21\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.715481171548117%\" valign=\"top\"\u003e\n \u003cp\u003e1.36\u003csup\u003ea\u003c/sup\u003e \u0026plusmn; 0.45\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.576011157601116%\" valign=\"top\"\u003e\n \u003cp\u003e2.75\u0026plusmn; 1.13\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.297071129707113%\" valign=\"top\"\u003e\n \u003cp\u003e1.20\u003csup\u003ee\u003c/sup\u003e \u0026plusmn;0.02\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.341701534170154%\" valign=\"top\"\u003e\n \u003cp\u003e0.27\u003csup\u003ed,e\u003c/sup\u003e \u0026plusmn; 0.02\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.760111576011157%\" valign=\"top\"\u003e\n \u003cp\u003e4.52 \u0026plusmn; 0.28\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.05997210599721%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eA. medius\u003c/em\u003e+NaCl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.249651324965132%\" valign=\"top\"\u003e\n \u003cp\u003e2.33\u003csup\u003ed\u003c/sup\u003e \u0026plusmn; 0.25\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.715481171548117%\" valign=\"top\"\u003e\n \u003cp\u003e1.33\u0026plusmn; 0.32\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.576011157601116%\" valign=\"top\"\u003e\n \u003cp\u003e1.83\u0026plusmn; 0.52\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.297071129707113%\" valign=\"top\"\u003e\n \u003cp\u003e1.09\u003csup\u003ef\u003c/sup\u003e\u0026plusmn; 0.04\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.341701534170154%\" valign=\"top\"\u003e\n \u003cp\u003e0.19\u003csup\u003eh\u003c/sup\u003e \u0026plusmn; 0.04\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.760111576011157%\" valign=\"top\"\u003e\n \u003cp\u003e5.70 \u0026plusmn; 1.21\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.05997210599721%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eC. parahalotolerant+ A. medius\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.249651324965132%\" valign=\"top\"\u003e\n \u003cp\u003e3.9\u003csup\u003ea\u003c/sup\u003e \u0026plusmn; 0.10\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.715481171548117%\" valign=\"top\"\u003e\n \u003cp\u003e1.56\u0026plusmn; 0.31\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.576011157601116%\" valign=\"top\"\u003e\n \u003cp\u003e3.20\u0026plusmn; 0.81\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.297071129707113%\" valign=\"top\"\u003e\n \u003cp\u003e1.47\u003csup\u003ea\u003c/sup\u003e\u0026plusmn; 0.03\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.341701534170154%\" valign=\"top\"\u003e\n \u003cp\u003e0.24\u003csup\u003ed,e\u003c/sup\u003e \u0026plusmn; 0.01\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.760111576011157%\" valign=\"top\"\u003e\n \u003cp\u003e6.04 \u0026plusmn; 0.21\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.05997210599721%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eC. parahalotolerant+ A. medius\u003c/em\u003e+NaCl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.249651324965132%\" valign=\"top\"\u003e\n \u003cp\u003e3.16\u003csup\u003ec\u003c/sup\u003e \u0026plusmn;\u0026nbsp;0.31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.715481171548117%\" valign=\"top\"\u003e\n \u003cp\u003e1.43\u0026plusmn; 0.26\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.576011157601116%\" valign=\"top\"\u003e\n \u003cp\u003e2.51\u0026plusmn; 0.58\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.297071129707113%\" valign=\"top\"\u003e\n \u003cp\u003e1.30\u003csup\u003ec\u003c/sup\u003e\u0026plusmn; 0.02\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.341701534170154%\" valign=\"top\"\u003e\n \u003cp\u003e0.20\u003csup\u003eg\u003c/sup\u003e \u0026plusmn; 0.03\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.760111576011157%\" valign=\"top\"\u003e\n \u003cp\u003e6.64 \u0026plusmn; 1.09\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Triticum aestivum L., Fungal endophyte, Salt stress, Reactive oxygen species (ROS), Ascorbate-glutathione cycle, Defensive system gene expression","lastPublishedDoi":"10.21203/rs.3.rs-4874583/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4874583/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Background and aims\n\nWheat (Triticum aestivum L.) faces considerable challenges in terms of growth and productivity due to soil salinity, which is a major constraint to agricultural success. This study investigated the potential of fungal endophytes to enhance wheat growth and improve salt tolerance by influencing the ascorbate-glutathione cycle and gene expression.\n\nMethods\n\nExperiments were conducted, usingwheat seedlings (PBW-343) inoculated with endophytic fungi (Cladosporium parahalotolerant and Aspergillus medius)isolated from salt-tolerant wheat genotypes (KRL-210, KRL-213 and KRL-19) fromthe previous study. Endophytic fungi were used individually and in combination. Fifteen days seedlings exposed to 100 mM NaCl in the presence and absence of fungal endophytes. To elucidate the molecular mechanism, gene expression analysis was performed on key genesAPX, SOD, GR, DHAR, and MDHAR.\n\nResults\n\nSeedlings treated with endophytic fungi (consortia form)significantly enhanced the sugar, protein, chlorophyll, carotenoid content, and chlorophyll fluorescence (Fv/Fm)compared to control under salt stress. The O2- and lipid peroxidation levels were significantly reduced in plants inoculated with fungal endophytes. Salt stress increased APX, SOD activities and decreased GR, MDHARand DHAR activities.Endophytic fungi inoculated with salt-stressed seedlings enhanced the above-mentioned indicators compared to the salt-stressed plants without fungal endophytes, as well as in the ratios of AsA/DHA and GSH/GSSG.Endophytic fungienhanced the transcript levels of SOD, DHAR, APX, GR, and MDHAR genes compared to the control\n\nConclusions\n\nThe present study found that the expression levels of several genes associated with the ascorbate-glutathione cycle were upregulated in endophyte-inoculated plants, indicating a more efficient antioxidant system capable of scavenging reactive oxygen species.","manuscriptTitle":"Fungal endophytes promote wheat (Triticum aestivum L., genotype-PBW-343) growth and enhance salt tolerance through improvement of ascorbate-glutathione cycle and gene expression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-17 06:29:39","doi":"10.21203/rs.3.rs-4874583/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e73d323b-7aa9-4dcf-9110-51048292a899","owner":[],"postedDate":"September 17th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-10-15T04:20:20+00:00","versionOfRecord":[],"versionCreatedAt":"2024-09-17 06:29:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4874583","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4874583","identity":"rs-4874583","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Outcome instruments

MUSA

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00