In silico approach to understand epigenetics of POTEE in ovarian cancer.
OA: gold
CC-BY-4.0
Abstract
Ovarian cancer is the third leading cause of cancer-related deaths in India. Epigenetics mechanisms seemingly plays an important role in ovarian cancer. This paper highlights the crucial epigenetic changes that occur in POTEE that get hypomethylated in ovarian cancer. We utilized the POTEE paralog mRNA sequence to identify major motifs and also performed its enrichment analysis. We identified 6 motifs of varying lengths, out of which only three motifs, including CTTCCAGCAGATGTGGATCA, GGAACTGCC, and CGCCACATGCAGGC were most likely to be present in the nucleotide sequence of POTEE. By enrichment and occurrences identification analyses, we rectified the best match motif as CTTCCAGCAGATGT. Since there is no experimentally verified structure of POTEE paralog, thus, we predicted the POTEE structure using an automated workflow for template-based modeling using the power of a deep neural network. Additionally, to validate our predicted model we used AlphaFold predicted POTEE structure and observed that the residual stretch starting from 237-958 had a very high confidence per residue. Furthermore, POTEE predicted model stability was evaluated using replica exchange molecular dynamic simulation for 50 ns. Our network-based epigenetic analysis discerns only 10 highly significant, direct, and physical associators of POTEE. Our finding aims to provide new insights about the POTEE paralog.
My notes (saved in your browser only)
Citation neighborhood (no data yet)
We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.
Source provenance
- europepmc
- last seen: 2026-07-08T06:14:57.058073+00:00
- unpaywall
- last seen: 2026-05-21T05:10:58.409756+00:00
License: CC-BY-4.0