Development and Field Evaluation of a Rapid Detection Method for Babesia microti using fluorescent recombinase polymerase amplification(RPA) technology

Development and Field Evaluation of a Rapid Detection Method for Babesia microti using fluorescent recombinase polymerase amplification(RPA) technology | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Development and Field Evaluation of a Rapid Detection Method for Babesia microti using fluorescent recombinase polymerase amplification(RPA) technology Yuchun Cai, Han Yin Yang, Kun Qiang, Chenghang Yu, Shuning Yan, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7755464/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 10 You are reading this latest preprint version Abstract Background The frequent occurrences of Babesia microti ( B. microti ) infection have emerged as a significant global public health safety concern. The diagnosis of patients constitutes a crucial component in the prevention and control of babesiosis, necessitating the urgent establishment of efficient and accurate molecular biology diagnostic methods for B. microti detection. Purpose This study aimed to develop a sensitive, specific, and rapid fluorescent recombinase polymerase amplification (RPA) technique for the detection of B. microti ( B. microti ) and assess its suitability for field use. Methods This study developed and optimized a fluorescent RPA assay targeting the B. microti 18S rRNA gene fragment. The method's sensitivity (detection limit down to 10 fg/µL genomic DNA), specificity (distinguishing Plasmodium samples), and detection limit for spiked mouse blood samples (across varying parasitemia levels) were evaluated. The detection capability was validated using samples from an infected mouse model (tail-tip blood collected 3–21 days post-infection) and two confirmed human cases. Furthermore, 119 blood samples from patients presenting with fever accompanied by thrombocytopenia were tested using both nested PCR and the newly developed fluorescent RPA assay. The agreement between the two methods was analyzed using the Kappa value, and the significance of their difference was assessed using McNemar's test. Results A fluorescent RPA assay was developed targeting two B. microti 18S rRNA fragments (243 bp/191 bp). The 191 bp fragment demonstrated superior sensitivity (detection limit: 1 fg/µL genomic DNA) and was selected for assay establishment. Optimized at 39°C for 20 min, its detection threshold was defined by the lowest detectable concentration (1 fg/µL). Specificity testing with 8 P. falciparum and 8 P. ovale samples showed fluorescence below this threshold. The assay achieved a detection limit of 0.046 parasites/µL blood, demonstrating a 600-fold increase in sensitivity compared to nested PCR, which detects 28.49 parasites/µL. In infected mice, both RPA and nested PCR detected parasites by day 9 post-infection (microscopy: day 15), with RPA showing higher positivity. The method confirmed infection in 2 patients. Among 119 febrile patients with thrombocytopenia from Xinyang City, Henan Province, nested PCR detected 20 B. microti- positive cases while fluorescent RPA detected 21. The Kappa value for agreement between the methods was 97.05% (91.31% − 100%), and McNemar's test indicated no statistically significant difference in their detection rates (S = 1, P > 0.1). Based on the combined results of both tests, the molecular positivity rate for B. microti in this sample set was 17.65%, with co-infections involving Bunya virus present, accounting for 10.08% of the tested samples. Conclusion The fluorescence RPA method provides a rapid, sensitive, and specific tool for detecting B. microti and is effective for field screening. Biological sciences/Biological techniques Biological sciences/Biotechnology Health sciences/Diseases Biological sciences/Microbiology Biological sciences/Molecular biology Babesiosis Babesia microti recombinase polymerase amplification fluorescence RPA technology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Babesiosis is a parasitic zoonosis caused by infection with Babesia ( Babesia spp. ) species. The definitive hosts of Babesia 's are various species of ticks, while the intermediate hosts are primarily mammals, including cattle, dogs, and sheep. Humans can also serve as intermediate hosts [ 1 – 4 ]. Within the intermediate host, Babesia infects erythrocytes, where it exists as trophozoites and schizonts [ 5 , 6 ]. The incubation period following infection is generally prolonged, often lasting more than a week, with fever and anemia being the predominant symptoms [ 4 , 7 ]. B. microti and Babesia venatorum are the most common species reported in China, with hundreds of confirmed cases [ 8 ]. Most B. venatorum , cases have been found in Northeast China, while B. microti infections have been reported in southern provinces, including Yunnan, Guangxi, and Fujian [ 8 , 9 ]. Molecular screening for Babesia has revealed more than 100 positive cases in studies of patients with fever or tick bites [ 8 ]. Although only about 320 cases of Babesia infections in China, prioritizing prevention, control, and rapid diagnosis is critical [ 8 ]. The early symptoms of Babesia microti infection, such as fever and fatigue, are easily confused with malaria or other febrile illnesses. Highly sensitive diagnostic tests enable rapid confirmation during the low parasitemia stage, preventing treatment delays that may lead to severe complications (e.g., hemolytic anemia, organ failure) or even death [ 10 ]. B. microti is a zoonotic pathogen. Highly sensitive detection technologies (such as fluorescent recombinase polymerase amplification (RPA)) can accurately identify asymptomatic carriers and low-level infections in environmental or reservoir animal hosts, providing crucial data for epidemic early warning [ 11 ]. High-sensitivity testing is vital for ensuring transfusion safety risks, as the blood of asymptomatic infected individuals can transmit babesiosis via transfusion. The US FDA mandates nucleic acid testing (NAT) for blood donor screening, requiring a sensitivity capable of detecting 1–10 parasites/µL (≈ 1 fg/µL DNA) to interrupt the transfusion transmission chain [ 12 ]. Molecular detection methods fo r Babesia spp. include conventional PCR, real-time quantitative PCR (qPCR), loop-mediated isothermal amplification (LAMP), and recombinase polymerase amplification (RPA). These techniques amplify pathogen nucleic acids by targeting specific genes (e.g., 18S rRNA, mitochondrial genes, or heat shock protein genes), ensuring high sensitivity and specificity. Compared to conventional PCR, RPA amplifies nucleic in just 20 minutes without the need for a thermal cycler, making it highly suitable for field or clinic use. While both methods exhibit comparable sensitivity (detecting 1–10 copies), RPA demonstrates superior stability in low-concentration samples. In contrast to LAMP, RPA offers distinct advantages: faster reaction times, simplified primer design, and lower temperature requirements (37–42°C) [ 13 ], enhancing its applicability in resource-limited settings. Key benefits of RPA for Babesia spp detection include its capacity to diagnose low-parasitemia infections [ 14 ], rapid diagnosis [ 15 ], field applicability through portable fluorescence detectors [ 16 ], and the ability to multiplex detect of species such as B. microti and B. venatorum using multicolor probe design. This study aim to establish a sensitive, specific, efficient, and rapid fluorescent recombinase polymerase amplification (RPA) assay for the detection of B. microti and to evaluate its diagnostic value through laboratory assessment and field sample testing. Methods Sample collection The standard B. microti Peabodymjr strain (ATCC, RPA-99) was purchased from the American Type Culture Collection (Manassas, VA) and maintained in BALB/c mice via serial passages, following previously described methods [ 17 ]. All animal experiments conducted in this study were approved by the Experimental Animal Welfare and Ethics Committee of the Animal Center of the Institute of Parasitic Disease Prevention and Control and the Chinese Center for Disease Control and Prevention (Chinese Center for Tropical Diseases Research) (Animal Ethics Approval No: IPD-2019-14). Blood samples from patients infected with P. falciparum and P. ovale were collected and preserved by the same institute. Blood samples from healthy donors were provided by the Health Examination Center of Shanghai, China. While samples from B. microti infected patients were provided by the Zhejiang Provincial Center for Disease Control and Prevention. Samples from patients with fever and thrombocytopenia were collected and provided by the Henan Provincial Center for Disease Control and Prevention. Ethics statement The animal and human blood collection study was reviewed and approved by The Laboratory Animal Welfare & Ethics Committee (LAWEC) of the Chinese Centre for Tropical Diseases Research (permit Number: IPD-2019-14) and the Medical Ethics Committee of National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention (Chinese Center for Tropical Diseases Research) (Ethical approval number 2019004). All methods were carried out in accordance with relevant guidelines and regulations. The informed consent was obtained from all subjects and/or their legal guardian(s). Establishment of the fluorescence RPA Method Design primers for RPA detection of B. microti Primers were designed for the 18S rRNA, regions of B. microti . According to RPA primer design principles, RPA method primers are typically longer than conventional PCR primers but are generally designed between 27–35 bp to avoid dimer formation caused by excessive length. Additionally, the CG base content at both ends of the primer should be optimized, excessive clustering of G bases at the 5’-end should be avoided, while the CG ratio at the 3’-end should be increased to enhance amplification efficiency. Using Primer Premier 6.0 and DNAMAN, along with manual design, six sets of primers were generated (Supplementary Table 1). Design primers and probes for fluorescence RPA detection of B. microti Based on the RPA amplification results, primers and probes for fluorescent RPA were designed for the fragments corresponding to the better-performing primer groups 2 and 7. To identify the optimal primers and probe for B. microti fluorescent RPA, two pairs of primers (27–35 bp in length) and a probe (modified with a tetrahydrofuran [THF] site and labeled with a FAM fluorophore at the 5′end) were designed for each of the two selected fragments (groups 2 and 7). Screening was conducted using B. microti genomic DNA as the template under the following conditions: 39°C for 40 min. The optimal primers and probe were determined by comparing the fluorescence intensity curves generated during the reaction. The sequences of the selected primers and probes are shown in Table 1 . Table 1 Primers and probes of fluorescent recombinase polymerase amplification (RPA) method. Accession number number Primer and probe sequences(5'→3') Primer and probe names MK609547.1 2 CACAGGGAGGTAGTGACAAGAAATAACAAT 2-1-F TATT GGAGCTGGAATTACCGCGGCTGCT 2-1-R CTTCCCAGAGTATCAATTGGAGGGCAAGTC 2-2-F CAAGGCAGAAATTCAACTACGAGCTTCTTAAC 2-2-R CAGGGCTTAAAGTCTTGTAATTGGAATGATG 2-3-F GACTTG CCCTCCAATTGATACTCTGGGAAGG 2-3-R CTTCTTAACTGCAACAACTTTAATATACGC/i6FAMdT//idSp//iBHQdT/TGGAGCTGGAATTAC-C3 Spacer 2-PROBE 7 TTCGATTCCGGAGAGGGAGCCTGAGAAACG 7-1-F CTGCAACAACTTTAATATACGCTATTGGAG 7-1-R CTGAGAAACGGCTACCACATCTAAGGAAGGC 7-2-F CTGCTGGCACCAGACTTGCCCTCCAATTGA 7-2-R CGGCTACCACATCTAAGGAAGGCAGCAGGC 7-3-F TCCCATCATTCCAATTACAAGACTTTAAGC 7-3-R CGCAAATTACCCAATCCTGACACAGGGAGG/i6FAMdT//idSp/G/iBHQdT/GACAAGAAATAAC-C3 Spacer 7-PROBE Establishment of a Fluorescent RPA Reaction System The fluorescent RPA reaction was prepared in a 50 µL system following the TwistAmp exo Kits protocol. The reaction mixture included 2.1 µL each of forward and reverse primers (10 µmol/µL), 0.6 µL fluorescent probe (10 µmol/µL), 25 µL buffer, and 15.2 µL deionized water. After gentle mixing and centrifugation, the solution was transferred to a lyophilized pellet tube, aliquoted into a BIO-RAD eight-tube strip (TLS0851), and briefly centrifuged to remove bubbles. Subsequently, 2 µL DNA template and 3 µL magnesium acetate (280 mmol/L) were added to the tube cap and centrifuged. The reaction was incubated at 39°C for 4 min in a metal bath, inverted repeatedly for homogenization, and briefly centrifuged. The reaction was performed utilizing a CFX96 fluorescence quantitative PCR instrument (Bio-Rad, USA) at 39°C for 40 cycles (60 seconds per cycle, total 40 minutes). Optimization of Temperature and Time Parameters, and Sensitivity Evaluation for Fluorescent RPA To optimize the temperature, nucleic acid amplification was performed at various temperatures (37℃, 38℃, 39℃, 40℃, 41℃, and 42℃) to determine the optimal conditions for the reaction using the genomic DNA of B. microti as a template. Sensitivity was evaluated by diluting B. microti genomic DNA into eight concentrations: 1 ng/µL, 100 pg/µL, 10 pg/µL, 1 pg/µL, 100 fg/µL, 10 fg/µL, 1 fg/µL, and 0.1 fg/µL, blank controls were double distilled water. Fluorescence RPA reactions were initially set for 40 minutes and monitored. At 20 minutes, clear amplification was observed for the 1 fg/µL group, allowing for the reduction of reaction time. Subsequent testing was conducted for 20 minutes to assess the method’s performance within this time frame. Parallel nested PCR was performed using the same samples. Nucleotide sequence of the 18S rRNA-specific fragment was amplified using the extracted DNA as the template, with primers listed in supplementary Table 2, according to the previously described protocols [ 18 ]. Laboratory Evaluation of the Fluorescent RPA Method Specificity Evaluation of the Fluorescent RPA Method To evaluate the specificity of the method, fluorescent RPA reactions were performed using blood samples from 8 patients infected with Plasmodium falciparum and 8 patients infected with Plasmodium ovale . Patient samples served as positive controls, B.microti genomic DNA concentrations of 1fg/µLwere used as the threshold reference, and samples from healthy individuals were included as negative controls. The specificity of the method was assessed by observing the fluorescence intensity of each reaction group. Determination of the Parasite Density Minimum Detection Limit for Fluorescent RPA Female Balb/c mice infected with the ATCC, RPA-99 strain of B. microti were used. Blood was collected from the orbital sinus of infected Balb/c mice (with a microscopically confirmed parasite density of 4%) into EDTA anticoagulant tubes and thoroughly mixed. Blood from uninfected mice was collected and anticoagulated using the same method. A 20 µL aliquot of B. microti -infected blood was diluted 5-fold with 80 µL of normal mice blood, resulting in an initial parasite density of 445,200 parasites /µL. A total of 14 dilution groups were prepared, with the lowest parasite density reaching 0.00037 parasites /µL. DNA was extracted from each diluted blood sample. The established fluorescent RPA detection method for B. microti was applied to detect the samples, using 2 µL of template DNA from each of the 14 diluted blood groups. Normal mice blood DNA served as negative controls. To evaluate the performance of the fluorescent RPA method in detecting B. microti DNA in blood, nested PCR was implemented as a parallel control. The minimum detection limit of nested PCR for B. microti DNA in the 14 blood groups was determined by observing agarose gel electrophoresis results. This limit was then compared with that of the fluorescent RPA method. Detection of B. microti in an infected mouse model Mice were infected with B. microti using an inoculum than a lower at the minimum detection limit of nested PCR to create a low-infection-rate animal model. Blood was collected from the tail tip of the mice on days 3, 6, 9, 12, 15, 18, and 21 post-infection. Thin blood smears were prepared, and staining the samples with Giemsa staining, 1000 red blood cells were selected per slide, from which the number of infected red blood cells was counted. The infection rate was then calculated using the same method according to scribed protocols [ 19 ]. Three slides were observed for each group. DNA was extracted for subsequent testing. Nested PCR and fluorescence RPA detection were performed until all mice tested positive. Detection rates were determined by recording the time at which positive results were first obtained through nested PCR, fluorescence RPA, and microscopy. The number of positive mice identified by each method was recorded at each time point. Detecting of B. microti in Clinical Patients Using Fluorescent RPA Method To assess the diagnostic accuracy of the established fluorescent RPA method for confirmed B. microti infections, blood samples from two microscopy-positive patients in Zhejiang Province were analyzed. Molecular detection was initially performed using touchdown PCR with the genus-specific primers BJ1 (5'-GTCTTGTAATTGGAATGATGG-3') and BN2 (5'-TAGTTTATGGTTAGGACTACG-3'). The 50 µL reaction mixture comprised 25 µL of PCR mix, 22 µL of deionized water, 1 µL each of forward and reverse primers (10 µmol/µL), and 1 µL of DNA template. Thermal cycling conditions included an initial denaturation at 96°C for 6 minutes, followed by 8 cycles of 95°C for 30 s, 58°C for 45 s, and 70°C for 1 min (with annealing temperature decreasing by 1°C per cycle), then 27 cycles of 95°C for 30 s, 50°C for 45 s, and 70°C for 1 min, and a final extension at 70°C for 8 minutes. Samples positive for Babesia genus amplification were sequenced and validated via BLAST analysis. Subsequent nested PCR and the fluorescent RPA method were applied to detect B. microti . Controls included B.microti genomic DNA (positive control), healthy human blood (negative control), and deionized water (blank control) to ensure assay specificity and reliability. Field application of fluorescence RPA Based on cases reported in 2012 in Xinyang, Henan Province, there were instances of patients presenting with fever and thrombocytopenia who were co-infected with Babesia parasites [ 20 ], This study employed the fluorescence RPA method to test blood samples from 119 patients with fever and thrombocytopenia collected by the Henan Provincial Center for Disease Control and Prevention in 2015, Controls included B.microti genomic DNA (positive control), healthy human blood (negative control), detection threshold concentration (1 fg/µL)in order to evaluate its effectiveness for field use. Data Analysis Data analysis was conducted using SAS 9.4. Detection rates and Kappa values of fluorescence RPA and nested PCR were compared, and the McNemar test was used to determine significant differences between the two methods. To enhance detection sensitivity, a combined testing approach was employed to determine B. microti infection in samples. A sample was classified as B. microti -positive if either method yielded a positive result. This outcome was then cross-referenced with the previously investigated Bunyavirus infection status of the samples to assess co-infection patterns between the two pathogens. Results Establishment of the fluorescence RPA Method Screening of the RPA primers In this study, target sequences were screened from 18S rRNA of B. microti . BLAST analysis identified 7 sequence groups with high interspecies specificity. PCR primers were constructed for fragment screening. As shown in Supplementary Figs. 1A, all but the fifth primer group targeting 18S rRNA produced a single, distinct band. RPA amplification primers were designed for six primer groups-1st, 2nd, 3rd, 4th, 6th, 7th-which produced favorable PCR results. The amplified products were electrophoresed on agarose gel, as shown in Supplementary Figs. 1B. The 2nd, 7th, primer groups yielded clear, distinct bands. Optimization of RPA fluorescence primers and probes Based on RPA primer design principles, two pairs of primers were created for each of the positively amplified fragments (2, 7) from basic RPA screening. Primer optimization tests conducted for each fragment group. Fluorescence RPA results (Supplementary Fig. 2) showed that none of the primers for fragment 2 produced effective fluorescence curves. Among the three sets of primers for fragment 7, the first pair (7-1-F/7-1-R) generated the highest fluorescence intensity and an earlier peak time, making it the best choice for this fragment. Fluorescence RPA temperature optimization To optimize the reaction temperature, B. microti genomic DNA was amplified at six different temperatures using group sequences 7: 37°C, 38°C, 39°C, 40°C, 41°C, and 42°C. The results (Supplementary Fig. 3) indicated that 39°C was the optimal temperature for the 7thgroup sequences, as this temperature produced the highest fluorescence intensity. Thus, 39°C was chosen as the ideal reaction temperature for subsequent experiments. Fluorescence RPA time optimization and sensitivity experiment To determine the minimal detection limit of fluorescence RPA for B. microti , reactions were performed with B. microti genomic DNA diluted in deionized water. The results (Fig. 1 A and 1 B) showed that the primers and probes targeting the 18S rRNA sequence of B. microti (7th group) could detect genomic DNA at a concentration as low as 1fg/µL. A sensitivity test was conducted using eight concentrations of B. microti genomic DNA (1 ng/µL to 0.1 fg/µL) with a 20-minute reaction time. The results (Fig. 1 C) indicated that the fluorescence intensity remained high across all concentrations, with a minimum detection limit of 1 fg/µL, consistent with the 40-minute test. The 1 fg/µL group showed sufficient fluorescence to identify the lowest concentration of B. microti genomic DNA at 20 minutes. Nested PCR was performed in parallel, with the lowest detectable concentration at 10 fg/µL (Fig. 1 D), but no bands were observed at lower concentrations. Evaluation of fluorescence RPA detection method for B. microti Specificity of fluorescence RPA Samples from 8 P. falciparum and 8 P. ovale patients showed no peaks, with fluorescence intensities far below the threshold set for B.microti genomic DNA concentrations of 1fg/µl (Fig. 2 ). Determination of the Parasite Density Minimum Detection Limit for Fluorescent RPA Fluorescence RPA detection was simultaneously performed on 14 sets of Balb/c mouse blood samples with varying parasite densities (Supplementary table 3). The results (Fig. 3 A) showed that this method could detect a minimum parasite load of 0.046 B. microti per microliter (µl) of blood. Blood samples from the three groups with even lower parasite densities showed no amplification curve (similar fluorescence intensity to the negative control). Among the positively detected groups, samples with higher parasite densities exhibited higher fluorescence intensities. Nested PCR detection results (Fig. 3 B) revealed clear bands in samples with B. microti loads of 445,200, 89,040, 17,808, and 3,561.6 per µl of mouse blood. Samples with loads of 712.32, 142.46, and 28.49 showed faint bands, while no bands were visible in the remaining groups. Therefore, the nested PCR method was able to effectively detect a minimum B. microti load of 28.49 parasites per µl of blood. Evaluation of different methods for detecting B. microti in infected mouse models Starting on 3 dpi, 10 mice were tested every 3 days using thin blood film smears and microscopic examination. B. microti was not observed in blood smears from any of the 10 mice on 3 dpi, 6 dpi, 9 dpi, or 12 dpi. On 15 dpi, B. microti was observed in 2 blood smears, and by 18 dpi, 8 samples were positive. By 21 dpi, all samples were positive (Table 2 ). Nested PCR was performed concurrently, with no bands observed on 3 dpi and 6 dpi. On 9 dpi, a band was detected in one blood sample, and by 12 dpi, 7 samples tested positive. By 15 dpi, B. microti was detectable in all 10 mice (Supplementary Fig. 4). No upward fluorescence curve was observed in the blood samples of mice on 3 dpi and 6 dpi after fluorescent RPA amplification, with their fluorescence intensity being close to that of the negative control (Fig. 4 A). By 9 dpi, four positive samples were detected (Fig. 4 B). On 12 dpi, all blood samples from the 10 mice exhibited fluorescence intensity exceeding 200 RFU after isothermal amplification (Fig. 4 C). It is suggested that effective detection of B. microti infection at low density can be achieved in all mice by fluorescent RPA method on 12 dpi. Table 2 Infection status of the mice inoculated with B. microti . Dpi (Days of post infection) Microscopy (No. positive / No. tested) nested PCR (No. positive / No. tested) RPA (No. positive / No. tested) 3 - - - 6 - - - 9 - +(1/10) +(4/10) 12 - +(7/10) +(10/10) 15 +(2/10) +(10/10) +(10/10) 18 +(8/10) +(10/10) +(10/10) 21 +(10/10) +(10/10) +(10/10) Detecting of B. microti in Clinical Patients Using Fluorescent RPA Method The nested PCR detection was performed on two patient samples, and both samples tested positive (Fig. 5 A).The fluorescence RPA method established in this study was used to detect blood samples from two patients infected with B. microti . Positive controls were genomic DNA from B. microti , and negative controls were healthy human blood samples and the blank control was water. Both patient samples showed clear peaks with fluorescence intensities exceeding 1000 RFU (Fig. 5 B). Preliminary application of the fluorescence RPA method Babesia primers were used in nested PCR amplification of the 119 blood samples from patients with fever and thrombocytopenia According to the Henan Provincial Center for Disease Control and Prevention, 71 of the 119 patients tested positive for Bunya virus and 48 negatives. The products were analyzed using electrophoresis and automated gel imaging. The nested PCR method detected target bands in 20 of 119 blood samples, while the fluorescence RPA method identified B. microti in 21 samples(Figure 6 ). Thus, the positive rate for B. microti was 17.65% by fluorescence RPA and 16.81% by nested PCR. The Kappa value between the two methods was 97.05% (91.31%-100%), with no significant difference in results (S = 1, P > 0.1). In addition, according to the test results of the combined experiment of the above two methods (a positive test result of one method was considered as positive for B. microti ), 12 patients were infected with both pathogens (10.08%), 9 patients were infected with B. microti alone (7.56%), 59 patients were infected with Bunya virus alone (49.58%) and 39 patients were negative for both pathogens (32.77%). The infection status of the two pathogens is shown in Table 3 . Table 3 Pathogen infection in patients with fever with thrombocytopenia in Xinyang City, Henan Province, 2015 Pathogen B. microti positive B. microti negative total Bunyavirus positive 12 59 71 Bunyavirus negative 9 39 48 total 21 98 119 Discussion Babesiosis is a parasitic disease transmitted primarily through tick bites. Transfusion-transmitted babesiosis poses a significant threat to blood product safety, particularly in endemic regions. Asymptomatic B. microti infections in donors can evade conventional screening methods, leading to documented cases of transfusion-associated transmission with severe outcomes in immunocompromised recipients [ 12 , 21 ]. Current FDA recommendations emphasize enhanced screening in high-risk areas, yet limitations persist: serological assays exhibit delayed seroconversion during the window period (> 20% false negatives), while etiological testingremains time-consuming and facility-dependent [ 22 ]. These constraints underscore an urgent need for highly sensitive, rapid point-of-need diagnostics to ensure timely pathogen interception. Rapid detection of B. microti in blood is of great significance for patient treatment and the prevention of Babesia transmission through blood transfusions [ 23 ]. In this study, we successfully developed a fluorescent RPA assay for the detection of B. microti based on the 18s gene, the detection technology established for B. microti in this study offers greater convenience and efficiency compared to traditional microscopy, requiring less technical expertise. Furthermore, compared to nested PCR technology [ 24 , 25 ], a widely used molecular detection method, our method significantly shortens detection time while maintaining high sensitivity. The effective diagnostic sensitivity of this test is demonstrated at 1 fg/µL, , which surpasses the 10 fg/µL limit achieved by nested PCR. A study by Wu Fen [ 26 ] used LAMP to establish a detection technique for B. microti , with a slightly higher sensitivity (0.687 fg/µL) than our RPA method. However, LAMP requires an hour for detection, whereas our method reduces the detection time to just 20 minutes, offering a distinct advantage in terms of efficiency. Our method proved effective for detecting low parasite densities. For comparison, a study by Nie et al [ 27 ] developed a combined flow chromatography and recombinant enzyme RPA method. The results can be determined by observing whether the test strips produce bands. The minimum detection density of this method is 0.5 B. microti per microliter of blood [ 27 ], but our method demonstrated higher sensitivity. The insidious transmission of B. microti driven by subpatent parasitemia (often < 100 parasites/µL) poses a critical public health challenge. Asymptomatic carriers with persistent low-level infections—undetectable by conventional microscopy or serology—can unknowingly donate contaminated blood, leading to transfusion-transmitted babesiosis (TTB) with mortality rates exceeding 20% in splenectomized or immunocompromised recipients [ 21 ]. Surveillance data indicate that > 80% of TTB cases originate from donations by asymptomatic individuals with parasite densities below microscopic detection limits (≈ 500 parasites/µL), while standard PCR fails to reliably identify burdens < 10 parasites/µL [ 12 , 23 ]. This diagnostic void perpetuates silent transmission chains, particularly in endemic regions like the northeastern United States and China’s Henan Province, where co-circulation with other tick-borne pathogens (e.g., Bunyavirus ) may further mask early infection indicators. Our fluorescent RPA assay, capable of detecting 0.046 parasites/µL—200-fold lower than the current gold standard—directly addresses this vulnerability by intercepting subclinical reservoirs before they enter the blood supply, thereby mitigating a pervasive yet underrecognized threat to transfusion safety. Moreover, Malaria has similarities in clinical manifestations with babesiosis, and distinguishing between these two diseases based on clinical microscopic examination alone is challenging [ 28 , 29 ]. Our specificity evaluation confirmed that the fluorescence RPA method did not amplify samples from P. falciparum or P. ovale infections, demonstrating excellent specificity. This is critical for accurate diagnosis, especially in regions where multiple tick-borne or parasitic diseases coexist, as it reduces the risk of false positives and ensures that patients receive appropriate treatment. Addition, this ensures that the fluorescence RPA can accurately differentiate between malaria and babesiosis, preventing misdiagnoses and guiding appropriate treatment strategies for these two similar, yet distinct, diseases. We further used the established RPA method to detect B. microti of blood samples collected from 119 patients with fever and thrombocytopenia symptoms in Xinyang City, Henan Province, China [ 30 ]. Both Babesia and Bunyavirus are tick-borne pathogens, but this retrospective study did not collect information on patient tick-bite history. Future studies should gather this data.Seo et al was conducted to identify the distribution profile of ticks and tick-borne pathogens in Daejeon and the adjacent areas in South Korea, they found SFTSV (2 cases), Borrelia spp. (32 cases), and B. microti (7 cases), this indicates that co-infection with SFTSV and B. microti may become a global phenomenon. Laboratory diagnostics for patients with fever and thrombocytopenia should consider Babesia infection, particularly when other pathogens like Bunyavirus are not detected [ 31 , 32 ]. It is particularly important to note that in cases where the detection of pathogens such as Bunyavirus is negative, patients with such symptoms may consider Babesia infection. Additionally, co-infection with B. microti should be carefully evaluated during the diagnosis and treatment of Bunyavirus-positive patients to ensure comprehensive and targeted care. While recombinase polymerase amplification (RPA) offers rapid and sensitive detection of Babesia spp. , several limitations must be acknowledged. First, RPA is prone to false positives due to non-specific amplification in resource-limited settings where contamination risks are higher, as well as false negatives caused by inhibitors in untreated blood samples or extremely low parasitemia levels (< 0.01%) that fall below the assay’s detection threshold [ 19 , 33 ]. Second, environmental factors such as temperature fluctuations during field testing (optimal RPA requires 37–42°C) and suboptimal sample processing can compromise reproducibility [ 34 , 35 ]. Third, while RPA can be adapted for multiplex detection, its current capacity to identify co-infections remains limited. Cross-reactivity between primers/probes or dominance of one pathogen’s signal may obscure co-infections, particularly in regions like China where tick-borne pathogens often overlap [ 36 ]. Addressing these challenges requires optimized probe design, rigorous validation of field-deployable protocols, and integration with complementary methods for comprehensive pathogen screening. Conclusion This study established a novel method for detecting B. microti using fluorescent recombinase polymerase amplification (RPA) technology. This method demonstrates high sensitivity, strong specificity, and rapid response, completing DNA amplification and detection in just 20 minutes. Addition, a retrospective study was conducted to evaluate the application of fluorescence RPA technology for the molecular detection of typical symptoms of Babesiosis in the population of Xinyang City, Henan Province, China. Instances of co-infection with Bunyavirus were identified, highlighting the potential of RPA technology to enhance molecular diagnostics in endemic areas. In summary, the RPA method for detecting B. microti shows great promise for field investigations. Declarations Declaration of Competing Interest The authors declare that they have no conflict of interests. Publish declaration The authors declare that they all agree to publish this paper in this journal. Statement The authors confirmed the study was reported in accordance with ARRIVE guidelines. Acknowledgements We would like to thank the staff of the National Institute of Parasitic Diseases, the Chinese Center for Disease Control and Prevention (Chinese Center for Tropical Diseases Research); School of Life Sciences, Fudan University; Department of Biology, College of Life Sciences, Inner Mongolia University, who participated in this study. Funding Declaration This study was supported by Shanghai Municipal Science and Technology Commission Special Foundation（24DZ2203100）, Science and Technology Leading Talent Team in Inner Mongolia Autonomous Region (2022LJRC0009), the National Parasitic Resources Center, and the Ministry of Science and Technology fund (NPRC-2019-194-30), the National Key Research & Development Program of China (2018ZX10101002-003, 2018ZX10734404), the Three-Year Public Health Action Plan (2023-2025) of Shanghai (No. GWVI-11.2-XD33), Three-Year Initiative Plan for Strengthening Public Health System Construction in Shanghai (2023–2025) Key Discipline Project (No. GWVI-11.1-12). Data Availability declaration All authors agree that the data in this article is available. Authors’ contributions YCC, BX, and WH conceived and designed the experiments; YCC, BX, CHY, KQ and HYY performed the experiments; HYY, ZRM, and SNY analysed the data; YCC, BX, BZ, HYY and WH drafted the manuscript. All authors read and approved the submission of the final manuscript. Appendix A. Supplementary data Supplementary data 1 is available online. References Busch M, Bloch E, Kleinman S (2019) Prevention of transfusion-transmitted infections. Blood 133(17):1854-1864 Madison-Antenucci S, Kramer LD, Gebhardt LL, Kauffman E (2022) Emerging tick-borne diseases. Clin Microbiol Rev 33(2):e00083-18 Sang C, Yang M, Xu B, Liu G, Yang Y, Kairullayev K, Bauyrzhan O, Hazihan W, Hornok S, Wang Y (2021) Tick distribution and detection of Babesia and Theileria species in Eastern and Southern Kazakhstan. Ticks Tick-Borne Dis 12(6):101817 Waked R, Krause PJ (2022) Human Babesiosis. Infect Dis Clin North Am 36(3):655-670 Lobo CA, Rodriguez M, Cursino-Santos JR (2012) Babesia and red cell invasion. Curr Opin Hematol 19(3):170-175 Uilenberg G (2006) Babesia--a historical overview. Vet Parasitol 138(1-2):3-10 Wang F, Jiang JF, Tian J, Du CH (2020) Clinical characteristics, diagnosis and treatment of human babesiosis: a review. Zhongguo Xue Xi Chong Bing Fang Zhi Za Zhi. 33(2):218-224 Chen M, Liu Q, Xue J, Chen S, Huang D, Yu Y (2020) Spreading of human babesiosis in China: current epidemiological status and future challenges. China CDC Weekly 634-637 Wang J, Zhang S, Yang J, Liu J, Zhang D, Li Y (2019) Babesia divergens in human in Gansu province, China. Emerg Microbes Infect 8(1):959-961 Tonnetti L, Proctor MC, Reddy HL, Goodrich RP, Leiby DA (2010) Evaluation of the Mirasol pathogen reduction technology system against Babesia microti in apheresis platelets and plasma. Transfusion 50(5):1019-1027 Swanson M, Pickrel A, Williamson J, Montgomery S (2023) Trends in Reported Babesiosis Cases-United States, 2011-2019. Morb Mortal Wkly Rep 72(11):273-277 Moritz ED, Winton CS, Tonnetti L, Townsend RL, Berardi VP, Hewins ME, Weeks KE, Dodd RY, Stramer SL (2016) Screening for Babesia microti in the U.S. Blood Supply. N Engl J Med 375(23):2236-2245 Tan M, Liao C, Liang L, Yi X, Zhou Z, Wei G (2022) Recent advances in recombinase polymerase amplification: Principle, advantages, disadvantages and applications. Front Cell Infect Microbiol 12:1019071 Ullah H, Qadeer A, Rashid M, Rashid MI, Cheng G (2020) Recent advances in nucleic acid-based methods for detection of helminth infections and the perspective of biosensors for future development. Parasitology 147(4):383-392 Mota DS, Guimarães JM, Gandarilla AMD, Filho JCBS, Brito WR, Mariúba LAM (2022) Recombinase polymerase amplification in the molecular diagnosis of microbiological targets and its applications. Can J Microbiol 68(6):383-402 Zheng WB, Wu Y, Ma JG, Zhu XQ, Zhou DH (2015) Recombinase Polymerase Amplification and its Applications in Parasite Detection. Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi 33(5):382-386 Cai Y, Wu F, Hu W, Chen J, Chen S, Xu B, Lu Y, Ai L, Yang C, Zhao S (2018) Molecular characterization of B. microti seroreactive antigen 5-1-1 and development of rapid detection methods for anti-B. microti antibodies in serum. Acta Trop 185:371-379 Welc-Faleciak R, Bajer A, Bednarska M, Paziewska A, Siński E (2007) Long term monitoring of B. microti infection in BALB/c mice using nested PCR. Ann Agric Environ Med 14:287-290 Cai Y, Xu B, Liu X, Yang W, Mo Z, Zheng B, Chen J, Hu W (2024) Transmission risk evaluation of transfusion blood containing low-density B. microti. Front Cell Infect Microbiol 14:1334426 Li T, Wang J, Zhang N, Li W, Yan H, Li L, Jia W, Fu B (2019) Rapid and visual detection of Trichinella spp. using a lateral flow strip-based recombinase polymerase amplification (LF-RPA) assay. Front Cell Infect Microbiol 9:1 Leiby DA (2011) Transfusion-associated babesiosis: shouldn’t we be ticked off? Ann Intern Med 155(8):556-557 Prince HE, Lapé-Nixon M, Patel H, Yeh C (2010) Comparison of the Babesia duncani (WA1) IgG detection rates among clinical sera submitted to a reference laboratory for WA1 IgG testing and blood donor specimens from diverse geographic areas of the United States. Clin Vaccine Immunol 17(11):1729-1733 Simon MS, Leff JA, Pandya A, Cushing M, Shaz BH, Calfee DP, Schackman BR, Mushlin AI (2014) Cost-effectiveness of blood donor screening for B. microti in endemic regions of the United States. Transfusion 54:889-899 Naderi A, Nayebzadeh H, Gholami S (2017) Detection of Babesia infection among humans, goats, and sheep using microscopic and molecular methods in the city of Kuhdasht in Lorestan Province, West of Iran. J Parasit Dis 41(3):837-842 O'Connor KE, Kjemtrup AM, Conrad PA, Swei A (2018) An improved PCR protocol for detection of Babesia duncani in wildlife and vector samples. J Parasitol 104(4):429-432 Wu F, Cai Y, Qin Z, Ai L, Lu Y, Chen S, Wu XP, Chen J (2016) Development of loop-mediated isothermal amplification (LAMP) assay combined with FTA card for detecting B. microti . Chin J Zoonoses 32(5):435-441 Nie Z, Zhao Y, Shu X, Li D, Ao Y, Li M, Wang S, Cui J, An X, Zhan X, He L, Liu Q, Zhao J (2021) Recombinase polymerase amplification with lateral flow strip for detecting Babesia microti infections. Parasitol Int 83:102351 Carter W, Yan Z, Cassai N, Sidhu G (2003) Detection of extracellular forms of Babesia in the blood by electron microscopy: a diagnostic method for differentiation from Plasmodium falciparum . Ultrastruct Pathol 27(4):211-216 Mazigo E, Jun H, Oh J, Malik W, Louis JM, Kim TS, Lee SJ, Na S, Chun W, Park WS, Park YK, Han ET, Kim MJ, Han JH (2022) Ring stage classification of Babesia microti and Plasmodium falciparum using optical diffraction 3D tomographic technique. Parasites Vectors 15(1):434 Saito-Ito A, Takada N, Ishiguro F, Fujita H, Yano Y, Ma XH, Chen ER (2008) Detection of Kobe-type B. microti associated with Japanese human babesiosis in field rodents in central Taiwan and southeastern mainland China. Parasitology 135(6):691-699 Shi Q, Song FL, Yang Y, Gao YF, Ci Y, Cheng XL, Nie C, Liu LJ, Zhang XL, Wang J (2023) Epidemiological and molecular study on tick-borne pathogens in Argun Port area near the Chinese-Russian border. Vector-Borne Zoonotic Dis 23(9):447-457 Zhuang L, Du J, Cui XM, Li H, Tang F, Zhang PH, Hu JG, Tong YG, Feng ZC, Liu W (2018) Identification of tick-borne pathogen diversity by metagenomic analysis in Haemaphysalis longicornis from Xinyang, China. Infect Dis Poverty 7(1):45 Mei X, Su C, Zhang S, Jia L, Yang Z, Tian X, Zhang Z, Wang S (2023) Development and application of recombinase polymerase amplification assay for rapid detection of Blastocystis sp. Parasitology 150(13):1221-1225 Castellanos-Gonzalez A, White AC Jr, Melby P, Travi B (2018) Molecular diagnosis of protozoan parasites by Recombinase Polymerase Amplification. Acta Trop 182:4-11 Onchan W, Ritbamrung O, Changtor P, RPAdit W, Chomdej S, Nganvongpanit K, Siengdee P, Suyasunanont U, Buddhachat K (2022) Sensitive and rapid detection of Babesia species in dogs by recombinase polymerase amplification with lateral flow dipstick (RPA-LFD). Sci Rep 12(1):20560 Jiang L, Ching P, Chao CC, Dumler JS, Ching WM (2020) Development of a Sensitive and Rapid Recombinase Polymerase Amplification Assay for Detection of Anaplasma phagocytophilum . J Clin Microbiol 58(5):e01777-19 Additional Declarations No competing interests reported. Supplementary Files supplementarydata20250914.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 17 Dec, 2025 Reviews received at journal 15 Dec, 2025 Reviews received at journal 11 Dec, 2025 Reviewers agreed at journal 07 Dec, 2025 Reviewers agreed at journal 05 Dec, 2025 Reviewers invited by journal 30 Nov, 2025 Editor assigned by journal 30 Nov, 2025 Editor invited by journal 27 Nov, 2025 Submission checks completed at journal 23 Nov, 2025 First submitted to journal 23 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7755464","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":553469645,"identity":"7784e2a5-c2fc-41b4-ae09-9766a380c49e","order_by":0,"name":"Yuchun Cai","email":"","orcid":"","institution":"National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention (Chinese Center for Tropical Diseases Research)","correspondingAuthor":false,"prefix":"","firstName":"Yuchun","middleName":"","lastName":"Cai","suffix":""},{"id":553469647,"identity":"3008cb31-3cba-4d8e-ac88-872ec26ec737","order_by":1,"name":"Han Yin Yang","email":"","orcid":"","institution":"National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention (Chinese Center for Tropical Diseases Research)","correspondingAuthor":false,"prefix":"","firstName":"Han","middleName":"Yin","lastName":"Yang","suffix":""},{"id":553469649,"identity":"9e845a90-df69-48b4-8669-160068660e08","order_by":2,"name":"Kun Qiang","email":"","orcid":"","institution":"National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention (Chinese Center for Tropical Diseases Research)","correspondingAuthor":false,"prefix":"","firstName":"Kun","middleName":"","lastName":"Qiang","suffix":""},{"id":553469650,"identity":"227016a0-d818-4fb9-87d0-fa5f6618a2b6","order_by":3,"name":"Chenghang Yu","email":"","orcid":"","institution":"National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention (Chinese Center for Tropical Diseases Research)","correspondingAuthor":false,"prefix":"","firstName":"Chenghang","middleName":"","lastName":"Yu","suffix":""},{"id":553469654,"identity":"d09d8e8d-d494-469d-bf94-d91eb7df843e","order_by":4,"name":"Shuning Yan","email":"","orcid":"","institution":"National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention (Chinese Center for Tropical Diseases Research)","correspondingAuthor":false,"prefix":"","firstName":"Shuning","middleName":"","lastName":"Yan","suffix":""},{"id":553469655,"identity":"db471662-d07f-41a8-9030-73557b2b1f52","order_by":5,"name":"Ziran Mo","email":"","orcid":"","institution":"Inner Mongolia University","correspondingAuthor":false,"prefix":"","firstName":"Ziran","middleName":"","lastName":"Mo","suffix":""},{"id":553469656,"identity":"0350e2e3-99ae-4bca-82f7-b587c10cc44f","order_by":6,"name":"Bin Zheng","email":"","orcid":"","institution":"National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention (Chinese Center for Tropical Diseases Research)","correspondingAuthor":false,"prefix":"","firstName":"Bin","middleName":"","lastName":"Zheng","suffix":""},{"id":553469657,"identity":"0ea40663-56ad-4a13-8039-e6f56b0b29a1","order_by":7,"name":"Bin Xu","email":"","orcid":"","institution":"National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention (Chinese Center for Tropical Diseases Research)","correspondingAuthor":false,"prefix":"","firstName":"Bin","middleName":"","lastName":"Xu","suffix":""},{"id":553469658,"identity":"72a2c3ac-4b94-4b56-8584-6d20b98436d4","order_by":8,"name":"Wei Hu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAs0lEQVRIiWNgGAWjYBACAwYGxgcVDMxgjgSxWpgNzpCqhU2CNC3mEjlmFQfbrOXNGZgP3uZhsMsjqMVyRo7ZjYNt6YY7G9iSrXkYkosJO+xG7rbbH9sOM244wGMmzcNwILGBGC0FB9sO2284wP+NeC0MQC2JQFvYiNRy5v1niQPn0pM3HGYztpxjkEyEluNpiR8OlFnbbjje/PDGmwo7wloQABw1BsSrHwWjYBSMglGABwAAbLM+aecvjrwAAAAASUVORK5CYII=","orcid":"","institution":"Inner Mongolia University","correspondingAuthor":true,"prefix":"","firstName":"Wei","middleName":"","lastName":"Hu","suffix":""}],"badges":[],"createdAt":"2025-10-01 01:08:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7755464/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7755464/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":97299469,"identity":"2e18cb7f-38ea-4e95-be6a-aebff006bd19","added_by":"auto","created_at":"2025-12-03 00:50:48","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":763628,"visible":true,"origin":"","legend":"","description":"","filename":"articleRPA20251124clear.docx","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/01eb0c9029def0bdf45314d0.docx"},{"id":97368614,"identity":"99389561-7eef-4951-8cfe-389706abf49d","added_by":"auto","created_at":"2025-12-03 16:22:33","extension":"json","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9035,"visible":true,"origin":"","legend":"","description":"","filename":"e8c03a59b26448d0b64085b469053a69.json","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/b6600bca6b5e0945e23abf92.json"},{"id":97369016,"identity":"d72fcd1a-8c27-48d6-ae98-057a8bc01c3c","added_by":"auto","created_at":"2025-12-03 16:23:29","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":483714,"visible":true,"origin":"","legend":"","description":"","filename":"supplementarydata20250914.docx","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/f6b4afbfbfb241d736d59e39.docx"},{"id":97368942,"identity":"030d0cfc-5c8e-4ef3-9dd5-fb69c67215db","added_by":"auto","created_at":"2025-12-03 16:23:15","extension":"xml","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":115846,"visible":true,"origin":"","legend":"","description":"","filename":"e8c03a59b26448d0b64085b469053a691enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/aa54958854bdd59b06232d38.xml"},{"id":97368644,"identity":"64aee639-22b7-46b3-a954-fc2cf579112a","added_by":"auto","created_at":"2025-12-03 16:22:40","extension":"zip","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2941049,"visible":true,"origin":"","legend":"","description":"","filename":"figuresofmanuscript.zip","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/276745a66e5650fc221a3e23.zip"},{"id":97299476,"identity":"8f452f22-ac91-489d-8fd7-520537546f2b","added_by":"auto","created_at":"2025-12-03 00:50:48","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":85444,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/50cf41ac2c4f7593994ebb77.jpeg"},{"id":97369044,"identity":"d908c3e9-b54a-420d-9f1b-eb0998387f3c","added_by":"auto","created_at":"2025-12-03 16:23:33","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":125551,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/49d5acc33298c92e653b65e1.jpeg"},{"id":97299486,"identity":"e83f163b-626e-4610-8814-aa1643a4de2a","added_by":"auto","created_at":"2025-12-03 00:50:48","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":222097,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/55a5a3da22e1f6f849d34683.jpeg"},{"id":97299474,"identity":"a02a6add-5840-4ed5-ac5c-5e0c1474c75b","added_by":"auto","created_at":"2025-12-03 00:50:48","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":53795,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/4cab70a59fec759bbff1450f.jpeg"},{"id":97299487,"identity":"751488cb-45e6-4bea-8088-f248798499fd","added_by":"auto","created_at":"2025-12-03 00:50:48","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":49523,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/a5153ff6fd714f30c99038e9.jpeg"},{"id":97368881,"identity":"a3c1ce0c-d85e-4818-b696-36c27cd76ad8","added_by":"auto","created_at":"2025-12-03 16:23:08","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":224894,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/ecbdb40e9ac130bc00c42db6.jpeg"},{"id":97299490,"identity":"0fe26c87-8cc7-465d-9ec3-ca4b40a9f03f","added_by":"auto","created_at":"2025-12-03 00:50:48","extension":"zip","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1548949,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfigures.zip","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/f26d9fe94e67488b39e3e6be.zip"},{"id":97299489,"identity":"aea86aaf-c1ef-4dc1-adcb-d0e4d6bef061","added_by":"auto","created_at":"2025-12-03 00:50:48","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":51828,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/eb441a16d94d4b22a91a2e5d.png"},{"id":97299477,"identity":"454791aa-157b-4733-9062-2aa3fe775d20","added_by":"auto","created_at":"2025-12-03 00:50:48","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16989,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/cb5eadddd3781304c27bb37f.png"},{"id":97299478,"identity":"7e10bfeb-f3cb-4275-85e1-ed611494159a","added_by":"auto","created_at":"2025-12-03 00:50:48","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":64228,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/8cdfe049ed9626a32df21ab0.png"},{"id":97368846,"identity":"ed021d44-3da7-4f0a-a393-9f10d02ab8c1","added_by":"auto","created_at":"2025-12-03 16:23:03","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":29049,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/4e21cda7360b382a122fa049.png"},{"id":97369342,"identity":"4368111e-100d-4229-bb7b-247b5bc17747","added_by":"auto","created_at":"2025-12-03 16:24:26","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":26759,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/697727e14115d6928e5f5d7e.png"},{"id":97299481,"identity":"74eec67a-4acd-4f51-9dee-b1d2cd8f4df7","added_by":"auto","created_at":"2025-12-03 00:50:48","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":76442,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/982a8a1671939728ba6bca29.png"},{"id":97369138,"identity":"6411530d-577e-4a7b-9948-4394201a9775","added_by":"auto","created_at":"2025-12-03 16:23:45","extension":"xml","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":112440,"visible":true,"origin":"","legend":"","description":"","filename":"e8c03a59b26448d0b64085b469053a691structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/4b2f81118198835de91e16ee.xml"},{"id":97299488,"identity":"aa289e3f-901b-4aa7-9007-d1c2059e1a95","added_by":"auto","created_at":"2025-12-03 00:50:48","extension":"html","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":127524,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/73c3a5634c35a55c9bb76dba.html"},{"id":97299464,"identity":"7b095e6f-d5c8-4c7f-b78b-4f272d1c9002","added_by":"auto","created_at":"2025-12-03 00:50:47","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":200511,"visible":true,"origin":"","legend":"\u003cp\u003eSensitivity detection of the fluorescence RPA and nested PCR methods. (A) Curves 1-8 represent the amplification profile of \u003cem\u003e\u0026nbsp;B. microti\u003c/em\u003e genomic DNA diluted in deionized water at a concentration of 1 ng/μL, 100 pg/μL, 10 pg/μL, 1 pg/μL, 100 fg/μL, 10 fg/μL, 1fg/μL and 0.1fg/μL, respectively, primers and fluorescent probes designed based on the 18S rRNA sequences of Group 7. Curve 9 represents the amplification profile of the negative sample. (B) Curves 1-7 represent the amplification profile of \u003cem\u003e\u0026nbsp;B. microti\u003c/em\u003egenomic DNA diluted in deionized water at a concentration of 1 ng/μL, 100 pg/μL, 10 pg/μL, 1 pg/μL, 100 fg/μL, 10 fg/μL, 1fg/μL and 0.1fg/μL, respectively, primers and fluorescent probes designed based on the 18S rRNA sequences of Group 8, curve 8 represents the amplification profile of the negative sample. (C) Curves 1-8 represent the amplification profile of \u003cem\u003e\u0026nbsp;B. microti\u003c/em\u003e genomic DNA diluted in deionized water at a concentration of 1 ng/μL, 100 pg/μL, 10 pg/μL, 1 pg/μL, 100 fg/μL, 10 fg/μL, 1fg/μL and 0.1fg/μL, respectively, primers and fluorescent probes designed based on the 18S rRNA sequences of Group 7. Curve 9 represents the amplification profile of the negative sample. (D) 1-8 represent the nested PCR results of \u003cem\u003e\u0026nbsp;B. microti\u003c/em\u003e genomic DNA diluted in deionized water at a concentration of 1 ng/μL, 100 pg/μL, 10 pg/μL, 1 pg/μL, 100 fg/μL, 10 fg/μL, 1fg/μL and 0.1fg/μL, respectively. H represents the negativesample . M represents the DNA marker. Full-length gel of part D was included in a Supplementary Information file.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/d8f4f70f238b50280447af2a.png"},{"id":97299463,"identity":"d69306f3-5ca6-404f-a9fd-f5463be71481","added_by":"auto","created_at":"2025-12-03 00:50:47","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":69816,"visible":true,"origin":"","legend":"\u003cp\u003eSpecificity detection of the fluorescence RPA method. Curves 1-8 represent the amplification profile of \u003cem\u003eB. microti\u003c/em\u003e genomic DNA from the blood samples of patients infected with \u003cem\u003eP. falciparum\u003c/em\u003e. Curves 9-16 represent \u003cem\u003eP. ovale \u003c/em\u003eand the controls.\u003cem\u003e \u003c/em\u003e++ represents the positive control, + represents the fluorescence threshold, - represents the negative control. The primers and fluorescent probes both designed based on the 18S rRNA sequences of Group 7.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/6f6d9e1bed0f38ee739346f0.png"},{"id":97299466,"identity":"9ea07b3e-3cf9-4df4-8bd7-6b1bdaa50ad7","added_by":"auto","created_at":"2025-12-03 00:50:47","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":247852,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eB. microti\u003c/em\u003e density test of fluorescence RPA and nested PCR\u003c/p\u003e\n\u003cp\u003e(A) Curves 1-14 represent the amplification profile of \u003cem\u003eB. microti\u003c/em\u003egenomic DNA from the blood samples from different\u003cem\u003e B.\u003c/em\u003e \u003cem\u003emicroti\u003c/em\u003e densities，- represent the negative reference. (B) Curves 1-8 represent the nested PCR results of \u003cem\u003eB. microti \u003c/em\u003egenomic DNA from the blood samples from different\u003cem\u003e B. microti\u003c/em\u003e densities，- represent the negative reference. Full-length gel of part B was included in a Supplementary Information file.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/8b1f1281289e9a8caa15cd03.png"},{"id":97299465,"identity":"74a2ffaa-be94-424c-a13d-4672b3d6f1ea","added_by":"auto","created_at":"2025-12-03 00:50:47","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":111046,"visible":true,"origin":"","legend":"\u003cp\u003eFluorescence RPA Results of \u003cem\u003eB. microti\u003c/em\u003e infected in mouse models of post infection days\u003c/p\u003e\n\u003cp\u003e(A) Curves 1-10 represent fluorescence RPA Results of 6 dpi. All samples were negative. + representsthe fluorescence threshold. - represents the negative control. (B) Curves 1-10 represent fluorescence RPA results of 9 dpi, samples of No.2, No.5, No.7, No. 9 were positive, and the other ones were negative.+ represents the fluorescence threshold. – represents the negative control. (C) Curves 1-10 represent fluorescence RPA results of 12 dpi, all samples were positive. + represents the fluorescence threshold. – represents the negative control.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/a51ea88a2004a948f60a2cb2.png"},{"id":97299472,"identity":"75c8d2ba-eb4d-4e3b-b280-4a44b980cb71","added_by":"auto","created_at":"2025-12-03 00:50:48","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":118045,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eDetecting of B. microti in Clinical Patients Using Fluorescent RPA Method\u003c/em\u003e. (A) Results of patients with\u003cem\u003e B. microti\u003c/em\u003eby nest PCR.1-2 The patients with \u003cem\u003eB. microti\u003c/em\u003e，+ The positive control ，- The negative control，M DNA makers\u003c/p\u003e\n\u003cp\u003e(B) The amplification profile of \u003cem\u003eB. microti\u003c/em\u003e genomic DNA from the blood samples of patients infected and the controls. Curves 1 and 2 represent the patients with \u003cem\u003eB. microti\u003c/em\u003e in Zhejiang Province, + represents the positive control, - represents the negative control, H represents the blank control. Full-length gel of part A was included in a Supplementary Information file.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/39c153e00b6aee198584efca.png"},{"id":97369860,"identity":"8784ff33-616f-4cbf-b762-c7e34c050b7c","added_by":"auto","created_at":"2025-12-03 16:25:56","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":230670,"visible":true,"origin":"","legend":"\u003cp\u003eNested-PCR and Fluorescence RPA results in patients with fever and thrombocytopenia in Xinyang City Henan Province in 2015.\u003c/p\u003e\n\u003cp\u003eSamples of No. 6, No.9, No.16, No.27, No.33, No.36, No.40, No.55, No.56, No.58, No.59, No.63, No.64, No.69, No.79, No.80, No.85, No.103, No.116, No.119 represent nested-PCR positive results of samples from patients with fever and thrombocytopenia in Xinyang City Henan Province in 2015. + represents the fluorescence threshold. – represents the negative control. (B) Curves 1-119 represent samples from patients with fever and thrombocytopenia in Xinyang City Henan Province in 2015.Samples of No. 6, No.9, No.16, No.27, No. 33, No.36, No.40, No.55, No.56, No.58, No.59, No.63, No.69, No.79, No.80, No.85, No.93, No.103, No.116, and No.119 were tested positive. The fluorescence intensity of sample No.64 is close to the fluorescence threshold, indicating a weak positive sample. The fluorescence intensity of other samples is much lower than the threshold, indicating a negative result. ++ represents the positive control. + represents the fluorescence threshold. - represents the negative control. Full-length gel of part A was included in a Supplementary Information file.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/593371f8616b5413cbdad9ec.png"},{"id":97664661,"identity":"ab80fa07-c388-4e03-8dc7-da31298e0590","added_by":"auto","created_at":"2025-12-08 09:12:23","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2257542,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/fc45cb05-d73b-4439-9b49-f086da939f75.pdf"},{"id":97299467,"identity":"d394498a-4670-48f6-9981-7696480ed750","added_by":"auto","created_at":"2025-12-03 00:50:48","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":483714,"visible":true,"origin":"","legend":"","description":"","filename":"supplementarydata20250914.docx","url":"https://assets-eu.researchsquare.com/files/rs-7755464/v1/7c6bfedbf2127714d29e58b1.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Development and Field Evaluation of a Rapid Detection Method for Babesia microti using fluorescent recombinase polymerase amplification(RPA) technology","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBabesiosis is a parasitic zoonosis caused by infection with \u003cem\u003eBabesia\u003c/em\u003e (\u003cem\u003eBabesia spp.\u003c/em\u003e) species. The definitive hosts of \u003cem\u003eBabesia\u003c/em\u003e's are various species of ticks, while the intermediate hosts are primarily mammals, including cattle, dogs, and sheep. Humans can also serve as intermediate hosts [\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Within the intermediate host, \u003cem\u003eBabesia\u003c/em\u003e infects erythrocytes, where it exists as trophozoites and schizonts [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The incubation period following infection is generally prolonged, often lasting more than a week, with fever and anemia being the predominant symptoms [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. \u003cem\u003eB. microti\u003c/em\u003e and \u003cem\u003eBabesia venatorum\u003c/em\u003e are the most common species reported in China, with hundreds of confirmed cases [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Most \u003cem\u003eB. venatorum\u003c/em\u003e, cases have been found in Northeast China, while \u003cem\u003eB. microti\u003c/em\u003e infections have been reported in southern provinces, including Yunnan, Guangxi, and Fujian [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Molecular screening for \u003cem\u003eBabesia\u003c/em\u003e has revealed more than 100 positive cases in studies of patients with fever or tick bites [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Although only about 320 cases of \u003cem\u003eBabesia\u003c/em\u003e infections in China, prioritizing prevention, control, and rapid diagnosis is critical [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe early symptoms of \u003cem\u003eBabesia microti\u003c/em\u003e infection, such as fever and fatigue, are easily confused with malaria or other febrile illnesses. Highly sensitive diagnostic tests enable rapid confirmation during the low parasitemia stage, preventing treatment delays that may lead to severe complications (e.g., hemolytic anemia, organ failure) or even death [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. \u003cem\u003eB. microti\u003c/em\u003e is a zoonotic pathogen. Highly sensitive detection technologies (such as fluorescent recombinase polymerase amplification (RPA)) can accurately identify asymptomatic carriers and low-level infections in environmental or reservoir animal hosts, providing crucial data for epidemic early warning [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. High-sensitivity testing is vital for ensuring transfusion safety risks, as the blood of asymptomatic infected individuals can transmit babesiosis via transfusion. The US FDA mandates nucleic acid testing (NAT) for blood donor screening, requiring a sensitivity capable of detecting 1\u0026ndash;10 parasites/\u0026micro;L (\u0026asymp;\u0026thinsp;1 fg/\u0026micro;L DNA) to interrupt the transfusion transmission chain [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eMolecular detection methods fo\u003cem\u003er Babesia\u003c/em\u003e spp. include conventional PCR, real-time quantitative PCR (qPCR), loop-mediated isothermal amplification (LAMP), and recombinase polymerase amplification (RPA). These techniques amplify pathogen nucleic acids by targeting specific genes (e.g., 18S rRNA, mitochondrial genes, or heat shock protein genes), ensuring high sensitivity and specificity. Compared to conventional PCR, RPA amplifies nucleic in just 20 minutes without the need for a thermal cycler, making it highly suitable for field or clinic use. While both methods exhibit comparable sensitivity (detecting 1\u0026ndash;10 copies), RPA demonstrates superior stability in low-concentration samples. In contrast to LAMP, RPA offers distinct advantages: faster reaction times, simplified primer design, and lower temperature requirements (37\u0026ndash;42\u0026deg;C) [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], enhancing its applicability in resource-limited settings. Key benefits of RPA for \u003cem\u003eBabesia spp\u003c/em\u003e detection include its capacity to diagnose low-parasitemia infections [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], rapid diagnosis [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], field applicability through portable fluorescence detectors [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], and the ability to multiplex detect of species such as \u003cem\u003eB. microti\u003c/em\u003e and \u003cem\u003eB. venatorum\u003c/em\u003e using multicolor probe design.\u003c/p\u003e\u003cp\u003eThis study aim to establish a sensitive, specific, efficient, and rapid fluorescent recombinase polymerase amplification (RPA) assay for the detection of \u003cem\u003eB. microti\u003c/em\u003e and to evaluate its diagnostic value through laboratory assessment and field sample testing.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eSample collection\u003c/h2\u003e\u003cp\u003eThe standard \u003cem\u003eB. microti\u003c/em\u003e Peabodymjr strain (ATCC, RPA-99) was purchased from the American Type Culture Collection (Manassas, VA) and maintained in BALB/c mice via serial passages, following previously described methods [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. All animal experiments conducted in this study were approved by the Experimental Animal Welfare and Ethics Committee of the Animal Center of the Institute of Parasitic Disease Prevention and Control and the Chinese Center for Disease Control and Prevention (Chinese Center for Tropical Diseases Research) (Animal Ethics Approval No: IPD-2019-14). Blood samples from patients infected with \u003cem\u003eP. falciparum\u003c/em\u003e and \u003cem\u003eP. ovale\u003c/em\u003e were collected and preserved by the same institute. Blood samples from healthy donors were provided by the Health Examination Center of Shanghai, China. While samples from \u003cem\u003eB. microti\u003c/em\u003e infected patients were provided by the Zhejiang Provincial Center for Disease Control and Prevention. Samples from patients with fever and thrombocytopenia were collected and provided by the Henan Provincial Center for Disease Control and Prevention.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eEthics statement\u003c/h3\u003e\n\u003cp\u003eThe animal and human blood collection study was reviewed and approved by The Laboratory Animal Welfare \u0026amp; Ethics Committee (LAWEC) of the Chinese Centre for Tropical Diseases Research (permit Number: IPD-2019-14) and the Medical Ethics Committee of National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention (Chinese Center for Tropical Diseases Research) (Ethical approval number 2019004). All methods were carried out in accordance with relevant guidelines and regulations. The informed consent was obtained from all subjects and/or their legal guardian(s).\u003c/p\u003e\u003cp\u003e\u003cb\u003eEstablishment of the\u003c/b\u003e \u003cb\u003efluorescence\u003c/b\u003e \u003cb\u003eRPA Method\u003c/b\u003e\u003c/p\u003e\n\u003ch3\u003eDesign primers for RPA detection of B. microti\u003c/h3\u003e\n\u003cp\u003ePrimers were designed for the 18S rRNA, regions of \u003cem\u003eB. microti\u003c/em\u003e. According to RPA primer design principles, RPA method primers are typically longer than conventional PCR primers but are generally designed between 27\u0026ndash;35 bp to avoid dimer formation caused by excessive length. Additionally, the CG base content at both ends of the primer should be optimized, excessive clustering of G bases at the 5\u0026rsquo;-end should be avoided, while the CG ratio at the 3\u0026rsquo;-end should be increased to enhance amplification efficiency. Using Primer Premier 6.0 and DNAMAN, along with manual design, six sets of primers were generated (Supplementary Table\u0026nbsp;1).\u003c/p\u003e\n\u003ch3\u003eDesign primers and probes for fluorescence RPA detection of B. microti\u003c/h3\u003e\n\u003cp\u003eBased on the RPA amplification results, primers and probes for fluorescent RPA were designed for the fragments corresponding to the better-performing primer groups 2 and 7. To identify the optimal primers and probe for \u003cem\u003eB. microti\u003c/em\u003e fluorescent RPA, two pairs of primers (27\u0026ndash;35 bp in length) and a probe (modified with a tetrahydrofuran [THF] site and labeled with a FAM fluorophore at the 5\u0026prime;end) were designed for each of the two selected fragments (groups 2 and 7). Screening was conducted using \u003cem\u003eB. microti\u003c/em\u003e genomic DNA as the template under the following conditions: 39\u0026deg;C for 40 min. The optimal primers and probe were determined by comparing the fluorescence intensity curves generated during the reaction. The sequences of the selected primers and probes are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers and probes of fluorescent recombinase polymerase amplification (RPA) method.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAccession number\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003enumber\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePrimer and probe sequences(5'\u0026rarr;3')\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003ePrimer and probe names\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"13\" rowspan=\"14\"\u003e\u003cp\u003eMK609547.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"6\" rowspan=\"7\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCACAGGGAGGTAGTGACAAGAAATAACAAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003e2-1-F\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTATT GGAGCTGGAATTACCGCGGCTGCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003e2-1-R\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTTCCCAGAGTATCAATTGGAGGGCAAGTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003e2-2-F\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAAGGCAGAAATTCAACTACGAGCTTCTTAAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003e2-2-R\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAGGGCTTAAAGTCTTGTAATTGGAATGATG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003e2-3-F\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGACTTG CCCTCCAATTGATACTCTGGGAAGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003e2-3-R\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTTCTTAACTGCAACAACTTTAATATACGC/i6FAMdT//idSp//iBHQdT/TGGAGCTGGAATTAC-C3 Spacer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003e2-PROBE\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"6\" rowspan=\"7\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTCGATTCCGGAGAGGGAGCCTGAGAAACG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003e7-1-F\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGCAACAACTTTAATATACGCTATTGGAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003e7-1-R\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGAGAAACGGCTACCACATCTAAGGAAGGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003e7-2-F\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGCTGGCACCAGACTTGCCCTCCAATTGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003e7-2-R\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGGCTACCACATCTAAGGAAGGCAGCAGGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003e7-3-F\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCCCATCATTCCAATTACAAGACTTTAAGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003e7-3-R\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGCAAATTACCCAATCCTGACACAGGGAGG/i6FAMdT//idSp/G/iBHQdT/GACAAGAAATAAC-C3 Spacer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003e7-PROBE\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003eEstablishment of a Fluorescent RPA Reaction System\u003c/h3\u003e\n\u003cp\u003eThe fluorescent RPA reaction was prepared in a 50 \u0026micro;L system following the TwistAmp exo Kits protocol. The reaction mixture included 2.1 \u0026micro;L each of forward and reverse primers (10 \u0026micro;mol/\u0026micro;L), 0.6 \u0026micro;L fluorescent probe (10 \u0026micro;mol/\u0026micro;L), 25 \u0026micro;L buffer, and 15.2 \u0026micro;L deionized water. After gentle mixing and centrifugation, the solution was transferred to a lyophilized pellet tube, aliquoted into a BIO-RAD eight-tube strip (TLS0851), and briefly centrifuged to remove bubbles. Subsequently, 2 \u0026micro;L DNA template and 3 \u0026micro;L magnesium acetate (280 mmol/L) were added to the tube cap and centrifuged. The reaction was incubated at 39\u0026deg;C for 4 min in a metal bath, inverted repeatedly for homogenization, and briefly centrifuged. The reaction was performed utilizing a CFX96 fluorescence quantitative PCR instrument (Bio-Rad, USA) at 39\u0026deg;C for 40 cycles (60 seconds per cycle, total 40 minutes).\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eOptimization of Temperature and Time Parameters, and Sensitivity Evaluation for Fluorescent RPA\u003c/h2\u003e\u003cp\u003eTo optimize the temperature, nucleic acid amplification was performed at various temperatures (37℃, 38℃, 39℃, 40℃, 41℃, and 42℃) to determine the optimal conditions for the reaction using the genomic DNA of \u003cem\u003eB. microti\u003c/em\u003e as a template. Sensitivity was evaluated by diluting \u003cem\u003eB. microti\u003c/em\u003e genomic DNA into eight concentrations: 1 ng/\u0026micro;L, 100 pg/\u0026micro;L, 10 pg/\u0026micro;L, 1 pg/\u0026micro;L, 100 fg/\u0026micro;L, 10 fg/\u0026micro;L, 1 fg/\u0026micro;L, and 0.1 fg/\u0026micro;L, blank controls were double distilled water. Fluorescence RPA reactions were initially set for 40 minutes and monitored. At 20 minutes, clear amplification was observed for the 1 fg/\u0026micro;L group, allowing for the reduction of reaction time. Subsequent testing was conducted for 20 minutes to assess the method\u0026rsquo;s performance within this time frame. Parallel nested PCR was performed using the same samples. Nucleotide sequence of the 18S rRNA-specific fragment was amplified using the extracted DNA as the template, with primers listed in supplementary Table\u0026nbsp;2, according to the previously described protocols [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eLaboratory Evaluation of the Fluorescent RPA Method\u003c/h3\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003eSpecificity Evaluation of the Fluorescent RPA Method\u003c/h2\u003e\u003cp\u003eTo evaluate the specificity of the method, fluorescent RPA reactions were performed using blood samples from 8 patients infected with \u003cem\u003ePlasmodium falciparum\u003c/em\u003e and 8 patients infected with \u003cem\u003ePlasmodium ovale\u003c/em\u003e. Patient samples served as positive controls, \u003cem\u003eB.microti\u003c/em\u003e genomic DNA concentrations of 1fg/\u0026micro;Lwere used as the threshold reference, and samples from healthy individuals were included as negative controls. The specificity of the method was assessed by observing the fluorescence intensity of each reaction group.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eDetermination of the Parasite Density Minimum Detection Limit for Fluorescent RPA\u003c/h2\u003e\u003cp\u003eFemale Balb/c mice infected with the ATCC, RPA-99 strain of \u003cem\u003eB. microti\u003c/em\u003e were used. Blood was collected from the orbital sinus of infected Balb/c mice (with a microscopically confirmed parasite density of 4%) into EDTA anticoagulant tubes and thoroughly mixed. Blood from uninfected mice was collected and anticoagulated using the same method. A 20 \u0026micro;L aliquot of \u003cem\u003eB. microti\u003c/em\u003e-infected blood was diluted 5-fold with 80 \u0026micro;L of normal mice blood, resulting in an initial parasite density of 445,200 parasites /\u0026micro;L. A total of 14 dilution groups were prepared, with the lowest parasite density reaching 0.00037 parasites /\u0026micro;L. DNA was extracted from each diluted blood sample. The established fluorescent RPA detection method for \u003cem\u003eB. microti\u003c/em\u003e was applied to detect the samples, using 2 \u0026micro;L of template DNA from each of the 14 diluted blood groups. Normal mice blood DNA served as negative controls. To evaluate the performance of the fluorescent RPA method in detecting \u003cem\u003eB. microti\u003c/em\u003e DNA in blood, nested PCR was implemented as a parallel control. The minimum detection limit of nested PCR for \u003cem\u003eB. microti\u003c/em\u003e DNA in the 14 blood groups was determined by observing agarose gel electrophoresis results. This limit was then compared with that of the fluorescent RPA method.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eDetection of B. microti in an infected mouse model\u003c/h2\u003e\u003cp\u003eMice were infected with \u003cem\u003eB. microti\u003c/em\u003e using an inoculum than a lower at the minimum detection limit of nested PCR to create a low-infection-rate animal model. Blood was collected from the tail tip of the mice on days 3, 6, 9, 12, 15, 18, and 21 post-infection. Thin blood smears were prepared, and staining the samples with Giemsa staining, 1000 red blood cells were selected per slide, from which the number of infected red blood cells was counted. The infection rate was then calculated using the same method according to scribed protocols [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Three slides were observed for each group. DNA was extracted for subsequent testing. Nested PCR and fluorescence RPA detection were performed until all mice tested positive. Detection rates were determined by recording the time at which positive results were first obtained through nested PCR, fluorescence RPA, and microscopy. The number of positive mice identified by each method was recorded at each time point.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eDetecting of B. microti in Clinical Patients Using Fluorescent RPA Method\u003c/h2\u003e\u003cp\u003eTo assess the diagnostic accuracy of the established fluorescent RPA method for confirmed \u003cem\u003eB. microti\u003c/em\u003e infections, blood samples from two microscopy-positive patients in Zhejiang Province were analyzed. Molecular detection was initially performed using touchdown PCR with the genus-specific primers BJ1 (5'-GTCTTGTAATTGGAATGATGG-3') and BN2 (5'-TAGTTTATGGTTAGGACTACG-3'). The 50 \u0026micro;L reaction mixture comprised 25 \u0026micro;L of PCR mix, 22 \u0026micro;L of deionized water, 1 \u0026micro;L each of forward and reverse primers (10 \u0026micro;mol/\u0026micro;L), and 1 \u0026micro;L of DNA template. Thermal cycling conditions included an initial denaturation at 96\u0026deg;C for 6 minutes, followed by 8 cycles of 95\u0026deg;C for 30 s, 58\u0026deg;C for 45 s, and 70\u0026deg;C for 1 min (with annealing temperature decreasing by 1\u0026deg;C per cycle), then 27 cycles of 95\u0026deg;C for 30 s, 50\u0026deg;C for 45 s, and 70\u0026deg;C for 1 min, and a final extension at 70\u0026deg;C for 8 minutes. Samples positive for \u003cem\u003eBabesia\u003c/em\u003e genus amplification were sequenced and validated via BLAST analysis. Subsequent nested PCR and the fluorescent RPA method were applied to detect \u003cem\u003eB. microti\u003c/em\u003e. Controls included \u003cem\u003eB.microti\u003c/em\u003e genomic DNA (positive control), healthy human blood (negative control), and deionized water (blank control) to ensure assay specificity and reliability.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eField application of fluorescence RPA\u003c/h2\u003e\u003cp\u003eBased on cases reported in 2012 in Xinyang, Henan Province, there were instances of patients presenting with fever and thrombocytopenia who were co-infected with \u003cem\u003eBabesia\u003c/em\u003e parasites [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], This study employed the fluorescence RPA method to test blood samples from 119 patients with fever and thrombocytopenia collected by the Henan Provincial Center for Disease Control and Prevention in 2015, Controls included \u003cem\u003eB.microti\u003c/em\u003e genomic DNA (positive control), healthy human blood (negative control), detection threshold concentration (1 fg/\u0026micro;L)in order to evaluate its effectiveness for field use.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eData Analysis\u003c/h2\u003e\u003cp\u003eData analysis was conducted using SAS 9.4. Detection rates and Kappa values of fluorescence RPA and nested PCR were compared, and the McNemar test was used to determine significant differences between the two methods. To enhance detection sensitivity, a combined testing approach was employed to determine \u003cem\u003eB. microti\u003c/em\u003e infection in samples. A sample was classified as \u003cem\u003eB. microti\u003c/em\u003e-positive if either method yielded a positive result. This outcome was then cross-referenced with the previously investigated Bunyavirus infection status of the samples to assess co-infection patterns between the two pathogens.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eEstablishment of the\u003c/b\u003e \u003cb\u003efluorescence\u003c/b\u003e \u003cb\u003eRPA Method\u003c/b\u003e\u003c/p\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eScreening of the RPA primers\u003c/h2\u003e\u003cp\u003eIn this study, target sequences were screened from 18S rRNA of \u003cem\u003eB. microti\u003c/em\u003e. BLAST analysis identified 7 sequence groups with high interspecies specificity. PCR primers were constructed for fragment screening. As shown in Supplementary Figs.\u0026nbsp;1A, all but the fifth primer group targeting 18S rRNA produced a single, distinct band. RPA amplification primers were designed for six primer groups-1st, 2nd, 3rd, 4th, 6th, 7th-which produced favorable PCR results. The amplified products were electrophoresed on agarose gel, as shown in Supplementary Figs.\u0026nbsp;1B. The 2nd, 7th, primer groups yielded clear, distinct bands.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eOptimization of RPA fluorescence primers and probes\u003c/h2\u003e\u003cp\u003eBased on RPA primer design principles, two pairs of primers were created for each of the positively amplified fragments (2, 7) from basic RPA screening. Primer optimization tests conducted for each fragment group. Fluorescence RPA results (Supplementary Fig.\u0026nbsp;2) showed that none of the primers for fragment 2 produced effective fluorescence curves. Among the three sets of primers for fragment 7, the first pair (7-1-F/7-1-R) generated the highest fluorescence intensity and an earlier peak time, making it the best choice for this fragment.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eFluorescence RPA temperature optimization\u003c/h2\u003e\u003cp\u003eTo optimize the reaction temperature, \u003cem\u003eB. microti\u003c/em\u003e genomic DNA was amplified at six different temperatures using group sequences 7: 37\u0026deg;C, 38\u0026deg;C, 39\u0026deg;C, 40\u0026deg;C, 41\u0026deg;C, and 42\u0026deg;C. The results (Supplementary Fig.\u0026nbsp;3) indicated that 39\u0026deg;C was the optimal temperature for the 7thgroup sequences, as this temperature produced the highest fluorescence intensity. Thus, 39\u0026deg;C was chosen as the ideal reaction temperature for subsequent experiments.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eFluorescence RPA time optimization and sensitivity experiment\u003c/h2\u003e\u003cp\u003eTo determine the minimal detection limit of fluorescence RPA for \u003cem\u003eB. microti\u003c/em\u003e, reactions were performed with \u003cem\u003eB. microti\u003c/em\u003e genomic DNA diluted in deionized water. The results (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) showed that the primers and probes targeting the 18S rRNA sequence of \u003cem\u003eB. microti\u003c/em\u003e (7th group) could detect genomic DNA at a concentration as low as 1fg/\u0026micro;L. A sensitivity test was conducted using eight concentrations of \u003cem\u003eB. microti\u003c/em\u003e genomic DNA (1 ng/\u0026micro;L to 0.1 fg/\u0026micro;L) with a 20-minute reaction time. The results (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC) indicated that the fluorescence intensity remained high across all concentrations, with a minimum detection limit of 1 fg/\u0026micro;L, consistent with the 40-minute test. The 1 fg/\u0026micro;L group showed sufficient fluorescence to identify the lowest concentration of \u003cem\u003eB. microti\u003c/em\u003e genomic DNA at 20 minutes. Nested PCR was performed in parallel, with the lowest detectable concentration at 10 fg/\u0026micro;L (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD), but no bands were observed at lower concentrations.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEvaluation of fluorescence RPA detection method for\u003c/b\u003e \u003cb\u003eB. microti\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eSpecificity of fluorescence RPA\u003c/h2\u003e\u003cp\u003eSamples from 8 \u003cem\u003eP. falciparum\u003c/em\u003e and 8 \u003cem\u003eP. ovale\u003c/em\u003e patients showed no peaks, with fluorescence intensities far below the threshold set for \u003cem\u003eB.microti\u003c/em\u003e genomic DNA concentrations of 1fg/\u0026micro;l (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eDetermination of the Parasite Density Minimum Detection Limit for Fluorescent RPA\u003c/h2\u003e\u003cp\u003eFluorescence RPA detection was simultaneously performed on 14 sets of Balb/c mouse blood samples with varying parasite densities (Supplementary table 3). The results (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA) showed that this method could detect a minimum parasite load of 0.046 \u003cem\u003eB. microti\u003c/em\u003e per microliter (\u0026micro;l) of blood. Blood samples from the three groups with even lower parasite densities showed no amplification curve (similar fluorescence intensity to the negative control). Among the positively detected groups, samples with higher parasite densities exhibited higher fluorescence intensities. Nested PCR detection results (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB) revealed clear bands in samples with \u003cem\u003eB. microti\u003c/em\u003e loads of 445,200, 89,040, 17,808, and 3,561.6 per \u0026micro;l of mouse blood. Samples with loads of 712.32, 142.46, and 28.49 showed faint bands, while no bands were visible in the remaining groups. Therefore, the nested PCR method was able to effectively detect a minimum \u003cem\u003eB. microti\u003c/em\u003e load of 28.49 parasites per \u0026micro;l of blood.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003eEvaluation of different methods for detecting B. microti in infected mouse models\u003c/h2\u003e\u003cp\u003eStarting on 3 dpi, 10 mice were tested every 3 days using thin blood film smears and microscopic examination. \u003cem\u003eB. microti\u003c/em\u003e was not observed in blood smears from any of the 10 mice on 3 dpi, 6 dpi, 9 dpi, or 12 dpi. On 15 dpi, \u003cem\u003eB. microti\u003c/em\u003e was observed in 2 blood smears, and by 18 dpi, 8 samples were positive. By 21 dpi, all samples were positive (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Nested PCR was performed concurrently, with no bands observed on 3 dpi and 6 dpi. On 9 dpi, a band was detected in one blood sample, and by 12 dpi, 7 samples tested positive. By 15 dpi, \u003cem\u003eB. microti\u003c/em\u003e was detectable in all 10 mice (Supplementary Fig.\u0026nbsp;4). No upward fluorescence curve was observed in the blood samples of mice on 3 dpi and 6 dpi after fluorescent RPA amplification, with their fluorescence intensity being close to that of the negative control (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). By 9 dpi, four positive samples were detected (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). On 12 dpi, all blood samples from the 10 mice exhibited fluorescence intensity exceeding 200 RFU after isothermal amplification (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). It is suggested that effective detection of \u003cem\u003eB. microti\u003c/em\u003e infection at low density can be achieved in all mice by fluorescent RPA method on 12 dpi.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eInfection status of the mice inoculated with \u003cem\u003eB. microti\u003c/em\u003e.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDpi\u003c/p\u003e\u003cp\u003e(Days of post infection)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMicroscopy\u003c/p\u003e\u003cp\u003e(No. positive / No. tested)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003enested PCR\u003c/p\u003e\u003cp\u003e(No. positive / No. tested)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eRPA\u003c/p\u003e\u003cp\u003e(No. positive / No. tested)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+(1/10)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e+(4/10)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+(7/10)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e+(10/10)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e+(2/10)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+(10/10)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e+(10/10)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e18\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e+(8/10)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+(10/10)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e+(10/10)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e+(10/10)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+(10/10)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e+(10/10)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003eDetecting of B. microti in Clinical Patients Using Fluorescent RPA Method\u003c/h2\u003e\u003cp\u003eThe nested PCR detection was performed on two patient samples, and both samples tested positive (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA).The fluorescence RPA method established in this study was used to detect blood samples from two patients infected with \u003cem\u003eB. microti\u003c/em\u003e. Positive controls were genomic DNA from \u003cem\u003eB. microti\u003c/em\u003e, and negative controls were healthy human blood samples and the blank control was water. Both patient samples showed clear peaks with fluorescence intensities exceeding 1000 RFU (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec25\" class=\"Section3\"\u003e\u003ch2\u003ePreliminary application of the fluorescence RPA method\u003c/h2\u003e\u003cp\u003e\u003cem\u003eBabesia\u003c/em\u003e primers were used in nested PCR amplification of the 119 blood samples from patients with fever and thrombocytopenia According to the Henan Provincial Center for Disease Control and Prevention, 71 of the 119 patients tested positive for Bunya virus and 48 negatives. The products were analyzed using electrophoresis and automated gel imaging. The nested PCR method detected target bands in 20 of 119 blood samples, while the fluorescence RPA method identified \u003cem\u003eB. microti\u003c/em\u003e in 21 samples(Figure \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Thus, the positive rate for \u003cem\u003eB. microti\u003c/em\u003e was 17.65% by fluorescence RPA and 16.81% by nested PCR. The Kappa value between the two methods was 97.05% (91.31%-100%), with no significant difference in results (S\u0026thinsp;=\u0026thinsp;1, P\u0026thinsp;\u0026gt;\u0026thinsp;0.1).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIn addition, according to the test results of the combined experiment of the above two methods (a positive test result of one method was considered as positive for \u003cem\u003eB. microti\u003c/em\u003e), 12 patients were infected with both pathogens (10.08%), 9 patients were infected with \u003cem\u003eB. microti\u003c/em\u003e alone (7.56%), 59 patients were infected with Bunya virus alone (49.58%) and 39 patients were negative for both pathogens (32.77%). The infection status of the two pathogens is shown in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ctable id=\"Tab3\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePathogen infection in patients with fever with thrombocytopenia in Xinyang City, Henan Province, 2015\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePathogen\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eB. microti positive\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eB. microti\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003enegative\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003etotal\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eBunyavirus\u003c/em\u003e positive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e71\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eBunyavirus\u003c/em\u003e negative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003etotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e119\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n"},{"header":"Discussion","content":"\u003cp\u003eBabesiosis is a parasitic disease transmitted primarily through tick bites. Transfusion-transmitted babesiosis poses a significant threat to blood product safety, particularly in endemic regions. Asymptomatic \u003cem\u003eB. microti\u003c/em\u003e infections in donors can evade conventional screening methods, leading to documented cases of transfusion-associated transmission with severe outcomes in immunocompromised recipients [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Current FDA recommendations emphasize enhanced screening in high-risk areas, yet limitations persist: serological assays exhibit delayed seroconversion during the window period (\u0026gt;\u0026thinsp;20% false negatives), while etiological testingremains time-consuming and facility-dependent [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. These constraints underscore an urgent need for highly sensitive, rapid point-of-need diagnostics to ensure timely pathogen interception. Rapid detection of \u003cem\u003eB. microti\u003c/em\u003e in blood is of great significance for patient treatment and the prevention of \u003cem\u003eBabesia\u003c/em\u003e transmission through blood transfusions [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In this study, we successfully developed a fluorescent RPA assay for the detection of \u003cem\u003eB. microti\u003c/em\u003e based on the 18s gene, the detection technology established for \u003cem\u003eB. microti\u003c/em\u003e in this study offers greater convenience and efficiency compared to traditional microscopy, requiring less technical expertise. Furthermore, compared to nested PCR technology [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], a widely used molecular detection method, our method significantly shortens detection time while maintaining high sensitivity. The effective diagnostic sensitivity of this test is demonstrated at 1 fg/\u0026micro;L,\u003c/p\u003e\u003cp\u003e, which surpasses the 10 fg/\u0026micro;L limit achieved by nested PCR. A study by Wu Fen [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] used LAMP to establish a detection technique for \u003cem\u003eB. microti\u003c/em\u003e, with a slightly higher sensitivity (0.687 fg/\u0026micro;L) than our RPA method. However, LAMP requires an hour for detection, whereas our method reduces the detection time to just 20 minutes, offering a distinct advantage in terms of efficiency.\u003c/p\u003e\u003cp\u003eOur method proved effective for detecting low parasite densities. For comparison, a study by Nie et al [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] developed a combined flow chromatography and recombinant enzyme RPA method. The results can be determined by observing whether the test strips produce bands. The minimum detection density of this method is 0.5 \u003cem\u003eB. microti\u003c/em\u003e per microliter of blood [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], but our method demonstrated higher sensitivity. The insidious transmission of \u003cem\u003eB. microti\u003c/em\u003e driven by subpatent parasitemia (often\u0026thinsp;\u0026lt;\u0026thinsp;100 parasites/\u0026micro;L) poses a critical public health challenge. Asymptomatic carriers with persistent low-level infections\u0026mdash;undetectable by conventional microscopy or serology\u0026mdash;can unknowingly donate contaminated blood, leading to transfusion-transmitted babesiosis (TTB) with mortality rates exceeding 20% in splenectomized or immunocompromised recipients [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Surveillance data indicate that \u0026gt;\u0026thinsp;80% of TTB cases originate from donations by asymptomatic individuals with parasite densities below microscopic detection limits (\u0026asymp;\u0026thinsp;500 parasites/\u0026micro;L), while standard PCR fails to reliably identify burdens\u0026thinsp;\u0026lt;\u0026thinsp;10 parasites/\u0026micro;L [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. This diagnostic void perpetuates silent transmission chains, particularly in endemic regions like the northeastern United States and China\u0026rsquo;s Henan Province, where co-circulation with other tick-borne pathogens (e.g., \u003cem\u003eBunyavirus\u003c/em\u003e) may further mask early infection indicators. Our fluorescent RPA assay, capable of detecting 0.046 parasites/\u0026micro;L\u0026mdash;200-fold lower than the current gold standard\u0026mdash;directly addresses this vulnerability by intercepting subclinical reservoirs before they enter the blood supply, thereby mitigating a pervasive yet underrecognized threat to transfusion safety.\u003c/p\u003e\u003cp\u003eMoreover, Malaria has similarities in clinical manifestations with babesiosis, and distinguishing between these two diseases based on clinical microscopic examination alone is challenging [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Our specificity evaluation confirmed that the fluorescence RPA method did not amplify samples from \u003cem\u003eP. falciparum\u003c/em\u003e or \u003cem\u003eP. ovale\u003c/em\u003e infections, demonstrating excellent specificity. This is critical for accurate diagnosis, especially in regions where multiple tick-borne or parasitic diseases coexist, as it reduces the risk of false positives and ensures that patients receive appropriate treatment. Addition, this ensures that the fluorescence RPA can accurately differentiate between malaria and babesiosis, preventing misdiagnoses and guiding appropriate treatment strategies for these two similar, yet distinct, diseases.\u003c/p\u003e\u003cp\u003eWe further used the established RPA method to detect \u003cem\u003eB. microti\u003c/em\u003e of blood samples collected from 119 patients with fever and thrombocytopenia symptoms in Xinyang City, Henan Province, China [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Both \u003cem\u003eBabesia\u003c/em\u003e and \u003cem\u003eBunyavirus\u003c/em\u003e are tick-borne pathogens, but this retrospective study did not collect information on patient tick-bite history. Future studies should gather this data.Seo et al was conducted to identify the distribution profile of ticks and tick-borne pathogens in Daejeon and the adjacent areas in South Korea, they found SFTSV (2 cases), \u003cem\u003eBorrelia spp.\u003c/em\u003e (32 cases), and \u003cem\u003eB. microti\u003c/em\u003e (7 cases), this indicates that co-infection with SFTSV and \u003cem\u003eB. microti\u003c/em\u003e may become a global phenomenon. Laboratory diagnostics for patients with fever and thrombocytopenia should consider \u003cem\u003eBabesia\u003c/em\u003e infection, particularly when other pathogens like Bunyavirus are not detected [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. It is particularly important to note that in cases where the detection of pathogens such as Bunyavirus is negative, patients with such symptoms may consider \u003cem\u003eBabesia\u003c/em\u003e infection. Additionally, co-infection with \u003cem\u003eB. microti\u003c/em\u003e should be carefully evaluated during the diagnosis and treatment of Bunyavirus-positive patients to ensure comprehensive and targeted care.\u003c/p\u003e\u003cp\u003eWhile recombinase polymerase amplification (RPA) offers rapid and sensitive detection of \u003cem\u003eBabesia spp.\u003c/em\u003e, several limitations must be acknowledged. First, RPA is prone to false positives due to non-specific amplification in resource-limited settings where contamination risks are higher, as well as false negatives caused by inhibitors in untreated blood samples or extremely low parasitemia levels (\u0026lt;\u0026thinsp;0.01%) that fall below the assay\u0026rsquo;s detection threshold [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Second, environmental factors such as temperature fluctuations during field testing (optimal RPA requires 37\u0026ndash;42\u0026deg;C) and suboptimal sample processing can compromise reproducibility [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Third, while RPA can be adapted for multiplex detection, its current capacity to identify co-infections remains limited. Cross-reactivity between primers/probes or dominance of one pathogen\u0026rsquo;s signal may obscure co-infections, particularly in regions like China where tick-borne pathogens often overlap [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Addressing these challenges requires optimized probe design, rigorous validation of field-deployable protocols, and integration with complementary methods for comprehensive pathogen screening.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study established a novel method for detecting \u003cem\u003eB. microti\u003c/em\u003e using fluorescent recombinase polymerase amplification (RPA) technology. This method demonstrates high sensitivity, strong specificity, and rapid response, completing DNA amplification and detection in just 20 minutes. Addition, a retrospective study was conducted to evaluate the application of fluorescence RPA technology for the molecular detection of typical symptoms of Babesiosis in the population of Xinyang City, Henan Province, China. Instances of co-infection with Bunyavirus were identified, highlighting the potential of RPA technology to enhance molecular diagnostics in endemic areas. In summary, the RPA method for detecting \u003cem\u003eB. microti\u003c/em\u003e shows great promise for field investigations.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDeclaration of Competing Interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors\u0026nbsp;declare that they have no conflict of interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Publish declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they all agree to publish this paper in this journal.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors confirmed the study was reported in accordance with ARRIVE guidelines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank the staff of the National Institute of Parasitic Diseases, the Chinese Center for Disease Control and Prevention (Chinese Center for Tropical Diseases Research); School of Life Sciences, Fudan University; Department of Biology, College of Life Sciences, Inner Mongolia University, who participated in this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by Shanghai Municipal Science and Technology Commission Special Foundation（24DZ2203100）, Science and Technology Leading Talent Team in Inner Mongolia Autonomous Region (2022LJRC0009), the National Parasitic Resources Center, and the Ministry of Science and Technology fund (NPRC-2019-194-30), the National Key Research \u0026amp; Development Program of China (2018ZX10101002-003, 2018ZX10734404), the Three-Year Public Health Action Plan (2023-2025) of Shanghai (No. GWVI-11.2-XD33), Three-Year Initiative Plan for Strengthening Public Health System Construction in Shanghai (2023\u0026ndash;2025) Key Discipline Project (No. GWVI-11.1-12).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Data Availability declaration\u003c/p\u003e\n\u003cp\u003eAll authors agree that the data in this article is available.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAuthors\u0026rsquo; contributions\u003c/p\u003e\n\u003cp\u003eYCC, BX, and WH conceived and designed the experiments; YCC, BX, CHY, KQ and HYY performed the experiments; HYY, ZRM, and SNY analysed the data; YCC, BX, BZ, HYY and WH drafted the manuscript. All authors read and approved the submission of the final manuscript.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAppendix A. Supplementary data\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSupplementary data 1 is available online.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBusch M, Bloch E, Kleinman S (2019) Prevention of transfusion-transmitted infections. Blood 133(17):1854-1864\u003c/li\u003e\n\u003cli\u003eMadison-Antenucci S, Kramer LD, Gebhardt LL, Kauffman E (2022) Emerging tick-borne diseases. Clin Microbiol Rev 33(2):e00083-18\u003c/li\u003e\n\u003cli\u003eSang C, Yang M, Xu B, Liu G, Yang Y, Kairullayev K, Bauyrzhan O, Hazihan W, Hornok S, Wang Y (2021) Tick distribution and detection of Babesia and Theileria species in Eastern and Southern Kazakhstan. Ticks Tick-Borne Dis 12(6):101817\u003c/li\u003e\n\u003cli\u003eWaked R, Krause PJ (2022) Human Babesiosis. Infect Dis Clin North Am 36(3):655-670\u003c/li\u003e\n\u003cli\u003eLobo CA, Rodriguez M, Cursino-Santos JR (2012) Babesia and red cell invasion. Curr Opin Hematol 19(3):170-175\u003c/li\u003e\n\u003cli\u003eUilenberg G (2006) Babesia--a historical overview. Vet Parasitol 138(1-2):3-10\u003c/li\u003e\n\u003cli\u003eWang F, Jiang JF, Tian J, Du CH (2020) Clinical characteristics, diagnosis and treatment of human babesiosis: a review. Zhongguo Xue Xi Chong Bing Fang Zhi Za Zhi. 33(2):218-224\u003c/li\u003e\n\u003cli\u003eChen M, Liu Q, Xue J, Chen S, Huang D, Yu Y (2020) Spreading of human babesiosis in China: current epidemiological status and future challenges. China CDC Weekly 634-637\u003c/li\u003e\n\u003cli\u003eWang J, Zhang S, Yang J, Liu J, Zhang D, Li Y (2019) \u003cem\u003eBabesia divergens\u003c/em\u003e in human in Gansu province, China. Emerg Microbes Infect 8(1):959-961\u003c/li\u003e\n\u003cli\u003eTonnetti L, Proctor MC, Reddy HL, Goodrich RP, Leiby DA (2010) Evaluation of the Mirasol pathogen reduction technology system against \u003cem\u003eBabesia microti\u003c/em\u003e in apheresis platelets and plasma. Transfusion 50(5):1019-1027\u003c/li\u003e\n\u003cli\u003eSwanson M, Pickrel A, Williamson J, Montgomery S (2023) Trends in Reported Babesiosis Cases-United States, 2011-2019. Morb Mortal Wkly Rep 72(11):273-277\u003c/li\u003e\n\u003cli\u003eMoritz ED, Winton CS, Tonnetti L, Townsend RL, Berardi VP, Hewins ME, Weeks KE, Dodd RY, Stramer SL (2016) Screening for \u003cem\u003eBabesia microti\u003c/em\u003e in the U.S. Blood Supply. N Engl J Med 375(23):2236-2245\u003c/li\u003e\n\u003cli\u003eTan M, Liao C, Liang L, Yi X, Zhou Z, Wei G (2022) Recent advances in recombinase polymerase amplification: Principle, advantages, disadvantages and applications. Front Cell Infect Microbiol 12:1019071\u003c/li\u003e\n\u003cli\u003eUllah H, Qadeer A, Rashid M, Rashid MI, Cheng G (2020) Recent advances in nucleic acid-based methods for detection of helminth infections and the perspective of biosensors for future development. Parasitology 147(4):383-392\u003c/li\u003e\n\u003cli\u003eMota DS, Guimar\u0026atilde;es JM, Gandarilla AMD, Filho JCBS, Brito WR, Mari\u0026uacute;ba LAM (2022) Recombinase polymerase amplification in the molecular diagnosis of microbiological targets and its applications. Can J Microbiol 68(6):383-402\u003c/li\u003e\n\u003cli\u003eZheng WB, Wu Y, Ma JG, Zhu XQ, Zhou DH (2015) Recombinase Polymerase Amplification and its Applications in Parasite Detection. Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi 33(5):382-386\u003c/li\u003e\n\u003cli\u003eCai Y, Wu F, Hu W, Chen J, Chen S, Xu B, Lu Y, Ai L, Yang C, Zhao S (2018) Molecular characterization of \u003cem\u003eB. microti\u003c/em\u003e seroreactive antigen 5-1-1 and development of rapid detection methods for anti-B. microti antibodies in serum. Acta Trop 185:371-379\u003c/li\u003e\n\u003cli\u003eWelc-Faleciak R, Bajer A, Bednarska M, Paziewska A, Siński E (2007) Long term monitoring of \u003cem\u003eB. microti\u003c/em\u003e infection in BALB/c mice using nested PCR. Ann Agric Environ Med 14:287-290\u003c/li\u003e\n\u003cli\u003eCai Y, Xu B, Liu X, Yang W, Mo Z, Zheng B, Chen J, Hu W (2024) Transmission risk evaluation of transfusion blood containing low-density B. microti. Front Cell Infect Microbiol 14:1334426\u003c/li\u003e\n\u003cli\u003eLi T, Wang J, Zhang N, Li W, Yan H, Li L, Jia W, Fu B (2019) Rapid and visual detection of Trichinella spp. using a lateral flow strip-based recombinase polymerase amplification (LF-RPA) assay. Front Cell Infect Microbiol 9:1\u003c/li\u003e\n\u003cli\u003eLeiby DA (2011) Transfusion-associated babesiosis: shouldn\u0026rsquo;t we be ticked off? Ann Intern Med 155(8):556-557\u003c/li\u003e\n\u003cli\u003ePrince HE, Lap\u0026eacute;-Nixon M, Patel H, Yeh C (2010) Comparison of the \u003cem\u003eBabesia duncani\u003c/em\u003e (WA1) IgG detection rates among clinical sera submitted to a reference laboratory for WA1 IgG testing and blood donor specimens from diverse geographic areas of the United States. Clin Vaccine Immunol 17(11):1729-1733\u003c/li\u003e\n\u003cli\u003eSimon MS, Leff JA, Pandya A, Cushing M, Shaz BH, Calfee DP, Schackman BR, Mushlin AI (2014) Cost-effectiveness of blood donor screening for \u003cem\u003eB. microti\u003c/em\u003e in endemic regions of the United States. Transfusion 54:889-899\u003c/li\u003e\n\u003cli\u003eNaderi A, Nayebzadeh H, Gholami S (2017) Detection of Babesia infection among humans, goats, and sheep using microscopic and molecular methods in the city of Kuhdasht in Lorestan Province, West of Iran. J Parasit Dis 41(3):837-842\u003c/li\u003e\n\u003cli\u003eO\u0026apos;Connor KE, Kjemtrup AM, Conrad PA, Swei A (2018) An improved PCR protocol for detection of \u003cem\u003eBabesia duncani\u003c/em\u003e in wildlife and vector samples. J Parasitol 104(4):429-432\u003c/li\u003e\n\u003cli\u003eWu F, Cai Y, Qin Z, Ai L, Lu Y, Chen S, Wu XP, Chen J (2016) Development of loop-mediated isothermal amplification (LAMP) assay combined with FTA card for detecting \u003cem\u003eB. microti\u003c/em\u003e. Chin J Zoonoses 32(5):435-441\u003c/li\u003e\n\u003cli\u003eNie Z, Zhao Y, Shu X, Li D, Ao Y, Li M, Wang S, Cui J, An X, Zhan X, He L, Liu Q, Zhao J (2021) Recombinase polymerase amplification with lateral flow strip for detecting \u003cem\u003eBabesia microti\u003c/em\u003e infections. Parasitol Int 83:102351\u003c/li\u003e\n\u003cli\u003eCarter W, Yan Z, Cassai N, Sidhu G (2003) Detection of extracellular forms of Babesia in the blood by electron microscopy: a diagnostic method for differentiation from \u003cem\u003ePlasmodium falciparum\u003c/em\u003e. Ultrastruct Pathol 27(4):211-216\u003c/li\u003e\n\u003cli\u003eMazigo E, Jun H, Oh J, Malik W, Louis JM, Kim TS, Lee SJ, Na S, Chun W, Park WS, Park YK, Han ET, Kim MJ, Han JH (2022) Ring stage classification of \u003cem\u003eBabesia microti\u003c/em\u003e and \u003cem\u003ePlasmodium falciparum\u003c/em\u003e using optical diffraction 3D tomographic technique. Parasites Vectors 15(1):434\u003c/li\u003e\n\u003cli\u003eSaito-Ito A, Takada N, Ishiguro F, Fujita H, Yano Y, Ma XH, Chen ER (2008) Detection of Kobe-type \u003cem\u003eB. microti\u003c/em\u003e associated with Japanese human babesiosis in field rodents in central Taiwan and southeastern mainland China. Parasitology 135(6):691-699\u003c/li\u003e\n\u003cli\u003eShi Q, Song FL, Yang Y, Gao YF, Ci Y, Cheng XL, Nie C, Liu LJ, Zhang XL, Wang J (2023) Epidemiological and molecular study on tick-borne pathogens in Argun Port area near the Chinese-Russian border. Vector-Borne Zoonotic Dis 23(9):447-457\u003c/li\u003e\n\u003cli\u003eZhuang L, Du J, Cui XM, Li H, Tang F, Zhang PH, Hu JG, Tong YG, Feng ZC, Liu W (2018) Identification of tick-borne pathogen diversity by metagenomic analysis in \u003cem\u003eHaemaphysalis longicornis\u003c/em\u003e from Xinyang, China. Infect Dis Poverty 7(1):45\u003c/li\u003e\n\u003cli\u003eMei X, Su C, Zhang S, Jia L, Yang Z, Tian X, Zhang Z, Wang S (2023) Development and application of recombinase polymerase amplification assay for rapid detection of Blastocystis sp. Parasitology 150(13):1221-1225\u003c/li\u003e\n\u003cli\u003eCastellanos-Gonzalez A, White AC Jr, Melby P, Travi B (2018) Molecular diagnosis of protozoan parasites by Recombinase Polymerase Amplification. Acta Trop 182:4-11\u003c/li\u003e\n\u003cli\u003eOnchan W, Ritbamrung O, Changtor P, RPAdit W, Chomdej S, Nganvongpanit K, Siengdee P, Suyasunanont U, Buddhachat K (2022) Sensitive and rapid detection of Babesia species in dogs by recombinase polymerase amplification with lateral flow dipstick (RPA-LFD). Sci Rep 12(1):20560\u003c/li\u003e\n\u003cli\u003eJiang L, Ching P, Chao CC, Dumler JS, Ching WM (2020) Development of a Sensitive and Rapid Recombinase Polymerase Amplification Assay for Detection of \u003cem\u003eAnaplasma phagocytophilum\u003c/em\u003e. J Clin Microbiol 58(5):e01777-19\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Babesiosis, Babesia microti, recombinase polymerase amplification, fluorescence RPA technology","lastPublishedDoi":"10.21203/rs.3.rs-7755464/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7755464/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eThe frequent occurrences of \u003cem\u003eBabesia microti\u003c/em\u003e (\u003cem\u003eB. microti\u003c/em\u003e) infection have emerged as a significant global public health safety concern. The diagnosis of patients constitutes a crucial component in the prevention and control of babesiosis, necessitating the urgent establishment of efficient and accurate molecular biology diagnostic methods for \u003cem\u003eB. microti\u003c/em\u003e detection.\u003c/p\u003e\u003ch2\u003ePurpose\u003c/h2\u003e\u003cp\u003eThis study aimed to develop a sensitive, specific, and rapid fluorescent recombinase polymerase amplification (RPA) technique for the detection of \u003cem\u003eB. microti\u003c/em\u003e (\u003cem\u003eB. microti\u003c/em\u003e) and assess its suitability for field use.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eThis study developed and optimized a fluorescent RPA assay targeting the \u003cem\u003eB. microti\u003c/em\u003e 18S rRNA gene fragment. The method's sensitivity (detection limit down to 10 fg/\u0026micro;L genomic DNA), specificity (distinguishing \u003cem\u003ePlasmodium\u003c/em\u003e samples), and detection limit for spiked mouse blood samples (across varying parasitemia levels) were evaluated. The detection capability was validated using samples from an infected mouse model (tail-tip blood collected 3\u0026ndash;21 days post-infection) and two confirmed human cases. Furthermore, 119 blood samples from patients presenting with fever accompanied by thrombocytopenia were tested using both nested PCR and the newly developed fluorescent RPA assay. The agreement between the two methods was analyzed using the Kappa value, and the significance of their difference was assessed using McNemar's test.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eA fluorescent RPA assay was developed targeting two \u003cem\u003eB. microti\u003c/em\u003e 18S rRNA fragments (243 bp/191 bp). The 191 bp fragment demonstrated superior sensitivity (detection limit: 1 fg/\u0026micro;L genomic DNA) and was selected for assay establishment. Optimized at 39\u0026deg;C for 20 min, its detection threshold was defined by the lowest detectable concentration (1 fg/\u0026micro;L). Specificity testing with 8 \u003cem\u003eP. falciparum\u003c/em\u003e and 8 \u003cem\u003eP. ovale\u003c/em\u003e samples showed fluorescence below this threshold. The assay achieved a detection limit of 0.046 parasites/\u0026micro;L blood, demonstrating a 600-fold increase in sensitivity compared to nested PCR, which detects 28.49 parasites/\u0026micro;L. In infected mice, both RPA and nested PCR detected parasites by day 9 post-infection (microscopy: day 15), with RPA showing higher positivity. The method confirmed infection in 2 patients. Among 119 febrile patients with thrombocytopenia from Xinyang City, Henan Province, nested PCR detected 20 \u003cem\u003eB. microti-\u003c/em\u003epositive cases while fluorescent RPA detected 21. The Kappa value for agreement between the methods was 97.05% (91.31% \u0026minus;\u0026thinsp;100%), and McNemar's test indicated no statistically significant difference in their detection rates (S\u0026thinsp;=\u0026thinsp;1, P\u0026thinsp;\u0026gt;\u0026thinsp;0.1). Based on the combined results of both tests, the molecular positivity rate for \u003cem\u003eB. microti\u003c/em\u003e in this sample set was 17.65%, with co-infections involving Bunya virus present, accounting for 10.08% of the tested samples.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eThe fluorescence RPA method provides a rapid, sensitive, and specific tool for detecting \u003cem\u003eB. microti\u003c/em\u003e and is effective for field screening.\u003c/p\u003e","manuscriptTitle":"Development and Field Evaluation of a Rapid Detection Method for Babesia microti using fluorescent recombinase polymerase amplification(RPA) technology","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-03 00:50:43","doi":"10.21203/rs.3.rs-7755464/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-12-17T05:38:34+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-15T14:25:55+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-12T00:32:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"233765106040691129697219370065458026258","date":"2025-12-08T01:48:21+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"114236229942073132424655035108998657024","date":"2025-12-05T19:51:18+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-01T03:42:14+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-01T03:34:02+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-11-27T10:26:32+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-24T02:53:22+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-11-24T02:50:02+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8242195a-3f1b-44de-85ca-f696e41fb7f7","owner":[],"postedDate":"December 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":58892447,"name":"Biological sciences/Biological techniques"},{"id":58892448,"name":"Biological sciences/Biotechnology"},{"id":58892449,"name":"Health sciences/Diseases"},{"id":58892450,"name":"Biological sciences/Microbiology"},{"id":58892451,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2026-02-25T06:38:45+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-03 00:50:43","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7755464","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7755464","identity":"rs-7755464","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}