Early blight infection and the influence of biocontrol agents on wild potato relatives: Implications for integrated pest management (IPM) in potato

Early blight infection and the influence of biocontrol agents on wild potato relatives: Implications for integrated pest management (IPM) in potato | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Early blight infection and the influence of biocontrol agents on wild potato relatives: Implications for integrated pest management (IPM) in potato Åsa Lankinen, Christian B. Andersen, Hadis Mostafanezhad, Chiara De Pasqual, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5655317/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 05 Sep, 2025 Read the published version in Potato Research → Version 1 posted 5 You are reading this latest preprint version Abstract Integrated pest management (IPM) is an important tool for sustainable crop production. IPM includes a diversity of methods, e.g. the use of biological control agents (BCAs) for disease control or growth promotion. While there is an increasing interest in the use of BCAs, less is known about their environmental costs and benefits on wild species, such as wild crop relatives. For example, a BCA may have the positive effect of controlling disease in wild relatives, but could also have the negative effect of growth promotion on wild relatives that act as weeds. In this study we investigated if three wild potato relatives – the perennial climber Solanum dulcamara , and the annual weeds S. nigrum and S. physalifolium – could be infected by Alternaria solani , the causal agent of early potato blight in Sweden, and studied how two BCAs, Pythium oligandrum (a lab strain) and Bacillus amyloliquefaciens (Serenade®), affected the disease and growth promotion in a series of greenhouse and field experiments. Our studies confirmed the semantic knowledge that A. solani can infect all three wild species, in particular the two annual species often growing as weeds in potato fields. We also found a disease controlling effect of B. amyloliquefaciens , but not P. oligandrum , in the greenhouse. Some growth effects were found for both BCAs, but whether these were positive or negative varied with trait, plant species and genotypes. In conclusion, BCAs can confer both environmental costs and benefits on wild plants, which should be taken into consideration for development of sustainable agriculture. Alternaria solani Bacillus amyloliquefaciens disease epidemiology growth promotion Pythium oligandrum wild Solanum species Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction In recent decades, it has become clear that our cultivation systems need to develop more sustainably, in particular to reduce the frequent use of agrochemicals (Aktar et al. 2009; Indira Devi et al. 2022). One solution is to implement Integrated Pest Management (IPM), which is mandatory within the EU (Directive 2009/128/EC, EC 2009). In IPM programs, a combination of alternative management methods is used first, and then pesticides as the last resort to combat pests and diseases (Barzman et al. 2015). Alternative pest management methods range from preventive methods, e.g. mechanical and cultural control, to ecologically based methods, e.g. using resistant cultivars, enhanced biological diversity, low-risk plant protection products and biological control agents (BCAs) (Stenberg 2017). BCAs are commonly defined as living organisms with a direct or indirect effect on the pest (Stenberg et al. 2021). BCAs may also have the added function of biostimulation such as growth promotion by improving the uptake of nutrients in the plant, or by regulation via phytohormones (Calvo et al. 2014; El-Saadony et al. 2022). While there is an increasing interest in the use of IPM, current problems involve e.g., a lack of knowledge about the efficacy of alternative methods, how and when they should be combined or applied, estimations of economic thresholds in various cultivation systems and a lack of knowledge about the general link between IPM, management, business and sustainability (; Matyjaszczyk 2018); Dara 2019; Karlsson Green et al. 2020; Deguine et al. 2021; Lankinen et al. 2024. While alternative pest management methods in general do not pose the same risks for humans and non-target organisms as synthetic pesticides, evaluations of these methods, such as the use of BCAs, should not only study their efficacy but also consider environmental impacts (Simberloff and Stiling 1996; Collinge et al. 2022; Hashemi et al. 2022). For example, environmental risks of a BCA could be that it may spread, persist for a long time, become a pathogen, produce toxins or antibiotics, have a negative side effect on non-target species or that the pest will evolve to tolerate the BCA (Keswani et al. 2019; Ke et al. 2021; Bardin and Siegwart 2022; Collinge et al. 2022). Another potential risk, that has received less attention, is the influence of alternative methods on wild plants growing in or next to the agricultural field (e.g. weeds). Such risks are considered when testing weed biocontrol (Hinz et al. 2019), but is seldom taken into consideration for pest biocontrol. In the case that a BCA also has a growth promoting effect, this may lead to an increased weed problem if applied on weeds present in an agricultural field (Rabiey et al. 2017; Ray et al. 2018). On the other hand, a BCA may also control pests and diseases on wild crop relatives, which may reduce their spread and severity. Potato is the fourth most important crop worldwide (Lovat et al. 2016), but because it suffers from many diseases including potato late blight, it is also one of the most sprayed (Hashemi et al. 2022). For example, in Sweden in 2013 potato was grown on 0.9 percent of the cultivated land, but used 21 percent of the total fungicides (Eriksson et al. 2016). Despite a reduction in the use of fungicides in potato in Sweden from 52 to 40 tones per hectar between 2017 to 2021, the percent of the total fungicides used in potato was still high (26% in 2021) (SCB 2022), While potato late blight is one of the most serious diseases, in recent years early blight has increased in Europe with identified yield losses of up to 50% (Leiminger and Hausladen 2012; Odilbekov et al. 2014). This increase is believed to be partly caused by a change in the climate and partly caused by rapid resistance development to fungicides by Alternaria solani , the causal agent of early blight (Kapsa 2008; Landschoot et al. 2017; Einspanier et al. 2022; Mostafanezhad et al. 2022). The resistance development to fungicides in A. solani is particularly worrying, as this may lead to a lack of any available fungicide for treatment of severe early blight. Adopting IPM in potato cultivation is therefore crucial. Currently, using BCAs as part of an IPM strategy in potato to control early blight or for growth promotion is gaining increasing interest despite challenges in large scale fields (Andersen 2023; Stridh et al. 2022). For example, BCAs approved to be used against early blight within the EU include the oomycete Pythium oligandrum (commercial product Polygandron®) and the bacterium Bacillus amyloliquefaciens (formerly subtilis ) (commercial product Serenade®) (EC 2024). Both these BCAs have been shown to have growth promoting effects in potato (Syed and Prasad Tollamadugu 2019; Andersen et al. 2024). The growth promoting effect of P. oligandrum in potato is genotype specific (Andersen et al. 2024). However, we still lack knowledge about the environmental risks associated with the use of these BCAs in potato cultivation in relation to wild relatives. In the current study, we focus on the environmental risks of using BCAs in relation to potential effects on wild hosts of A. solani in Sweden, including three wild Solanum species - the annual weeds S. nigrum and S. physalifolium (Taab 2021) and the perennial climber S. dulcamara . The annual weeds are commonly found in potato fields. The perennial species can grow close to agricultural fields, e.g. in wetlands or small streams. These species are known hosts of Phytophthora infestans , the causal agent of late blight (Abreha et al. 2018). Surprisingly, we are not aware of any studies identifying infection of A. solani in these species, even though there appears to be semantic knowledge that this occurs. We studied early blight infection in these three wild potato relatives in the greenhouse, in a small-scale field trial and investigated the presence of natural early blight infections in the annual wild species growing in potato fields. We also studied the potential benefits and risks of using two BCAs. We focused on the questions: Can the three studied wild Solanum species host A. solani ? Do BCAs ( P. oligandrum and B. amyloliquefaciens ) reduce A. solani infection in wild Solanum species? Are BCAs causing growth promotion in wild Solanum species, and do these effects differ between plant genotypes or vary with timing of application? Materials and Methods We performed two greenhouse experiments (Experiment 1 and 2) and a small-scale field trial to investigate the interactions between the three wild Solanum species, the pathogen A. solani , and the potential effects of the biocontrol agents P. oligandrum and B. amyloliquefaciens on disease suppression and on plant performance (Fig. 1 ). Plant material We used three S. dulcamara genotypes in both the greenhouse and field trial. The genotypes were collected as seeds in two nearby wild populations (one genotype from population Lomma 2 (L2:3.6), a coastal forest in Lomma and two genotypes from population Geneticum (G20:1 and G21:1), an urban parking space outside the Genetics Department at Lund University) (Masini et al. 2019). S. dulcamara in the greenhouse (Experiment 1) was grown from seeds collected from the three genotypes in a field plot established with micro-propagated clones in 2016 at Campus Alnarp, Swedish University of Agricultural Sciences (SLU) in Lomma, south Sweden (Masini et al. 2019). The field plot of this perennial plant was used in the field trial of the current study. We used five S. nigrum genotypes collected at five sites in Skåne, of which three were used in the greenhouse (greenhouse Experiment 1–2 and field: Lillgårda, Löderup farm field (Nr 2 L), Stockholmsgården, Valleberga farm field (Nr 6 T), see Lankinen et al (Lankinen et al. 2016) for coordinates of close by S. physalifolium sites; only Experiment 2: Helgegården, Kristianstad field trial (He E, coordinates N56.02404, E14.06913); only field: Simrishamn ruderal land, Alnarp farm field, (Abreha et al. 2018)). For S. physalifolium , we used four genotypes collected at two ruderal sites in Skåne. Two of these were used in both greenhouse and field trials (Borgeby (Nr 1 B), Spillepengen, Malmö (Nr 5 S)), and another two genotypes were used only in the field (Spillepengen, Malmö, Abreha et al. 2018, note that the coordinates for Borgeby is given as a S. nigrum site). Seeds from all wild species were germinated using the method described in Lankinen et al. (2016). We used commercial tubers of the starch potato cultivar Kuras (a commonly used cultivar in Sweden) as a control to promote A. solani infection in a known host in the field trial. In a parallel study, we tested induction of growth promotion by P. oligandrum in these potato plants (Andersen et al. 2024). Preparation of Alternaria solani inoculum We used the A. solani strain AS112 (isolated from a potato field in south Sweden and used in previous studies (Odilbekov et al., 2019; Stridh et al., 2022; Andersen, 2023) in all experiments. In Experiment 2 in the greenhouse, we also used another strain isolated from S. nigrum in Helgegården 2019 (strain ASH4). Experiment 1 Preparation of spore inoculum of A. solani for greenhouse Experiment 1 was performed following the Shahin and Shepard (Shahin and Shepard 1979) protocol. Briefly, ~ 254 mm 2 agar blocks from 20% PDA (Potato Dextrose Agar) plate containing dark growth A. solani were placed growth-down in new plates with S-medium and incubated in the dark at 18°C for 5–7 days. The S-medium was composed of 10 g sucrose, 15 g CaCO3 and 500 mL milliQ water, adjusted to 7.4 pH. Once 10 g of Bacto Agar was added, and the medium was autoclaved. Spores were collected by flooding the plate with 10 mL autoclaved tap water amended with 0.01% (v/v) Tween-20 and gently scraped the surface of the plate with a sterile spatula. A second S-medium plate with conidia was flooded with the 10 mL suspension from the first plate and the surface was gently scraped with a sterile spatula. The suspension was collected and spores were counted using a Fuchs-Rosenthal counter chamber. The final spore concentration was adjusted to 25000 spore mL − 1 , supplemented with 0.1% Bacto Agar and MilliQ water with a final volume of 25 mL. Experiment 2 and the field trial Preparation of spore inoculum of A. solani for the greenhouse Experiment 2 and the field trials was done following Stridh et al. (2022), with minor modification. Briefly, A. solani pure cultures were grown on 20% PDA media plates supplemented with 12 g L-1 Bacto Agar in the dark for 7 days at 25°C. The plates were then exposed to UV-c light (254 nm dominant wavelength) for 7 days (5–6 hour per day). The plates were flooded with 1 mL of MilliQ water amended with 0.01% (v/v) Tween 20 and the spores were dislodged using a sterile L-shaped cell spreader. The final concentration of the spore suspension was adjusted to 10 4 spore mL − 1 using a Fuchs-Rosenthal counter chamber and supplemented with 0.1% Bacto Agar. Preparation of biocontrol agents Pythium oligandrum To produce the oospore inoculum from P. oligandrum (CBS-strain 530.74), one agar plug of P. oligandrum was inoculated on solid V8 agar plates and allowed to completely overgrow the plates for approximately 5 days at 20℃. Five agar plugs from the solid P. oligandrum cultures were inoculated into each of six 1L bluecap bottles, each containing 300 mL of clarified V8 broth. The bottles were put into a rotary incubator, shaking at 120 rpm at 20℃ for seven days. To harvest the oospores from the liquid cultures, the mycelium was macerated using a high-speed blender and 200 mL of sterile water was amended. The inoculum was then filtered through cheesecloth and a final concentration of 2.5×10 4 oospore/mL, resuspended in sterile water, was used in all treatments. Bacillus amyloliquefaciens For the biocontrol agent B. amyloliquefaciens (formerly subtilis ) we used Serenade® ASO from Bayer Crop Science containing strain QST 713 with a minimum of 1.05 x 10 12 cfu L − 1 . A solution of Serenade® was prepared by diluting 12.5 mL of Serenade® in tap water with a final concentration of 0.5% Serenade®. Greenhouse experiments In both experiments we transferred germinated seeds to soil, and cultivated plants in a greenhouse with 16 h light at an approximate temperature of 22°C. We repotted plants in larger pots as they grew. We used unfertilized potting compost (peat with 10% clay and 2% calcium) and the final size of the pots was 1.5 L. In both experiments, plants were moved around weekly to avoid boarder effects. Plants in Experiment 1 were watered twice with extra nutrients. Greenhouse Experiment 1 – three wild species and biocontrol agent P. oligandrum 15–24 plants per genotype of the three species were randomly divided into two groups where one was treated with P. oligandrum and the other served as control. For S. dulcamara we used two batches of plants, where the second batch was grown from seeds ca two weeks after the first batch (Fig. 1 ). This allowed to test how developmental age affected interactions with the biocontrol agent. Plants treated with P. oligandrum were sprayed with spores twice with one week apart at about the age of 2.5 months (annual plants had started flowering) (second set of S. dulcamara 2 months). Both treatments consisted of 10 ml oospore inoculum applied as foliar spray with a high-pressure handheld sprayer. At the first spraying time, a soil drench using additional 10 ml of P. oligandrum was also conducted in all treated S. dulcamara plants. At the second spraying time, a soil drench was applied to all treated plants. Control plants were treated with sterile water of the same volume. Five days after the second spraying with P. oligandrum , we selected 12 plants (6 treated with P. oligandrum and 6 control) of one genotype from the two annual species and two genotypes from S. dulcamara , respectively, for the inoculation experiment with A. solani . We inoculated 6 plants per genotype (3 treated with P. oligandrum and 3 control). Greenhouse Experiment 2 – S. nigrum and biocontrol agent B. amyloliquefaciens We selected S. nigrum for Experiment 2 and added a third genotype, based on the fact that this species showed an interaction between genotype and biocontrol treatment in Experiment 1 (see Result section). 18–24 plants per genotype of S. nigrum were randomly distributed in four groups: i) treatment with biocontrol agent B. amyloliquefaciens , ii) treatment with B. amyloliquefaciens and infected with A. solani , iii) infected with A. solani and iv) control. For genotypes with fewer than 24 plants, six plants were still included in group ii) and iii), to allow infection by two isolates of A. solani (three plants per isolate). Plants were sprayed with B. amyloliquefaciens at the age of 2.5 months, and at 9 and 2 days before inoculation with A. solani . Inoculation and disease scoring in the greenhouse On each inoculated plant of Experiment 1, we placed 2 droplets of 10 µl of A. solani on either side of the central vein on seven young, fully expanded leaves. Two additional leaves of the same plant were mock-treated with 0.033% bacto agar control. In Experiment 2, inoculation was performed by placing 1 droplet of 10 µl of A. solani on one side of the central vein on ten young, fully expanded leaves per plant. No leaves were mock-treated in this experiment, as we never detected any response on such leaves in Experiment 1 (see results). After inoculation, we placed a plastic tent over the plants to maintain high humidity (around 95%) during the first 24 h after inoculation. We then used a misting system within the chamber to stabilize relative humidity at 85%. We estimated disease development 9, 12 and 20 days after inoculation in Experiment 1, and after 7 and 10 days after inoculation in Experiment 2 by measuring the lesion area. Lesion area (LA) was measured as an oval area, using the equation LA = π/4 × D1 × D2, where D1 and D2 are two perpendicular diameters. Estimates of plant performance in the greenhouse To investigate the effects of the biocontrol agents on plant performance, we measured plant performance traits before treatment with biocontrol agents and at the end of the experiment (at plant age of approximately 4 months). In Experiment 1, early performance was recorded as plant size. At the end of the experiment, we recorded final plant size, leaf area, number of flowers or berries, dry above ground biomass and dry root biomass. Early plant size was measured as total length of all shoots in S. dulcamara (batch 1) and as length of the longest shoot (batch 1,2). Final plant size in S. dulcamara (batch 1,2) was recorded as total length of all shoots. Early and final plant size were measured as plant height in S. nigrum and S. physalifolium . Leaf area was measured as the length multiplied by the width of three fully expanded leaves per plant. The number of flowers was counted in S. dulcamara as an indication of reproductive effort as this outcrossing species did not set seeds in the greenhouse. In the annual, self-compatible species, we counted the number of berries. Plant biomass above ground was separated into green mass and fruit mass for S. nigrum , as this species had a substantial number of fruits at the time of harvest. We hereafter refer to ‘green biomass’ for all above ground biomass for S. dulcamara and S. physalifolium , and for S. nigrum to the above ground measure separated from fruit biomass. Roots were rinsed to remove soil. Rinsing resulted in some loss of fine roots. Green biomass, fruit biomass and root biomass were weighed after drying for 24 h at a temperature of 60°C. Field trial We conducted the small field trial at Campus Alnarp in June to September 2019 to investigate the interaction between the three wild Solanum species, and A. solani and the biocontrol agent P. oligandrum under field conditions (Fig. 2 ). Establishment of plants and management of field trial At establishment of the perennial species S. dulcamara in 2016, the three genotypes were randomly mixed and planted in six blocks (12–14 plants per block, arranged in two rows along the length of the plot, i.e. one row in the control area and one row in the A. solani area, Fig. 2 ). In a previous study, that finished a year before the present work commenced, two thirds of the plants were treated with P. infestans , but only showed week disease symptoms. All above ground plant material was removed at the end of each season. We could not detect any long-term treatment effects on survival (survival rate in early season 2019; inoculated: 94%, control: 96%, χ 2 = 0.001, df = 1, P > 0.05) or on performance traits (shoot length, flower and fruit production late season 2018; P > 0.53) (Lankinen unpublished data). The two annual species were planted out as seedlings when they reached ca 15 cm in height (at approximately four weeks old) on the 24th of June. Plants were arranged in 5 rows per species across the control and A.solani treatment areas with 7 plants per row (Fig. 2 ). The four genotypes per species were planted randomly across rows. Commercial potato tubers, cv. Kuras, were sown on the 7th of May 2019 in 10 rows with 6 plants per row (70 cm between rows, 30–40 cm between plants) (Fig. 2 ). Additionally, to get an immediate comparison between the four different species, we planted three plants (one per species of S. nigrum , S. physalifolium and potato) in the five areas between the existing S. dulcamara blocks (Fig. 2 ). The field was fertilized with 100 kg N/ha at the beginning of July. See Andersen et al. (2024) for measurements of soil properties. Weeding and watering were performed when needed over the growing season. Field trial treatments Alternaria solani inoculum was spread as infected kernels in half of the field on the 31st of July using the method by Adolf and Hausladen (2015) to have a control area for treatments with the biocontrol agent P. oligandrum . However, because of the narrow field, we expected that plants in both areas could be infected. To study the potential effects of P. oligandrum on the infection and on plant performance, 12 plants per species were treated with P. oligandrum (6 plants in the control area and 6 plants in area exposed to A. solani kernels) five times during the season, starting at the beginning of July and ending at the beginning of September (8th and 25th of July, 6th and 19th of August, 3rd of September). 12 plants per species served as controls (6 per area). Plants were treated with the P. oligandrum oospore inoculum in sterile water or with sterile water (control), both as foliar application and soil drenching as described above and in Andersen et al. (2024). We used a volume of 300 l/ha, corresponding to 200 ml per plant, following the recommendations for application of commercial products of P. oligandrum. Disease scoring in the field trial Disease scoring of early blight was conducted three times from the middle of August to the middle of September (21st of August, 6-9th of September, 23-24th of September) using the method of Duarte et al. (Duarte et al., 2013) developed for potato. We identified infection as the percentage of green leaf area covered by typical dark early blight spots per individual plant. We also noted defoliation as the percentage of leaves that were dead or defoliated. Because infection levels were low < 5%, we used the percentages per individual plant at the last estimation date for statistics rather than calculating the relative area under the disease progression curve (rAUDPC). Additionally, a spontaneous late blight infection (caused by naturally occurring P. infestans ) affected S. physalifolium around the middle of August. Only minor signs of late blight symptoms were seen on the other species, which are known to be more resistant. We scored late blight infection in S. physalifolium at one occasion (21st of August) as a percentage of infected leaves. Estimates of plant performance in the field trial Plant performance traits were measured three times between July and the middle of September (8th of July, 2-7th of August, 11-19th of September, including plant size, and number of flowers and berries. In S. dulcamara plant size was estimated as total length of all shoots, and in S. nigrum and S. physalifolium as plant height. In S. dulcamara the number of flowers and berries were counted, while in the other species we counted the number of inflorescences containing flowers or berries. In S. physalifolium we noted survival and measured regrowth of the plant after the spontaneous P. infestans infection (24th of September), as a percentage of plant size at the time of infection. All above ground material was also collected on the 14th of November. Plant biomass above ground was separated into green mass and fruit mass for S. dulcamara , but not for the other species as fruits had been lost. The material was weighed after drying for 24 h at a temperature of 60°C. Confirmation of A. solani infection in the wild Solanum species Lesions of infected leaves of the three wild species were collected from the small field trial and grown on water agar and kept in an UV incubator for two days with a temperature of 18°C, and then kept near the window for a week. Plates were then inspected under the microscope to confirm the presence of A. solani . As a complement, we included leaves of S. nigrum with typical A. solani lesions collected from naturally infected potato field trials at Helgegården in 2019 ( S. nigrum , at the same site where we collected S. nigrum seeds and field inoculum, see above). Production of single celled isolates Single cell isolates of putative A. solani from S. dulcamara (Alnarp) and S. nigrum (Helgegården) leaves were confirmed to be A. solani by genetic markers (PCR). To produce single cell isolates a lesion was cut from the leaf, washed in bleach and MilliQ water, then cultured on water agar for at least two weeks in the UV incubator at 18C with 30% intensity UV-c light for 9h per day. After two weeks, the spores were transferred to new plates, this time 20% PDA and incubated for 10 days in the UV chamber. Spores were then detached from the mycelium with 40uL of MilliQ water. The droplet was moved on a new 20% PDA plate and spread with with L-shaped spreader. The plate was incubated at room temperature for 3 hours to allow spore germination. Finally, a sterile scalpel was used to cut out a piece of the PDA containing one single spore and moved to a new 20% PDA plate. The plate was then incubated in the UV chamber for the culture to grow for 14 days at room temperature. One agar plug of 1 cm 2 was cut out from the edge of a growing culture and transferred into a bottle of potato dextrose broth medium. The bottles were incubated in the dark on a lab shaker, at room temperature for 7 days. The mycelium was then separated from the agar plugs using forceps. Mycelial samples were frozen in liquid nitrogen and ground to a find powder using a mortar and a pestle. Molecular confirmation of A. solani DNA extraction was carried out using the DNA-Plant mini kit from Qiagen, following the manufacturer's protocol. We confirmed the quality of the extracted DNA using Nano-drop ND1000 and diluted it to a concentration of 100 ng/µL. As a positive control for the presence of A. solani in the PCR assay, DNA from the reference strain AS 112 (Odilbekov et al. 2014) was utilized. Negative controls consisted of distilled water as template. PCR was performed using two sets of A. solani -specific primers: AS1 (5'-GCTCCCACTCCTTCCGCGC-3') and AS2 (5'-GGAGGTGGAGTTACCGACAA-3') from Kumar et al (2013), or forward primer Asol 129 (319) (ATGCGGGTGAATACGGTTAA) and reverse primer 143 (CTCTACTTTGTTTATGTTATTTAACCAAGAATG), as published in Edin et al. (Edin et al., 2019). PCR reactions were carried out in 25 µL reactions, using 50 ng/µL DNA as the template. The PCR conditions followed the protocols described in Kumar et al. (Kumar et al. 2013) for the AS1 and AS2 primers and Edin et al. (Edin et al. 2019) for the Asol 139 (319) and 143 reverse primer. Subsequently, the PCR product was separated on a 1% agarose gel (confirmational pictures can be found in Online Resource 1). Data analysis of greenhouse experiments and field trial Data was analysed in SPSS, version 29 (IBM SPSS Statistics for Windows 2022), using a series of Anovas. Type III sum of squares was used in the Anovas. Continuous covariates were standardized to a mean of zero and a standard deviation of 1. Greenhouse experiments In Experiment 1 we tested lesion area in a model involving the factors Solanum species, S. dulcamara genotype nested within species, treatment with P. oligandrum and the interaction between species and treatment. In Experiment 2 we tested lesion area in a model with the factors S. nigrum genotype, A. solani isolate, treatment with B. amyloliquefaciens , all two- and three-way interactions. To investigate plant performance following biocontrol treatment in Experiment 1–2, we used models with plant genotype, treatment and their interaction. We included early plant size as a covariate when it was significant (for S. dulcamara ) and the factor growth chamber nested under genotype (for S. nigrum and S. physalifolium ) as plants of some genotypes were split between greenhouse chambers. To analyse whether biocontrol treatment affected plant allocation above vs. below ground, we added the covariate dry root weight to the models with the dependent variable dry green mass and all interactions with genotype and treatment. Significant interactions between dry root weight and treatment would indicate an altered allocation in treated plants. In Experiment 1, we tested how plant performance was influenced by age at the biocontrol treatment in two batches of S. dulcamara plants with a model involving plant genotype, treatment, plant batch and all two- and three-way interactions. We also included the covariate early plant size when significant. Dependent variables were transformed when needed to obtain normal distribution of residuals in the models (Experiment 1; Log-transformed: S. dulcamara : early plant size, plant size at harvest, S. dulcamara two batches: early plant size, plant size at harvest, dry green mass and dry root mass, S. nigrum : leaf area, dry root mass, S. physalifolium : dry green mass and dry root mass; Experiment 2: Power-transformed: plant size, Log-transformed: dry root mass). Field trial To investigate how the percentage infected leaf area by A. solani and wilting (both arcsine-transformed) differed among wild species and potato, we first tested S. nigrum and potato in their two growth places (own plot and between S. dulcamara plants). We used a model with growth place, species and their interaction. Because percentage infection did not differ between growth places (Anova; Growth place: F 1,95 = 0.581, P = 0.45, Species: F 1,95 = 3.14, P = 0.079, Interaction: F 1,95 = 2.48, P = 0.12), we pooled all samples of these species in tests for differences among species. As wilting was affected by growth place (see Results), we also performed an additional analyses of the differences among the four species growing in the S. dulcamara plot. Genotype differences in percentage infection and wilting within each species was tested with non-parametric Kruskal-Wallis test. We tested the effect of P. oligandrum on percentage infection in the selected 24 plants per species by using a model with species, treatment (control in A. solani or control aarea, P. oligandrum in A. solani or control area), scoring date and all two- and three-way interaction. For effects on percentage wilting on the last scoring date we used a model with species, treatment and their interaction. Additionally, we tested how S. physalifolium genotype affected P. infestans infection percentage and the percentage regrowth with non-parametric Kruskal-Wallis test. Moreover, the effect of P. oligandrum on percentage infection and regrowth was tested with non-parametric Man-Whitney U-test. To study how plant performance was affected by P. oligandrum treatment we used a model with treatment and if significant included the covariate early plant size ( S. dulcamara and S. nigrum ). Some traits were log-transformed to obtain normally-distributed resuíduals of the models ( S. dulcamara : number of flowers, number of berries, dry berry mass, S. nigrum : number of inflorescences with flowers and berries, dry green mass). Results Alternaria solani infection in the greenhouse All three wild Solanum species inoculated with A. solani developed lesions typical for early blight disease in the greenhouse experiments (Fig. 3 ). In Experiment 1, involving all species, mock treated leaves showed no signs of lesions. Lesions in inoculated plants were possible to measure nine days post inoculation (dpi). After 12 and 20 days leaves started to drop, so we concluded that the data was most reliable at 9 dpi. Lesion size at 9 dpi differed among species across A. solani treatments (with and without P. oligandrum treatment), showing that S. physalifolium was more susceptible to infection than S. dulcamara and S. nigrum (Fig. 3 a, Table 1 ). There was no significant difference between the two tested S. dulcamara genotypes. Table 1 Analyses of variance of lesion area following inoculations by A. solani in wild Solanum species treated with a biocontrol agent ( P. oligandrum or B. amyloliquefaciens ) in the greenhouse in Experiment 1–2. Source of variation df F P Experiment 1: Lesion area (mm 2 ) 9 dpi Solanum species 2 5.63 0.013 S. dulcamara genotype a 1 1.14 0.30 Treatment ( P. oligandrum ) 1 3.54 0.077 Species × treat 2 0.361 0.70 Error 17 Experiment 2: Lesion area (mm 2 ) 7 dpi S. nigrum genotype 2 0.511 0.61 A. solani isolate 1 3.62 0.069 Treatment (Serenade) 1 8.26 0.008 Genotype × isolate 2 0.956 0.40 Genotype × treat 2 0.508 0.61 Isolate × treat 1 3.61 0.070 Genotype × isolate × treat 2 0.952 0.40 Error 24 a S. dulcamara genotype was nested within species. Bold indicate significant (P < 0.05) factors. In Experiment 2, lesion area at 7 and 10 dpi in S. nigrum showed similar results. Lesion size at 7 dpi was similar across the three S. nigrum genotypes and for the two isolates (Fig. 3 b, Table 1 ). However, there was a non-significant trend that the newly collected isolate caused larger lesions (P = 0.069) and the variance for this isolate was significantly larger (F-test; F = 0.047, P = 0.0001). Effect of biocontrol agents on early blight disease in the greenhouse In Experiment 1, no effect of the biocontrol agent P. oligandrum on lesion area was detected in any of the three wild Solanum species (Fig. 3 a, Table 1 ). In Experiment 2, the biocontrol agent B. amyloliquefaciens had a strong negative effect on lesion area in S. nigrum (Fig. 3 b, Table 1 ). Effect of biocontrol agents on plant performance in the greenhouse In Experiment 1, the biocontrol agent P. oligandrum affected plant performance in all three Solanum species, but in slightly different ways (Fig. 4 , Table 2 ). In the three S. dulcamara genotypes, treated plants became smaller (Fig. 4 a). The effect on dry root weight varied among genotypes (Fig. 4 c), as indicated by the significant genotype by treatment interaction. In the two S. nigrum genotypes, a significant genotype by treatment interaction was seen for both plant size, estimated as plant height (Fig. 4 d), and dry root weight (Fig. 4 f). Thus, the response to the treatment varied with genotype. In S.physalifolium , the two genotypes responded in a similar way to P. oligandrum; they became shorter (Fig. 4 j), produced a higher dry green biomass (Fig. 4 k) and a higher dry root biomass (Fig. 4 l). Leaf area was not affected by treatment in any species (Table 2 ). Likewise, no treatment effects were seen for berry production in S. nigrum or S. physalifolium (Table 2 ). Table 2 Analyses of variance of plant performance traits in three wild Solanum species treated with the biocontrol agent P. oligandrum in the greenhouse Experiment 1. Source of variation Plant size (cm) a Leaf area (mm 2 ) b Number of berries Dry berry mass (g) Dry green mass (g) c Dry root mass (g) d df F P df F P df F P df F P df F P df F P S. dulcamara Genotype 2 36.8 < 0.001 1 3.08 0.054 2 4.41 0.17 2 19.2 < 0.001 Treatment 1 7.12 0.010 1 0.784 0.38 1 1.37 0.25 1 0.651 0.42 Early plant size e 1 20.4 < 0.001 - - - 1 5.18 0.027 1 6.37 0.015 Genotype ×Treat 2 0.951 0.39 2 1.19 0.31 2 0.258 0.77 2 3.61 0.034 Error 52 51 52 52 S. nigrum Genotype 1 0.885 0.35 1 13.6 0.001 1 7.73 0.008 1 0.402 0.53 1 9.77 0.003 1 1.68 0.20 Treatment 1 0.50 0.48 1 0.048 0.83 1 0.200 0.66 1 2.22 0.14 1 0.030 0.86 1 4.80 < 0.001 Chamber (G) f 1 13.8 0.001 1 2.45 0.13 1 6.04 0.018 1 0.489 0.49 1 2.46 0.12 1 0.063 0.80 Genotype ×Treat 1 7.53 0.009 1 0.025 0.87 1 3.01 0.090 1 0.793 0.38 1 < 0.001 1.0 1 10.5 0.002 Error 43 43 43 43 43 43 S. physalifolium Genotype 1 7.76 0.008 1 0.014 0.91 1 1.56 0.22 1 0.048 0.83 1 0.286 0.60 Treatment 1 5.69 0.022 1 0.026 0.87 1 0.710 0.41 1 11.1 0.002 1 4.44 0.042 Chamber (G) f 1 15.8 < 0.001 1 1.64 0.21 1 2.84 0.10 1 1.48 0.23 1 4.07 0.052 Genotype ×Treat 1 1.32 0.26 1 1.26 0.27 1 1.29 0.26 1 0.337 0.57 1 1.83 0.19 Error 37 37 36 36 35 a Plant size in S. dulcamara was estimated as length of all shoots (log-transformed), and in S. nigrum and S. physalifolium as plant height. b Log-transformed in S. nigrum c Dry green mass included berries in S. dulcamara and in S. physalifolium (log-transformed in this species), but not in S. nigrum which had produced a very high number of berries. d Log-transformed in S. nigrum and in S. physalifolium e Early plant size was controlled for in S. dulcamara models to take into account early size differences in this species. f Chamber nested under genotype (G) was included in the models for S. nigrum and S. physalifolium because some genotypes were split between two different chambers in the greenhouse. Bold indicates a significant (P < 0.05) difference. In Experiment 2, the three S. nigrum genotypes treated with the biocontrol agent B. amyloliquefaciens , significant genotype by treatment interactions were found for plant size and dry root weight (Fig. 4 , Table 3 ). This pattern was similar to that seen in S. nigrum genotypes treated with P. oligandrum . Interestingly, the two genotypes used in both experiments (Nr 2 L and Nr 6 T) showed a similar plant size response to both biocontrol agents, but an opposite response regarding dry root mass (Fig. 4 ). The strong genotype effect detected on dry green mass was similar for the two genotypes across biocontrol agents. Table 3 Analyses of variance of plant performance traits in S. nigrum treated with the biocontrol agent B. amyloliquefaciens in the greenhouse Experiment 2. Plant size (cm) a Number of berries Dry berry mass (g) Dry green mass (g) Dry root mass (g) b Source of variation df F P df F P df F P df F P df F P Genotype 2 15.3 < 0.001 2 106 < 0.001 2 16.8 < 0.001 2 20.1 < 0.001 2 22.6 < 0.001 Treatment 1 0.052 0.82 1 0.086 0.77 1 1.14 0.29 1 0.030 0.86 1 0.074 0.79 Genotype ×Treat 1 3.95 0.025 1 0.094 0.91 1 1.22 0.30 1 2.46 0.12 1 4.39 0.017 Error 58 58 58 58 58 a Estimated as plant height and power-transformed b Log-transformed Bold indicates a significant (P < 0.05) difference. Effect of biocontrol agents on above vs. below ground allocation in the greenhouse To test if plants allocated resources differently above vs. below ground in response to the biocontrol agents, we included dry root mass as a covariate in the models with the dependent variable above green mass, including all interactions. However, we found no significant differences in allocation in either tested species, as indicated by the interaction between treatment and dry root mass, or the interaction between treatment, dry root mass and genotype ( S. dulcamara : P > 0.61, S. nigrum : P > 0.16, S. physalifolium : P > 0.67). Thus, there was no evidence for a change in above vs. below ground allocation in response to treatment with the two tested biocontrol agents. There were, however, positive correlations between dry green mass and dry root mass across treatments (both with and without BCAs) in S. dulcamara (P = 0.005) and S. nigrum (Experiment 1: P = 0.011, Experiment 2: P = 0.013), but not in S. physalifolium (P = 0.085). Plant developmental stage and performance in response to P. oligandrum in the greenhouse To get an indication of whether plant developmental stage influenced the response to treatment with the biocontrol agent P. oligandrum , plant performance traits in S. dulcamara were also evaluated in plants that were two weeks younger than the first replicate of plants and therefore smaller in size (mean ± sd longest shoot: First batch = 101 ± 22 cm; Second batch = 36 ± 10 cm). Even though plants in the second replicate (batch 2) were harvested two weeks later than the first replicate (batch 1), these plants remained smaller (mean ± sd total shoot length: First replicate = 563 ± 30 cm; Second replicate = 238 ± 8 cm, Table 4 ). The response to P. oligandrum was significantly different between replicates (batches) for plant size and dry root biomass at the end of the experiment, as suggested by the significant interactions involving treatment and plant batch (Table 4 ). Separate analyses including only plants from the second batch could not detect any significant effect of either biocontrol treatment or its interaction with genotype (Anova; Plant size: Genotype: F 2,55 = 1.72, P = 0.22, Treatment: F 1,55 = 0.573, P = 0.45, T × G: F 2,55 = 1.11, P = 0.34; Dry root weight: Genotype: F 2,55 = 1.00, P = 0.38, Treatment: F 1,55 = 0.299, P = 0.59, T × G: F 2,55 = 1.52, P = 0.23). No difference in response to the biocontrol treatment was seen for dry green biomass, indicating that this trait was not affected by P. oligandrum in either of the plant batches (Table 2 , 4 ). Table 4 Analyses of variance of plant performance traits in two S. dulcamara plant batches with an age difference of two weeks treated at the same time with the biocontrol agent P. oligandrum in the greenhouse Experiment 1. Plant size (cm) a Dry green mass (g) b Dry root mass (g) b Source of variation df F P df F P df F P Genotype 2 10.3 < 0.001 2 0.968 0.38 2 6.76 0.002 Treatment 1 0.692 0.41 1 1.40 0.24 1 1.69 0.20 Plant batch 1 19.1 < 0.001 1 4.08 0.046 1 1.41 0.24 Early plant size c 1 5.22 0.024 1 10.6 0.002 1 8.29 0.005 Genotype ×Treat 2 0.116 0.89 2 0.442 0.64 2 0.26 0.77 Genotype × Plant batch 2 22.1 < 0.001 2 12.7 < 0.001 2 14.3 < 0.001 Treat × Plant batch 1 4.42 0.038 1 0.243 0.63 1 0.293 0.59 Genotype × Treat × Plant batch 2 1.45 0.24 2 0.949 0.39 2 3.43 0.036 Error 107 105 104 a Estimated as length of all shoots (log-transformed) b Log-transformed c Estimated as longest shoot (log-transformed) Bold indicates a significant (P < 0.05) difference. Disease progression in the field trial and confirmation of A. solani All three wild Solanum species and the potato cultivar Kuras started to show lesions typical of infection by A. solani (Fig. 5 ) from the middle of August, i.e. three weeks post inoculation of kernels. The percentage of infected leaves increased over the three scoring events performed during five weeks between middle August and middle September, but at the latest scoring date the infection was still low (Fig. 6 ). The S. physalifolium plot was affected by a spontaneous P. infestans infection at the end of August, causing the plants to drop all of their leaves. Thus, for S. physalifolium early blight could only be scored in plants growing between S. dulcamara plants (N = 5). Despite the low infection level, the four species differed in percentage infected leaves (F 3,168 = 31.9, P < 0.001, using pooled values for growth place as this factor was non-significant). S. physalifolium and S. nigrum were more susceptible to infection compared to S. dulcamara (Fig. 6 ). There were no differences in percentage infection among the three genotypes of S. dulcamara (Kruskal-Wallis; 1.15, N = 68, df = 2, P = 0.56) or the four genotypes of S. nigrum (Kruskal-Wallis; 5.47, N = 29, df = 3, P = 0.14). Percentage wilting of plants at the last scoring event (in mid-September) differed between growth place for S. nigrum and potato, but also between species as potato had slightly higher wilting percentage (Anova; Own plots: S. nigrum 0.32 ± 0.11 (se) %, potato 1.3 ± 0.22%, S. dulcamara plot: S. nigrum 0.90 ± 0.56%, potato 4.0 ± 1.64%; Anova; Growth place: F 1,95 = 9.51, P = 0.003, Species: F 1,95 = 22.0, P < 0.001, Interaction: F 1,95 = 2.33, P = 0.13). A separate analysis for all four species in the S. dulcamara plot showed a lower wilting percentage in S. dulcamara than in the five S. physalifolium plants and five potato plants (Anova; F 3,78 = 5.1, P = 0.003; S. dulcamara 1.2 ± 0.26, %, S. physalifolium 4.2 ± 1.64%). This difference was in line with the percentage infected leaves (Fig. 6 ). Inspecting the water agar plates from all wild species under the microscope confirmed the presence of typical A. solani spores. Moreover, PCRs of isolates from S. dulcamara in our small field trial at Campus Alnarp and from naturally infected S. nigrum in a larger field trial confirmed the infection of A. solani in these two wild species (see Online Resource 1). Effect of P. oligandrum on disease and plant performance in the field trial We were unable to detect any significant effect of treatment with P. oligandrum on the percentage of infection by A. solani or wilting involving the 24 selected plants of S. dulcamara , S. nigrum or potato per species grown in the A. solani or control area across the three scoring dates (Anova; Infection: Species: F 2,180 = 16.7, P < 0.001, Treatment: F 3,180 = 1.57, P = 0.20, Date: F 2,180 = 64.7, P < 0.001, Species × Date: F 4,180 = 8.55, P < 0.001, other two-way interactions and three-way interaction: P = 0.64–0.78; Wilting: Species: F 2,60 = 13.5, P < 0.001, Treatment: F 3,60 = 1.60, P = 0.20, Interaction: F 6,60 = 1.73, P = 0.13). Solanum physalifolium scored for infection by P. infestans on the 21st of August, showed that 64 ± 15 (sd) % of leaves were infected (ranging between 50–100% per individual plant). The two plants with 100% infected leaves died, while plants with < 100% infected leaves all survived and started regrowing new leaves. Plant genotype did not influence percentage infection (Kruskal-Wallis; 3.16, N = 34, df = 3, P = 0.37) or the percentage of regrowth in late September (0–75%, Kruskal-Wallis; 6.63, N = 32, df = 3, P = 0.093). Treatment with P. oligandrum did not influence infection by P. infestans in the selected plants (Man-Whitney U-test; 93, N = 23, P = 0.089) or regrowth in the surviving 22 of the selected plants (Man-Whitney U-test; 63, N = 22, P = 0.87). No plant performance traits were affected by P. oligandrum treatment in the A. solani treated or control area, for either of the three wild species (Table 5 ). For both S. dulcamara and S. nigrum early plant size had a big impact on later performance. Table 5 Analyses of variance of plant performance traits in three wild Solanum species treated with the biocontrol agent P. oligandrum in a field trial at Campus Alnarp, Sweden. Source of variation Plant size (cm) a August Number of flowers b /flower + berries c August Plant size (cm) a September Number of berries d September Dry green mass (g) e November Dry berry mass (g) d November df F P df F P df F P df F P df F P df F P S. dulcamara Treatment 1 2.24 0.15 1 0.020 0.89 1 0.214 0.65 1 0.214 0.65 1 0.184 0.67 1 2.68 0.12 Plant size f July 1 22.8 < 0.001 1 19.2 < 0.001 1 9.86 0.005 1 9.86 0.005 - - - 1 10.7 0.006 Error 16 16 20 20 20 14 S. nigrum Treatment 1 0.50 0.48 1 0.048 0.83 1 0.369 0.55 1 0.068 0.80 Plant size f July 1 26.3 < 0.001 - - - 1 10.2 0.005 - - - Error 19 19 19 20 S. physalifolium Treatment 1 0.191 0.66 1 0.006 0.94 1 0.003 0.96 Error 21 20 20 a Plant size in S. dulcamara was estimated as length of all shoots, and in S. nigrum and S. physalifolium as plant height. b Number of flowers in S. dulcamara ( log-transformed) c Number of inflorescences with flowers and berries in S. nigrum (log-transformed) d Log-transformed e Log-transformed in S. nigrum f Early plant size was controlled for in S. dulcamara and S. nigrum models to take into account early size differences in these species. Bold indicates a significant (P < 0.05) difference. Discussion In this study we showed that three wild Solanum species growing either as weeds in potato fields or close by potato fields can host the potato pathogen Alternaria solani . We also tested how two BCAs used in potato to control A. solani affect these wild plants. We found some indication of disease control of one of the BCAs – B. amyloliquefaciens in the commercial product Serenade®. Both BCAs had effects on plant growth, but the effect varied with investigated trait, species and genotype within species. When assessing environmental risks of BCAs, it may therefore be of interest to also consider their effects on wild relatives present in the field. Wild Solanum species as alternative hosts of A. solani Disease epidemiology in crops is not only affected by the crop per se but can also be influenced by presence of alternative hosts (Kumar et al. 2021; Susi 2024). For this reason, it is important to investigate if crop-wild relatives can act as alternative hosts of crop pathogens. Potato has three wild relatives in Sweden – the perennial climber S. dulcamara and the two annual weeds S. nigrum and S. physalifolium . Previous studies showed varying susceptibility to late blight in these species (Grönberg et al. 2012; Abreha et al. 2018) – and that S. dulcamara can act as an overwintering host (in the rhizosphere) (Vetukuri et al. 2020). Surprisingly, we were unable to find studies that had tested if these three species could act as alternative hosts also to A. solani , but there appears to be some sematic knowledge. For example, the two annual weeds often grow in potato fields and lesions similar to those resulting from early blight are often noted by farmers. In our study we inoculated these three species with A. solani both in the greenhouse and in a small-scale field trial. We found that A. solani was able to infect all three species. The greenhouse results suggested that S. physalifolium was more susceptible than the other species. Further, results from the field trials indicated that the two annual species showed higher levels of infection than S. dulcamara , indicating a different pattern compared to infection by P. infestans where S. physalifolium is highly susceptible and S. nigrum is mostly resistant (Abreha et al. 2018). The higher levels of infection in the greenhouse compared to in the field for S. dulcamara was seen previously for P. infestans (Masini et al. 2019), and is probably related to the production of thicker and smaller leaves in the field. It should be noted that our field trial was small and the degree of infection by A. solani quite low. Moreover, a spontaneous P. infestans infection in S. physalifolium caused these plants to drop their leaves and therefore reduced the number of plants we could score for early blight. Confirmation of A. solani was also carried out by inspection of the spores under the microscope for all three species and through PCR from samples from our small field trial for S. dulcamara and for S. nigrum from a potato field trial with natural infection. These data further support the hypothesis that the wild species can be alternative hosts for A. solani . From other observations of potato field trials and commercial potato fields with naturally occurring A. solani infection in south Sweden, we have noted that S. nigrum and S. physalifolium growing next to the field often show early blight disease symptoms, which may indicate an influence on disease epidemiology (Lankinen et al. unpublished observations). However, we have also seen that disease symptoms in the wild species usually appear later than in potato. Because early blight disease is positively correlated to plant age (Odilbekov et al. 2020), it is possible that the later life-cycle of these wild species (from July - October) compared to potato, reduces their potential influence on the epidemiology of early blight. Interestingly, the isolate collected from S. nigrum in potato field trials showed a trend towards higher pathogenicity than a commonly used lab strain. The trend of higher pathogenicity in the isolate collected from the wild species may be caused by the more recent collection of this isolate compared to the lab strain, reflecting the well-known degeneration of pathogenicity in lab strains of plant pathogens in general (Danner et al. 2023). In future studies it would be of interest to understand better if the wild Solanum species influence A. solani evolution, and if this impacts pathogenicity on potato, as has been indicated for P. infestans (Grönberg et al. 2012). Control of early blight by BCAs in wild Solanum species While environmental risks must be taken into consideration in the approval process of BCAs (Simberloff and Stiling 1996; Collinge et al. 2022), less is known about potential positive effects, e.g. if the BCA can control disease also in wild relatives and thereby reducing the presence of the pathogen. In the current study we investigated if the oomycete BCA Pythium oligandrum (using a lab strain) and the bacterial BCA Bacillus amyloliquefaciens (formerly B. subtilis ) (using the commercial product Serenade®) could control early blight in the three wild Solanum species. Previous studies in potato showed that both P. oligandrum (the commercial product Polygandron® and our lab strain) and B. amyloliquefaciens (Serenade®) controlled early blight in the greenhouse, and that B. amyloliquefaciens was more effective than P. oligandrum (Stridh et al. 2022). In line with these studies, we found that B. amyloliquefaciens was effective at controlling early blight when tested in S. nigrum in the greenhouse. In contrast, P. oligandrum had no disease controlling effect in either of the tested three species in the greenhouse. It is possible that the lack of effect of P. oligandrum was because this was a small experiment in combination with an expected smaller effect size for this BCA compared to Serenade®. It is also possible that P. oligandrum is unable to control early blight in these wild species. In our field trial, we investigated the biocontrol effect of P. oligandrum. In line with the results of the greenhouse study, we were unable to detect a disease controlling effect in either S. dulcamara , S. nigrum or the starch potato cultivar Kuras. This result was not surprising given that in potato, BCAs are less effective in the field compared to in the greenhouse (Stridh et al. 2022) or show a transient effect (Andersen 2023). It is also possible that the low infection pressure made our studies less reliable, or less easy to detect. In S. physalifolium , we were not able to investigate a biocontrol effect on A. solani because of the spontaneous P. infestans infection. However, P. oligandrum had no disease controlling effect on the P. infestans infection or on the capacity of these plants to regrow. Interestingly, even though plants lost most of their leaves, 22 out of 24 plants survived the P. infestans infection and started to regrow. Abscission of leaves either as a response to damage or as a defence response has been observed in many species (Kong and Yang 2023). In future studies, knowledge about the disease controlling capacity of a BCA not only on a given crop but also on nearby alternative hosts may be of interest to quantify for a better understanding of the environmental impact of BCAs and also for a more comprehensive understanding of how important it is to control these weeds in potato fields. Growth promotion in wild Solanum species following BCA treatment The added benefit of growth promotion of BCAs is receiving increasing interest (El-Saadony et al. 2022), but less is known about environmental effects on wild plants. In this study we evaluated a potential growth promoting effect also on the three wild relatives of potato of the BCAs P. oligandrum and B. amyloliquefaciens (Serenade®), known to be growth promoting in potato (Syed and Prasad Tollamadugu 2019; Andersen et al. 2024). In the greenhouse, we found that growth was affected following treatment with P. oligandrum , but the outcome varied across investigated traits, species and genotypes within species. In general, root mass was more often positively affected, while the response in above ground biomass or plant size was more variable. S. physalifolium responded positively to P. oligandrum treatment in terms of both root mass and above ground mass, but plant size (measured as height) was slightly reduced. Solanum dulcamara and S. nigrum showed variation among genotypes in the root mass response. In S. dulcamara there was a slight negative effect on plant size (measured as shoot length), while in S. nigrum the response in plant size (measured as height) again differed among genotypes. When we tested the effect of B. amyloliquefaciens (Serenade®) in S. nigrum the outcome was similar to the effect of P. oligandrum. However, the genotype response was not consistent across BCAs tested. The variation in response among genotypes is in line with studies showing that growth is promoted only in some potato cultivars following treatment with P. oligandrum (Andersen et al. 2024). Moreover, one of the few other studies that investigated how a BCA influences growth promotion in wild species found that the endomycorrhizal fungus Serendipita vermifera had a variable effect on three nearby weed species occurring with the crop switchgrass (Ray et al. 2018). Our greenhouse results suggest that at least for S. physalifolium and potentially also for S. nigrum exposure in a potato field may enhance the weed problem, as increased root mass is likely to increase water and nutrient update, and therefore performance of these weeds. It is, however, uncertain if these effects are dependent on the plant development stage that is exposed to the BCA, as our greenhouse results indicated for S. dulcamara , or if the same results will be seen under field conditions. We were unable to detect any effects of P. oligandrum treatment in the field trial but here only plant height was measured, which showed an unclear or negative effect in the greenhouse. Even though this was a small field trial, we could detect a positive effect on plant height of the potato plants grown in the same field trial (Andersen et al. 2024). From these greenhouse results we conclude that growth promotion can happen in wild Solanum relatives of potato exposed to BCAs, but the effect can vary and it is therefore not so easy to predict unless investigated. Future studies should evaluate growth promotion effects of BCAs on wild plants under field conditions and at time points that reflect their use in agriculture. Such data on wild crop relatives may also be useful for finding genetic differences in the response to BCAs that could contribute to plant breeding for genotypes that respond well to BCAs (Schmidt et al. 2020). Conclusions In this study, we showed that A. solani can infect the three wild Solanum species that occur in Sweden, supporting the hypothesis that they can be alternative hosts of this pathogen. To our knowledge, this is the first study to report infection of A. solani in these wild species, which is important for the prediction of early blight disease epidemiology in the future. We also found that to some extent, the BCA B. amyloliquefaciens , but not the BCA P. oligandrum can control early blight in wild Solanum species. Moreover, these BCAs affected growth of the wild species, but the effects were not always positive. We conclude that the investigated BCAs can result in both positive and negative environmental effects when affecting these wild species within or near to potato fields. The variability in the responses suggests that these effects may be difficult to predict beforehand and therefore it may be beneficial to take the effects of BCAs on wild species into consideration for successful use of them in sustainable agriculture. Declarations Author contributions ÅL initiated and coordinated the study. ÅL, CBA, HM, EL, LGB contributed to the study conception and design. Material preparation and data collection was performed by ÅL, CBA, HM, FQ, CDP, VH, LJS. Data analysis was performed by ÅL. The first draft of the manuscript was written by ÅL with help from CBA, CDP. ÅL, HM, CDP, VH, EL, LGB contributed to manuscript editing and reviewing. All authors read and approved the final manuscript. Acknowledgements We thank Francesco Quaiotto, Kristin Aleklett and Daniella Weber for help in the greenhouse, and Sophie Brouwer and Maja Brus-Szkalej for lab support. The study was supported by Swedish Research Council (grant nr 2018–04354 to ÅL and grant nr 2023–05529 to LGB and ÅL), The Swedish Research Council Formas (grant nr 2021 − 01320 to ÅL, EL, LGB and grant nr 2019 − 00881 to LGB) and the Carl Tryggers foundation (to ÅL). Competing Interests: The authors have no competing interests to declare that are relevant to the content of this article. References Abreha KB, Lankinen Å, Masini L, Hydbom S, Andreasson E (2018) Late blight resistance screening of major wild Swedish Solanum species: S. dulcamara , S. nigrum and S. physalifolium . Phytopathol 108:847–857. https://doi.org/10.1094/PHYTO-10-17-0355-R Adolf B, Hausladen H (2015). Protocol for the artificial inoculation with A. solani in field trials (with infected kernels). Euroblight Protocols for Alternaria. https://agro.au.dk/forskning/internationale-platforme/euroblight/alternaria/protocols. Accessed 6 November 2024 Aktar W, Sengupta D, Chowdhury (2009) Impact of pesticides use in agriculture: their benefits and hazards. Interdiscip. Toxicol. 2:1–12. https://doi.org/10.2478/v10102-009-0001-7 Andersen C (2023). Friend or Foe? Biocontrol interactions of Pythium oligandrum within the potato cropping system. Dissertation, SLU. Andersen CB, Aleklett K, Digdarshika G, Lankinen Å, Grenville-Briggs, L (2024). Pythium oligandrum induces growth promotion in starch potato without significantly altering the rhizosphere microbiome. Appl Soil Ecol 199:105423. https://doi.org/https://doi.org/10.1016/j.apsoil.2024.105423 Bardin M, Siegwart M (2022). Can pests develop resistance to biocontrol products? In: Fauvergue X, Rusch A, Barret M, Bardin M, Jacquin-Joly E, Malausa T, Lannou C (eds) Extended Biocontrol. Springer, Netherlands, pp 267–272. https://doi.org/10.1007/978-94-024-2150-7_23 Barzman M, Bàrberi P, Birch ANE, Boonekamp P, Dachbrodt-Saaydeh S, Graf B, Hommel B, Jensen JE, Kiss J, Kudsk P, Lamichhane JR, Messéan A, Moonen A-C, Ratnadass A, Ricci P, Sarah J-L, Sattin M (2015) Eight principles of integrated pest management. Agron Sustain Dev 35:1199–1215. https://doi.org/10.1007/s13593-015-0327-9 Calvo P, Nelson L, Kloepper JW (2014) Agricultural uses of plant biostimulants. Plant Soil 383:3–41. https://doi.org/10.1007/s11104-014-2131-8 Collinge DB, Jensen DF, Rabiey M, Sarrocco S, Shaw MW, Shaw RH (2022) Biological control of plant diseases – What has been achieved and what is the direction? Plant Pathol 71: 1024–1047. https://doi.org/10.1111/ppa.13555 Danner C, Mach RL, Mach-Aigner AR (2023) The phenomenon of strain degeneration in biotechnologically relevant fungi. Appl Microbiol Biotechnol 107:4745–4758. https://doi.org/10.1007/s00253-023-12615-z Dara SK (2019) The new integrated pest management paradigm for the modern age. J Integr Pest Manag 10:1. https://doi.org/10.1093/jipm/pmz010 Deguine J-P, Aubertot J-N, Flor RJ, Lescourret F, Wyckhuys KAG, Ratnadass A (2021) Integrated pest management: good intentions, hard realities. A review. Agron Sustain Dev 41:38.. https://doi.org/10.1007/s13593-021-00689-w Duarte HSS, Zambolim L, Capucho AS, Júnior AFN, Rosado AWC, Cardoso CR, Paul PA, Mizubuti ESG (2013) Development and validation of a set of standard area diagrams to estimate severity of potato early blight. Eur J Plant Pathol 137:249–257. https://doi.org/10.1007/s10658-013-0234-3 EC (2009) Directive 2009/128/EC of the European Parliament and of the Council of 21 October 2009 establishing a framework for Community action to achieve the sustainable use of pesticides. http://data.europa.eu/eli/dir/2009/128/2019-07-26. Accessed 10 January 2023 EC (2024) EU pesticide database for active substances. https://ec.europa.eu/food/plant/pesticides/eu-pesticides-database/start/screen/active-substances. Accessed 8 April 2024 Edin E, Liljeroth E, Andersson B (2019) Long term field sampling in Sweden reveals a shift in occurrence of cytochrome b genotype and amino acid substitution F129L in Alternaria solani , together with a high incidence of the G143A substitution in Alternaria alternata . Eur J Plant Pathol 155:627–641. https://doi.org/10.1007/s10658-019-01798-9 Einspanier S, Susanto T, Metz N, Wolters PJ, Vleeshouwers VGAA, Lankinen Å, Liljeroth E, Landschoot S, Ivanović Ž, Hückelhoven R, Hausladen H, Stam R (2022) Whole-genome sequencing elucidates the species-wide diversity and evolution of fungicide resistance in the early blight pathogen Alternaria solani. Evol Appl 15:1605–1620. https://doi.org/10.1111/eva.13350 El-Saadony MT, Saad AM, Soliman SM, Salem HM, Ahmed AI, Mahmood M, El-Tahan AM, Ebrahim AAM, Abd El-Mageed TA, Negm SH, Selim S, Babalghith AO, Elrys AS, El-Tarabily KA, AbuQamar SF (2022) Plant growth-promoting microorganisms as biocontrol agents of plant diseases: mechanisms, challenges and future perspectives. Front Plant Sci 13:923880. https://doi.org/10.3389/fpls.2022.923880 Eriksson D, Carlson-Nilsson U, Ortíz R., Andreasson E (2016) Overview and breeding strategies of table potato production in Sweden and the Fennoscandian region. Potato Res 59:279–294. https://doi.org/10.1007/s11540-016-9328-6 Grönberg L, Andersson B, Yuen JE (2012) Can weed hosts increase aggressiveness of Phytophthora infestans on potato? Phytopathol 102:429–433. https://doi.org/10.1094/PHYTO-12-11-0326 Hashemi M, Tabet D, Sandroni M, Benavent-Celma C, Seematti J, Andersen CB, Grenville-Briggs LJ (2022) The hunt for sustainable biocontrol of oomycete plant pathogens, a case study of Phytophthora infestans . Fungal Biol Rev 40:53–69. https://doi.org/10.1016/j.fbr.2021.11.003 Hinz HL, Winston RL, Schwarzländer M (2019) How safe is weed biological control? A global review of direct nontarget attack. Q Rev Biol 94:1. https://doi.org/10.1086/702340 IBM SPSS Statistics for Windows (2022) SPSS (29.0). IBM Corp. Indira Devi P, Manjula M, Bhavani RV (2022) Agrochemicals, environment, and human health. Annu Rev Environ Resour 47:399–421. https://doi.org/10.1146/annurev-environ-120920 Kapsa JS (2008) Important threats in potato production and integrated pathogen/pest management. Potato Res 51:385–401. https://doi.org/10.1007/s11540-008-9114-1 Karlsson Green K, Stenberg JA, Lankinen Å (2020) Making sense of integrated pest management (IPM) in the light of evolution. Evol Appl 13:1791–1805. https://doi.org/10.1111/eva.13067 Ke J, Wang B, Yoshikuni Y (2021) Synthetic biology of plant-associated microbiomes in sustainable agriculture. Trends Biotechnol 39:244–261). https://doi.org/10.1016/j.tibtech.2020.07.008 Keswani C, Prakash O, Bharti N, Vílchez JI, Sansinenea E, Lally RD, Borriss R, Singh SP, Gupta VK, Fraceto LF, de Lima R, Singh HB (2019) Re-addressing the biosafety issues of plant growth promoting rhizobacteria. Sci Total Environ 690:841–852. https://doi.org/10.1016/j.scitotenv.2019.07.046 Kong F, Yang L (2023) Pathogen-triggered changes in plant development: virulence strategies or host defense mechanism? Front Microbiol 14:1122947. https://doi.org/10.3389/fmicb.2023.1122947 Kumar S, Bhowmick MK, Ray P (2021) Weeds as alternate and alternative hosts of crop pests. Indian Journal of Weed Science 53:14–29. https://doi.org/10.5958/0974-8164.2021.00002.2 Kumar S, Singh R, Kashyap PL, Srivastava AK (2013) Rapid detection and quantification of Alternaria solani in tomato. Sci Hortic 151:184–189. https://doi.org/10.1016/j.scienta.2012.12.026 Landschoot S, Carrette J, Vandecasteele M, De Baets B, Höfte M, Audenaert K, Haesaert G (2017) Boscalid-resistance in Alternaria alternata and Alternaria solani populations: an emerging problem in Europe. Crop Prot 92:49–59. https://doi.org/10.1016/j.cropro.2016.10.011 Lankinen Å, Abreha KB, Alexandersson E, Andersson S, Andreasson E (2016) Nongenetic inheritance of induced resistance in a wild annual plant. Phytopathol 106:877–883. https://doi.org/10.1094/PHYTO-10-15-0278-R Lankinen Å, Witzell J, Aleklett K, Furenhed S, Karlsson Green K, Latz M, Liljeroth E, Larsson R, Löfkvist K, Meijer J, Menkis A, Ninkovic V, Olson Å, Grenville-Briggs L (2024) Challenges and opportunities for increasing the use of low-risk plant protection products in sustainable production. A review. Agron Sustain Dev 44:21. https://doi.org/10.1007/s13593-024-00957-5 Leiminger JH, Hausladen H (2012) Early blight control in potato using disease-orientated threshold values. Plant Dis 96:124–130. https://doi.org/10.1094/PDIS-05-11-0431 Lovat C., Nassar, AMK, Kubow S, Li, XQ, Donnelly DJ (2016) Metabolic biosynthesis of potato ( Solanum tuberosum l.) antioxidants and implications for human health. Crit Rev Food Sci Nutr 56:2278–2303. https://doi.org/10.1080/10408398.2013.830208 Masini L, Grenville-Briggs LJ, Andreasson E, Råberg L, Lankinen Å (2019) Tolerance and overcompensation to infection by Phytophthora infestans in the wild perennial climber Solanum dulcamara . Ecol Evol 9:4557–4567. https://doi.org/10.1002/ece3.5057 Matyjaszczyk E (2018) “Biorationals” in integrated pest management strategies. J Plant Dis Prot 125:523–527. https://doi.org/10.1007/s41348-018-0180-6 Mostafanezhad H, Edin E, Grenville-Briggs LJ, Lankinen Å, Liljeroth E (2022) Rapid emergence of boscalid resistance in Swedish populations of Alternaria solani revealed by a combination of field and laboratory experiments. Eur J Plant Pathol 162:289–303. https://doi.org/10.1007/s10658-021-02403-8 Odilbekov F, Carlson-Nilsson U, Liljeroth E (2014) Phenotyping early blight resistance in potato cultivars and breeding clones. Euphytica 197:87–97. https://doi.org/10.1007/s10681-013-1054-4 Odilbekov F, Edin E, Mostafanezhad H, Coolman H, Grenville-Briggs LJ, Liljeroth E (2019) Within-season changes in Alternaria solani populations in potato in response to fungicide application strategies. Eur J Plant Pathol 155:953–965. https://doi.org/10.1007/s10658-019-01826-8 Odilbekov F, Selga C, Ortiz R, Chawade A, Liljeroth E (2020) QTL mapping for resistance to early blight in a tetraploid potato population. Agronomy 10:728. https://doi.org/10.3390/agronomy10050728 Rabiey M, Ullah I, Shaw LJ, Shaw MW (2017) Potential ecological effects of Piriformospora indica , a possible biocontrol agent, in UK agricultural systems. Biological Control 104:1–9. https://doi.org/10.1016/j.biocontrol.2016.10.005 Ray P, Guo Y, Kolape J, Craven KD (2018) Non-targeted colonization by the endomycorrhizal fungus, Serendipita vermifera , in three weeds typically co-occurring with switchgrass. Front Plant Sci 8:2236. https://doi.org/10.3389/fpls.2017.02236 SCB (2022) Pesticides in agriculture and horticulture 2021. Use on crops. Statistiska meddelanden MI 31 SM 2202, Statistiska Centralbyrån, Sweden. https://www.scb.se/contentassets/6e042f0902bb449fb15edc4c1eb8e22c/mi0502_2021i20_br_mi31br2202.pdf. Accessed 2 December 2024. Schmidt J, Dotson BR, Schmiderer L, van Tour A, Kumar B, Marttila S, Fredlund KM, Widell S, Rasmusson AG (2020) Substrate and plant genotype strongly influence the growth and gene expression response to Trichoderma afroharzianum T22 in sugar beet. Plants 9:1–14. https://doi.org/10.3390/plants9081005 Shahin EA Shepard JF (1979) An efficient technique for inducing profuse sporulation of Alternaria species. Phytopathol 69:618–620. Simberloff D, Stiling P (1996) How risky is biological control? Ecol 77:1965–1974. https://doi.org/10.2307/2265693 Stenberg JA (2017) A conceptual framework for integrated pest management. Trends Plant Sci 22:759–769. https://doi.org/10.1016/j.tplants.2017.06.010 Stridh LJ, Mostafanezhad H, Andersen CB, Odilbekov F, Grenville-Briggs L, Lankinen Å, Liljeroth E (2022) Reduced efficacy of biocontrol agents and plant resistance inducers against potato early blight from greenhouse to field. J Plant Dis Prot 129:923–938. https://doi.org/10.1007/s41348-022-00633-4 Susi H (2024) Alternative host shapes transmission and life-history trait correlations in a multi-host plant pathogen. Evol Appl 17:e13672. https://doi.org/10.1111/eva.13672 Syed S, Prasad Tollamadugu NVKV (2019) Role of plant growth-promoting microorganisms as a tool for environmental sustainability. In: Buddolla V (ed) Recent Developments in Applied Microbiology and Biochemistry. Elsevier, pp. 209–222. https://doi.org/10.1016/B978-0-12-816328-3.00016-7 Taab A (2021) Solanum nigrum and Solanum physalifolium . In: Bhagirath Singh Chauhan (ed) Biology and Management of Problematic Crop Weed Species, 1st edn. Elsevier pp 357–373. https://doi.org/10.1016/B978-0-12-822917-0.00005-7 Vetukuri RR, Masini L, McDougal R, Panda P, de Zinger L, Brus-Szkalej M, Lankinen Å, Grenville-Briggs LJ (2020) The presence of Phytophthora infestans in the rhizosphere of a wild Solanum species may contribute to off-season survival and pathogenicity. Appl Soil Ecol 148:103475 https://doi.org/10.1016/j.apsoil.2019.103475 Supplementary Files Wildbiocontrolsupplementaryinformationfinal.docx Online Resource 1 - Confirmation of Alternaria solani infection in the wild species Solanum dulcamara and S. nigrum through PCR Cite Share Download PDF Status: Published Journal Publication published 05 Sep, 2025 Read the published version in Potato Research → Version 1 posted Reviewers agreed at journal 15 Jan, 2025 Reviewers invited by journal 19 Dec, 2024 Editor invited by journal 18 Dec, 2024 Editor assigned by journal 18 Dec, 2024 First submitted to journal 16 Dec, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5655317","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":392363649,"identity":"bab35592-dfed-4f52-a80e-e13cf4336327","order_by":0,"name":"Åsa Lankinen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3UlEQVRIiWNgGAWjYLCCBwwMBmwgxgcGCyK1JEC1MM5gkCBBC4hm5iFGC3//4QcMCTV3jPmkm489tvkjkdjAf/gAXi0SN9IMGBKOPTNjkzmWbpzbBtQikZaA35obQDclsB22YZPIMZPObQBp4THAq0P+/PEPDAn/QFryv0lbgB12/gNeLQYHcgwYEtsOmwFtYZNmYANqYcjB7y7DGzkFBxL7DhuzSaSZSfa2SRi3SaThd5jc+eMbH3z4dthw/ozkZxI//tjI9vMDw5AQOIDCYyOofhSMglEwCkYBQQAA5kNCLnwTFTEAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-0850-4081","institution":"Swedish University of Agricultural Sciences: Sveriges lantbruksuniversitet","correspondingAuthor":true,"prefix":"","firstName":"Åsa","middleName":"","lastName":"Lankinen","suffix":""},{"id":392363650,"identity":"a288d1b0-5bf1-4059-adb6-e266a286de31","order_by":1,"name":"Christian B. Andersen","email":"","orcid":"","institution":"Carlsberg Research Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Christian","middleName":"B.","lastName":"Andersen","suffix":""},{"id":392363651,"identity":"f80e018b-539c-4d05-bc68-8140eebec008","order_by":2,"name":"Hadis Mostafanezhad","email":"","orcid":"","institution":"University of Gothenburg: Goteborgs Universitet","correspondingAuthor":false,"prefix":"","firstName":"Hadis","middleName":"","lastName":"Mostafanezhad","suffix":""},{"id":392363652,"identity":"283fab64-6c08-4d04-9f37-f76c259e72c9","order_by":3,"name":"Chiara De Pasqual","email":"","orcid":"","institution":"Swedish University of Agricultural Sciences: Sveriges lantbruksuniversitet","correspondingAuthor":false,"prefix":"","firstName":"Chiara","middleName":"","lastName":"De Pasqual","suffix":""},{"id":392363653,"identity":"784aca5a-c3fe-4a8c-9c82-6ce1be33e74b","order_by":4,"name":"Veronica Hederström","email":"","orcid":"","institution":"Lund University: Lunds Universitet","correspondingAuthor":false,"prefix":"","firstName":"Veronica","middleName":"","lastName":"Hederström","suffix":""},{"id":392363654,"identity":"d473e361-c9a9-4036-b2aa-3d576f155719","order_by":5,"name":"Linnea J. Stridh","email":"","orcid":"","institution":"Swedish University of Agricultural Sciences: Sveriges lantbruksuniversitet","correspondingAuthor":false,"prefix":"","firstName":"Linnea","middleName":"J.","lastName":"Stridh","suffix":""},{"id":392363655,"identity":"f6177aed-52c6-49e1-8dce-60bb9b73b9d6","order_by":6,"name":"Erland Liljeroth","email":"","orcid":"","institution":"Swedish University of Agricultural Sciences: Sveriges lantbruksuniversitet","correspondingAuthor":false,"prefix":"","firstName":"Erland","middleName":"","lastName":"Liljeroth","suffix":""},{"id":392363656,"identity":"683b1bc5-2351-4bd0-9285-aab4e5cde663","order_by":7,"name":"Laura Grenville-Briggs","email":"","orcid":"","institution":"Swedish University of Agricultural Sciences: Sveriges lantbruksuniversitet","correspondingAuthor":false,"prefix":"","firstName":"Laura","middleName":"","lastName":"Grenville-Briggs","suffix":""}],"badges":[],"createdAt":"2024-12-16 15:54:39","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5655317/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5655317/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11540-025-09905-6","type":"published","date":"2025-09-05T15:57:41+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":72154576,"identity":"3d5cc98c-7c9c-45b6-8703-fcefcd34e38f","added_by":"auto","created_at":"2024-12-23 08:50:53","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":172195,"visible":true,"origin":"","legend":"\u003cp\u003eOverview of greenhouse experiments and field trial to study the interaction between wild \u003cem\u003eSolanum\u003c/em\u003especies, the pathogen \u003cem\u003eA. solani\u003c/em\u003e and biocontrol agents on infection and plant performance. Two batches of \u003cem\u003eS. dulcamara\u003c/em\u003e were used with an age difference of two weeks. N = number\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5655317/v1/331d369532879a21b3db1db4.jpeg"},{"id":72154574,"identity":"6f0f6d2e-f399-4047-8bb4-e4205f84b512","added_by":"auto","created_at":"2024-12-23 08:50:53","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":120510,"visible":true,"origin":"","legend":"\u003cp\u003eDesign of small field trial at Campus SLU in Alnarp in 2019 (37 m × 2.5 m). The three wild \u003cem\u003eSolanum \u003c/em\u003especies and a starch potato cultivar (Kuras) were grown in their own individual plots. The \u003cem\u003eS. dulcamara \u003c/em\u003eplot was established in 2016 and plants were arranged in six blocks. Between these blocks three plants of the other species (gray circle = potato, white circle = \u003cem\u003eS. nigrum\u003c/em\u003e and black circle = \u003cem\u003eS. physalifolium\u003c/em\u003e) were planted to allow more immediate comparison. In half of the field \u003cem\u003eA. solani\u003c/em\u003e was spread by dispersing infected kernels to the soil. The other half of the field served as control. In both areas of all species, six selected plants were treated with the biocontrol agent \u003cem\u003eP. oligandrum\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5655317/v1/9c817ca11f9b1cf5238dbc2c.jpeg"},{"id":72156991,"identity":"8b42bb89-dd99-4b9c-b4f7-1a48f32e230d","added_by":"auto","created_at":"2024-12-23 09:06:53","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":82467,"visible":true,"origin":"","legend":"\u003cp\u003eBox plots for lesion area following inoculation with \u003cem\u003eA. solani\u003c/em\u003e in a) Experiment 1 and b) Experiment 2 in the greenhouse. In Experiment 1, the biocontrol agent \u003cem\u003eP. oligandrum \u003c/em\u003e(gray bars) was compared to control (white bars) across three wild \u003cem\u003eSolanum\u003c/em\u003especies. In Experiment 2, the biocontrol agent \u003cem\u003eB. amyloliquefaciens\u003c/em\u003ewas tested against control on three \u003cem\u003eS. nigrum\u003c/em\u003e genotypes. In Experiment 1 we used \u003cem\u003eA. solani\u003c/em\u003e isolate AS112. In Experiment 2, we used isolates AS112 (white bars) and ASH4 (gray bars). Different letters indicate a significant (P \u0026lt; 0.05) difference. dpi = days post infection\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5655317/v1/39366f6be48ff7d77b48cca9.jpeg"},{"id":72154581,"identity":"6662f2f8-cd67-43dc-baf5-6859f91997fe","added_by":"auto","created_at":"2024-12-23 08:50:53","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":136269,"visible":true,"origin":"","legend":"\u003cp\u003ePlant performance traits measured in a-c) three \u003cem\u003eS. dulcamara \u003c/em\u003egenotypes\u003cem\u003e,\u003c/em\u003e d-i) three \u003cem\u003eS. nigrum\u003c/em\u003e genotypes, and j-l) two \u003cem\u003eS. physalifolium \u003c/em\u003egenotypes treated with a biocontrol agent or control in the greenhouse Experiment 1-2. The biocontrol agent \u003cem\u003eP. oligandrum \u003c/em\u003ewas tested on all species, while the biocontrol agent \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e was tested only on \u003cem\u003eS. nigrum\u003c/em\u003e. Plant size in \u003cem\u003eS. dulcamara\u003c/em\u003e was estimated as length of all shoots, and in \u003cem\u003eS. nigrum\u003c/em\u003e and \u003cem\u003eS. physalifolium \u003c/em\u003eas plant height. G = effect of genotype, T = effect of treatment, G×T = effect of genotype by treatment interaction, * P \u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5655317/v1/a400acaa7674fc8b11803ca1.jpeg"},{"id":72154582,"identity":"8e179dc3-7bdc-4fa1-a3b6-bfc2729a8f31","added_by":"auto","created_at":"2024-12-23 08:50:53","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":187749,"visible":true,"origin":"","legend":"\u003cp\u003eLeaves of a) \u003cem\u003eS. dulcamara\u003c/em\u003e, b) \u003cem\u003eS. nigrum\u003c/em\u003e and c) \u003cem\u003eS. physalifolium\u003c/em\u003e with lesions following infection by \u003cem\u003eA. solani\u003c/em\u003e in a field trial at Campus Alnarp, Sweden\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5655317/v1/733ee0c18774a6fbccd2f12e.jpeg"},{"id":72154585,"identity":"842fcb7c-c9e6-4550-9fe4-2a9f7f407dcf","added_by":"auto","created_at":"2024-12-23 08:50:53","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":36466,"visible":true,"origin":"","legend":"\u003cp\u003eBoxplot for percentage of infected leaf area by \u003cem\u003eA. solani\u003c/em\u003e in three wild \u003cem\u003eSolanum\u003c/em\u003e species – \u003cem\u003eS. dulcamara\u003c/em\u003e, \u003cem\u003eS. nigrum\u003c/em\u003e and \u003cem\u003eS. physalifolium \u003c/em\u003e– and the potato (\u003cem\u003eS. tuberosum\u003c/em\u003e) cultivar Kuras in a field trial at Campus Alnarp, Sweden (plants grown in different places were pooled) at three occasions between 21\u003csup\u003est\u003c/sup\u003e of August to 24\u003csup\u003eth\u003c/sup\u003e of September. Different letters indicate a significant (P \u0026lt; 0.05) difference. N = number of plants\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5655317/v1/64ed0541c6545e1beffe8e28.jpeg"},{"id":90827973,"identity":"28a6393d-279b-424c-a549-f1fb34377ddf","added_by":"auto","created_at":"2025-09-08 16:04:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2755880,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5655317/v1/97017b4d-6d84-461b-be7e-cdb366e56a35.pdf"},{"id":72156739,"identity":"304101f4-7733-484c-b6a1-9afebbdb0086","added_by":"auto","created_at":"2024-12-23 08:58:53","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":583634,"visible":true,"origin":"","legend":"\u003cp\u003eOnline Resource 1 - Confirmation of \u003cem\u003eAlternaria solani \u003c/em\u003einfection in the wild species \u003cem\u003eSolanum dulcamara\u003c/em\u003e and \u003cem\u003eS. nigrum\u003c/em\u003e through PCR\u003c/p\u003e","description":"","filename":"Wildbiocontrolsupplementaryinformationfinal.docx","url":"https://assets-eu.researchsquare.com/files/rs-5655317/v1/d9c933fbe75cd985f4b43aa8.docx"}],"financialInterests":"","formattedTitle":"Early blight infection and the influence of biocontrol agents on wild potato relatives: Implications for integrated pest management (IPM) in potato","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIn recent decades, it has become clear that our cultivation systems need to develop more sustainably, in particular to reduce the frequent use of agrochemicals (Aktar et al. 2009; Indira Devi et al. 2022). One solution is to implement Integrated Pest Management (IPM), which is mandatory within the EU (Directive 2009/128/EC, EC 2009). In IPM programs, a combination of alternative management methods is used first, and then pesticides as the last resort to combat pests and diseases (Barzman et al. 2015). Alternative pest management methods range from preventive methods, e.g. mechanical and cultural control, to ecologically based methods, e.g. using resistant cultivars, enhanced biological diversity, low-risk plant protection products and biological control agents (BCAs) (Stenberg 2017). BCAs are commonly defined as living organisms with a direct or indirect effect on the pest (Stenberg et al. 2021). BCAs may also have the added function of biostimulation such as growth promotion by improving the uptake of nutrients in the plant, or by regulation via phytohormones (Calvo et al. 2014; El-Saadony et al. 2022). While there is an increasing interest in the use of IPM, current problems involve e.g., a lack of knowledge about the efficacy of alternative methods, how and when they should be combined or applied, estimations of economic thresholds in various cultivation systems and a lack of knowledge about the general link between IPM, management, business and sustainability (; Matyjaszczyk 2018); Dara 2019; Karlsson Green et al. 2020; Deguine et al. 2021; Lankinen et al. 2024.\u003c/p\u003e \u003cp\u003eWhile alternative pest management methods in general do not pose the same risks for humans and non-target organisms as synthetic pesticides, evaluations of these methods, such as the use of BCAs, should not only study their efficacy but also consider environmental impacts (Simberloff and Stiling 1996; Collinge et al. 2022; Hashemi et al. 2022). For example, environmental risks of a BCA could be that it may spread, persist for a long time, become a pathogen, produce toxins or antibiotics, have a negative side effect on non-target species or that the pest will evolve to tolerate the BCA (Keswani et al. 2019; Ke et al. 2021; Bardin and Siegwart 2022; Collinge et al. 2022). Another potential risk, that has received less attention, is the influence of alternative methods on wild plants growing in or next to the agricultural field (e.g. weeds). Such risks are considered when testing weed biocontrol (Hinz et al. 2019), but is seldom taken into consideration for pest biocontrol. In the case that a BCA also has a growth promoting effect, this may lead to an increased weed problem if applied on weeds present in an agricultural field (Rabiey et al. 2017; Ray et al. 2018). On the other hand, a BCA may also control pests and diseases on wild crop relatives, which may reduce their spread and severity.\u003c/p\u003e \u003cp\u003ePotato is the fourth most important crop worldwide (Lovat et al. 2016), but because it suffers from many diseases including potato late blight, it is also one of the most sprayed (Hashemi et al. 2022). For example, in Sweden in 2013 potato was grown on 0.9 percent of the cultivated land, but used 21 percent of the total fungicides (Eriksson et al. 2016). Despite a reduction in the use of fungicides in potato in Sweden from 52 to 40 tones per hectar between 2017 to 2021, the percent of the total fungicides used in potato was still high (26% in 2021) (SCB 2022), While potato late blight is one of the most serious diseases, in recent years early blight has increased in Europe with identified yield losses of up to 50% (Leiminger and Hausladen 2012; Odilbekov et al. 2014). This increase is believed to be partly caused by a change in the climate and partly caused by rapid resistance development to fungicides by \u003cem\u003eAlternaria solani\u003c/em\u003e, the causal agent of early blight (Kapsa 2008; Landschoot et al. 2017; Einspanier et al. 2022; Mostafanezhad et al. 2022). The resistance development to fungicides in \u003cem\u003eA. solani\u003c/em\u003e is particularly worrying, as this may lead to a lack of any available fungicide for treatment of severe early blight. Adopting IPM in potato cultivation is therefore crucial. Currently, using BCAs as part of an IPM strategy in potato to control early blight or for growth promotion is gaining increasing interest despite challenges in large scale fields (Andersen 2023; Stridh et al. 2022). For example, BCAs approved to be used against early blight within the EU include the oomycete \u003cem\u003ePythium oligandrum\u003c/em\u003e (commercial product Polygandron\u0026reg;) and the bacterium \u003cem\u003eBacillus amyloliquefaciens\u003c/em\u003e (formerly \u003cem\u003esubtilis\u003c/em\u003e) (commercial product Serenade\u0026reg;) (EC 2024). Both these BCAs have been shown to have growth promoting effects in potato (Syed and Prasad Tollamadugu 2019; Andersen et al. 2024). The growth promoting effect of \u003cem\u003eP. oligandrum\u003c/em\u003e in potato is genotype specific (Andersen et al. 2024). However, we still lack knowledge about the environmental risks associated with the use of these BCAs in potato cultivation in relation to wild relatives.\u003c/p\u003e \u003cp\u003eIn the current study, we focus on the environmental risks of using BCAs in relation to potential effects on wild hosts of \u003cem\u003eA. solani\u003c/em\u003e in Sweden, including three wild \u003cem\u003eSolanum\u003c/em\u003e species - the annual weeds \u003cem\u003eS. nigrum\u003c/em\u003e and \u003cem\u003eS. physalifolium\u003c/em\u003e(Taab 2021) and the perennial climber \u003cem\u003eS. dulcamara\u003c/em\u003e. The annual weeds are commonly found in potato fields. The perennial species can grow close to agricultural fields, e.g. in wetlands or small streams. These species are known hosts of \u003cem\u003ePhytophthora infestans\u003c/em\u003e, the causal agent of late blight (Abreha et al. 2018). Surprisingly, we are not aware of any studies identifying infection of \u003cem\u003eA. solani\u003c/em\u003e in these species, even though there appears to be semantic knowledge that this occurs. We studied early blight infection in these three wild potato relatives in the greenhouse, in a small-scale field trial and investigated the presence of natural early blight infections in the annual wild species growing in potato fields. We also studied the potential benefits and risks of using two BCAs. We focused on the questions:\u003c/p\u003e \u003cp\u003e \u003cul\u003e \u003cli\u003e \u003cp\u003eCan the three studied wild \u003cem\u003eSolanum\u003c/em\u003e species host \u003cem\u003eA. solani\u003c/em\u003e?\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eDo BCAs (\u003cem\u003eP. oligandrum\u003c/em\u003e and \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e) reduce \u003cem\u003eA. solani\u003c/em\u003e infection in wild \u003cem\u003eSolanum\u003c/em\u003e species?\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eAre BCAs causing growth promotion in wild \u003cem\u003eSolanum\u003c/em\u003e species, and do these effects differ between plant genotypes or vary with timing of application?\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eWe performed two greenhouse experiments (Experiment 1 and 2) and a small-scale field trial to investigate the interactions between the three wild \u003cem\u003eSolanum\u003c/em\u003e species, the pathogen \u003cem\u003eA. solani\u003c/em\u003e, and the potential effects of the biocontrol agents \u003cem\u003eP. oligandrum\u003c/em\u003e and \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e on disease suppression and on plant performance (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlant material\u003c/h2\u003e \u003cp\u003eWe used three \u003cem\u003eS. dulcamara\u003c/em\u003e genotypes in both the greenhouse and field trial. The genotypes were collected as seeds in two nearby wild populations (one genotype from population Lomma 2 (L2:3.6), a coastal forest in Lomma and two genotypes from population Geneticum (G20:1 and G21:1), an urban parking space outside the Genetics Department at Lund University) (Masini et al. 2019). \u003cem\u003eS. dulcamara\u003c/em\u003e in the greenhouse (Experiment 1) was grown from seeds collected from the three genotypes in a field plot established with micro-propagated clones in 2016 at Campus Alnarp, Swedish University of Agricultural Sciences (SLU) in Lomma, south Sweden (Masini et al. 2019). The field plot of this perennial plant was used in the field trial of the current study.\u003c/p\u003e \u003cp\u003eWe used five \u003cem\u003eS. nigrum\u003c/em\u003e genotypes collected at five sites in Sk\u0026aring;ne, of which three were used in the greenhouse (greenhouse Experiment 1\u0026ndash;2 and field: Lillg\u0026aring;rda, L\u0026ouml;derup farm field (Nr 2 L), Stockholmsg\u0026aring;rden, Valleberga farm field (Nr 6 T), see Lankinen et al (Lankinen et al. 2016) for coordinates of close by \u003cem\u003eS. physalifolium\u003c/em\u003e sites; only Experiment 2: Helgeg\u0026aring;rden, Kristianstad field trial (He E, coordinates N56.02404, E14.06913); only field: Simrishamn ruderal land, Alnarp farm field, (Abreha et al. 2018)). For \u003cem\u003eS. physalifolium\u003c/em\u003e, we used four genotypes collected at two ruderal sites in Sk\u0026aring;ne. Two of these were used in both greenhouse and field trials (Borgeby (Nr 1 B), Spillepengen, Malm\u0026ouml; (Nr 5 S)), and another two genotypes were used only in the field (Spillepengen, Malm\u0026ouml;, Abreha et al. 2018, note that the coordinates for Borgeby is given as a \u003cem\u003eS. nigrum\u003c/em\u003e site). Seeds from all wild species were germinated using the method described in Lankinen et al. (2016).\u003c/p\u003e \u003cp\u003eWe used commercial tubers of the starch potato cultivar Kuras (a commonly used cultivar in Sweden) as a control to promote \u003cem\u003eA. solani\u003c/em\u003e infection in a known host in the field trial. In a parallel study, we tested induction of growth promotion by \u003cem\u003eP. oligandrum\u003c/em\u003e in these potato plants (Andersen et al. 2024).\u003c/p\u003e \u003cp\u003e \u003cb\u003ePreparation of\u003c/b\u003e \u003cb\u003eAlternaria solani\u003c/b\u003e \u003cb\u003einoculum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe used the \u003cem\u003eA. solani\u003c/em\u003e strain AS112 (isolated from a potato field in south Sweden and used in previous studies (Odilbekov et al., 2019; Stridh et al., 2022; Andersen, 2023) in all experiments. In Experiment 2 in the greenhouse, we also used another strain isolated from \u003cem\u003eS. nigrum\u003c/em\u003e in Helgeg\u0026aring;rden 2019 (strain ASH4).\u003c/p\u003e \u003cp\u003eExperiment 1\u003c/p\u003e \u003cp\u003ePreparation of spore inoculum of \u003cem\u003eA. solani\u003c/em\u003e for greenhouse Experiment 1 was performed following the Shahin and Shepard (Shahin and Shepard 1979) protocol. Briefly, ~\u0026thinsp;254 mm\u003csup\u003e2\u003c/sup\u003e agar blocks from 20% PDA (Potato Dextrose Agar) plate containing dark growth \u003cem\u003eA. solani\u003c/em\u003e were placed growth-down in new plates with S-medium and incubated in the dark at 18\u0026deg;C for 5\u0026ndash;7 days. The S-medium was composed of 10 g sucrose, 15 g CaCO3 and 500 mL milliQ water, adjusted to 7.4 pH. Once 10 g of Bacto Agar was added, and the medium was autoclaved. Spores were collected by flooding the plate with 10 mL autoclaved tap water amended with 0.01% (v/v) Tween-20 and gently scraped the surface of the plate with a sterile spatula. A second S-medium plate with conidia was flooded with the 10 mL suspension from the first plate and the surface was gently scraped with a sterile spatula. The suspension was collected and spores were counted using a Fuchs-Rosenthal counter chamber. The final spore concentration was adjusted to 25000 spore mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, supplemented with 0.1% Bacto Agar and MilliQ water with a final volume of 25 mL.\u003c/p\u003e \u003cp\u003eExperiment 2 and the field trial\u003c/p\u003e \u003cp\u003ePreparation of spore inoculum of \u003cem\u003eA. solani\u003c/em\u003e for the greenhouse Experiment 2 and the field trials was done following Stridh et al. (2022), with minor modification. Briefly, \u003cem\u003eA. solani\u003c/em\u003e pure cultures were grown on 20% PDA media plates supplemented with 12 g L-1 Bacto Agar in the dark for 7 days at 25\u0026deg;C. The plates were then exposed to UV-c light (254 nm dominant wavelength) for 7 days (5\u0026ndash;6 hour per day). The plates were flooded with 1 mL of MilliQ water amended with 0.01% (v/v) Tween 20 and the spores were dislodged using a sterile L-shaped cell spreader. The final concentration of the spore suspension was adjusted to 10\u003csup\u003e4\u003c/sup\u003e spore mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e using a Fuchs-Rosenthal counter chamber and supplemented with 0.1% Bacto Agar.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePreparation of biocontrol agents\u003c/h3\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePythium oligandrum\u003c/h2\u003e \u003cp\u003eTo produce the oospore inoculum from \u003cem\u003eP. oligandrum\u003c/em\u003e (CBS-strain 530.74), one agar plug of \u003cem\u003eP. oligandrum\u003c/em\u003e was inoculated on solid V8 agar plates and allowed to completely overgrow the plates for approximately 5 days at 20℃. Five agar plugs from the solid \u003cem\u003eP. oligandrum\u003c/em\u003e cultures were inoculated into each of six 1L bluecap bottles, each containing 300 mL of clarified V8 broth. The bottles were put into a rotary incubator, shaking at 120 rpm at 20℃ for seven days. To harvest the oospores from the liquid cultures, the mycelium was macerated using a high-speed blender and 200 mL of sterile water was amended. The inoculum was then filtered through cheesecloth and a final concentration of 2.5\u0026times;10\u003csup\u003e4\u003c/sup\u003e oospore/mL, resuspended in sterile water, was used in all treatments.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eBacillus amyloliquefaciens\u003c/h3\u003e\n\u003cp\u003eFor the biocontrol agent \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e (formerly \u003cem\u003esubtilis\u003c/em\u003e) we used Serenade\u0026reg; ASO from Bayer Crop Science containing strain QST 713 with a minimum of 1.05 x 10\u003csup\u003e12\u003c/sup\u003e cfu L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. A solution of Serenade\u0026reg; was prepared by diluting 12.5 mL of Serenade\u0026reg; in tap water with a final concentration of 0.5% Serenade\u0026reg;.\u003c/p\u003e \u003cp\u003eGreenhouse experiments\u003c/p\u003e \u003cp\u003eIn both experiments we transferred germinated seeds to soil, and cultivated plants in a greenhouse with 16 h light at an approximate temperature of 22\u0026deg;C. We repotted plants in larger pots as they grew. We used unfertilized potting compost (peat with 10% clay and 2% calcium) and the final size of the pots was 1.5 L. In both experiments, plants were moved around weekly to avoid boarder effects. Plants in Experiment 1 were watered twice with extra nutrients.\u003c/p\u003e \u003cp\u003eGreenhouse Experiment 1 \u0026ndash; three wild species and biocontrol agent \u003cem\u003eP. oligandrum\u003c/em\u003e\u003c/p\u003e \u003cp\u003e15\u0026ndash;24 plants per genotype of the three species were randomly divided into two groups where one was treated with \u003cem\u003eP. oligandrum\u003c/em\u003e and the other served as control. For \u003cem\u003eS. dulcamara\u003c/em\u003e we used two batches of plants, where the second batch was grown from seeds ca two weeks after the first batch (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This allowed to test how developmental age affected interactions with the biocontrol agent. Plants treated with \u003cem\u003eP. oligandrum\u003c/em\u003e were sprayed with spores twice with one week apart at about the age of 2.5 months (annual plants had started flowering) (second set of \u003cem\u003eS. dulcamara\u003c/em\u003e 2 months). Both treatments consisted of 10 ml oospore inoculum applied as foliar spray with a high-pressure handheld sprayer. At the first spraying time, a soil drench using additional 10 ml of \u003cem\u003eP. oligandrum\u003c/em\u003e was also conducted in all treated \u003cem\u003eS. dulcamara\u003c/em\u003e plants. At the second spraying time, a soil drench was applied to all treated plants. Control plants were treated with sterile water of the same volume.\u003c/p\u003e \u003cp\u003eFive days after the second spraying with \u003cem\u003eP. oligandrum\u003c/em\u003e, we selected 12 plants (6 treated with \u003cem\u003eP. oligandrum\u003c/em\u003e and 6 control) of one genotype from the two annual species and two genotypes from \u003cem\u003eS. dulcamara\u003c/em\u003e, respectively, for the inoculation experiment with \u003cem\u003eA. solani\u003c/em\u003e. We inoculated 6 plants per genotype (3 treated with \u003cem\u003eP. oligandrum\u003c/em\u003e and 3 control).\u003c/p\u003e \u003cp\u003eGreenhouse Experiment 2 \u0026ndash; \u003cem\u003eS. nigrum\u003c/em\u003e and biocontrol agent \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e\u003c/p\u003e \u003cp\u003eWe selected \u003cem\u003eS. nigrum\u003c/em\u003e for Experiment 2 and added a third genotype, based on the fact that this species showed an interaction between genotype and biocontrol treatment in Experiment 1 (see Result section). 18\u0026ndash;24 plants per genotype of \u003cem\u003eS. nigrum\u003c/em\u003e were randomly distributed in four groups: i) treatment with biocontrol agent \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e, ii) treatment with \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e and infected with \u003cem\u003eA. solani\u003c/em\u003e, iii) infected with \u003cem\u003eA. solani\u003c/em\u003e and iv) control. For genotypes with fewer than 24 plants, six plants were still included in group ii) and iii), to allow infection by two isolates of \u003cem\u003eA. solani\u003c/em\u003e (three plants per isolate). Plants were sprayed with \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e at the age of 2.5 months, and at 9 and 2 days before inoculation with \u003cem\u003eA. solani\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eInoculation and disease scoring in the greenhouse\u003c/p\u003e \u003cp\u003eOn each inoculated plant of Experiment 1, we placed 2 droplets of 10 \u0026micro;l of \u003cem\u003eA. solani\u003c/em\u003e on either side of the central vein on seven young, fully expanded leaves. Two additional leaves of the same plant were mock-treated with 0.033% bacto agar control. In Experiment 2, inoculation was performed by placing 1 droplet of 10 \u0026micro;l of \u003cem\u003eA. solani\u003c/em\u003e on one side of the central vein on ten young, fully expanded leaves per plant. No leaves were mock-treated in this experiment, as we never detected any response on such leaves in Experiment 1 (see results). After inoculation, we placed a plastic tent over the plants to maintain high humidity (around 95%) during the first 24 h after inoculation. We then used a misting system within the chamber to stabilize relative humidity at 85%.\u003c/p\u003e \u003cp\u003eWe estimated disease development 9, 12 and 20 days after inoculation in Experiment 1, and after 7 and 10 days after inoculation in Experiment 2 by measuring the lesion area. Lesion area (LA) was measured as an oval area, using the equation LA\u0026thinsp;=\u0026thinsp;π/4 \u0026times; D1 \u0026times; D2, where D1 and D2 are two perpendicular diameters.\u003c/p\u003e \u003cp\u003eEstimates of plant performance in the greenhouse\u003c/p\u003e \u003cp\u003eTo investigate the effects of the biocontrol agents on plant performance, we measured plant performance traits before treatment with biocontrol agents and at the end of the experiment (at plant age of approximately 4 months). In Experiment 1, early performance was recorded as plant size. At the end of the experiment, we recorded final plant size, leaf area, number of flowers or berries, dry above ground biomass and dry root biomass.\u003c/p\u003e \u003cp\u003eEarly plant size was measured as total length of all shoots in \u003cem\u003eS. dulcamara\u003c/em\u003e (batch 1) and as length of the longest shoot (batch 1,2). Final plant size in \u003cem\u003eS. dulcamara\u003c/em\u003e (batch 1,2) was recorded as total length of all shoots. Early and final plant size were measured as plant height in \u003cem\u003eS. nigrum\u003c/em\u003e and \u003cem\u003eS. physalifolium\u003c/em\u003e. Leaf area was measured as the length multiplied by the width of three fully expanded leaves per plant. The number of flowers was counted in \u003cem\u003eS. dulcamara\u003c/em\u003e as an indication of reproductive effort as this outcrossing species did not set seeds in the greenhouse. In the annual, self-compatible species, we counted the number of berries. Plant biomass above ground was separated into green mass and fruit mass for \u003cem\u003eS. nigrum\u003c/em\u003e, as this species had a substantial number of fruits at the time of harvest. We hereafter refer to \u0026lsquo;green biomass\u0026rsquo; for all above ground biomass for \u003cem\u003eS. dulcamara\u003c/em\u003e and \u003cem\u003eS. physalifolium\u003c/em\u003e, and for \u003cem\u003eS. nigrum\u003c/em\u003e to the above ground measure separated from fruit biomass. Roots were rinsed to remove soil. Rinsing resulted in some loss of fine roots. Green biomass, fruit biomass and root biomass were weighed after drying for 24 h at a temperature of 60\u0026deg;C.\u003c/p\u003e\n\u003ch3\u003eField trial\u003c/h3\u003e\n\u003cp\u003eWe conducted the small field trial at Campus Alnarp in June to September 2019 to investigate the interaction between the three wild \u003cem\u003eSolanum\u003c/em\u003e species, and \u003cem\u003eA. solani\u003c/em\u003e and the biocontrol agent \u003cem\u003eP. oligandrum\u003c/em\u003e under field conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eEstablishment of plants and management of field trial\u003c/p\u003e \u003cp\u003eAt establishment of the perennial species \u003cem\u003eS. dulcamara\u003c/em\u003e in 2016, the three genotypes were randomly mixed and planted in six blocks (12\u0026ndash;14 plants per block, arranged in two rows along the length of the plot, i.e. one row in the control area and one row in the \u003cem\u003eA. solani\u003c/em\u003e area, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). In a previous study, that finished a year before the present work commenced, two thirds of the plants were treated with \u003cem\u003eP. infestans\u003c/em\u003e, but only showed week disease symptoms. All above ground plant material was removed at the end of each season. We could not detect any long-term treatment effects on survival (survival rate in early season 2019; inoculated: 94%, control: 96%, χ\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.001, df\u0026thinsp;=\u0026thinsp;1, P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) or on performance traits (shoot length, flower and fruit production late season 2018; P\u0026thinsp;\u0026gt;\u0026thinsp;0.53) (Lankinen unpublished data).\u003c/p\u003e \u003cp\u003eThe two annual species were planted out as seedlings when they reached ca 15 cm in height (at approximately four weeks old) on the 24th of June. Plants were arranged in 5 rows per species across the control and \u003cem\u003eA.solani\u003c/em\u003e treatment areas with 7 plants per row (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The four genotypes per species were planted randomly across rows.\u003c/p\u003e \u003cp\u003eCommercial potato tubers, cv. Kuras, were sown on the 7th of May 2019 in 10 rows with 6 plants per row (70 cm between rows, 30\u0026ndash;40 cm between plants) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Additionally, to get an immediate comparison between the four different species, we planted three plants (one per species of \u003cem\u003eS. nigrum\u003c/em\u003e, \u003cem\u003eS. physalifolium\u003c/em\u003e and potato) in the five areas between the existing \u003cem\u003eS. dulcamara\u003c/em\u003e blocks (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe field was fertilized with 100 kg N/ha at the beginning of July. See Andersen et al. (2024) for measurements of soil properties. Weeding and watering were performed when needed over the growing season.\u003c/p\u003e \u003cp\u003eField trial treatments\u003c/p\u003e \u003cp\u003e \u003cem\u003eAlternaria solani\u003c/em\u003e inoculum was spread as infected kernels in half of the field on the 31st of July using the method by Adolf and Hausladen (2015) to have a control area for treatments with the biocontrol agent \u003cem\u003eP. oligandrum\u003c/em\u003e. However, because of the narrow field, we expected that plants in both areas could be infected. To study the potential effects of \u003cem\u003eP. oligandrum\u003c/em\u003e on the infection and on plant performance, 12 plants per species were treated with \u003cem\u003eP. oligandrum\u003c/em\u003e (6 plants in the control area and 6 plants in area exposed to \u003cem\u003eA. solani\u003c/em\u003e kernels) five times during the season, starting at the beginning of July and ending at the beginning of September (8th and 25th of July, 6th and 19th of August, 3rd of September). 12 plants per species served as controls (6 per area). Plants were treated with the \u003cem\u003eP. oligandrum\u003c/em\u003e oospore inoculum in sterile water or with sterile water (control), both as foliar application and soil drenching as described above and in Andersen et al. (2024). We used a volume of 300 l/ha, corresponding to 200 ml per plant, following the recommendations for application of commercial products of \u003cem\u003eP. oligandrum.\u003c/em\u003e\u003c/p\u003e \u003cp\u003eDisease scoring in the field trial\u003c/p\u003e \u003cp\u003eDisease scoring of early blight was conducted three times from the middle of August to the middle of September (21st of August, 6-9th of September, 23-24th of September) using the method of Duarte et al. (Duarte et al., 2013) developed for potato. We identified infection as the percentage of green leaf area covered by typical dark early blight spots per individual plant. We also noted defoliation as the percentage of leaves that were dead or defoliated. Because infection levels were low\u0026thinsp;\u0026lt;\u0026thinsp;5%, we used the percentages per individual plant at the last estimation date for statistics rather than calculating the relative area under the disease progression curve (rAUDPC).\u003c/p\u003e \u003cp\u003eAdditionally, a spontaneous late blight infection (caused by naturally occurring \u003cem\u003eP. infestans\u003c/em\u003e) affected \u003cem\u003eS. physalifolium\u003c/em\u003e around the middle of August. Only minor signs of late blight symptoms were seen on the other species, which are known to be more resistant. We scored late blight infection in \u003cem\u003eS. physalifolium\u003c/em\u003e at one occasion (21st of August) as a percentage of infected leaves.\u003c/p\u003e \u003cp\u003eEstimates of plant performance in the field trial\u003c/p\u003e \u003cp\u003ePlant performance traits were measured three times between July and the middle of September (8th of July, 2-7th of August, 11-19th of September, including plant size, and number of flowers and berries. In \u003cem\u003eS. dulcamara\u003c/em\u003e plant size was estimated as total length of all shoots, and in \u003cem\u003eS. nigrum\u003c/em\u003e and \u003cem\u003eS. physalifolium\u003c/em\u003e as plant height. In \u003cem\u003eS. dulcamara\u003c/em\u003e the number of flowers and berries were counted, while in the other species we counted the number of inflorescences containing flowers or berries. In \u003cem\u003eS. physalifolium\u003c/em\u003e we noted survival and measured regrowth of the plant after the spontaneous \u003cem\u003eP. infestans\u003c/em\u003e infection (24th of September), as a percentage of plant size at the time of infection. All above ground material was also collected on the 14th of November. Plant biomass above ground was separated into green mass and fruit mass for \u003cem\u003eS. dulcamara\u003c/em\u003e, but not for the other species as fruits had been lost. The material was weighed after drying for 24 h at a temperature of 60\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cb\u003eConfirmation of\u003c/b\u003e \u003cb\u003eA. solani\u003c/b\u003e \u003cb\u003einfection in the wild\u003c/b\u003e \u003cb\u003eSolanum\u003c/b\u003e \u003cb\u003especies\u003c/b\u003e\u003c/p\u003e \u003cp\u003eLesions of infected leaves of the three wild species were collected from the small field trial and grown on water agar and kept in an UV incubator for two days with a temperature of 18\u0026deg;C, and then kept near the window for a week. Plates were then inspected under the microscope to confirm the presence of \u003cem\u003eA. solani\u003c/em\u003e. As a complement, we included leaves of \u003cem\u003eS. nigrum\u003c/em\u003e with typical \u003cem\u003eA. solani\u003c/em\u003e lesions collected from naturally infected potato field trials at Helgeg\u0026aring;rden in 2019 (\u003cem\u003eS. nigrum\u003c/em\u003e, at the same site where we collected \u003cem\u003eS. nigrum\u003c/em\u003e seeds and field inoculum, see above).\u003c/p\u003e \u003cp\u003eProduction of single celled isolates\u003c/p\u003e \u003cp\u003eSingle cell isolates of putative \u003cem\u003eA. solani\u003c/em\u003e from \u003cem\u003eS. dulcamara\u003c/em\u003e (Alnarp) and \u003cem\u003eS. nigrum\u003c/em\u003e (Helgeg\u0026aring;rden) leaves were confirmed to be \u003cem\u003eA. solani\u003c/em\u003e by genetic markers (PCR). To produce single cell isolates a lesion was cut from the leaf, washed in bleach and MilliQ water, then cultured on water agar for at least two weeks in the UV incubator at 18C with 30% intensity UV-c light for 9h per day. After two weeks, the spores were transferred to new plates, this time 20% PDA and incubated for 10 days in the UV chamber. Spores were then detached from the mycelium with 40uL of MilliQ water. The droplet was moved on a new 20% PDA plate and spread with with L-shaped spreader. The plate was incubated at room temperature for 3 hours to allow spore germination. Finally, a sterile scalpel was used to cut out a piece of the PDA containing one single spore and moved to a new 20% PDA plate. The plate was then incubated in the UV chamber for the culture to grow for 14 days at room temperature. One agar plug of 1 cm\u003csup\u003e2\u003c/sup\u003e was cut out from the edge of a growing culture and transferred into a bottle of potato dextrose broth medium. The bottles were incubated in the dark on a lab shaker, at room temperature for 7 days. The mycelium was then separated from the agar plugs using forceps. Mycelial samples were frozen in liquid nitrogen and ground to a find powder using a mortar and a pestle.\u003c/p\u003e \u003cp\u003eMolecular confirmation of \u003cem\u003eA. solani\u003c/em\u003e\u003c/p\u003e \u003cp\u003eDNA extraction was carried out using the DNA-Plant mini kit from Qiagen, following the manufacturer's protocol. We confirmed the quality of the extracted DNA using Nano-drop ND1000 and diluted it to a concentration of 100 ng/\u0026micro;L. As a positive control for the presence of \u003cem\u003eA. solani\u003c/em\u003e in the PCR assay, DNA from the reference strain AS 112 (Odilbekov et al. 2014) was utilized. Negative controls consisted of distilled water as template.\u003c/p\u003e \u003cp\u003ePCR was performed using two sets of \u003cem\u003eA. solani\u003c/em\u003e-specific primers: AS1 (5'-GCTCCCACTCCTTCCGCGC-3') and AS2 (5'-GGAGGTGGAGTTACCGACAA-3') from Kumar et al (2013), or forward primer Asol 129 (319) (ATGCGGGTGAATACGGTTAA) and reverse primer 143 (CTCTACTTTGTTTATGTTATTTAACCAAGAATG), as published in Edin et al. (Edin et al., 2019). PCR reactions were carried out in 25 \u0026micro;L reactions, using 50 ng/\u0026micro;L DNA as the template. The PCR conditions followed the protocols described in Kumar et al. (Kumar et al. 2013) for the AS1 and AS2 primers and Edin et al. (Edin et al. 2019) for the Asol 139 (319) and 143 reverse primer. Subsequently, the PCR product was separated on a 1% agarose gel (confirmational pictures can be found in Online Resource 1).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eData analysis of greenhouse experiments and field trial\u003c/h2\u003e \u003cp\u003eData was analysed in SPSS, version 29 (IBM SPSS Statistics for Windows 2022), using a series of Anovas. Type III sum of squares was used in the Anovas. Continuous covariates were standardized to a mean of zero and a standard deviation of 1.\u003c/p\u003e \u003cp\u003eGreenhouse experiments\u003c/p\u003e \u003cp\u003eIn Experiment 1 we tested lesion area in a model involving the factors \u003cem\u003eSolanum\u003c/em\u003e species, \u003cem\u003eS. dulcamara\u003c/em\u003e genotype nested within species, treatment with \u003cem\u003eP. oligandrum\u003c/em\u003e and the interaction between species and treatment. In Experiment 2 we tested lesion area in a model with the factors \u003cem\u003eS. nigrum\u003c/em\u003e genotype, \u003cem\u003eA. solani\u003c/em\u003e isolate, treatment with \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e, all two- and three-way interactions.\u003c/p\u003e \u003cp\u003eTo investigate plant performance following biocontrol treatment in Experiment 1\u0026ndash;2, we used models with plant genotype, treatment and their interaction. We included early plant size as a covariate when it was significant (for \u003cem\u003eS. dulcamara\u003c/em\u003e) and the factor growth chamber nested under genotype (for \u003cem\u003eS. nigrum\u003c/em\u003e and \u003cem\u003eS. physalifolium\u003c/em\u003e) as plants of some genotypes were split between greenhouse chambers. To analyse whether biocontrol treatment affected plant allocation above vs. below ground, we added the covariate dry root weight to the models with the dependent variable dry green mass and all interactions with genotype and treatment. Significant interactions between dry root weight and treatment would indicate an altered allocation in treated plants.\u003c/p\u003e \u003cp\u003eIn Experiment 1, we tested how plant performance was influenced by age at the biocontrol treatment in two batches of \u003cem\u003eS. dulcamara\u003c/em\u003e plants with a model involving plant genotype, treatment, plant batch and all two- and three-way interactions. We also included the covariate early plant size when significant.\u003c/p\u003e \u003cp\u003eDependent variables were transformed when needed to obtain normal distribution of residuals in the models (Experiment 1; Log-transformed: \u003cem\u003eS. dulcamara\u003c/em\u003e: early plant size, plant size at harvest, \u003cem\u003eS. dulcamara\u003c/em\u003e two batches: early plant size, plant size at harvest, dry green mass and dry root mass, \u003cem\u003eS. nigrum\u003c/em\u003e: leaf area, dry root mass, \u003cem\u003eS. physalifolium\u003c/em\u003e: dry green mass and dry root mass; Experiment 2: Power-transformed: plant size, Log-transformed: dry root mass).\u003c/p\u003e \u003cp\u003eField trial\u003c/p\u003e \u003cp\u003eTo investigate how the percentage infected leaf area by \u003cem\u003eA. solani\u003c/em\u003e and wilting (both arcsine-transformed) differed among wild species and potato, we first tested \u003cem\u003eS. nigrum\u003c/em\u003e and potato in their two growth places (own plot and between \u003cem\u003eS. dulcamara\u003c/em\u003e plants). We used a model with growth place, species and their interaction. Because percentage infection did not differ between growth places (Anova; Growth place: F\u003csub\u003e1,95\u003c/sub\u003e = 0.581, P\u0026thinsp;=\u0026thinsp;0.45, Species: F\u003csub\u003e1,95\u003c/sub\u003e = 3.14, P\u0026thinsp;=\u0026thinsp;0.079, Interaction: F\u003csub\u003e1,95\u003c/sub\u003e = 2.48, P\u0026thinsp;=\u0026thinsp;0.12), we pooled all samples of these species in tests for differences among species. As wilting was affected by growth place (see Results), we also performed an additional analyses of the differences among the four species growing in the \u003cem\u003eS. dulcamara\u003c/em\u003e plot. Genotype differences in percentage infection and wilting within each species was tested with non-parametric Kruskal-Wallis test.\u003c/p\u003e \u003cp\u003eWe tested the effect of \u003cem\u003eP. oligandrum\u003c/em\u003e on percentage infection in the selected 24 plants per species by using a model with species, treatment (control in \u003cem\u003eA. solani\u003c/em\u003e or control aarea, \u003cem\u003eP. oligandrum\u003c/em\u003e in \u003cem\u003eA. solani\u003c/em\u003e or control area), scoring date and all two- and three-way interaction. For effects on percentage wilting on the last scoring date we used a model with species, treatment and their interaction.\u003c/p\u003e \u003cp\u003eAdditionally, we tested how \u003cem\u003eS. physalifolium\u003c/em\u003e genotype affected \u003cem\u003eP. infestans\u003c/em\u003e infection percentage and the percentage regrowth with non-parametric Kruskal-Wallis test. Moreover, the effect of \u003cem\u003eP. oligandrum\u003c/em\u003e on percentage infection and regrowth was tested with non-parametric Man-Whitney U-test.\u003c/p\u003e \u003cp\u003eTo study how plant performance was affected by \u003cem\u003eP. oligandrum\u003c/em\u003e treatment we used a model with treatment and if significant included the covariate early plant size (\u003cem\u003eS. dulcamara\u003c/em\u003e and \u003cem\u003eS. nigrum\u003c/em\u003e). Some traits were log-transformed to obtain normally-distributed resu\u0026iacute;duals of the models (\u003cem\u003eS. dulcamara\u003c/em\u003e: number of flowers, number of berries, dry berry mass, \u003cem\u003eS. nigrum\u003c/em\u003e: number of inflorescences with flowers and berries, dry green mass).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eAlternaria solani\u003c/b\u003e \u003cb\u003einfection in the greenhouse\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAll three wild \u003cem\u003eSolanum\u003c/em\u003e species inoculated with \u003cem\u003eA. solani\u003c/em\u003e developed lesions typical for early blight disease in the greenhouse experiments (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In Experiment 1, involving all species, mock treated leaves showed no signs of lesions. Lesions in inoculated plants were possible to measure nine days post inoculation (dpi). After 12 and 20 days leaves started to drop, so we concluded that the data was most reliable at 9 dpi. Lesion size at 9 dpi differed among species across \u003cem\u003eA. solani\u003c/em\u003e treatments (with and without \u003cem\u003eP. oligandrum\u003c/em\u003e treatment), showing that \u003cem\u003eS. physalifolium\u003c/em\u003e was more susceptible to infection than \u003cem\u003eS. dulcamara\u003c/em\u003e and \u003cem\u003eS. nigrum\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). There was no significant difference between the two tested \u003cem\u003eS. dulcamara\u003c/em\u003e genotypes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAnalyses of variance of lesion area following inoculations by \u003cem\u003eA. solani\u003c/em\u003e in wild \u003cem\u003eSolanum\u003c/em\u003e species treated with a biocontrol agent (\u003cem\u003eP. oligandrum\u003c/em\u003e or \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e) in the greenhouse in Experiment 1\u0026ndash;2.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSource of variation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c4\" namest=\"c1\"\u003e \u003cp\u003eExperiment 1: Lesion area (mm\u003csup\u003e2\u003c/sup\u003e) 9 dpi\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSolanum\u003c/em\u003e species\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e5.63\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.013\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS. dulcamara\u003c/em\u003e genotype\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment (\u003cem\u003eP. oligandrum\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.077\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSpecies \u0026times; treat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.361\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.70\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eError\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c4\" namest=\"c1\"\u003e \u003cp\u003eExperiment 2: Lesion area (mm\u003csup\u003e2\u003c/sup\u003e) 7 dpi\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS. nigrum\u003c/em\u003e genotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.511\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.61\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eA. solani\u003c/em\u003e isolate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.069\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment (Serenade)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e8.26\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.008\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype \u0026times; isolate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.956\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype \u0026times; treat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.508\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.61\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIsolate \u0026times; treat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.070\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype \u0026times; isolate \u0026times; treat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.952\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eError\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003csup\u003ea\u003c/sup\u003e \u003cem\u003eS. dulcamara\u003c/em\u003e genotype was nested within species.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003eBold indicate significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) factors.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eIn Experiment 2, lesion area at 7 and 10 dpi in \u003cem\u003eS. nigrum\u003c/em\u003e showed similar results. Lesion size at 7 dpi was similar across the three \u003cem\u003eS. nigrum\u003c/em\u003e genotypes and for the two isolates (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). However, there was a non-significant trend that the newly collected isolate caused larger lesions (P\u0026thinsp;=\u0026thinsp;0.069) and the variance for this isolate was significantly larger (F-test; F\u0026thinsp;=\u0026thinsp;0.047, P\u0026thinsp;=\u0026thinsp;0.0001).\u003c/p\u003e\n\u003ch3\u003eEffect of biocontrol agents on early blight disease in the greenhouse\u003c/h3\u003e\n\u003cp\u003eIn Experiment 1, no effect of the biocontrol agent \u003cem\u003eP. oligandrum\u003c/em\u003e on lesion area was detected in any of the three wild \u003cem\u003eSolanum\u003c/em\u003e species (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In Experiment 2, the biocontrol agent \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e had a strong negative effect on lesion area in \u003cem\u003eS. nigrum\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eEffect of biocontrol agents on plant performance in the greenhouse\u003c/h2\u003e \u003cp\u003eIn Experiment 1, the biocontrol agent \u003cem\u003eP. oligandrum\u003c/em\u003e affected plant performance in all three \u003cem\u003eSolanum\u003c/em\u003e species, but in slightly different ways (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). In the three \u003cem\u003eS. dulcamara\u003c/em\u003e genotypes, treated plants became smaller (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). The effect on dry root weight varied among genotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec), as indicated by the significant genotype by treatment interaction. In the two \u003cem\u003eS. nigrum\u003c/em\u003e genotypes, a significant genotype by treatment interaction was seen for both plant size, estimated as plant height (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed), and dry root weight (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef). Thus, the response to the treatment varied with genotype. In \u003cem\u003eS.physalifolium\u003c/em\u003e, the two genotypes responded in a similar way to \u003cem\u003eP. oligandrum;\u003c/em\u003e they became shorter (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ej), produced a higher dry green biomass (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ek) and a higher dry root biomass (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003el). Leaf area was not affected by treatment in any species (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Likewise, no treatment effects were seen for berry production in \u003cem\u003eS. nigrum\u003c/em\u003e or \u003cem\u003eS. physalifolium\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAnalyses of variance of plant performance traits in three wild \u003cem\u003eSolanum\u003c/em\u003e species treated with the biocontrol agent \u003cem\u003eP. oligandrum\u003c/em\u003e in the greenhouse Experiment 1.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"19\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c14\" colnum=\"14\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c15\" colnum=\"15\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c16\" colnum=\"16\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c17\" colnum=\"17\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c18\" colnum=\"18\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c19\" colnum=\"19\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSource of variation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003ePlant size (cm)\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e \u003cp\u003eLeaf area (mm\u003csup\u003e2\u003c/sup\u003e)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c10\" namest=\"c8\"\u003e \u003cp\u003eNumber of berries\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c13\" namest=\"c11\"\u003e \u003cp\u003eDry berry mass (g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c16\" namest=\"c14\"\u003e \u003cp\u003eDry green mass (g)\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c19\" namest=\"c17\"\u003e \u003cp\u003eDry root mass (g)\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c13\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c14\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c15\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c16\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c17\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c18\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c19\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"19\" nameend=\"c19\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS. dulcamara\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e36.8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.054\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e4.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u003cb\u003e19.2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e7.12\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.010\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.784\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e1.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.651\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e0.42\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEarly plant size\u003csup\u003ee\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e20.4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u003cb\u003e5.18\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u003cb\u003e0.027\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u003cb\u003e6.37\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u003cb\u003e0.015\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype \u0026times;Treat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.951\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e0.258\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u003cb\u003e3.61\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u003cb\u003e0.034\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eError\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"19\" nameend=\"c19\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS. nigrum\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.885\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e13.6\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e7.73\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e0.008\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.402\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u003cb\u003e9.77\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u003cb\u003e0.003\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e1.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e0.20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e2.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e0.030\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u003cb\u003e4.80\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eChamber (G)\u003csup\u003ef\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e13.8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e6.04\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e0.018\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.489\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e2.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.063\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e0.80\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype \u0026times;Treat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e7.53\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.009\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.025\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e3.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.090\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.793\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e1.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u003cb\u003e10.5\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u003cb\u003e0.002\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eError\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"19\" nameend=\"c19\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS. physalifolium\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e7.76\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.008\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.014\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e0.048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.286\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e0.60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e5.69\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.022\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.026\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.710\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u003cb\u003e11.1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u003cb\u003e0.002\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u003cb\u003e4.44\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u003cb\u003e0.042\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eChamber (G)\u003csup\u003ef\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e15.8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e2.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e1.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e4.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e0.052\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype \u0026times;Treat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e0.337\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e1.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e0.19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eError\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"19\"\u003e\u003csup\u003ea\u003c/sup\u003e Plant size in \u003cem\u003eS. dulcamara\u003c/em\u003e was estimated as length of all shoots (log-transformed), and in \u003cem\u003eS. nigrum\u003c/em\u003e and \u003cem\u003eS. physalifolium\u003c/em\u003e as plant height.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"19\"\u003e\u003csup\u003eb\u003c/sup\u003e Log-transformed in \u003cem\u003eS. nigrum\u003c/em\u003e\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"19\"\u003e\u003csup\u003ec\u003c/sup\u003e Dry green mass included berries in \u003cem\u003eS. dulcamara\u003c/em\u003e and in \u003cem\u003eS. physalifolium\u003c/em\u003e (log-transformed in this species), but not in \u003cem\u003eS. nigrum\u003c/em\u003e which had produced a very high number of berries.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"19\"\u003e\u003csup\u003ed\u003c/sup\u003e Log-transformed in \u003cem\u003eS. nigrum\u003c/em\u003e and in \u003cem\u003eS. physalifolium\u003c/em\u003e\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"19\"\u003e\u003csup\u003ee\u003c/sup\u003e Early plant size was controlled for in \u003cem\u003eS. dulcamara\u003c/em\u003e models to take into account early size differences in this species.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"19\"\u003e\u003csup\u003ef\u003c/sup\u003e Chamber nested under genotype (G) was included in the models for \u003cem\u003eS. nigrum\u003c/em\u003e and \u003cem\u003eS. physalifolium\u003c/em\u003e because some genotypes were split between two different chambers in the greenhouse.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"19\"\u003eBold indicates a significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) difference.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eIn Experiment 2, the three \u003cem\u003eS. nigrum\u003c/em\u003e genotypes treated with the biocontrol agent \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e, significant genotype by treatment interactions were found for plant size and dry root weight (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). This pattern was similar to that seen in \u003cem\u003eS. nigrum\u003c/em\u003e genotypes treated with \u003cem\u003eP. oligandrum\u003c/em\u003e. Interestingly, the two genotypes used in both experiments (Nr 2 L and Nr 6 T) showed a similar plant size response to both biocontrol agents, but an opposite response regarding dry root mass (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The strong genotype effect detected on dry green mass was similar for the two genotypes across biocontrol agents.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAnalyses of variance of plant performance traits in \u003cem\u003eS. nigrum\u003c/em\u003e treated with the biocontrol agent \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e in the greenhouse Experiment 2.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"16\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c14\" colnum=\"14\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c15\" colnum=\"15\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c16\" colnum=\"16\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003ePlant size (cm)\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e \u003cp\u003eNumber of berries\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c10\" namest=\"c8\"\u003e \u003cp\u003eDry berry mass (g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c13\" namest=\"c11\"\u003e \u003cp\u003eDry green mass (g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c16\" namest=\"c14\"\u003e \u003cp\u003eDry root mass (g)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSource of variation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e15.3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e106\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e16.8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e20.1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u003cb\u003e22.6\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.052\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.086\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.030\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e0.074\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.79\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype \u0026times;Treat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e3.95\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.025\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.094\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e2.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u003cb\u003e4.39\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u003cb\u003e0.017\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eError\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"16\"\u003e\u003csup\u003ea\u003c/sup\u003e Estimated as plant height and power-transformed\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"16\"\u003e\u003csup\u003eb\u003c/sup\u003e Log-transformed\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"16\"\u003eBold indicates a significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) difference.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eEffect of biocontrol agents on above vs. below ground allocation in the greenhouse\u003c/h2\u003e \u003cp\u003eTo test if plants allocated resources differently above vs. below ground in response to the biocontrol agents, we included dry root mass as a covariate in the models with the dependent variable above green mass, including all interactions. However, we found no significant differences in allocation in either tested species, as indicated by the interaction between treatment and dry root mass, or the interaction between treatment, dry root mass and genotype (\u003cem\u003eS. dulcamara\u003c/em\u003e: P\u0026thinsp;\u0026gt;\u0026thinsp;0.61, \u003cem\u003eS. nigrum\u003c/em\u003e: P\u0026thinsp;\u0026gt;\u0026thinsp;0.16, \u003cem\u003eS. physalifolium\u003c/em\u003e: P\u0026thinsp;\u0026gt;\u0026thinsp;0.67). Thus, there was no evidence for a change in above vs. below ground allocation in response to treatment with the two tested biocontrol agents. There were, however, positive correlations between dry green mass and dry root mass across treatments (both with and without BCAs) in \u003cem\u003eS. dulcamara\u003c/em\u003e (P\u0026thinsp;=\u0026thinsp;0.005) and \u003cem\u003eS. nigrum\u003c/em\u003e (Experiment 1: P\u0026thinsp;=\u0026thinsp;0.011, Experiment 2: P\u0026thinsp;=\u0026thinsp;0.013), but not in \u003cem\u003eS. physalifolium\u003c/em\u003e (P\u0026thinsp;=\u0026thinsp;0.085).\u003c/p\u003e \u003cp\u003e \u003cb\u003ePlant developmental stage and performance in response to\u003c/b\u003e \u003cb\u003eP. oligandrum\u003c/b\u003e \u003cb\u003ein the greenhouse\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo get an indication of whether plant developmental stage influenced the response to treatment with the biocontrol agent \u003cem\u003eP. oligandrum\u003c/em\u003e, plant performance traits in \u003cem\u003eS. dulcamara\u003c/em\u003e were also evaluated in plants that were two weeks younger than the first replicate of plants and therefore smaller in size (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;sd longest shoot: First batch\u0026thinsp;=\u0026thinsp;101\u0026thinsp;\u0026plusmn;\u0026thinsp;22 cm; Second batch\u0026thinsp;=\u0026thinsp;36\u0026thinsp;\u0026plusmn;\u0026thinsp;10 cm). Even though plants in the second replicate (batch 2) were harvested two weeks later than the first replicate (batch 1), these plants remained smaller (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;sd total shoot length: First replicate\u0026thinsp;=\u0026thinsp;563\u0026thinsp;\u0026plusmn;\u0026thinsp;30 cm; Second replicate\u0026thinsp;=\u0026thinsp;238\u0026thinsp;\u0026plusmn;\u0026thinsp;8 cm, Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The response to \u003cem\u003eP. oligandrum\u003c/em\u003e was significantly different between replicates (batches) for plant size and dry root biomass at the end of the experiment, as suggested by the significant interactions involving treatment and plant batch (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Separate analyses including only plants from the second batch could not detect any significant effect of either biocontrol treatment or its interaction with genotype (Anova; Plant size: Genotype: F\u003csub\u003e2,55\u003c/sub\u003e = 1.72, P\u0026thinsp;=\u0026thinsp;0.22, Treatment: F\u003csub\u003e1,55\u003c/sub\u003e = 0.573, P\u0026thinsp;=\u0026thinsp;0.45, T \u0026times; G: F\u003csub\u003e2,55\u003c/sub\u003e = 1.11, P\u0026thinsp;=\u0026thinsp;0.34; Dry root weight: Genotype: F\u003csub\u003e2,55\u003c/sub\u003e = 1.00, P\u0026thinsp;=\u0026thinsp;0.38, Treatment: F\u003csub\u003e1,55\u003c/sub\u003e = 0.299, P\u0026thinsp;=\u0026thinsp;0.59, T \u0026times; G: F\u003csub\u003e2,55\u003c/sub\u003e = 1.52, P\u0026thinsp;=\u0026thinsp;0.23). No difference in response to the biocontrol treatment was seen for dry green biomass, indicating that this trait was not affected by \u003cem\u003eP. oligandrum\u003c/em\u003e in either of the plant batches (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e,\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAnalyses of variance of plant performance traits in two \u003cem\u003eS. dulcamara\u003c/em\u003e plant batches with an age difference of two weeks treated at the same time with the biocontrol agent \u003cem\u003eP. oligandrum\u003c/em\u003e in the greenhouse Experiment 1.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"10\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003ePlant size (cm)\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e \u003cp\u003eDry green mass (g)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c10\" namest=\"c8\"\u003e \u003cp\u003eDry root mass (g)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSource of variation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e10.3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.968\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e6.76\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e0.002\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.692\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlant batch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e19.1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e4.08\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e0.046\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.24\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEarly plant size\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e5.22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.024\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e10.6\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e0.002\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e8.29\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e0.005\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype \u0026times;Treat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.116\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.442\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.77\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype \u0026times; Plant batch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e22.1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e12.7\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e14.3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreat \u0026times; Plant batch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e4.42\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.038\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.243\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.293\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.59\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype \u0026times; Treat \u0026times; Plant batch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.949\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e3.43\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e0.036\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eError\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e105\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e104\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"10\"\u003e\u003csup\u003ea\u003c/sup\u003e Estimated as length of all shoots (log-transformed)\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"10\"\u003e\u003csup\u003eb\u003c/sup\u003e Log-transformed\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"10\"\u003e\u003csup\u003ec\u003c/sup\u003e Estimated as longest shoot (log-transformed)\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"10\"\u003eBold indicates a significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) difference.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDisease progression in the field trial and confirmation of\u003c/b\u003e \u003cb\u003eA. solani\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAll three wild \u003cem\u003eSolanum\u003c/em\u003e species and the potato cultivar Kuras started to show lesions typical of infection by \u003cem\u003eA. solani\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) from the middle of August, i.e. three weeks post inoculation of kernels. The percentage of infected leaves increased over the three scoring events performed during five weeks between middle August and middle September, but at the latest scoring date the infection was still low (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). The \u003cem\u003eS. physalifolium\u003c/em\u003e plot was affected by a spontaneous \u003cem\u003eP. infestans\u003c/em\u003e infection at the end of August, causing the plants to drop all of their leaves. Thus, for \u003cem\u003eS. physalifolium\u003c/em\u003e early blight could only be scored in plants growing between \u003cem\u003eS. dulcamara\u003c/em\u003e plants (N\u0026thinsp;=\u0026thinsp;5). Despite the low infection level, the four species differed in percentage infected leaves (F\u003csub\u003e3,168\u003c/sub\u003e = 31.9, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, using pooled values for growth place as this factor was non-significant). \u003cem\u003eS. physalifolium\u003c/em\u003e and \u003cem\u003eS. nigrum\u003c/em\u003e were more susceptible to infection compared to \u003cem\u003eS. dulcamara\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). There were no differences in percentage infection among the three genotypes of \u003cem\u003eS. dulcamara\u003c/em\u003e (Kruskal-Wallis; 1.15, N\u0026thinsp;=\u0026thinsp;68, df\u0026thinsp;=\u0026thinsp;2, P\u0026thinsp;=\u0026thinsp;0.56) or the four genotypes of \u003cem\u003eS. nigrum\u003c/em\u003e (Kruskal-Wallis; 5.47, N\u0026thinsp;=\u0026thinsp;29, df\u0026thinsp;=\u0026thinsp;3, P\u0026thinsp;=\u0026thinsp;0.14).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003ePercentage wilting of plants at the last scoring event (in mid-September) differed between growth place for \u003cem\u003eS. nigrum\u003c/em\u003e and potato, but also between species as potato had slightly higher wilting percentage (Anova; Own plots: \u003cem\u003eS. nigrum\u003c/em\u003e 0.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11 (se) %, potato 1.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22%, \u003cem\u003eS. dulcamara\u003c/em\u003e plot: \u003cem\u003eS. nigrum\u003c/em\u003e 0.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.56%, potato 4.0\u0026thinsp;\u0026plusmn;\u0026thinsp;1.64%; Anova; Growth place: F\u003csub\u003e1,95\u003c/sub\u003e = 9.51, P\u0026thinsp;=\u0026thinsp;0.003, Species: F\u003csub\u003e1,95\u003c/sub\u003e = 22.0, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Interaction: F\u003csub\u003e1,95\u003c/sub\u003e = 2.33, P\u0026thinsp;=\u0026thinsp;0.13). A separate analysis for all four species in the \u003cem\u003eS. dulcamara\u003c/em\u003e plot showed a lower wilting percentage in \u003cem\u003eS. dulcamara\u003c/em\u003e than in the five \u003cem\u003eS. physalifolium\u003c/em\u003e plants and five potato plants (Anova; F\u003csub\u003e3,78\u003c/sub\u003e = 5.1, P\u0026thinsp;=\u0026thinsp;0.003; \u003cem\u003eS. dulcamara\u003c/em\u003e 1.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26, %, \u003cem\u003eS. physalifolium\u003c/em\u003e 4.2\u0026thinsp;\u0026plusmn;\u0026thinsp;1.64%). This difference was in line with the percentage infected leaves (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eInspecting the water agar plates from all wild species under the microscope confirmed the presence of typical \u003cem\u003eA. solani\u003c/em\u003e spores. Moreover, PCRs of isolates from \u003cem\u003eS. dulcamara\u003c/em\u003e in our small field trial at Campus Alnarp and from naturally infected \u003cem\u003eS. nigrum\u003c/em\u003e in a larger field trial confirmed the infection of \u003cem\u003eA. solani\u003c/em\u003e in these two wild species (see Online Resource 1).\u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of\u003c/b\u003e \u003cb\u003eP. oligandrum\u003c/b\u003e \u003cb\u003eon disease and plant performance in the field trial\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe were unable to detect any significant effect of treatment with \u003cem\u003eP. oligandrum\u003c/em\u003e on the percentage of infection by \u003cem\u003eA. solani\u003c/em\u003e or wilting involving the 24 selected plants of \u003cem\u003eS. dulcamara\u003c/em\u003e, \u003cem\u003eS. nigrum\u003c/em\u003e or potato per species grown in the \u003cem\u003eA. solani\u003c/em\u003e or control area across the three scoring dates (Anova; Infection: Species: F\u003csub\u003e2,180\u003c/sub\u003e = 16.7, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Treatment: F\u003csub\u003e3,180\u003c/sub\u003e = 1.57, P\u0026thinsp;=\u0026thinsp;0.20, Date: F\u003csub\u003e2,180\u003c/sub\u003e = 64.7, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Species \u0026times; Date: F\u003csub\u003e4,180\u003c/sub\u003e = 8.55, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, other two-way interactions and three-way interaction: P\u0026thinsp;=\u0026thinsp;0.64\u0026ndash;0.78; Wilting: Species: F\u003csub\u003e2,60\u003c/sub\u003e = 13.5, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Treatment: F\u003csub\u003e3,60\u003c/sub\u003e = 1.60, P\u0026thinsp;=\u0026thinsp;0.20, Interaction: F\u003csub\u003e6,60\u003c/sub\u003e = 1.73, P\u0026thinsp;=\u0026thinsp;0.13).\u003c/p\u003e \u003cp\u003e \u003cem\u003eSolanum physalifolium\u003c/em\u003e scored for infection by \u003cem\u003eP. infestans\u003c/em\u003e on the 21st of August, showed that 64\u0026thinsp;\u0026plusmn;\u0026thinsp;15 (sd) % of leaves were infected (ranging between 50\u0026ndash;100% per individual plant). The two plants with 100% infected leaves died, while plants with \u0026lt;\u0026thinsp;100% infected leaves all survived and started regrowing new leaves. Plant genotype did not influence percentage infection (Kruskal-Wallis; 3.16, N\u0026thinsp;=\u0026thinsp;34, df\u0026thinsp;=\u0026thinsp;3, P\u0026thinsp;=\u0026thinsp;0.37) or the percentage of regrowth in late September (0\u0026ndash;75%, Kruskal-Wallis; 6.63, N\u0026thinsp;=\u0026thinsp;32, df\u0026thinsp;=\u0026thinsp;3, P\u0026thinsp;=\u0026thinsp;0.093). Treatment with \u003cem\u003eP. oligandrum\u003c/em\u003e did not influence infection by \u003cem\u003eP. infestans\u003c/em\u003e in the selected plants (Man-Whitney U-test; 93, N\u0026thinsp;=\u0026thinsp;23, P\u0026thinsp;=\u0026thinsp;0.089) or regrowth in the surviving 22 of the selected plants (Man-Whitney U-test; 63, N\u0026thinsp;=\u0026thinsp;22, P\u0026thinsp;=\u0026thinsp;0.87).\u003c/p\u003e \u003cp\u003eNo plant performance traits were affected by \u003cem\u003eP. oligandrum\u003c/em\u003e treatment in the \u003cem\u003eA. solani\u003c/em\u003e treated or control area, for either of the three wild species (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). For both \u003cem\u003eS. dulcamara\u003c/em\u003e and \u003cem\u003eS. nigrum\u003c/em\u003e early plant size had a big impact on later performance.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAnalyses of variance of plant performance traits in three wild \u003cem\u003eSolanum\u003c/em\u003e species treated with the biocontrol agent \u003cem\u003eP. oligandrum\u003c/em\u003e in a field trial at Campus Alnarp, Sweden.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"19\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c14\" colnum=\"14\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c15\" colnum=\"15\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c16\" colnum=\"16\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c17\" colnum=\"17\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c18\" colnum=\"18\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c19\" colnum=\"19\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSource of variation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003ePlant size (cm)\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eAugust\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e \u003cp\u003eNumber of flowers\u003csup\u003eb\u003c/sup\u003e /flower\u0026thinsp;+\u0026thinsp;berries\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eAugust\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c10\" namest=\"c8\"\u003e \u003cp\u003ePlant size (cm)\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eSeptember\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c13\" namest=\"c11\"\u003e \u003cp\u003eNumber of berries\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eSeptember\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c16\" namest=\"c14\"\u003e \u003cp\u003eDry green mass (g)\u003csup\u003ee\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eNovember\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c19\" namest=\"c17\"\u003e \u003cp\u003eDry berry mass (g)\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eNovember\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c13\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c14\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c15\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c16\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c17\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c18\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c19\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"19\" nameend=\"c19\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS. dulcamara\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.020\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.214\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.214\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e0.184\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e2.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e0.12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlant size\u003csup\u003ef\u003c/sup\u003e July\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e22.8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e19.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e9.86\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e0.005\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e9.86\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u003cb\u003e0.005\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u003cb\u003e10.7\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u003cb\u003e0.006\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eError\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"19\" nameend=\"c19\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS. nigrum\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.369\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e0.068\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlant size\u003csup\u003ef\u003c/sup\u003e July\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e10.2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e0.005\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eError\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"19\" nameend=\"c19\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS. physalifolium\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.191\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.006\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e0.003\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eError\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"19\"\u003e\u003csup\u003ea\u003c/sup\u003e Plant size in \u003cem\u003eS. dulcamara\u003c/em\u003e was estimated as length of all shoots, and in \u003cem\u003eS. nigrum\u003c/em\u003e and \u003cem\u003eS. physalifolium\u003c/em\u003e as plant height.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"19\"\u003e\u003csup\u003eb\u003c/sup\u003e Number of flowers in \u003cem\u003eS. dulcamara\u003c/em\u003e \u003csup\u003e(\u003c/sup\u003elog-transformed)\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"19\"\u003e\u003csup\u003ec\u003c/sup\u003e Number of inflorescences with flowers and berries in \u003cem\u003eS. nigrum\u003c/em\u003e (log-transformed)\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"19\"\u003e\u003csup\u003ed\u003c/sup\u003e Log-transformed\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"19\"\u003e\u003csup\u003ee\u003c/sup\u003e Log-transformed in \u003cem\u003eS. nigrum\u003c/em\u003e\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"19\"\u003e\u003csup\u003ef\u003c/sup\u003e Early plant size was controlled for in \u003cem\u003eS. dulcamara\u003c/em\u003e and \u003cem\u003eS. nigrum\u003c/em\u003e models to take into account early size differences in these species.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"19\"\u003eBold indicates a significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) difference.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study we showed that three wild \u003cem\u003eSolanum\u003c/em\u003e species growing either as weeds in potato fields or close by potato fields can host the potato pathogen \u003cem\u003eAlternaria solani\u003c/em\u003e. We also tested how two BCAs used in potato to control \u003cem\u003eA. solani\u003c/em\u003e affect these wild plants. We found some indication of disease control of one of the BCAs \u0026ndash; \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e in the commercial product Serenade\u0026reg;. Both BCAs had effects on plant growth, but the effect varied with investigated trait, species and genotype within species. When assessing environmental risks of BCAs, it may therefore be of interest to also consider their effects on wild relatives present in the field.\u003c/p\u003e \u003cp\u003e \u003cb\u003eWild\u003c/b\u003e \u003cb\u003eSolanum\u003c/b\u003e \u003cb\u003especies as alternative hosts of\u003c/b\u003e \u003cb\u003eA. solani\u003c/b\u003e\u003c/p\u003e \u003cp\u003eDisease epidemiology in crops is not only affected by the crop \u003cem\u003eper se\u003c/em\u003e but can also be influenced by presence of alternative hosts (Kumar et al. 2021; Susi 2024). For this reason, it is important to investigate if crop-wild relatives can act as alternative hosts of crop pathogens. Potato has three wild relatives in Sweden \u0026ndash; the perennial climber \u003cem\u003eS. dulcamara\u003c/em\u003e and the two annual weeds \u003cem\u003eS. nigrum\u003c/em\u003e and \u003cem\u003eS. physalifolium\u003c/em\u003e. Previous studies showed varying susceptibility to late blight in these species (Gr\u0026ouml;nberg et al. 2012; Abreha et al. 2018) \u0026ndash; and that \u003cem\u003eS. dulcamara\u003c/em\u003e can act as an overwintering host (in the rhizosphere) (Vetukuri et al. 2020). Surprisingly, we were unable to find studies that had tested if these three species could act as alternative hosts also to \u003cem\u003eA. solani\u003c/em\u003e, but there appears to be some sematic knowledge. For example, the two annual weeds often grow in potato fields and lesions similar to those resulting from early blight are often noted by farmers. In our study we inoculated these three species with \u003cem\u003eA. solani\u003c/em\u003e both in the greenhouse and in a small-scale field trial. We found that \u003cem\u003eA. solani\u003c/em\u003e was able to infect all three species. The greenhouse results suggested that \u003cem\u003eS. physalifolium\u003c/em\u003e was more susceptible than the other species. Further, results from the field trials indicated that the two annual species showed higher levels of infection than \u003cem\u003eS. dulcamara\u003c/em\u003e, indicating a different pattern compared to infection by \u003cem\u003eP. infestans\u003c/em\u003e where \u003cem\u003eS. physalifolium\u003c/em\u003e is highly susceptible and \u003cem\u003eS. nigrum\u003c/em\u003e is mostly resistant (Abreha et al. 2018). The higher levels of infection in the greenhouse compared to in the field for \u003cem\u003eS. dulcamara\u003c/em\u003e was seen previously for \u003cem\u003eP. infestans\u003c/em\u003e (Masini et al. 2019), and is probably related to the production of thicker and smaller leaves in the field. It should be noted that our field trial was small and the degree of infection by \u003cem\u003eA. solani\u003c/em\u003e quite low. Moreover, a spontaneous \u003cem\u003eP. infestans\u003c/em\u003e infection in \u003cem\u003eS. physalifolium\u003c/em\u003e caused these plants to drop their leaves and therefore reduced the number of plants we could score for early blight.\u003c/p\u003e \u003cp\u003eConfirmation of \u003cem\u003eA. solani\u003c/em\u003e was also carried out by inspection of the spores under the microscope for all three species and through PCR from samples from our small field trial for \u003cem\u003eS. dulcamara\u003c/em\u003e and for \u003cem\u003eS. nigrum\u003c/em\u003e from a potato field trial with natural infection. These data further support the hypothesis that the wild species can be alternative hosts for \u003cem\u003eA. solani\u003c/em\u003e. From other observations of potato field trials and commercial potato fields with naturally occurring \u003cem\u003eA. solani\u003c/em\u003e infection in south Sweden, we have noted that \u003cem\u003eS. nigrum\u003c/em\u003e and \u003cem\u003eS. physalifolium\u003c/em\u003e growing next to the field often show early blight disease symptoms, which may indicate an influence on disease epidemiology (Lankinen et al. unpublished observations). However, we have also seen that disease symptoms in the wild species usually appear later than in potato. Because early blight disease is positively correlated to plant age (Odilbekov et al. 2020), it is possible that the later life-cycle of these wild species (from July - October) compared to potato, reduces their potential influence on the epidemiology of early blight. Interestingly, the isolate collected from \u003cem\u003eS. nigrum\u003c/em\u003e in potato field trials showed a trend towards higher pathogenicity than a commonly used lab strain. The trend of higher pathogenicity in the isolate collected from the wild species may be caused by the more recent collection of this isolate compared to the lab strain, reflecting the well-known degeneration of pathogenicity in lab strains of plant pathogens in general (Danner et al. 2023). In future studies it would be of interest to understand better if the wild \u003cem\u003eSolanum\u003c/em\u003e species influence \u003cem\u003eA. solani\u003c/em\u003e evolution, and if this impacts pathogenicity on potato, as has been indicated for \u003cem\u003eP. infestans\u003c/em\u003e (Gr\u0026ouml;nberg et al. 2012).\u003c/p\u003e \u003cp\u003e \u003cb\u003eControl of early blight by BCAs in wild\u003c/b\u003e \u003cb\u003eSolanum\u003c/b\u003e \u003cb\u003especies\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWhile environmental risks must be taken into consideration in the approval process of BCAs (Simberloff and Stiling 1996; Collinge et al. 2022), less is known about potential positive effects, e.g. if the BCA can control disease also in wild relatives and thereby reducing the presence of the pathogen. In the current study we investigated if the oomycete BCA \u003cem\u003ePythium oligandrum\u003c/em\u003e (using a lab strain) and the bacterial BCA \u003cem\u003eBacillus amyloliquefaciens\u003c/em\u003e (formerly \u003cem\u003eB. subtilis\u003c/em\u003e) (using the commercial product Serenade\u0026reg;) could control early blight in the three wild \u003cem\u003eSolanum\u003c/em\u003e species. Previous studies in potato showed that both \u003cem\u003eP. oligandrum\u003c/em\u003e (the commercial product Polygandron\u0026reg; and our lab strain) and \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e (Serenade\u0026reg;) controlled early blight in the greenhouse, and that \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e was more effective than \u003cem\u003eP. oligandrum\u003c/em\u003e (Stridh et al. 2022). In line with these studies, we found that \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e was effective at controlling early blight when tested in \u003cem\u003eS. nigrum\u003c/em\u003e in the greenhouse. In contrast, \u003cem\u003eP. oligandrum\u003c/em\u003e had no disease controlling effect in either of the tested three species in the greenhouse. It is possible that the lack of effect of \u003cem\u003eP. oligandrum\u003c/em\u003e was because this was a small experiment in combination with an expected smaller effect size for this BCA compared to Serenade\u0026reg;. It is also possible that \u003cem\u003eP. oligandrum\u003c/em\u003e is unable to control early blight in these wild species.\u003c/p\u003e \u003cp\u003eIn our field trial, we investigated the biocontrol effect of \u003cem\u003eP. oligandrum.\u003c/em\u003e In line with the results of the greenhouse study, we were unable to detect a disease controlling effect in either \u003cem\u003eS. dulcamara\u003c/em\u003e, \u003cem\u003eS. nigrum\u003c/em\u003e or the starch potato cultivar Kuras. This result was not surprising given that in potato, BCAs are less effective in the field compared to in the greenhouse (Stridh et al. 2022) or show a transient effect (Andersen 2023). It is also possible that the low infection pressure made our studies less reliable, or less easy to detect. In \u003cem\u003eS. physalifolium\u003c/em\u003e, we were not able to investigate a biocontrol effect on \u003cem\u003eA. solani\u003c/em\u003e because of the spontaneous \u003cem\u003eP. infestans\u003c/em\u003e infection. However, \u003cem\u003eP. oligandrum\u003c/em\u003e had no disease controlling effect on the \u003cem\u003eP. infestans\u003c/em\u003e infection or on the capacity of these plants to regrow. Interestingly, even though plants lost most of their leaves, 22 out of 24 plants survived the \u003cem\u003eP. infestans\u003c/em\u003e infection and started to regrow. Abscission of leaves either as a response to damage or as a defence response has been observed in many species (Kong and Yang 2023). In future studies, knowledge about the disease controlling capacity of a BCA not only on a given crop but also on nearby alternative hosts may be of interest to quantify for a better understanding of the environmental impact of BCAs and also for a more comprehensive understanding of how important it is to control these weeds in potato fields.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGrowth promotion in wild\u003c/b\u003e \u003cb\u003eSolanum\u003c/b\u003e \u003cb\u003especies following BCA treatment\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe added benefit of growth promotion of BCAs is receiving increasing interest (El-Saadony et al. 2022), but less is known about environmental effects on wild plants. In this study we evaluated a potential growth promoting effect also on the three wild relatives of potato of the BCAs \u003cem\u003eP. oligandrum\u003c/em\u003e and \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e (Serenade\u0026reg;), known to be growth promoting in potato (Syed and Prasad Tollamadugu 2019; Andersen et al. 2024). In the greenhouse, we found that growth was affected following treatment with \u003cem\u003eP. oligandrum\u003c/em\u003e, but the outcome varied across investigated traits, species and genotypes within species. In general, root mass was more often positively affected, while the response in above ground biomass or plant size was more variable. \u003cem\u003eS. physalifolium\u003c/em\u003e responded positively to \u003cem\u003eP. oligandrum\u003c/em\u003e treatment in terms of both root mass and above ground mass, but plant size (measured as height) was slightly reduced. \u003cem\u003eSolanum dulcamara\u003c/em\u003e and \u003cem\u003eS. nigrum\u003c/em\u003e showed variation among genotypes in the root mass response. In \u003cem\u003eS. dulcamara\u003c/em\u003e there was a slight negative effect on plant size (measured as shoot length), while in \u003cem\u003eS. nigrum\u003c/em\u003e the response in plant size (measured as height) again differed among genotypes. When we tested the effect of \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e (Serenade\u0026reg;) in \u003cem\u003eS. nigrum\u003c/em\u003e the outcome was similar to the effect of \u003cem\u003eP. oligandrum.\u003c/em\u003e However, the genotype response was not consistent across BCAs tested. The variation in response among genotypes is in line with studies showing that growth is promoted only in some potato cultivars following treatment with \u003cem\u003eP. oligandrum\u003c/em\u003e (Andersen et al. 2024). Moreover, one of the few other studies that investigated how a BCA influences growth promotion in wild species found that the endomycorrhizal fungus \u003cem\u003eSerendipita vermifera\u003c/em\u003e had a variable effect on three nearby weed species occurring with the crop switchgrass (Ray et al. 2018). Our greenhouse results suggest that at least for \u003cem\u003eS. physalifolium\u003c/em\u003e and potentially also for \u003cem\u003eS. nigrum\u003c/em\u003e exposure in a potato field may enhance the weed problem, as increased root mass is likely to increase water and nutrient update, and therefore performance of these weeds. It is, however, uncertain if these effects are dependent on the plant development stage that is exposed to the BCA, as our greenhouse results indicated for \u003cem\u003eS. dulcamara\u003c/em\u003e, or if the same results will be seen under field conditions. We were unable to detect any effects of \u003cem\u003eP. oligandrum\u003c/em\u003e treatment in the field trial but here only plant height was measured, which showed an unclear or negative effect in the greenhouse. Even though this was a small field trial, we could detect a positive effect on plant height of the potato plants grown in the same field trial (Andersen et al. 2024). From these greenhouse results we conclude that growth promotion can happen in wild \u003cem\u003eSolanum\u003c/em\u003e relatives of potato exposed to BCAs, but the effect can vary and it is therefore not so easy to predict unless investigated. Future studies should evaluate growth promotion effects of BCAs on wild plants under field conditions and at time points that reflect their use in agriculture. Such data on wild crop relatives may also be useful for finding genetic differences in the response to BCAs that could contribute to plant breeding for genotypes that respond well to BCAs (Schmidt et al. 2020).\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn this study, we showed that \u003cem\u003eA. solani\u003c/em\u003e can infect the three wild \u003cem\u003eSolanum\u003c/em\u003e species that occur in Sweden, supporting the hypothesis that they can be alternative hosts of this pathogen. To our knowledge, this is the first study to report infection of \u003cem\u003eA. solani\u003c/em\u003e in these wild species, which is important for the prediction of early blight disease epidemiology in the future. We also found that to some extent, the BCA \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e, but not the BCA \u003cem\u003eP. oligandrum\u003c/em\u003e can control early blight in wild \u003cem\u003eSolanum\u003c/em\u003e species. Moreover, these BCAs affected growth of the wild species, but the effects were not always positive. We conclude that the investigated BCAs can result in both positive and negative environmental effects when affecting these wild species within or near to potato fields. The variability in the responses suggests that these effects may be difficult to predict beforehand and therefore it may be beneficial to take the effects of BCAs on wild species into consideration for successful use of them in sustainable agriculture.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor contributions\u003c/h2\u003e \u003cp\u003e\u0026Aring;L initiated and coordinated the study. \u0026Aring;L, CBA, HM, EL, LGB contributed to the study conception and design. Material preparation and data collection was performed by \u0026Aring;L, CBA, HM, FQ, CDP, VH, LJS. Data analysis was performed by \u0026Aring;L. The first draft of the manuscript was written by \u0026Aring;L with help from CBA, CDP. \u0026Aring;L, HM, CDP, VH, EL, LGB contributed to manuscript editing and reviewing. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eWe thank Francesco Quaiotto, Kristin Aleklett and Daniella Weber for help in the greenhouse, and Sophie Brouwer and Maja Brus-Szkalej for lab support. The study was supported by Swedish Research Council (grant nr 2018\u0026ndash;04354 to \u0026Aring;L and grant nr 2023\u0026ndash;05529 to LGB and \u0026Aring;L), The Swedish Research Council Formas (grant nr 2021\u0026thinsp;\u0026minus;\u0026thinsp;01320 to \u0026Aring;L, EL, LGB and grant nr 2019\u0026thinsp;\u0026minus;\u0026thinsp;00881 to LGB) and the Carl Tryggers foundation (to \u0026Aring;L).\u003c/p\u003e\u003cp\u003eCompeting Interests: The authors have no competing interests to declare that are relevant to the content of this article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbreha KB, Lankinen \u0026Aring;, Masini L, Hydbom S, Andreasson E (2018) Late blight resistance screening of major wild Swedish Solanum species: \u003cem\u003eS. dulcamara\u003c/em\u003e, \u003cem\u003eS. nigrum\u003c/em\u003e and \u003cem\u003eS. physalifolium\u003c/em\u003e. Phytopathol 108:847\u0026ndash;857. https://doi.org/10.1094/PHYTO-10-17-0355-R\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAdolf B, Hausladen H (2015). Protocol for the artificial inoculation with \u003cem\u003eA. solani\u003c/em\u003e in field trials (with infected kernels). Euroblight Protocols for Alternaria. https://agro.au.dk/forskning/internationale-platforme/euroblight/alternaria/protocols. Accessed 6 November 2024\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAktar W, Sengupta D, Chowdhury (2009) Impact of pesticides use in agriculture: their benefits and hazards. Interdiscip. Toxicol. 2:1\u0026ndash;12. https://doi.org/10.2478/v10102-009-0001-7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndersen C (2023). Friend or Foe? Biocontrol interactions of \u003cem\u003ePythium oligandrum\u003c/em\u003e within the potato cropping system. Dissertation, SLU.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndersen CB, Aleklett K, Digdarshika G, Lankinen \u0026Aring;, Grenville-Briggs, L (2024). \u003cem\u003ePythium oligandrum\u003c/em\u003e induces growth promotion in starch potato without significantly altering the rhizosphere microbiome. Appl Soil Ecol 199:105423. https://doi.org/https://doi.org/10.1016/j.apsoil.2024.105423\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBardin M, Siegwart M (2022). Can pests develop resistance to biocontrol products? In: Fauvergue X, Rusch A, Barret M, Bardin M, Jacquin-Joly E, Malausa T, Lannou C (eds) Extended Biocontrol. Springer, Netherlands, pp 267\u0026ndash;272. https://doi.org/10.1007/978-94-024-2150-7_23\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarzman M, B\u0026agrave;rberi P, Birch ANE, Boonekamp P, Dachbrodt-Saaydeh S, Graf B, Hommel B, Jensen JE, Kiss J, Kudsk P, Lamichhane JR, Mess\u0026eacute;an A, Moonen A-C, Ratnadass A, Ricci P, Sarah J-L, Sattin M (2015) Eight principles of integrated pest management. Agron Sustain Dev 35:1199\u0026ndash;1215. https://doi.org/10.1007/s13593-015-0327-9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCalvo P, Nelson L, Kloepper JW (2014) Agricultural uses of plant biostimulants. Plant Soil 383:3\u0026ndash;41. https://doi.org/10.1007/s11104-014-2131-8\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCollinge DB, Jensen DF, Rabiey M, Sarrocco S, Shaw MW, Shaw RH (2022) Biological control of plant diseases \u0026ndash; What has been achieved and what is the direction? Plant Pathol 71: 1024\u0026ndash;1047. https://doi.org/10.1111/ppa.13555\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDanner C, Mach RL, Mach-Aigner AR (2023) The phenomenon of strain degeneration in biotechnologically relevant fungi. Appl Microbiol Biotechnol 107:4745\u0026ndash;4758. https://doi.org/10.1007/s00253-023-12615-z\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDara SK (2019) The new integrated pest management paradigm for the modern age. J Integr Pest Manag 10:1. https://doi.org/10.1093/jipm/pmz010\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeguine J-P, Aubertot J-N, Flor RJ, Lescourret F, Wyckhuys KAG, Ratnadass A (2021) Integrated pest management: good intentions, hard realities. A review. Agron Sustain Dev 41:38.. https://doi.org/10.1007/s13593-021-00689-w\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuarte HSS, Zambolim L, Capucho AS, J\u0026uacute;nior AFN, Rosado AWC, Cardoso CR, Paul PA, Mizubuti ESG (2013) Development and validation of a set of standard area diagrams to estimate severity of potato early blight. Eur J Plant Pathol 137:249\u0026ndash;257. https://doi.org/10.1007/s10658-013-0234-3\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEC (2009) Directive 2009/128/EC of the European Parliament and of the Council of 21 October 2009 establishing a framework for Community action to achieve the sustainable use of pesticides. http://data.europa.eu/eli/dir/2009/128/2019-07-26. Accessed 10 January 2023\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEC (2024) EU pesticide database for active substances. https://ec.europa.eu/food/plant/pesticides/eu-pesticides-database/start/screen/active-substances. Accessed 8 April 2024\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdin E, Liljeroth E, Andersson B (2019) Long term field sampling in Sweden reveals a shift in occurrence of cytochrome b genotype and amino acid substitution F129L in \u003cem\u003eAlternaria solani\u003c/em\u003e, together with a high incidence of the G143A substitution in \u003cem\u003eAlternaria alternata\u003c/em\u003e. Eur J Plant Pathol 155:627\u0026ndash;641. https://doi.org/10.1007/s10658-019-01798-9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEinspanier S, Susanto T, Metz N, Wolters PJ, Vleeshouwers VGAA, Lankinen \u0026Aring;, Liljeroth E, Landschoot S, Ivanović Ž, H\u0026uuml;ckelhoven R, Hausladen H, Stam R (2022) Whole-genome sequencing elucidates the species-wide diversity and evolution of fungicide resistance in the early blight pathogen Alternaria solani. Evol Appl 15:1605\u0026ndash;1620. https://doi.org/10.1111/eva.13350\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-Saadony MT, Saad AM, Soliman SM, Salem HM, Ahmed AI, Mahmood M, El-Tahan AM, Ebrahim AAM, Abd El-Mageed TA, Negm SH, Selim S, Babalghith AO, Elrys AS, El-Tarabily KA, AbuQamar SF (2022) Plant growth-promoting microorganisms as biocontrol agents of plant diseases: mechanisms, challenges and future perspectives. Front Plant Sci 13:923880. https://doi.org/10.3389/fpls.2022.923880\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEriksson D, Carlson-Nilsson U, Ort\u0026iacute;z R., Andreasson E (2016) Overview and breeding strategies of table potato production in Sweden and the Fennoscandian region. Potato Res 59:279\u0026ndash;294. https://doi.org/10.1007/s11540-016-9328-6\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGr\u0026ouml;nberg L, Andersson B, Yuen JE (2012) Can weed hosts increase aggressiveness of \u003cem\u003ePhytophthora infestans\u003c/em\u003e on potato? Phytopathol 102:429\u0026ndash;433. https://doi.org/10.1094/PHYTO-12-11-0326\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHashemi M, Tabet D, Sandroni M, Benavent-Celma C, Seematti J, Andersen CB, Grenville-Briggs LJ (2022) The hunt for sustainable biocontrol of oomycete plant pathogens, a case study of \u003cem\u003ePhytophthora infestans\u003c/em\u003e. Fungal Biol Rev 40:53\u0026ndash;69. https://doi.org/10.1016/j.fbr.2021.11.003\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHinz HL, Winston RL, Schwarzl\u0026auml;nder M (2019) How safe is weed biological control? A global review of direct nontarget attack. Q Rev Biol 94:1. https://doi.org/10.1086/702340\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIBM SPSS Statistics for Windows (2022) SPSS (29.0). IBM Corp.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIndira Devi P, Manjula M, Bhavani RV (2022) Agrochemicals, environment, and human health. Annu Rev Environ Resour 47:399\u0026ndash;421. https://doi.org/10.1146/annurev-environ-120920\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKapsa JS (2008) Important threats in potato production and integrated pathogen/pest management. Potato Res 51:385\u0026ndash;401. https://doi.org/10.1007/s11540-008-9114-1\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarlsson Green K, Stenberg JA, Lankinen \u0026Aring; (2020) Making sense of integrated pest management (IPM) in the light of evolution. Evol Appl 13:1791\u0026ndash;1805. https://doi.org/10.1111/eva.13067\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKe J, Wang B, Yoshikuni Y (2021) Synthetic biology of plant-associated microbiomes in sustainable agriculture. Trends Biotechnol 39:244\u0026ndash;261). https://doi.org/10.1016/j.tibtech.2020.07.008\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKeswani C, Prakash O, Bharti N, V\u0026iacute;lchez JI, Sansinenea E, Lally RD, Borriss R, Singh SP, Gupta VK, Fraceto LF, de Lima R, Singh HB (2019) Re-addressing the biosafety issues of plant growth promoting rhizobacteria. Sci Total Environ 690:841\u0026ndash;852. https://doi.org/10.1016/j.scitotenv.2019.07.046\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKong F, Yang L (2023) Pathogen-triggered changes in plant development: virulence strategies or host defense mechanism? Front Microbiol 14:1122947. https://doi.org/10.3389/fmicb.2023.1122947\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar S, Bhowmick MK, Ray P (2021) Weeds as alternate and alternative hosts of crop pests. Indian Journal of Weed Science 53:14\u0026ndash;29. https://doi.org/10.5958/0974-8164.2021.00002.2\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar S, Singh R, Kashyap PL, Srivastava AK (2013) Rapid detection and quantification of \u003cem\u003eAlternaria solani\u003c/em\u003e in tomato. Sci Hortic 151:184\u0026ndash;189. https://doi.org/10.1016/j.scienta.2012.12.026\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLandschoot S, Carrette J, Vandecasteele M, De Baets B, H\u0026ouml;fte M, Audenaert K, Haesaert G (2017) Boscalid-resistance in \u003cem\u003eAlternaria alternata\u003c/em\u003e and \u003cem\u003eAlternaria solani\u003c/em\u003e populations: an emerging problem in Europe. Crop Prot 92:49\u0026ndash;59. https://doi.org/10.1016/j.cropro.2016.10.011\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLankinen \u0026Aring;, Abreha KB, Alexandersson E, Andersson S, Andreasson E (2016) Nongenetic inheritance of induced resistance in a wild annual plant. Phytopathol 106:877\u0026ndash;883. https://doi.org/10.1094/PHYTO-10-15-0278-R\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLankinen \u0026Aring;, Witzell J, Aleklett K, Furenhed S, Karlsson Green K, Latz M, Liljeroth E, Larsson R, L\u0026ouml;fkvist K, Meijer J, Menkis A, Ninkovic V, Olson \u0026Aring;, Grenville-Briggs L (2024) Challenges and opportunities for increasing the use of low-risk plant protection products in sustainable production. A review. Agron Sustain Dev 44:21. https://doi.org/10.1007/s13593-024-00957-5\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeiminger JH, Hausladen H (2012) Early blight control in potato using disease-orientated threshold values. Plant Dis 96:124\u0026ndash;130. https://doi.org/10.1094/PDIS-05-11-0431\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLovat C., Nassar, AMK, Kubow S, Li, XQ, Donnelly DJ (2016) Metabolic biosynthesis of potato (\u003cem\u003eSolanum tuberosum\u003c/em\u003e l.) antioxidants and implications for human health. Crit Rev Food Sci Nutr 56:2278\u0026ndash;2303. https://doi.org/10.1080/10408398.2013.830208\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMasini L, Grenville-Briggs LJ, Andreasson E, R\u0026aring;berg L, Lankinen \u0026Aring; (2019) Tolerance and overcompensation to infection by \u003cem\u003ePhytophthora infestans\u003c/em\u003e in the wild perennial climber \u003cem\u003eSolanum dulcamara\u003c/em\u003e. Ecol Evol 9:4557\u0026ndash;4567. https://doi.org/10.1002/ece3.5057\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatyjaszczyk E (2018) \u0026ldquo;Biorationals\u0026rdquo; in integrated pest management strategies. J Plant Dis Prot 125:523\u0026ndash;527. https://doi.org/10.1007/s41348-018-0180-6\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMostafanezhad H, Edin E, Grenville-Briggs LJ, Lankinen \u0026Aring;, Liljeroth E (2022) Rapid emergence of boscalid resistance in Swedish populations of \u003cem\u003eAlternaria solani\u003c/em\u003e revealed by a combination of field and laboratory experiments. Eur J Plant Pathol 162:289\u0026ndash;303. https://doi.org/10.1007/s10658-021-02403-8\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOdilbekov F, Carlson-Nilsson U, Liljeroth E (2014) Phenotyping early blight resistance in potato cultivars and breeding clones. Euphytica 197:87\u0026ndash;97. https://doi.org/10.1007/s10681-013-1054-4\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOdilbekov F, Edin E, Mostafanezhad H, Coolman H, Grenville-Briggs LJ, Liljeroth E (2019) Within-season changes in Alternaria solani populations in potato in response to fungicide application strategies. Eur J Plant Pathol 155:953\u0026ndash;965. https://doi.org/10.1007/s10658-019-01826-8\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOdilbekov F, Selga C, Ortiz R, Chawade A, Liljeroth E (2020) QTL mapping for resistance to early blight in a tetraploid potato population. Agronomy 10:728. https://doi.org/10.3390/agronomy10050728\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRabiey M, Ullah I, Shaw LJ, Shaw MW (2017) Potential ecological effects of \u003cem\u003ePiriformospora indica\u003c/em\u003e, a possible biocontrol agent, in UK agricultural systems. Biological Control 104:1\u0026ndash;9. https://doi.org/10.1016/j.biocontrol.2016.10.005\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRay P, Guo Y, Kolape J, Craven KD (2018) Non-targeted colonization by the endomycorrhizal fungus, \u003cem\u003eSerendipita vermifera\u003c/em\u003e, in three weeds typically co-occurring with switchgrass. Front Plant Sci 8:2236. https://doi.org/10.3389/fpls.2017.02236\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSCB (2022) Pesticides in agriculture and horticulture 2021. Use on crops. Statistiska meddelanden MI 31 SM 2202, Statistiska Centralbyr\u0026aring;n, Sweden. https://www.scb.se/contentassets/6e042f0902bb449fb15edc4c1eb8e22c/mi0502_2021i20_br_mi31br2202.pdf. Accessed 2 December 2024.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchmidt J, Dotson BR, Schmiderer L, van Tour A, Kumar B, Marttila S, Fredlund KM, Widell S, Rasmusson AG (2020) Substrate and plant genotype strongly influence the growth and gene expression response to \u003cem\u003eTrichoderma afroharzianum\u003c/em\u003e T22 in sugar beet. Plants 9:1\u0026ndash;14. https://doi.org/10.3390/plants9081005\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShahin EA Shepard JF (1979) An efficient technique for inducing profuse sporulation of \u003cem\u003eAlternaria\u003c/em\u003e species. Phytopathol 69:618\u0026ndash;620.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimberloff D, Stiling P (1996) How risky is biological control? Ecol 77:1965\u0026ndash;1974. https://doi.org/10.2307/2265693\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStenberg JA (2017) A conceptual framework for integrated pest management. Trends Plant Sci 22:759\u0026ndash;769. https://doi.org/10.1016/j.tplants.2017.06.010\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStridh LJ, Mostafanezhad H, Andersen CB, Odilbekov F, Grenville-Briggs L, Lankinen \u0026Aring;, Liljeroth E (2022) Reduced efficacy of biocontrol agents and plant resistance inducers against potato early blight from greenhouse to field. J Plant Dis Prot 129:923\u0026ndash;938. https://doi.org/10.1007/s41348-022-00633-4\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSusi H (2024) Alternative host shapes transmission and life-history trait correlations in a multi-host plant pathogen. Evol Appl 17:e13672. https://doi.org/10.1111/eva.13672\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSyed S, Prasad Tollamadugu NVKV (2019) Role of plant growth-promoting microorganisms as a tool for environmental sustainability. In: Buddolla V (ed) Recent Developments in Applied Microbiology and Biochemistry. Elsevier, pp. 209\u0026ndash;222. https://doi.org/10.1016/B978-0-12-816328-3.00016-7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaab A (2021) \u003cem\u003eSolanum nigrum\u003c/em\u003e and \u003cem\u003eSolanum physalifolium\u003c/em\u003e. In: Bhagirath Singh Chauhan (ed) Biology and Management of Problematic Crop Weed Species, 1st edn. Elsevier pp 357\u0026ndash;373. https://doi.org/10.1016/B978-0-12-822917-0.00005-7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVetukuri RR, Masini L, McDougal R, Panda P, de Zinger L, Brus-Szkalej M, Lankinen \u0026Aring;, Grenville-Briggs LJ (2020) The presence of \u003cem\u003ePhytophthora infestans\u003c/em\u003e in the rhizosphere of a wild \u003cem\u003eSolanum\u003c/em\u003e species may contribute to off-season survival and pathogenicity. Appl Soil Ecol 148:103475 https://doi.org/10.1016/j.apsoil.2019.103475\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"potato-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"potr","sideBox":"Learn more about [Potato Research](http://link.springer.com/journal/11540)","snPcode":"11540","submissionUrl":"https://www.editorialmanager.com/potr/default2.aspx","title":"Potato Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Alternaria solani, Bacillus amyloliquefaciens, disease epidemiology, growth promotion, Pythium oligandrum, wild Solanum species","lastPublishedDoi":"10.21203/rs.3.rs-5655317/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5655317/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIntegrated pest management (IPM) is an important tool for sustainable crop production. IPM includes a diversity of methods, e.g. the use of biological control agents (BCAs) for disease control or growth promotion. While there is an increasing interest in the use of BCAs, less is known about their environmental costs and benefits on wild species, such as wild crop relatives. For example, a BCA may have the positive effect of controlling disease in wild relatives, but could also have the negative effect of growth promotion on wild relatives that act as weeds. In this study we investigated if three wild potato relatives \u0026ndash; the perennial climber \u003cem\u003eSolanum dulcamara\u003c/em\u003e, and the annual weeds \u003cem\u003eS. nigrum\u003c/em\u003e and \u003cem\u003eS. physalifolium\u003c/em\u003e \u0026ndash; could be infected by \u003cem\u003eAlternaria solani\u003c/em\u003e, the causal agent of early potato blight in Sweden, and studied how two BCAs, \u003cem\u003ePythium oligandrum\u003c/em\u003e (a lab strain) and \u003cem\u003eBacillus amyloliquefaciens\u003c/em\u003e (Serenade\u0026reg;), affected the disease and growth promotion in a series of greenhouse and field experiments. Our studies confirmed the semantic knowledge that \u003cem\u003eA. solani\u003c/em\u003e can infect all three wild species, in particular the two annual species often growing as weeds in potato fields. We also found a disease controlling effect of \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e, but not \u003cem\u003eP. oligandrum\u003c/em\u003e, in the greenhouse. Some growth effects were found for both BCAs, but whether these were positive or negative varied with trait, plant species and genotypes. In conclusion, BCAs can confer both environmental costs and benefits on wild plants, which should be taken into consideration for development of sustainable agriculture.\u003c/p\u003e","manuscriptTitle":"Early blight infection and the influence of biocontrol agents on wild potato relatives: Implications for integrated pest management (IPM) in potato","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-23 08:50:48","doi":"10.21203/rs.3.rs-5655317/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-01-15T14:41:16+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-12-19T12:19:34+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"Potato Research","date":"2024-12-18T21:32:35+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-12-18T13:18:57+00:00","index":"","fulltext":""},{"type":"submitted","content":"Potato Research","date":"2024-12-16T10:51:28+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"potato-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"potr","sideBox":"Learn more about [Potato Research](http://link.springer.com/journal/11540)","snPcode":"11540","submissionUrl":"https://www.editorialmanager.com/potr/default2.aspx","title":"Potato Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"e5738d93-8c6c-4f50-a423-87f049af1ffd","owner":[],"postedDate":"December 23rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-09-08T16:00:51+00:00","versionOfRecord":{"articleIdentity":"rs-5655317","link":"https://doi.org/10.1007/s11540-025-09905-6","journal":{"identity":"potato-research","isVorOnly":false,"title":"Potato Research"},"publishedOn":"2025-09-05 15:57:41","publishedOnDateReadable":"September 5th, 2025"},"versionCreatedAt":"2024-12-23 08:50:48","video":"","vorDoi":"10.1007/s11540-025-09905-6","vorDoiUrl":"https://doi.org/10.1007/s11540-025-09905-6","workflowStages":[]},"version":"v1","identity":"rs-5655317","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5655317","identity":"rs-5655317","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}