Targeting Fyn kinase for alleviation of cognitive impairment in Streptozocin-induced Alzheimer’s disease in mice by Loperamide; An Experimental and In silico analysis

Targeting Fyn kinase for alleviation of cognitive impairment in Streptozocin-induced Alzheimer’s disease in mice by Loperamide; An Experimental and In silico analysis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Targeting Fyn kinase for alleviation of cognitive impairment in Streptozocin-induced Alzheimer’s disease in mice by Loperamide; An Experimental and In silico analysis Halima Qadir, Haroon Hussain, Amama Ghaffar, Fawad Ali Shah, Sagheer Ahmed This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6268540/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Jun, 2025 Read the published version in Neurochemical Research → Version 1 posted 13 You are reading this latest preprint version Abstract Alzheimer’s disease (AD) is a complex, progressive neurodegenerative disorder that leads to irreversible deterioration of neuronal cells over time. It is the most frequent cause of dementia in elderly individuals globally. Current treatment drugs exhibit a modest effect on AD patients. Fyn kinase is implicated in AD pathogenesis, and its interactions with both AD hallmarks Aβ and tau make it a unique therapeutic target. To explore small molecule inhibitors effective in treating AD, FDA-approved drugs were evaluated using molecular docking to determine their affinity for fyn kinase. The findings of molecular simulations support the repurposing of loperamide for treating AD. Swiss albino mice were divided into six groups, including sham control, STZ group, donepezil-treated positive control, and three loperamide-treated groups with varying doses (2.5, 5, 10 mg/kg). Cognitive functions were assessed using Novel Object Recognition (NOR), Morris Water Maze (MWM), and Elevated Plus Maze (EPM) tests. Histological analyses were performed using Congo red, hematoxylin-eosin, and nissl staining. Gene expression of AD markers including Fyn, App, tau, Dlg4, Gfap, Bdnf, Cal1, Ide, Nep, and Sv2a were evaluated using qPCR. Our results show that Loperamide treatment significantly improved cognitive function in mice, reduced amyloid accumulation and neuronal loss, and enhanced Aβ clearance most probably by upregulating Nep and IDE. Additionally, qPCR results revealed a significant decrease in Fyn expression. We conclude from these investigations that Loperamide may serve as a promising therapeutic agent for AD by potentially targeting Fyn kinase, suggesting that further research is needed to explore its effectiveness in treating AD. Alzheimer’s disease fyn kinase loperamide molecular docking molecular dynamic simulation. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 1. Introduction Alzheimer’s disease (AD) is a relentless, chronic, and debilitating neurodegenerative disease that takes almost two decades to develop fully before the initial symptoms begin to appear [ 1 ]. AD is typically marked by gradual and progressive loss of cognitive abilities, changes in behavior, reduced independence, and increasing requirements for care and support. Age is the primary risk factor for AD development while other significant factors contributing to its pathology include the presence of one or more apolipoprotein gene E4 alleles (APOE4), cardiovascular disorders, family history of AD, and severe brain injuries [ 2 ]. The key hallmarks of AD include the deposition of β amyloid plaques and neurofibrillary tangles of hyperphosphorylated tau [ 1 ]. Moreover, the presence of neuropil threads, dystrophic neurites, and astrocytic activation, are found to play a pivotal role. These pathological processes culminate in widespread synaptic disruption and neuronal loss, thereby contributing to brain atrophy and cognitive decline, which are the characteristic features of AD [ 3 ]. To date, available treatments for AD provide symptomatic relief only, aimed at alleviating neurotransmitter imbalance. There are three cholinesterase inhibitors (CIs) approved for the treatment of mild to moderate AD, while memantine is a further therapeutic option for patients with moderate to severe AD [ 4 ]. Recent advancements in AD treatment focus on monoclonal antibodies as a promising new approach [ 5 ]. However, the use of monoclonal antibodies faces significant challenges, including high cost, logistical complexities, and risk of ARIA as well as the special requirement of infrastructure [ 5 ]. Given the current limitations, there is a substantial need for novel therapies that can modify the course of AD. Disruption of Aβ plaque formation and neurofibrillary tangles are crucial to halt its progression. Fyn is an attractive target found to be implicated in AD pathology. Fyn is activated by Aβ and interacts with tau protein, connecting the two key pathways of disease [ 6 ]. Thus Fyn inhibition may serve as a means of slowing or preventing disease progression [ 7 – 9 ]. This study aimed to repurpose Loperamide a drug identified through virtual screening as a potential Fyn kinase inhibitor for AD treatment. Loperamide, an FDA-approved phenylpiperidine opioid, is widely used as a non-prescription treatment for diarrhea [ 10 ]. Drug repurposing seeks to unravel novel indications of existing drugs other than their known effects and mechanisms. Escalating clinical trial failures have led to the emergence of drug repurposing as a critical approach to reduce risk and increase success [ 11 ]. We repurposed loperamide as a potential therapeutic agent aiming to mitigate the extent of cognitive impairment in AD. Initial in-silico screening of FDA-approved agents identified 10 potential Fyn kinase inhibitors, which were subsequently narrowed down to loperamide due to its ease of availability for further evaluation. In vivo experiments, histological and molecular studies were performed to investigate the effects of Fyn inhibition on AD-related biomarkers. 2. Methods 2.1. Ethical Approval The proposed research methods were reviewed and approved by the Research Ethical Committee of Shifa International Hospital, Islamabad, with a reference number of IRB 0300-23. This approval was granted in accordance with the guidelines for the care and use of laboratory animals set by the National Institute of Health. 2.2. In silico studies 2.2.1. Protein sequence retrieval The UniProtKB database was utilized to retrieve the sequence of the Fyn protein (https://www.uniprot.org/uniprotkb/P39688/entry), with accession ID: P39688. The UniProt is a comprehensive, freely accessible database that provides information on protein sequences 2.2.2. Selection of Drug Compounds The DrugBank database (https://go.drugbank.com/) was utilized to retrieve the FDA-approved drug dataset, which comprises 2,508 drug compounds that were downloaded in a PDB format. The DrugBank is an open-source, extensive, and up-to-date database that dispenses comprehensive information on approved and experimentally validated drugs. The drug compounds that have been validated and known to function well in many diseases, along with their toxicities and activities, were selected [12]. 2.2.3. Structure prediction of protein The homology modeling techniques were employed to predict the 3D structure of the fyn protein utilizing MODELLER 10.3 [13]. It can efficiently perform the fold assignment de novo modeling of loops in protein structures with high speed and accuracy, pairwise, and multiple sequence alignment [13]. Initially, the NCBI BLAST sequence search (blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to pinpoint the template structure based on query coverage and the identity of the template sequence with the target sequence. Subsequently, the 3D structure of the template protein was retrieved by employing the PDB (https://www.rcsb.org/) with PDB ID: 2H8H. The PDB is a universal repository that comprises the experimentally determined and validated 3D structures of macromolecules [14]. Moreover, the structure was then subjected to cleaning utilizing the UCSF Chimera, where the non-standard residues and unnecessary chains were removed. Furthermore, loop modeling was performed to model the unmodeled regions in the structure employing MODELLER 10.3. Additionally, the modeled template structure was utilized to perform homology modeling of the fyn protein, as a result of which ten models were generated, and the best model was selected on the basis of the DOPE score. 2.2.4. Structure evaluation of protein The resulting predicted protein model underwent a structural evaluation to assess the validity of the structure utilizing a combination of web servers such as UCLA-DOELAB — SAVES v6.0, QMEAN, and ProSA-web. To predict the several types of stereochemical parameters and analyze the errors in the 3D structure of the protein, the SAVES v6.0 (https://saves.mbi.ucla.edu/) and ProSA web servers (https://prosa.services.came.sbg.ac.at/prosa.php) were utilized respectively. The ProSA results indicate the overall quality of the models compared to experimentally determined protein structures obtained from x-ray crystallography and nuclear magnetic resonance (NMR) [15]. Furthermore, the ERRAT statistics that evaluate non-bonded interactions in the predicted structures and Verify 3D were also determined by utilizing Saves 6.0 [16]. ERRAT evaluates the overall quality of non-bonded atomic interactions within protein structures where higher scores indicate better quality [17]. Moreover, to evaluate the major geometrical features of protein structures, QMEAN (https://swissmodel.expasy.org/qmean/) was employed to calculate the consistency of pairwise distances between Cα atoms in the predicted models, utilizing constraints extracted from homologous structures [18]. Additionally, the three aforementioned webservers generated results that verified the overall quality of the predicted structure. 2 .2.5. Molecular docking The Fyn protein was screened against the FDA-approved 2,508 drug compounds by employing the AutoDock Vina [19]. The AutoDock Vina utilizes an advanced optimization method, can speed up the execution by using a multithreading process, and offers high accuracy [20]. In the docking process, grid box coordinates were used. As a result of the molecular docking, the output PDBQT files were generated. Furthermore, the vina split was performed, and this resulted in different binding affinities of the generated 9 different poses of the ligand with protein in PDBQT format, and the top complexes with the highest binding affinity poses were selected to generate protein-ligand complexes. These complexes were visualized in PyMol (The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC), a Python-based graphic tool widely used for the visualizations of 3D molecular structures [21]. 2.2.6. ADMET analysis To elucidate the pharmacokinetic, toxicological, and ADMET properties, the selected top compounds were subjected to the Absorption, Distribution, Metabolism, Excretion, and Toxicity (ADMET) analysis using ADMETSar 2.0 [22], a web server that provides comprehensive, precise, and efficient prediction of the ADMET profiles for the drug compounds [23]. The top 10 compounds that complied with Lipinski’s rule of five and were capable of crossing the blood-brain barrier were selected. 2.2.7. Domain analysis The InterPro public database (https://www.uniprot.org/) was utilized to identify the functional domains of the fyn protein. The InterPro database is a freely accessible database that determines the functional domains and their regions in the proteins by employing and classifying the protein sequences into families [24]. The length and name of the domains were retrieved from the InterPro database and were further used for the protein and ligand interaction analysis. 2.2.8. Protein-ligand interaction analysis The protein-ligand interaction analysis was conducted to identify the interacting residues of proteins with their respective ligands by employing the Protein-ligand interaction profiler (PLIP) web-based tool (https://plip-tool.biotec.tu-dresden.de), which identified the binding residues within the protein-ligand complexes. This tool acquires the 3D structure of the protein as input, displaying the interactions between the protein and the ligand [25]. It generates an extensive report that includes the residue name and interactions between the protein and the ligand. 2.2.9. Molecular dynamics simulations Classical Molecular Dynamics (MD) simulates atomic-level biological system evolution to evaluate the conformational stability and interaction of the complexes [26]. The MD simulation was conducted on wild-type fyn and docked complex (fyn protein with loperamide) using the Desmond module of Maestro 12.0 (version 12.0.012, Schrödinger, LLC, New York, NY), a GPU-enabled high-performance molecular dynamics suite [27]. Initially, the protein underwent preprocessing and refinement in the protein preparation wizard, where water beyond 5 angstroms was removed. Moreover, each complex was solvated in a water box of size 10 with periodic boundary conditions (PBC) using the TIP3P water model. An OPLS force field and salt ions (Na + and Cl - ) were incorporated. Subsequently, the prepared system underwent a 100-step energy minimization process before the simulation run. Further, the prepared system was then loaded into the MD window module, where parameters were set for a simulation time of 50 nanoseconds (ns) at a default temperature of 300K and pressure bar of 1 atmospheric pressure (atm). The remaining parameters were unchanged and can be found in the Desmond user guide [28]. Lastly, the trajectory file from the simulation was loaded into the simulation interaction diagram module tool in the Desmond package to conduct post-simulation analysis, including the calculation of root mean square deviation (RMSD) and root mean square fluctuations (RMSF). The binding capabilities of the molecules were observed throughout the simulation run by generating snapshots every 50th frame. 2.3. Experimental Animals Swiss albino male mice weighing 30-40g were used for this study. These animals were housed in Shifa College of Pharmaceutical Sciences, Shifa Tameer e Millat University, Islamabad. Mice were maintained in a controlled environment with 5-6 animals per cage, a 12-hour light/dark cycle, and unrestricted access to food and water. 2.4. Experimental Design The animals were randomly assigned to six groups, each comprising 10 mice. Group 1: Sham group received citrate buffer 0.01 mL/kg intracerebroventricular (ICV); Group II STZ group 3 mg/kg ICV; Group III: Donepezil (Positive Control) 3 mg/kg i.p; Group IV: Loperamide 2.5 mg/kg; Group V: Loperamide 5 mg/kg; Group VI: Loperamide 10 mg/ kg; respectively through intraperitoneal route. Treatments were given to III, IV, V, and VI groups for 23 days. All groups except the control received STZ 3mg/kg via the ICV route on day 1 and day 3. The experimental animals received weight-based doses. The animals were monitored daily for signs of morbidity and mortality. 2.5. Intracerebroventricular injection of Streptozocin Mice were anesthetized using ketamine (100mg/kg) and xylazine (10mg/kg) and restrained onto the stereotaxic apparatus. The scalp was incised to expose the skull. After locating Bregma, a unilateral hole was drilled into the mouse skull according to coordinates -1.0 mm lateral, -0.3 mm posterior, and -2.5 mm ventral, and 3mg/kg STZ solution in citrate buffer (pH 4.5) was administered [29]. Sham-operated mice received vehicle solution of the same volume. 2.6. Behavioural Tests 2.6.1. Novel object recognition test (NORT) The NORT was performed in a 30 cm × 30 cm × 30 cm wooden enclosure to evaluate the non-spatial memory of animals. This test comprised 3 phases conducted on three consecutive days. During phase one the animal was allowed to habituate, allowing it to freely explore the apparatus and get familiarized with the environment. The second phase was a training session, where two similar objects were placed in the apparatus and each mouse was allowed to explore the objects for 10 minutes. Testing takes place on the third day where one of the familiar objects was replaced by the novel object that differed significantly from the previous object in terms of size, shape, and color. Each mouse was left to explore the object for 5 min. After each experiment, the objects and arena were thoroughly sanitized with a 70% ethanol solution to eliminate any residual odors that might potentially affect the mice's behavior during subsequent trials [30]. 2.6.2. Morris water maze (MWM) test The spatial memory of mice was assessed using MWM according to the protocol described previously [29]. A round pool having a diameter of 180 cm was filled with water maintained at 21 ± 2°C was used. The pool was divided into four quadrants (target, left, right, and opposite) and four visible cues were placed on the walls of the pool. A 14cm diameter platform was submerged 1 cm below the surface of water for 4 trials per day over four consecutive days during training. The start position randomly varied across the four quadrants of the pool. For each trial mice were given 60 sec. to reach the hidden platform. If mice failed to locate the platform they were gently guided towards it. The mice were kept for 20 seconds on the platform for spatial orientation. Latencies to find the platform were recorded during the training period. A probe trial was conducted 24 hr. after the final training day. During probe trial the platform was removed and the animal was allowed to swim in water for 60 sec. The amount of time spent in the platform quadrant (target) was compared to the time spent in the other three quadrants. 2.6.3. Elevated plus maze (EPM) test The EPM test was performed to assess anxiety like behavior experienced during neurodegenerative diseases following method described previously [31]. The apparatus consisted of two open arms (25 cm × 5 cm) and two closed arms of the same size with 15-cm-high walls and a central square (5 cm × 5 cm) connecting the arms. The mouse was placed at the distal end of one of the open arms, with its back to the central square platform. Transfer latency was then measured, which refers to the time it takes for the mouse to enter any one of the closed arms using all four paws. Number of entries in either of the arms was calculated in EPM test [32]. 2.7. Brain tissue collection After completion of behavioral tests, all the animals were euthanized and decapitated. Brains were removed for further molecular and histological analysis. The brains of four animals were fixed in 4% formalin solution for at least 24 hours before processing for histological examination. The remaining brains were kept at -80 °C until molecular studies were performed. 2.8. Congo red Staining Congo red staining is a widely used qualitative method that enables detection of amyloid deposits in brain tissue sections. Briefly the paraffin-embedded brain slices were deparafinized by immersing in xylene, then rehydrated using series of graded ethanol solutions followed by rinse with distilled water. Subsequently these hydrated sections were stained with 0.5 % Congo red solution for 30 sec. The stained sections were sequentially incubated for 1 minute in 50% ethanol, 70% ethanol and finally dehydrated with 100% ethanol. Finally cleared with xylene and coversliped using mountant media and photographed under microscope [33]. These images were analyzed using ImageJ software for presence of amyloid plaque. 2.9. Haematoxylin eosin staining Xylene was used to deparafinize paraffin embedded tissue sections. These sections were hydrated using gradient solution of ethanol 100%, 90%, 80% and 75%. Hematoxylin and eosin solution was used for staining these sections and then rinsed with distilled water. Subsequently these sections were dehydrated in absolute alcohol, cleared in xylene and coversliped. Cortex, hippocampal CA1 and DG regions were observed under light microscope and photographed [34]. The photographed images were further analyzed using ImageJ software while focusing on survival of neuronal cells. 2.10. Nissl staining Coronal sections of brain fixed on slides were deparafinized in xylene and hydrated in serial grades of ethanol. The tissue was stained with Nissl stain for 3 minutes, followed by dehydration, clearing, and coversliped. Later on these slides were observed under microscope and photographed [35]. ImageJ software was used for further analysis of these images. 2.11. RNA extraction and gene expression determination Trizol reagent was used to extract total RNA from cerebral cortex. RNA was reverse-transcribed into cDNA using a reverse transcriptase-PCR kit, following the manufacturer's instructions for optimal conversion. The purity and yield of RNA was determined using NanoDrop™ ND-1000 apparatus (Thermo Fisher, Waltham, MA, USA). Quantitative polymerase chain reaction (qPCR) was carried out using a reaction mixture comprising of Sybr Green PCR Master Mix cDNA, nuclease-free water, and primers. Data was analyzed using comparative cycle threshold (Ct) (ΔΔCt) method. Expression levels were normalized using β-actin as the endogenous reference gene. The primer sequences used in this study are listed in Table 1. Each sample was analyzed in duplicate and the results represent the n-fold difference in the transcript levels among different groups [36]. Table 1 Primers sequence of genes used for expression analysis Gene Sequence Amyloid precursor protein (App) TCCGTGTGATCTACGAGCGCAT GCCAAGACATCGTCGGAGTAGT Synaptic Vesicle Glycoprotein 2A (sv2a) TCCAGTCTGACACAGGAACCTG GCCGATACTCTGGACTGAAGCA Tau CCAACATTGCCTCTGGTGAGGA GCACCACTTGATGGACGGGATC Neprilysin (Nep) ACCAGAACCTGTCCAAGGAGG CATCAGGTCCATTCGGTGGTAC Insulin degrading enzyme (Ide) CAAACCTCTCCTTCCAAGTCAC TGTTCTCCGAGGTGCTCTGCAT Discs Large MAGUK Scaffold Protein 4 ( Dlg4 ) TCAGACGGTCACGATCATCGCT GTTGCTTCGCAGAGATGCAGTC Brain derived neurotrophic factor (Bdnf) GGCTGACACTTTTGAGCACGTC CTCCAAAGGCACTTGACTGCTG Fyn CAGTTGACTCCATCCAGGCAGA CACGGATGGAAAGTGAGTAGC Glial Fibrillary Acidic Protein (Gfap) CACCTACAGGAAATTGCTGGAG CCACGATGTTCCTCTTGAGGTG Calbindin 1 ( cal-1) CTTGCTGCTCTTTCGATGCCAG GTTCCTCGGTTTCGATGAAGCC Beta actin (Actb) CTGAATGGCCCAGGTCTGA CCCTGGCTGCCTCAACA 2.12. Statistical Analysis All values are expressed as the mean ± SEM. Statistical analyses were performed using GraphPad Prism 6.0 software (La Jolla, CA, USA). Percentage time spent with novel object vs. familiar object in NORT, number of entries in close arm vs open arm in EPM, and MWM behaviour data were assessed by two-way ANOVA followed by Tukey’s post hoc analysis for multiple comparisons. The other parameters were executed using one-way ANOVA followed by Tukey’s post-hoc test for multiple comparisons. Probability values P < 0.05 were considered statistically significant. 3. Results 3.1. Insilico studies 3.1.1. Protein domain analysis The InterPro database was utilized to analyse the protein domains and gain insight into the functional characteristics of the fyn protein. Seven domains were found, including SH3 Domain (82-143), Fyn/Yrk, SH3 Domain (85-140), SH2 Domain (147-246), Fyn/Yrk SH2 Domain (145-245), Protein Kinase Domain (271-524), Serine-threonine/tyrosine-protein kinase, catalytic Domain (271-518), and Tyrosine-protein kinase, catalytic domain (271-520), as shown in Figure 1a. The fyn protein domains and their sequence lengths are mentioned below in Table 2. Table 2 The domains of fyn protein along with their sequence lengths. Domains Positions SH3 Domain 82-143 Fyn/Yrk, SH3 Domain 85-140 SH2 Domain 147-246s Fyn/Yrk SH2 Domain 145-245 Protein Kinase Domain 271-524 Serine-threonine/tyrosine-protein kinase, catalytic Domain 271-518 Tyrosine-protein kinase, catalytic domain 271-520 3.1.2. Structural evaluation and molecular docking of Fyn The predicted protein structure of fyn was observed to have an overall high-quality score on all three web servers (UCLA-DOE LAB — SAVES v6.0, ProSA web, and QMEAN). The ERRAT and Verify3D resulted in a good quality score of the fyn protein, while the ProSA web and QMEAN also showed significant results. The ERRAT score on SAVES was 74.06, while the ProSA web exhibited -10.6 Z-score and QMEAN showed a score of 0.76, respectively. The fyn protein structure evaluation scores are mentioned in Table 3. Lastly, the molecular docking of the fyn protein with loperamide resulted in 9 distinct poses with binding affinity scores ranging from -8.28 kcal /mol to -10.11 kcal /mol. The top pose (-10.11 kcal /mol) which exhibited interactions with the fyn protein was selected, as shown in Figure 1 (b-c). It was observed that the loperamide interacted with the ASN protein residue at position 333 which was found within the protein kinase domain, serine-threonine/tyrosine-protein kinase, catalytic domain, and tyrosine-protein kinase, catalytic domain region, indicating that loperamide might be implicated in the hindrance of fyn as the aforementioned domains are implicated in a multitude of cellular processes, including division, proliferation, apoptosis, and differentiation. Table 3 The Fyn protein structure evaluation scores using SAVES, ProSA web and QMEAN. Protein SAVES (ERRAT) SAVES (Verify3D) ProSA web QMEAN Fyn 74.06 93.26% of residues have averaged 3D-1D score -10.06 0.76 3.1.3. Molecular dynamics simulations The MD simulations of the wild-type fyn protein and the docked complex (fyn-loperamide) were performed to observe the flexibility and stability of the protein before and after binding with loperamide. The wild-type fyn protein showed that the protein was stable from 11.30 ns to 22.60 ns time. The RMSD value of the protein at the end of the simulation time was 9.23 Å. Moreover, the Fyn-Loperamide complex indicated that the protein was stable from 25.10 ns to 40.15 ns during the simulation time. Moreover, the minimum RMSD difference between the protein and the ligand was found at 26.80 ns. Additionally, the RMSD values of the protein and the ligand at the end of the simulation time were 7.92 Å and 12.34 Å, respectively. While comparing the RMSDs of wild-type fyn and fyn-loperamide complex, it was found that the protein was unstable before docked with loperamide, while after docking, the complex showed a slight decrease in RMSD value, indicating that the binding of loperamide with fyn provides stability to the protein complex, as shown in Figure 2. Moreover, the flexibility of the wild-type fyn protein and fyn-loperamide was assessed through RMSF graphs obtained from MD simulations. The wild-type fyn protein showed a slight decrease in RMSF value, whereas the fyn-loperamide showed a slight increase in RMSF value compared to wild-type fyn. In this regard, fyn-loperamide was found to be more flexible than the wild-type fyn, as shown in Figure 3. Furthermore, the PL-contacts showed 26 interacting protein residues, while MET-283 and ASP-290 exhibited interaction fractions for more than 40% of the simulation. The highest interactions were exhibited by ASP-290 (Hydrogen bonds = 0.036, Water bridges = 0.837, Ionic = 0.024), followed by MET-283 (Hydrogen bonds = 0.001, Water bridges = 0.476), LEU-215 (Hydrogen bonds = 0.068, Hydrophobic = 0.111, Water bridges = 0.135). Additionally, the timeline plot also showed that the ASP-290 and MET-283 protein residues interacted with loperamide over the simulation time, as shown in Figure 4 (a-b). Subsequently, the LP contacts indicated that loperamide interacted with the ASP-290 and MET-283 protein residues for 50% and 46% of the simulation time, respectively, as shown in Figure 4c. Lastly, the fyn-loperamide complex simulation snapshots indicated that the loperamide remained in the binding pocket of the fyn, suggesting a stable complex throughout the simulation. This indicated that the loperamide might be implicated in the functional hindrance of fyn by inhibiting its binding to its actual targets. The simulation snapshot of fyn -fyn-loperamide is shown in Figure 4d. 3.2. Loperamide mitigates cognitive decline in stz-induced AD mouse model: NORT was conducted to assess cognitive impairment induced in mice and to assess the effects of loperamide treatment on cognition. Mice have an intrinsic tendency to interact more with new objects as compared to familiar ones. Conversely, when memory impairment is present, mice do not differentiate and engage equally with both new and familiar objects. We observed that loperamide 10 mg/ kg treated mice spent a higher percentage of time (70%) with a novel object when compared to stz-induced AD mice (30%) (Figure 5). Moreover, improvement in cognition was also obvious through an increase in the discrimination index of loperamide-treated mice while diseased mice spent equal time with novel and familiar objects. Nonetheless, no significant difference was observed between the loperamide-treated and stz-induced AD group in the EPM test, which assesses the anxiety-like behavior associated with neurodegenerative diseases (Figure 5). Results from the MWM test demonstrated that loperamide treatment alleviated the learning and spatial memory deficits induced by icv stz administration (Figure 6 A). With each passing day, loperamide treatment improved latencies to the hidden platform while no significant difference was observed in stz treated group from day 1 to day 4 (Figure 6 B). During the probe trial, the loperamide-treated group showed a preference towards the target quadrant, particularly showing marked effects at the dose of 10 mg /kg. In a probe trial, the loperamide-treated group preferred the target quadrant with the most prominent effects observed in loperamide 10mg /kg. 3.3. Effect of Loperamide treatment on histopathological features of the cerebral cortex and hippocampus: The Congo red is a histological stain known for its ability to bind to amyloid fibers and produce a characteristic red coloration. A notable difference between Aβ aggregates in stz-induced AD and the loperamide-treated group was observed. The number of Aβ deposits was significantly reduced after the administration of loperamide at a dosage of 10 mg/kg, as evidenced by the results of Congo red staining in the cortex, dentate gyrus (DG), and cornu ammonis 1 (CA1) regions of the brain (Figure 7). Based on H & E staining, morphological changes in neuronal cells of the cerebral cortex and hippocampus (dentate gyrus: DG and cornu ammonis 1: CA1) were assessed. Microscopic examination of the sham group revealed a normal appearance with round-shaped cells and lightly stained cytoplasm. Histopathological analysis of STZ group showed pyknosis, characterized by darkly stained irregularly shaped neuronal cells in the cortex region. In the DG and CA1 regions, condensed nuclei with empty spaces around them were predominant. In comparison to the STZ group, Donepezil treatment did not improve neuronal death in the cortex region. In the treatment group, administration of Loperamide at the dose of 10 mg/kg enhanced the neuronal survival in the cerebral cortex and increased neuronal density in the DG and CA1 region (Figure 8). Nissl staining was then used to compare the presence of nissl bodies in normal, stz-induced AD and Loperamide-treated mice. In normal mice, nissl staining showed well-defined nissl bodies in the cortex and hippocampus regions. Conversely, stz-induced AD mice exhibited a significant reduction in the presence of nissl bodies in the cortex and hippocampus. The neurodegeneration in AD group was characterized by shrunken nuclei, pyknosis, and loss of structure. In comparison with other treatment groups’ neuronal loss in Loperamide 10 mg/ kg group was significantly reduced (Figure 9) 3.4. Modulation of AD Pathology-Related Gene Expression by Fyn Kinase Inhibition Fyn kinase in collaboration with Aβ and tau is found to exacerbate AD related pathology. We evaluated the expression of Fyn kinase and other genes that are critically involved in AD using qPcr (Figure 10). Fyn kinase levels were notably elevated in the stz-induced AD mice that strongly correlated with impaired performance in the MWM and NORT. In our study, we found a significant increase in the expression of App and tau, which are the key genes that are altered prior to the onset of cognitive impairment. This overexpression is significantly reduced in mice treated with Loperamide 10 mg/ kg. Moreover, we found a signification increase in the expression of genes Dlg4, Gfap, Cal1, and Sv2a in AD mice that were suppressed by Loperamide 10 mg/ kg treatment. On the other hand, genes encoding enzymes involved in the processing of App were decreased in the stz-induced AD mice group which were restored after treatment with Loperamide 10 mg/ kg. Bdnf is crucial for synaptic plasticity and neuronal survival. We found an increase in levels of Bdnf after treatment with Loperamide as well as donepezil. However, these findings did not reach statistical significance due to considerable variability in obtained data. 4. Discussion AD is age related, progressive neurodegenerative disease marked by cognitive loss, behavioral challenges and ultimately death [37]. Current treatment for AD merely serve to delay disease progression [38]. Despite extensive research, AD has intricate etiology and pathogenesis is not fully understood. The most widely accepted theory states that aberrant deposition of beta-amyloid proteins; tau hyper phosphorylation and neuronal inflammation are the key contributors of AD pathology [38]. Currently Fyn kinase has gained significant attention as a key mediator of tau-dependent synaptic toxicity, triggered by Aβ and is found to be overexpressed in brain of AD patients [39]. Moreover, Fyn kinase inhibition has shown significant potential in addressing AD pathology and this approach has advanced to clinical trials [39, 40]. The association of Fyn with key hallmarks of AD, Aβ and tau has prompted us to explore potential Fyn kinase inhibitors from FDA-approved agents. We aimed to evaluate impact of selected Fyn kinase inhibitors on cognition and other memory related aspects of AD. Repositioning of FDA approved drugs accelerates the drug discovery process by enabling researcher to identify new therapeutic target and indications using existing knowledge of these drugs [41]. In line with this approach, ligand-based virtual screening of 2,508 FDA-approved drugs from Drug Bank was conducted to identify potential Fyn kinase inhibitors. Based on binding affinity, ability to cross blood brain barrier ease of availability and results of simulation study, we selected Loperamide for further investigation through stz-induced AD mouse model. Loperamide is an over-the-counter drug primarily used to manage various forms of diarrhea. Donepezil was used as standard drug that is approved by FDA for symptomatic treatment of AD. The icv injected stz induced brain state in mice is widely used as model of sporadic AD and has been beneficial in predicting the outcomes of pharmacological interventions [42]. ICV administration of stz recapitulates key features of AD including formation of amyloid beta fragments, hyper phosphorylated tau, neuroinflammation, oxidative stress and biochemical alterations [43]. The effective induction of AD following stz icv administration and therapeutic efficacy of loperamide were evaluated using several behavioral assessments. The NORT is the most widely used test to assess cognition in rodents based on their natural inclination to explore a new object more than a familiar one [44]. The results of nort indicated that loperamide treatment (10mg/ kg) mitigated the cognitive deficits induced by stz. This was obvious through the increased exploratory behavior exhibited by the loperamide-treated mice toward the novel object. Furthermore the ability of to discriminate between novel and familiar object was enhanced in loperamide treated mice. This increase in discrimination ability underscores the potential of loperamide to improve cognitive performance, possibly by modulating neurochemical pathways that are disrupted in models of cognitive dysfunction [45]. In AD, spatial disorientation is among the earliest symptoms, with allocentric deficits noticeable in the preclinical asymptomatic stages [46]. MWM test is a valuable tool used in scientific research to assess spatial reference memory in animal model. The results of MWM test indicated decrease in latency to reach the hidden platform after 4 days of training in loperamide and donepezil treated mice. This indicates improvement in spatial learning. Correspondingly, the time spent in target quadrant increased in loperamide treated mice, indicating stronger memory retention. These findings prompt further exploration of mechanism underlying the neuroprotective potential of loperamide. While cognitive decline is the hallmark of AD, it is also associated with neuropsychiatric symptoms like psychological distress, anxiety, and depression [47]. Therefore we used the EPM, a widely accepted tool, in this study to evaluate anxiety-like behavior linked to neurodegenerative diseases like AD. However, loperamide did not demonstrate any anti-anxiety effects, as no significant differences in number of entries in open and closed arm were observed between any of the groups. A major pathological finding in AD is the accumulation of amyloid plaques that leads to neurodegeneration and impaired cognition [37]. Congo red is histological stain that allows for detection and visualization of amyloidal deposits in tissues by staining them red [48]. In the present study, we identified a substantial increase in stained amyloid beta plaques in the brains of stz-induced AD’s mice; however, treatment with loperamide (10 mg/kg) caused a significant reduction in these plaques. Moreover, autopsy findings in AD patients show significant neuronal loss, evidenced by cortical volume shrinkage, a reduction in gyri size of up to 50%, and enlarged sulci [49]. In line with the previous studies, amyloid beta deposits in brain triggers oxidative stress, and disrupts ionic homeostasis leading to neuronal dysfunction, synaptotoxicity and ultimately neuronal death [50]. H&E staining demonstrated increased neuronal loss in the cortex and hippocampus of AD mice. However, treatment with loperamide (5 mg/kg, 10 mg/kg) and donepezil there was notable reduction in this neuronal loss. These findings highlight neuroprotective potential of loperamide, suggesting it may be useful in therapeutic approach designed to prevent neuronal loss in AD. Additionally neuronal density increased in loperamide treated group in comparison to stz-induced AD group. Nissl staining is used to visualize nissl bodies and assess neuronal health, density, and morphology, which is essential for understanding neurodegenerative changes in AD [51]. Our study showed that number of nissl bodies reduced in stz-induced AD mice while loperamide treated group prevented loss of nissl bodies at the dose of 10 mg/ kg. Preserved Nissl bodies imply that loperamide could potentially sustain neuron functionality and reduce chance of neurodegeneration. Analyzing gene expression in brain is the key to understand cellular changes implicated in AD pathogenesis, its mechanism and the role of pharmacological treatments. Through comprehensive literature review we identified 10 dysregulated genes linked to AD pathology and cognition and evaluated the treatment effect on their expression [52-58]. App overexpression is the primary event in amyloid-beta-induced neurotoxicity and neurodegeneration [59]. Amyloid beta aggregation induces tau hyper phosphorylation that form neurofibrillary tangles and disrupt the transcription of genes regulating synaptic function [60]. Synaptic toxicity induced by Aβ and tau is linked through non-receptor tyrosine kinase Fyn that belongs to Src family and offers potential target for AD treatment [39, 61]. Studies indicate that Fyn overexpression contributes to synaptic deficits and cognitive impairment [39, 52]. In this study to evaluate the effect of loperamide on Aβ-fyn-tau toxic triad we measured their gene expression levels in stz-induced AD mouse model and treated groups. We found significantly increased expression of fyn, App and tau in the AD mice. Interestingly loperamide treatment led to substantial decrease in expression of these genes, suggesting potential of loperamide to counteract the toxic effects associated with their overexpression. These findings corroborated the findings of behavior studies that showed loperamide in dose of 10 mg/ kg reduced cognitive deterioration and enhanced memory function in treated mice. [8, 62] state that Aβ, tau, and fyn jointly disrupt synaptic function, suggesting that targeting their co-pathogenic interactions could offer therapeutic benefits by restoring synapse density and reversing memory deficits, a result that is evident in our findings as well. The role of fyn in neuroinflammation has been less studied however, it has been reported earlier that presence of Aβ deposits in brain trigger proinflammatory response through fyn [63]. Besides fyn kinase inhibitor AZD 0530 in AD mice showed improvement in cognitive deficits through decreasing synapse loss, tau phosphorylation and astrogliosis [64]. In AD clinical research, Gfap levels are commonly assessed and regarded as reliable biomarker for reactive astrogliosis [65]. The neuroinflammatory response caused by AD pathology was assessed through measuring the glial fibrillary acidic protein (Gfap) expression. Loperamide and donepezil treatment showed anti-inflammatory potential in brain through reducing expression of Gfap. Bdnf is a neurotrophin that supports neuronal survival and development [66] and is predominantly expressed in cortex, hippocampus and basal brain which play key roles in memory and learning. Previous studies on Bdnf levels in AD patients have produced conflicting results [66]. We found significant increase in expression of Bdnf after inducing AD in mice when compared to sham group. The increase in BDNF might reflect a compensatory mechanism against neurodegeneration induced by stz [67]. However after treatment with loperamide as well as donepezil, no change in level of Bdnf was observed indicating loperamide has no effect on Bdnf. Dlg4 gene encodes PSD-95, a scaffolding protein at the postsynaptic density, crucial for maintaining synaptic plasticity and integrity [68]. According to previous studies increased levels of PSD-95 are positively correlated with Aβ and phosphorylated tau in AD patients, particularly in initial stages of disease [68-70]. In our study, PSD-95 levels increased in stz-induced AD mice as compared to sham group while loperamide (10 mg/ kg) group showed a significant trend towards normalization. This enhanced PSD-95 may be a compensatory response to neurotoxic effect of Aβ aimed at preserving synaptic function [68]. During early stage of AD, accumulation of Aβ and tau accompanied by calcium dysregulation leads to synaptic loss and disrupted neuronal network [71]. Research shows that cal-1 expression may increase in brain of transgenic Alzheimer's mouse models, as a compensatory response to calcium dysregulation caused by Aβ accumulation [72]. We observed increased cal-1 levels in the diseased group and a decrease in the loperamide-treated group. Decrease in cal-1 following loperamide treatment implies restoration of normal calcium signaling. While cal-1 buffers excessive calcium, sv2a functions as a glycoprotein that ensures proper neurotransmitter release, potentially reducing some synaptic disturbances induced by Aβ. In AD dysfunctional sv2a leads to accumulation of presynaptic Ca2+, which triggers the release of irregular neurotransmitters and destabilize the synaptic system [73]. We noted a significant increase in sv2a expression in both AD and treated mice as compared to sham group, however loperamide treatment showed no substantial effect on sv2a over expression, leaving the results inconclusive. Since Aβ aggregation contributes to neuronal toxicity associated with AD, its clearance is imperative for therapeutic strategies. Numerous enzymes have been reported to degrade Aβ with Ide and Nep being the most significant [74]. It has been reported that levels of these enzymes decline in patients diagnosed with sporadic AD [75]. In the non-treated group of stz-induced AD mice, we observed a marked suppression of Nep and Ide expression levels. Conversely, there was a significant increase in the expression levels of both Nep and Ide in the group of mice treated with loperamide. This enhancement suggests that loperamide may play a role in upregulating the activity of these enzymes, which are crucial for the degradation of amyloid-beta (Aβ) peptides associated with AD. Conclusion In summary, we present experimental data showing the significant anti-AD potential of loperamide. Treatment with loperamide improved cognitive behavior accompanied by reduced amyloid beta deposits and neuronal death. The decreased expression of key genes, including Fyn, APP, tau, Dlg4, cal-1, and Gfap, after loperamide treatment, suggests a mechanism by which it may alleviate neurodegeneration associated with AD. Additionally, increased expression of Nep and Ide indicates loperamide treatment may aid in amyloid clearance and provide neuroprotection. Overall, these findings highlight the therapeutic potential of loperamide as a promising candidate for Alzheimer's treatment, warranting further investigation into its mechanisms and long-term effects. Statements and Declarations Author contributions: All authors equally contributed to the design, collection, analysis, formatting, and reviewing of the manuscript . All authors contributed significantly to the work presented in this article. [H.U] conceived the study and designed the experiments. [H.U, H.H and A.G] conducted the experiments and collected data. [H.U, S.A and F.S] analysed the data and interpreted the results. [H.U] wrote the manuscript and [S.A and F.S] provided critical revisions. All authors reviewed and approved the final version of the manuscript. Funding: The author (s) received no financial support for the research,authorship, or publication of this work. No funds, grants, or other support were received during the preparation of this manuscript. Acknowledgments: I would like to express my gratitude to Shifa Tameer-e-Millat University for providing the resources and support necessary for the completion of this research. Declaration of Interests I have nothing to declare. Data Availability : The datasets generated during and/or analyzed during the current study are not publicly available due to [data confidentiality] but are available from the corresponding author at reasonable request. Ethics approval : The study obtained ethical approval by the Research Ethical Committee of Shifa International Hospital, Islamabad, with a reference number of IRB 0300-23. This approval was granted in accordance with the guidelines for the care and use of laboratory animals set by the National Institute of Health. Competing interests: All Authors have checked and agreed for the publication of this manuscript without any conflict of interest. Availability of data and materials: The data that support the findings of this study are available on request from the corresponding author. Ethical Approval The proposed research methods were reviewed and approved by the Research Ethical Committee of Shifa International Hospital, Islamabad, with a reference number of IRB 0300-23. This approval was granted in accordance with the guidelines for the care and use of laboratory animals set by the National Institute of Health. References Petersen C, Nolan A L, De Paula França Resende E, Miller Z, Ehrenberg A J, Gorno-Tempini M L, Rosen H J, Kramer J H, Spina S, and Rabinovici G D (2019) Alzheimer’s disease clinical variants show distinct regional patterns of neurofibrillary tangle accumulation. Acta neuropathologica 138 : 597-612 Zvěřová M (2019) Clinical aspects of Alzheimer's disease. Clinical Biochemistry 72 : 3-6.https://doi.org/10.1016/j.clinbiochem.2019.04.015 Lane C A, Hardy J, and Schott J M (2018) Alzheimer's disease. European journal of neurology 25 : 59-70 Weller J and Budson A (2018) Current understanding of Alzheimer's disease diagnosis and treatment. F1000Res 7 .10.12688/f1000research.14506.1 Ameen T B, Kashif S N, Abbas S M I, Babar K, Ali S M S, and Raheem A (2024) Unraveling Alzheimer’s: the promise of aducanumab, lecanemab, and donanemab. The Egyptian Journal of Neurology, Psychiatry and Neurosurgery 60 : 72.10.1186/s41983-024-00845-5 Nygaard H B (2018) Targeting Fyn Kinase in Alzheimer's Disease. Biol Psychiatry 83 : 369-376.10.1016/j.biopsych.2017.06.004 Liang X, Yao Y, Lin Y, Kong L, Xiao H, Shi Y, and Yang J (2019) Panaxadiol inhibits synaptic dysfunction in Alzheimer's disease and targets the Fyn protein in APP/PS1 mice and APP-SH-SY5Y cells. Life Sciences 221 : 35-46.https://doi.org/10.1016/j.lfs.2019.02.012 Kaufman A C, Salazar S V, Haas L T, Yang J, Kostylev M A, Jeng A T, Robinson S A, Gunther E C, Van Dyck C H, Nygaard H B, and Strittmatter S M (2015) Fyn inhibition rescues established memory and synapse loss in Alzheimer mice. Ann Neurol 77 : 953-71.10.1002/ana.24394 Chen R J, Chang W W, Lin Y C, Cheng P L, and Chen Y R (2013) Alzheimer's amyloid-β oligomers rescue cellular prion protein induced tau reduction via the Fyn pathway. ACS Chem Neurosci 4 : 1287-96.10.1021/cn400085q Wu P E and Juurlink D N (2017) Clinical Review: Loperamide Toxicity. Annals of Emergency Medicine 70 : 245-252.https://doi.org/10.1016/j.annemergmed.2017.04.008 Das A K K, Sharma D, and Sharma L (2021) Drug repurposing strategy for treating Alzheimer’s disease. Alzheimer's & Dementia 17 : e058503.https://doi.org/10.1002/alz.058503 Cuesta S A, Mora J R, and Márquez E A (2021) In Silico Screening of the DrugBank Database to Search for Possible Drugs against SARS-CoV-2. Molecules 26 : 1100 Webb B and Sali A (2016) Comparative Protein Structure Modeling Using MODELLER. Curr Protoc Bioinformatics 54 : 5.6.1-5.6.37.10.1002/cpbi.3 Segura J, Rose Y, Bi C, Duarte J, Burley S K, and Bittrich S (2023) RCSB Protein Data Bank: visualizing groups of experimentally determined PDB structures alongside computed structure models of proteins. Frontiers in Bioinformatics 3 .10.3389/fbinf.2023.1311287 Wiederstein M and Sippl M J (2007) ProSA-web: interactive web service for the recognition of errors in three-dimensional structures of proteins. Nucleic Acids Research 35 : W407-W410.10.1093/nar/gkm290 Haron F N, Azazi A, Chua K H, Lim Y a L, Lee P C, and Chew C H (2022) In silico structural modeling and quality assessment of Plasmodium knowlesi apical membrane antigen 1 using comparative protein models. Trop Biomed 39 : 394-401.10.47665/tb.39.3.009 Messaoudi A, Belguith H, and Ben Hamida J (2013) Homology modeling and virtual screening approaches to identify potent inhibitors of VEB-1 β-lactamase. Theor Biol Med Model 10 : 22.10.1186/1742-4682-10-22 Benkert P, Künzli M, and Schwede T (2009) QMEAN server for protein model quality estimation. Nucleic Acids Res 37 : W510-4.10.1093/nar/gkp322 Eberhardt J, Santos-Martins D, Tillack A F, and Forli S (2021) AutoDock Vina 1.2.0: New Docking Methods, Expanded Force Field, and Python Bindings. J Chem Inf Model 61 : 3891-3898.10.1021/acs.jcim.1c00203 Trott O and Olson A J (2010) AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J Comput Chem 31 : 455-61.10.1002/jcc.21334 Rosignoli S and Paiardini A (2022) Boosting the Full Potential of PyMOL with Structural Biology Plugins. Biomolecules 12 .10.3390/biom12121764 Yang H, Lou C, Sun L, Li J, Cai Y, Wang Z, Li W, Liu G, and Tang Y (2019) admetSAR 2.0: web-service for prediction and optimization of chemical ADMET properties. Bioinformatics 35 : 1067-1069.10.1093/bioinformatics/bty707 Jia C Y, Li J Y, Hao G F, and Yang G F (2020) A drug-likeness toolbox facilitates ADMET study in drug discovery. Drug Discov Today 25 : 248-258.10.1016/j.drudis.2019.10.014 Blum M, Chang H Y, Chuguransky S, Grego T, Kandasaamy S, Mitchell A, Nuka G, Paysan-Lafosse T, Qureshi M, Raj S, Richardson L, Salazar G A, Williams L, Bork P, Bridge A, Gough J, Haft D H, Letunic I, Marchler-Bauer A, Mi H, Natale D A, Necci M, Orengo C A, Pandurangan A P, Rivoire C, Sigrist C J A, Sillitoe I, Thanki N, Thomas P D, Tosatto S C E, Wu C H, Bateman A, and Finn R D (2021) The InterPro protein families and domains database: 20 years on. Nucleic Acids Res 49 : D344-d354.10.1093/nar/gkaa977 Adasme M F, Linnemann K L, Bolz S N, Kaiser F, Salentin S, Haupt V J, and Schroeder M (2021) PLIP 2021: expanding the scope of the protein-ligand interaction profiler to DNA and RNA. Nucleic Acids Res 49 : W530-w534.10.1093/nar/gkab294 Carmena-Bargueño M, Martínez-Cortés C, Banegas-Luna A J, and Pérez-Sánchez H (2023) TOLEDO: Accelerated Maestro GUI molecular dynamics simulations. Abdelmoniem N, M H A, R M M, Moutasim F, Rafie Ahmed A, Edris A, Ibraheem W, Makki A A, E M E, Elhag R, Osman W, R A M, and Alzain A A (2023) Identification of Novel Natural Dual HDAC and Hsp90 Inhibitors for Metastatic TNBC Using e-Pharmacophore Modeling, Molecular Docking, and Molecular Dynamics Studies. Molecules 28 .10.3390/molecules28041771 Burger P B, Hu X, Balabin I, Muller M, Stanley M, Joubert F, and Kaiser T M (2024) FEP Augmentation as a Means to Solve Data Paucity Problems for Machine Learning in Chemical Biology. Journal of Chemical Information and Modeling 64 : 3812-3825.10.1021/acs.jcim.4c00071 Chen Y, Liang Z, Tian Z, Blanchard J, Dai C L, Chalbot S, Iqbal K, Liu F, and Gong C X (2014) Intracerebroventricular streptozotocin exacerbates Alzheimer-like changes of 3xTg-AD mice. Mol Neurobiol 49 : 547-62.10.1007/s12035-013-8539-y Lueptow L M (2017) Novel Object Recognition Test for the Investigation of Learning and Memory in Mice. J Vis Exp.10.3791/55718 Shoji H and Miyakawa T (2021) Effects of test experience, closed-arm wall color, and illumination level on behavior and plasma corticosterone response in an elevated plus maze in male C57BL/6J mice: a challenge against conventional interpretation of the test. Molecular Brain 14 : 34.10.1186/s13041-020-00721-2 Vasilopoulou F, Companys-Alemany J, Canudas A-M, Palomera-Ávalos V, Ortuño-Sahagún D, Pallàs M, and Griñán-Ferré C (2021) Anxiety, impaired social and aggressive behaviour correlates with cognitive decline accompanied by molecular alterations in older SAMP8 males. Sarkar S, Raymick J, Cuevas E, Rosas-Hernandez H, and Hanig J (2020) Modification of methods to use Congo-red stain to simultaneously visualize amyloid plaques and tangles in human and rodent brain tissue sections. Metabolic brain disease 35 : 1371-1383 Lian Q, Nie Y, Zhang X, Tan B, Cao H, Chen W, Gao W, Chen J, Liang Z, Lai H, Huang S, Xu Y, Jiang W, and Huang P (2016) Effects of grape seed proanthocyanidin on Alzheimer's disease in?vitro and in?vivo. Experimental and Therapeutic Medicine 12 .10.3892/etm.2016.3530 El Sayed N, Kandil E, and Ghoneum M (2021) Enhancement of Insulin/PI3K/Akt Signaling Pathway and Modulation of Gut Microbiome by Probiotics Fermentation Technology, a Kefir Grain Product, in Sporadic Alzheimer’s Disease Model in Mice. Frontiers in Pharmacology 12 : 666502.10.3389/fphar.2021.666502 Vasilopoulou F, Rodríguez-Arévalo S, Bagán A, Escolano C, Griñán-Ferré C, and Pallàs M (2021) Disease-modifying treatment with I(2) imidazoline receptor ligand LSL60101 in an Alzheimer's disease mouse model: a comparative study with donepezil. Br J Pharmacol 178 : 3017-3033.10.1111/bph.15478 Paladugu L, Gharaibeh A, Kolli N, Learman C, Hall T C, Li L, Rossignol J, Maiti P, and Dunbar G L (2021) Liraglutide Has Anti-Inflammatory and Anti-Amyloid Properties in Streptozotocin-Induced and 5xFAD Mouse Models of Alzheimer’s Disease. International Journal of Molecular Sciences 22 : 860 Peng Y, Jin H, Xue Y-H, Chen Q, Yao S-Y, Du M-Q, and Liu S (2023) Current and future therapeutic strategies for Alzheimer’s disease: an overview of drug development bottlenecks. Frontiers in Aging Neuroscience 15 .10.3389/fnagi.2023.1206572 Briner A, Götz J, and Polanco J C (2020) Fyn Kinase Controls Tau Aggregation In Vivo. Cell Reports 32 : 108045.https://doi.org/10.1016/j.celrep.2020.108045 Nygaard H B, Van Dyck C H, and Strittmatter S M (2014) Fyn kinase inhibition as a novel therapy for Alzheimer’s disease. Alzheimer's Research & Therapy 6 : 8.10.1186/alzrt238 Shamsi A, Khan M S, Yadav D K, and Shahwan M (2024) Structure-based screening of FDA-approved drugs identifies potential histone deacetylase 3 repurposed inhibitor: molecular docking and molecular dynamic simulation approaches. Frontiers in Pharmacology 15 .10.3389/fphar.2024.1424175 Gáspár A, Hutka B, Ernyey A J, Tajti B T, Varga B T, Zádori Z S, and Gyertyán I (2022) Performance of the intracerebroventricularly injected streptozotocin Alzheimer’s disease model in a translationally relevant, aged and experienced rat population. Scientific Reports 12 : 20247.10.1038/s41598-022-24292-5 Kadhim H J, Al-Mumen H, Nahi H H, and Hamidi S M (2022) Streptozotocin-induced Alzheimer's disease investigation by one-dimensional plasmonic grating chip. Scientific Reports 12 : 21878.10.1038/s41598-022-26607-y Szczepańska K, Bojarski A J, Popik P, and Malikowska-Racia N (2023) Novel object recognition test as an alternative approach to assessing the pharmacological profile of sigma-1 receptor ligands. Pharmacological Reports 75 : 1291-1298.10.1007/s43440-023-00516-x Broadbelt T, Mutlu-Smith M, Carnicero-Senabre D, Saido T C, Saito T, and Wang S-H (2022) Impairment in novelty-promoted memory via behavioral tagging and capture before apparent memory loss in a knock-in model of Alzheimer’s disease. Scientific Reports 12 : 22298.10.1038/s41598-022-26113-1 Curdt N, Schmitt F W, Bouter C, Iseni T, Weile H C, Altunok B, Beindorff N, Bayer T A, Cooke M B, and Bouter Y (2022) Search strategy analysis of Tg4-42 Alzheimer Mice in the Morris Water Maze reveals early spatial navigation deficits. Scientific Reports 12 : 5451.10.1038/s41598-022-09270-1 Pentkowski N S, Rogge-Obando K K, Donaldson T N, Bouquin S J, and Clark B J (2021) Anxiety and Alzheimer's disease: Behavioral analysis and neural basis in rodent models of Alzheimer's-related neuropathology. Neurosci Biobehav Rev 127 : 647-658.10.1016/j.neubiorev.2021.05.005 Sarkar S, Raymick J, Cuevas E, Rosas-Hernandez H, and Hanig J (2020) Modification of methods to use Congo-red stain to simultaneously visualize amyloid plaques and tangles in human and rodent brain tissue sections. Metab Brain Dis 35 : 1371-1383.10.1007/s11011-020-00608-0 Goel P, Chakrabarti S, Goel K, Bhutani K, Chopra T, and Bali S (2022) Neuronal cell death mechanisms in Alzheimer's disease: An insight. Front Mol Neurosci 15 : 937133.10.3389/fnmol.2022.937133 Nie J, Tian Y, Zhang Y, Lu Y-L, Li L-S, and Shi J-S (2016) Dendrobium alkaloids prevent Aβ 25–35 -induced neuronal and synaptic loss via promoting neurotrophic factors expression in mice. PeerJ 4 : e2739.10.7717/peerj.2739 Brasnjevic I, Lardenoije R, Schmitz C, Kolk N, Dickstein D, Takahashi H, Hof P, Steinbusch H, and Rutten B (2013) Region-specific neuron and synapse loss in the hippocampus of APPSL/PS1 knock-in mice. Translational Neuroscience 4 .10.2478/s13380-013-0111-8 Chin J, Palop J J, Puoliväli J, Massaro C, Bien-Ly N, Gerstein H, Scearce-Levie K, Masliah E, and Mucke L (2005) Fyn kinase induces synaptic and cognitive impairments in a transgenic mouse model of Alzheimer's disease. Journal of Neuroscience 25 : 9694-9703 Bustos F J, Ampuero E, Jury N, Aguilar R, Falahi F, Toledo J, Ahumada J, Lata J, Cubillos P, Henríquez B, Guerra M V, Stehberg J, Neve R L, Inestrosa N C, Wyneken U, Fuenzalida M, Härtel S, Sena-Esteves M, Varela-Nallar L, Rots M G, Montecino M, and Van Zundert B (2017) Epigenetic editing of the Dlg4/PSD95 gene improves cognition in aged and Alzheimer’s disease mice. Brain 140 : 3252-3268.10.1093/brain/awx272 Wes P D, Easton A, Corradi J, Barten D M, Devidze N, Decarr L B, Truong A, He A, Barrezueta N X, and Polson C (2014) Tau overexpression impacts a neuroinflammation gene expression network perturbed in Alzheimer’s disease. PloS one 9 : e106050 Mikkelsen J D, Kaad S, Aripaka S S, and Finsen B (2023) Synaptic vesicle glycoprotein 2A (SV2A) levels in the cerebral cortex in patients with Alzheimer's disease: a radioligand binding study in postmortem brains. Neurobiology of Aging 129 : 50-57.https://doi.org/10.1016/j.neurobiolaging.2023.05.003 Yamamoto N, Nakazawa M, Nunono N, Yoshida N, Obuchi A, Tanida M, Suzuki K, Ikeda-Matsuo Y, and Sobue K (2021) Protein kinases A and C regulate amyloid-β degradation by modulating protein levels of neprilysin and insulin-degrading enzyme in astrocytes. Neuroscience Research 166 : 62-72 Amidfar M, De Oliveira J, Kucharska E, Budni J, and Kim Y-K (2020) The role of CREB and BDNF in neurobiology and treatment of Alzheimer's disease. Life sciences 257 : 118020 Low C Y, Lee J H, Lim F T, Lee C, Ballard C, Francis P T, Lai M K, and Tan M G (2021) Isoform‐specific upregulation of FynT kinase expression is associated with tauopathy and glial activation in Alzheimer's disease and Lewy body dementias. Brain Pathology 31 : 253-266 Abid N B, Naseer M I, and Kim M O (2019) Comparative Gene-Expression Analysis of Alzheimer's Disease Progression with Aging in Transgenic Mouse Model. Int J Mol Sci 20 .10.3390/ijms20051219 Roda A R, Serra-Mir G, Montoliu-Gaya L, Tiessler L, and Villegas S (2022) Amyloid-beta peptide and tau protein crosstalk in Alzheimer’s disease. Neural Regeneration Research 17 : 1666-1674.10.4103/1673-5374.332127 Meur S and Karati D (2024) Fyn Kinase in Alzheimer's Disease: Unraveling Molecular Mechanisms and Therapeutic Implications. Mol Neurobiol.10.1007/s12035-024-04286-2 Roberson E D, Halabisky B, Yoo J W, Yao J, Chin J, Yan F, Wu T, Hamto P, Devidze N, Yu G-Q, Palop J J, Noebels J L, and Mucke L (2011) Amyloid-β/Fyn–Induced Synaptic, Network, and Cognitive Impairments Depend on Tau Levels in Multiple Mouse Models of Alzheimer's Disease. The Journal of Neuroscience 31 : 700-711.10.1523/jneurosci.4152-10.2011 Moore K J, El Khoury J, Medeiros L A, Terada K, Geula C, Luster A D, and Freeman M W (2002) A CD36-initiated signaling cascade mediates inflammatory effects of β-amyloid. Journal of Biological Chemistry 277 : 47373-47379 Lee C, Low C Y B, Wong S Y, Lai M K P, and Tan M G K (2017) Selective induction of alternatively spliced FynT isoform by TNF facilitates persistent inflammatory responses in astrocytes. Scientific Reports 7 : 43651.10.1038/srep43651 De Bastiani M A, Bellaver B, Brum W S, Souza D G, Ferreira P C L, Rocha A S, Povala G, Ferrari-Souza J P, Benedet A L, Ashton N J, Karikari T K, Zetterberg H, Blennow K, Rosa-Neto P, Pascoal T A, and Zimmer E R (2023) Hippocampal GFAP-positive astrocyte responses to amyloid and tau pathologies. Brain, Behavior, and Immunity 110 : 175-184.https://doi.org/10.1016/j.bbi.2023.03.001 Ng T K S, Ho C S H, Tam W W S, Kua E H, and Ho R C-M (2019) Decreased Serum Brain-Derived Neurotrophic Factor (BDNF) Levels in Patients with Alzheimer’s Disease (AD): A Systematic Review and Meta-Analysis. International Journal of Molecular Sciences 20 : 257 Faria M C, Gonçalves G S, Rocha N P, Moraes E N, Bicalho M A, Gualberto Cintra M T, Jardim De Paula J, José Ravic De Miranda L F, Clayton De Souza Ferreira A, Teixeira A L, Gomes K B, Carvalho M D G, and Sousa L P (2014) Increased plasma levels of BDNF and inflammatory markers in Alzheimer's disease. Journal of Psychiatric Research 53 : 166-172.https://doi.org/10.1016/j.jpsychires.2014.01.019 Kivisäkk P, Carlyle B C, Sweeney T, Quinn J P, Ramirez C E, Trombetta B A, Mendes M, Brock M, Rubel C, Czerkowicz J, Graham D, and Arnold S E (2022) Increased levels of the synaptic proteins PSD-95, SNAP-25, and neurogranin in the cerebrospinal fluid of patients with Alzheimer’s disease. Alzheimer's Research & Therapy 14 : 58.10.1186/s13195-022-01002-x Leuba G, Walzer C, Vernay A, Carnal B, Kraftsik R, Piotton F, Marin P, Bouras C, and Savioz A (2008) Postsynaptic density protein PSD-95 expression in Alzheimer's disease and okadaic acid induced neuritic retraction. Neurobiol Dis 30 : 408-419.10.1016/j.nbd.2008.02.012 Savioz A, Leuba G, and Vallet P G (2014) A framework to understand the variations of PSD-95 expression in brain aging and in Alzheimer's disease. Ageing Research Reviews 18 : 86-94.https://doi.org/10.1016/j.arr.2014.09.004 Mroczko B, Kulczynska-Przybik A, Borawska R, Dulewicz M, Doroszkiewicz J, Karpiuk M, and Slowik A (2023) The significance of the Calbindin-D in Alzheimer’s disease. Alzheimer's & Dementia 19 : e062132.https://doi.org/10.1002/alz.062132 Odero G L, Oikawa K, Glazner K A, Schapansky J, Grossman D, Thiessen J D, Motnenko A, Ge N, Martin M, Glazner G W, and Albensi B C (2010) Evidence for the involvement of calbindin D28k in the presenilin 1 model of Alzheimer's disease. Neuroscience 169 : 532-43.10.1016/j.neuroscience.2010.04.004 Bavarsad M S and Grinberg L T (2024) SV2A PET imaging in human neurodegenerative diseases. Frontiers in Aging Neuroscience 16 .10.3389/fnagi.2024.1380561 Jha N K, Jha S K, Kumar D, Kejriwal N, Sharma R, Ambasta R K, and Kumar P (2015) Impact of Insulin Degrading Enzyme and Neprilysin in Alzheimer's Disease Biology: Characterization of Putative Cognates for Therapeutic Applications. J Alzheimers Dis 48 : 891-917.10.3233/jad-150379 Miners J S, Baig S, Tayler H, Kehoe P G, and Love S (2009) Neprilysin and insulin-degrading enzyme levels are increased in Alzheimer disease in relation to disease severity. J Neuropathol Exp Neurol 68 : 902-14.10.1097/NEN.0b013e3181afe475 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 26 Jun, 2025 Read the published version in Neurochemical Research → Version 1 posted Editorial decision: Revision requested 22 Apr, 2025 Reviews received at journal 18 Apr, 2025 Reviews received at journal 15 Apr, 2025 Reviews received at journal 14 Apr, 2025 Reviews received at journal 14 Apr, 2025 Reviewers agreed at journal 28 Mar, 2025 Reviewers agreed at journal 24 Mar, 2025 Reviewers agreed at journal 24 Mar, 2025 Reviewers agreed at journal 24 Mar, 2025 Reviewers invited by journal 24 Mar, 2025 Editor assigned by journal 24 Mar, 2025 Submission checks completed at journal 21 Mar, 2025 First submitted to journal 20 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6268540","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":436507238,"identity":"273c5eb6-1524-4a9b-b7d5-bc92daaac5d3","order_by":0,"name":"Halima Qadir","email":"","orcid":"","institution":"Shifa College of Pharmaceutical Sciences, Shifa Tameer-e-Millat University","correspondingAuthor":false,"prefix":"","firstName":"Halima","middleName":"","lastName":"Qadir","suffix":""},{"id":436507239,"identity":"5563962d-7c04-477e-affc-ad70159e4cbb","order_by":1,"name":"Haroon Hussain","email":"","orcid":"","institution":"Shifa College of Pharmaceutical Sciences, Shifa Tameer-e-Millat University","correspondingAuthor":false,"prefix":"","firstName":"Haroon","middleName":"","lastName":"Hussain","suffix":""},{"id":436507240,"identity":"9f454ce5-efa4-4333-b6e7-6257eded0ad5","order_by":2,"name":"Amama Ghaffar","email":"","orcid":"","institution":"University of Punjab","correspondingAuthor":false,"prefix":"","firstName":"Amama","middleName":"","lastName":"Ghaffar","suffix":""},{"id":436507241,"identity":"8e408da1-3583-4479-be7a-61a520286bfd","order_by":3,"name":"Fawad Ali Shah","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIiWNgGAWjYBAC9gYGAwbGBoYEfgYGNuK08ByAapFsIFmLwQGitUgkb2D8ucMuz/hG8rMHHyoY5PnFDhDSklbAzHsmudjsRpq54YwzDIYzZyfg12IvnWPAzNjGnLjtRoKZNG8b0IW3CWjhAWph/NlWn7h5Rvo34rUw8LYdTtwgkUOsLfLPgH5pO54448ybMskZZyQI+4WH5zAwxNqqE/vb07dJfKiwkeeXJqAFCNh/gCkBsEoJgsqRAP8BUlSPglEwCkbBSAIAWwFBOSRoxOMAAAAASUVORK5CYII=","orcid":"","institution":"Prince Sattam Bin Abdulaziz University","correspondingAuthor":true,"prefix":"","firstName":"Fawad","middleName":"Ali","lastName":"Shah","suffix":""},{"id":436507242,"identity":"9f15d8d4-c4b8-4292-a65e-704bd848a531","order_by":4,"name":"Sagheer Ahmed","email":"","orcid":"","institution":"Shifa College of Pharmaceutical Sciences, Shifa Tameer-e-Millat University","correspondingAuthor":false,"prefix":"","firstName":"Sagheer","middleName":"","lastName":"Ahmed","suffix":""}],"badges":[],"createdAt":"2025-03-20 10:08:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6268540/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6268540/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11064-025-04465-0","type":"published","date":"2025-06-26T15:57:33+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":79834967,"identity":"a2942a45-183b-4e83-93a3-27762dc5a3f0","added_by":"auto","created_at":"2025-04-03 11:13:29","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2254814,"visible":true,"origin":"","legend":"\u003cp\u003eThe domain analysis showing the seven domains spanning over the fyn protein, while docked complex showing the interactions between loperamide and fyn.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6268540/v1/ec1880190f44e80938115121.png"},{"id":79836628,"identity":"8a4a1d8b-5333-409d-ad48-2950d546a8eb","added_by":"auto","created_at":"2025-04-03 11:29:29","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":156392,"visible":true,"origin":"","legend":"\u003cp\u003eIllustration represents PL-RMSD of the wild-type fyn protein and the docked complex of fyn protein with loperamide.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6268540/v1/343283e793cb6ceddbd43700.png"},{"id":79834971,"identity":"5a790371-aefa-433b-81cf-82b2de9b6ebd","added_by":"auto","created_at":"2025-04-03 11:13:29","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":203827,"visible":true,"origin":"","legend":"\u003cp\u003eIllustration represents RMSF values of the wild-type fyn protein and the docked complex of fyn protein with loperamide\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6268540/v1/69977302045b537dbf3fed55.png"},{"id":79836629,"identity":"36a32e20-2627-407c-95bf-2e94a44b74e2","added_by":"auto","created_at":"2025-04-03 11:29:29","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":178159,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eThe PL and LP contacts of fyn-loperamide complex exhibiting the interactions over the simulation time and the simulation snapshot showing the trajectory of loperamide within the binding pocket of the fyn over the simulation period\u003c/em\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6268540/v1/488965aab9bde6e1ec952c1a.png"},{"id":79835850,"identity":"e5e7f6d0-b155-48c3-846a-574bc303442b","added_by":"auto","created_at":"2025-04-03 11:21:29","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1159098,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of treatment with Donepezil and Loperamide (2.5 mg /kg, 5 mg /kg and 10 mg /kg) on cognitive status in ICV-STZ induced AD mouse model assessed through behavior studies. \u003cstrong\u003eA)\u003c/strong\u003e Experimental setup for the NOR test. The test spans 3 days: Day 1 involves a 5-minute habituation in the open field; Day 2 consists of training with two identical objects; and Day 3 involves testing 24 hours after training, where mice explored the arena containing one familiar object and one novel object.\u003cstrong\u003e B) \u003c/strong\u003eComparison of interaction time:\u003cstrong\u003e \u003c/strong\u003ePercentage of time spent interacting with the familiar vs. novel object during testing phase. Data analyzed using 2 way ANOVA followed by Tukey’s multiple comparison. \u003cstrong\u003eC) \u003c/strong\u003eDiscrimination index calculated using formula Percentage DI=(TN-TF)/(TN+TF)​×100, where T N is time spent with the novel object and T F is time spent with the familiar object. Data analyzed using 1 way ANOVA followed by Tukey’s multiple comparison. \u003cstrong\u003eD) \u003c/strong\u003eExperimental setup for Elevated plus maze. \u003cstrong\u003eE) \u003c/strong\u003eEPM results:\u003cstrong\u003e \u003c/strong\u003eBar graphs show the results of the EPM. Data analyzed using one way ANOVA followed by Tukey’s multiple comparison. \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eLoperamide treatment did not lead to differences in entries into the open arms (a) and entries into the closed arms. Where ##: p\u0026lt; 0.01, ###: p\u0026lt; 0.001 vs. Sham, while ***: p \u0026lt; 0.001, **: p \u0026lt; 0.01: *:p\u0026lt;0.05 as compared with STZ group\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6268540/v1/c17d5af179b0563b9021f683.png"},{"id":79836630,"identity":"acba4e82-7f80-4ce7-a8d1-7a27b15e3868","added_by":"auto","created_at":"2025-04-03 11:29:29","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1155195,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of Loperamide (2.5 mg /kg, 5 mg /kg and 10 mg /kg) on learning and memory in stz-induced AD mice using the MWM. A) Schematic representation for the setup of MWM. B) Change in escape latency of mice among different groups. C) The time (seconds) spent by the mice in the target quadrant among the different experimental groups in the probe trial. D) Percentage time spent by the mice in target quadrant in the probe trial. Data was analyzed by two way ANOVA (B and C) and one way ANOVA (D) and expressed as ±SEM. ## p\u0026lt;0.01 and ### p\u0026lt;0.001, denotes a significant difference from the sham group. ** p\u0026lt;0.01 or *** p\u0026lt;0.001 denotes a significant difference from the STZ induced AD group\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6268540/v1/292ba8a59ad9ebabb5d9822f.png"},{"id":79834972,"identity":"a3d25336-3dfb-418a-9946-8044913bfa65","added_by":"auto","created_at":"2025-04-03 11:13:29","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1797596,"visible":true,"origin":"","legend":"\u003cp\u003eCongo red stained brain sections of mice for visualization of amyloid plaques. Black arrows show congophilic amyloid plaque in the cerebral cortex (Cx) and hippocampal region (DG: dentate gyrus and CA: cornu ammonis). Scale bar 50 μm, magnification 10×. Data were analyzed using one-way ANOVA followed by Tukey's multiple comparison test and expressed as mean ± SD (n=10/group). # p\u0026lt;0.05 or ## p\u0026lt;0.01, denotes a significant difference from the sham group. * p\u0026lt;0.05 or ** p\u0026lt;0.01 or *** p\u0026lt;0.001 denotes a significant difference from the STZ induced AD group\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-6268540/v1/2cb996a96726077bef7ce8b3.png"},{"id":79835854,"identity":"5505c069-648d-4458-86e5-6df9efd61a78","added_by":"auto","created_at":"2025-04-03 11:21:30","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":8062864,"visible":true,"origin":"","legend":"\u003cp\u003eHematoxylin and eosin (H\u0026amp;E) staining showing the extent of surviving neurons in the cortex and hippocampus (Cornu ammonis, CA and dentate gyrus DG). Scale bar 50 μm, magnification 20×. Dead neurons were characterized by a swollen cytoplasm, vacuolization, scalloped morphology with intense cytoplasmic eosinophilia, and nuclear basophilia. STZ: (Streptozocin 3mg/kg), Cx: Cortex, DG: dentate gyrus, CA: cornu ammonis. The H \u0026amp; E slides were made after the euthanization of animals following behavioral analysis. Data were analyzed using one-way ANOVA followed by Tukey's multiple comparison test and expressed as mean ± SEM (n=3/group). # p\u0026lt;0.05 and ### p\u0026lt;0.001, denotes a significant difference from the sham group. ** p\u0026lt;0.01 or *** p\u0026lt;0.001 denotes a significant difference from the STZ induced AD group\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-6268540/v1/4a291dbeaf972bcaa895a19d.png"},{"id":79834981,"identity":"0a115864-efcc-49fc-8ddf-984cfc789939","added_by":"auto","created_at":"2025-04-03 11:13:30","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":1758246,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative images of Nissl-stained brain sections of sham, ICV-STZ induced AD and treated mice brains (n=3). 5µm thick coronal brain sections passing through cortex (Cx: cortex) and hippocampus (DG: dentate gyrus and CA: cornu ammonis) were stained with cresyl violet. The different brain regions were photographed at 10x magnification under bright field illumination. Scale bar 50 μm. Data were analyzed using one-way ANOVA followed by Tukey's multiple comparison test and expressed as mean ± SD (n=10/group). # p\u0026lt;0.05 and ### p\u0026lt;0.001 denotes a significant difference from the sham group. *p\u0026lt;0.05, ** p\u0026lt;0.01 or *** p\u0026lt;0.001 denotes a significant difference from the STZ induced AD group\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-6268540/v1/c2c10cb5abce089edb14d3cb.png"},{"id":79835855,"identity":"19988e6a-e7f3-4e2c-aaeb-56c2acd1c73f","added_by":"auto","created_at":"2025-04-03 11:21:30","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":312730,"visible":true,"origin":"","legend":"\u003cp\u003eGene expression analysis quantified by real-time PCR (qPCR) in sham, icv-stz induced AD and treated mice brain (n=4). Gene expression levels were normalized to the housekeeping gene (β-actin). Data are expressed using the 2−∆∆Ct method.\u003cstrong\u003e \u003c/strong\u003eData were analyzed with a one-way ANOVA followed by Tukey's multiple comparison tests. #p \u0026lt; 0.05 and ## p \u0026lt; 0.01 and ###p \u0026lt; 0.001 vs. the sham. *p \u0026lt; 0.05, **p \u0026lt; 0.01 and ***p \u0026lt; 0.001 vs. Disease\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-6268540/v1/247da6bb2cc2240bb4b87cd0.png"},{"id":85686248,"identity":"bc7aa0e1-8a0b-4e94-8476-4672edf73cd1","added_by":"auto","created_at":"2025-06-30 16:05:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":16750770,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6268540/v1/c245c2ee-4840-497c-924a-1bf0f852f86f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Targeting Fyn kinase for alleviation of cognitive impairment in Streptozocin-induced Alzheimer’s disease in mice by Loperamide; An Experimental and In silico analysis","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAlzheimer\u0026rsquo;s disease (AD) is a relentless, chronic, and debilitating neurodegenerative disease that takes almost two decades to develop fully before the initial symptoms begin to appear [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. AD is typically marked by gradual and progressive loss of cognitive abilities, changes in behavior, reduced independence, and increasing requirements for care and support. Age is the primary risk factor for AD development while other significant factors contributing to its pathology include the presence of one or more apolipoprotein gene E4 alleles (APOE4), cardiovascular disorders, family history of AD, and severe brain injuries [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The key hallmarks of AD include the deposition of β amyloid plaques and neurofibrillary tangles of hyperphosphorylated tau [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Moreover, the presence of neuropil threads, dystrophic neurites, and astrocytic activation, are found to play a pivotal role. These pathological processes culminate in widespread synaptic disruption and neuronal loss, thereby contributing to brain atrophy and cognitive decline, which are the characteristic features of AD [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo date, available treatments for AD provide symptomatic relief only, aimed at alleviating neurotransmitter imbalance. There are three cholinesterase inhibitors (CIs) approved for the treatment of mild to moderate AD, while memantine is a further therapeutic option for patients with moderate to severe AD [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Recent advancements in AD treatment focus on monoclonal antibodies as a promising new approach [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. However, the use of monoclonal antibodies faces significant challenges, including high cost, logistical complexities, and risk of ARIA as well as the special requirement of infrastructure [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Given the current limitations, there is a substantial need for novel therapies that can modify the course of AD. Disruption of Aβ plaque formation and neurofibrillary tangles are crucial to halt its progression. Fyn is an attractive target found to be implicated in AD pathology. Fyn is activated by Aβ and interacts with tau protein, connecting the two key pathways of disease [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Thus Fyn inhibition may serve as a means of slowing or preventing disease progression [\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. This study aimed to repurpose Loperamide a drug identified through virtual screening as a potential Fyn kinase inhibitor for AD treatment. Loperamide, an FDA-approved phenylpiperidine opioid, is widely used as a non-prescription treatment for diarrhea [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Drug repurposing seeks to unravel novel indications of existing drugs other than their known effects and mechanisms. Escalating clinical trial failures have led to the emergence of drug repurposing as a critical approach to reduce risk and increase success [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. We repurposed loperamide as a potential therapeutic agent aiming to mitigate the extent of cognitive impairment in AD. Initial in-silico screening of FDA-approved agents identified 10 potential Fyn kinase inhibitors, which were subsequently narrowed down to loperamide due to its ease of availability for further evaluation. In vivo experiments, histological and molecular studies were performed to investigate the effects of Fyn inhibition on AD-related biomarkers.\u003c/p\u003e"},{"header":"2. Methods","content":"\u003cp\u003e\u003cstrong\u003e2.1. Ethical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe proposed research methods were reviewed and approved by the Research Ethical Committee of Shifa International Hospital, Islamabad, with a reference number of IRB 0300-23. This approval was granted in accordance with the guidelines for the care and use of laboratory animals set by the National Institute of Health.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2. In silico studies\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.1. Protein sequence retrieval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe UniProtKB database was utilized to retrieve the sequence of the Fyn protein (https://www.uniprot.org/uniprotkb/P39688/entry), with accession ID: P39688. The UniProt is a comprehensive, freely accessible database that provides information on protein sequences\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.2. Selection of Drug Compounds\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe DrugBank database (https://go.drugbank.com/) was utilized to retrieve the FDA-approved drug dataset, which comprises 2,508 drug compounds that were downloaded in a PDB format. The DrugBank is an open-source, extensive, and up-to-date database that dispenses comprehensive information on approved and experimentally validated drugs. The drug compounds that have been validated and known to function well in many diseases, along with their toxicities and activities, were selected [12].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.3. Structure prediction of protein\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe homology modeling techniques were employed to predict the 3D structure of the fyn protein utilizing MODELLER 10.3 [13]. It can efficiently perform the fold assignment de novo modeling of loops in protein structures with high speed and accuracy, pairwise, and multiple sequence alignment [13]. Initially, the NCBI BLAST sequence search (blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to pinpoint the template structure based on query coverage and the identity of the template sequence with the target sequence. Subsequently, the 3D structure of the template protein was retrieved by employing the PDB (https://www.rcsb.org/) with PDB ID: 2H8H. The PDB is a universal repository that comprises the experimentally determined and validated 3D structures of macromolecules [14]. Moreover, the structure was then subjected to cleaning utilizing the UCSF Chimera, where the non-standard residues and unnecessary chains were removed. Furthermore, loop modeling was performed to model the unmodeled regions in the structure employing MODELLER 10.3. Additionally, the modeled template structure was utilized to perform homology modeling of the fyn protein, as a result of which ten models were generated, and the best model was selected on the basis of the DOPE score.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.4. Structure evaluation of protein\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe resulting predicted protein model underwent a structural evaluation to assess the validity of the structure utilizing a combination of web servers such as UCLA-DOELAB \u0026mdash; SAVES v6.0, QMEAN, and ProSA-web. To predict the several types of stereochemical parameters and analyze the errors in the 3D structure of the protein, the SAVES v6.0 (https://saves.mbi.ucla.edu/) and ProSA web servers (https://prosa.services.came.sbg.ac.at/prosa.php) were utilized respectively. The ProSA results indicate the overall quality of the models compared to experimentally determined protein structures obtained from x-ray crystallography and nuclear magnetic resonance (NMR) [15]. Furthermore, the ERRAT statistics that evaluate non-bonded interactions in the predicted structures and Verify 3D were also determined by utilizing Saves 6.0 [16]. ERRAT evaluates the overall quality of non-bonded atomic interactions within protein structures where higher scores indicate better quality [17]. Moreover, to evaluate the major geometrical features of protein structures, QMEAN (https://swissmodel.expasy.org/qmean/) was employed to calculate the consistency of pairwise distances between C\u0026alpha; atoms in the predicted models, utilizing constraints extracted from homologous structures [18]. Additionally, the three aforementioned webservers generated results that verified the overall quality of the predicted structure.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003cstrong\u003e.2.5. Molecular docking\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Fyn protein was screened against the FDA-approved 2,508 drug compounds by employing the AutoDock Vina [19]. The AutoDock Vina utilizes an advanced optimization method, can speed up the execution by using a multithreading process, and offers high accuracy [20]. In the docking process, grid box coordinates were used. As a result of the molecular docking, the output PDBQT files were generated. Furthermore, the vina split was performed, and this resulted in different binding affinities of the generated 9 different poses of the ligand with protein in PDBQT format, and the top complexes with the highest binding affinity poses were selected to generate protein-ligand complexes. These complexes were visualized in PyMol (The PyMOL Molecular Graphics System, Version 2.0 Schr\u0026ouml;dinger, LLC), a Python-based graphic tool widely used for the visualizations of 3D molecular structures [21].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.6. ADMET analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo elucidate the pharmacokinetic, toxicological, and ADMET properties, the selected top compounds were subjected to the Absorption, Distribution, Metabolism, Excretion, and Toxicity (ADMET) analysis using ADMETSar 2.0 [22], a web server that provides comprehensive, precise, and efficient prediction of the ADMET profiles for the drug compounds [23]. The top 10 compounds that complied with Lipinski\u0026rsquo;s rule of five and were capable of crossing the blood-brain barrier were selected.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.7. Domain analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe InterPro public database (https://www.uniprot.org/) was utilized to identify the functional domains of the fyn protein. The InterPro database is a freely accessible database that determines the functional domains and their regions in the proteins by employing and classifying the protein sequences into families [24]. The length and name of the domains were retrieved from the InterPro database and were further used for the protein and ligand interaction analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.8. Protein-ligand interaction analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe protein-ligand interaction analysis was conducted to identify the interacting residues of proteins with their respective ligands by employing the Protein-ligand interaction profiler (PLIP) web-based tool (https://plip-tool.biotec.tu-dresden.de), which identified the binding residues within the protein-ligand complexes. This tool acquires the 3D structure of the protein as input, displaying the interactions between the protein and the ligand [25]. It generates an extensive report that includes the residue name and interactions between the protein and the ligand.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.9. Molecular dynamics simulations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eClassical Molecular Dynamics (MD) simulates atomic-level biological system evolution to evaluate the conformational stability and interaction of the complexes [26]. The MD simulation was conducted on wild-type fyn and docked complex (fyn protein with loperamide) using the Desmond module of Maestro 12.0 (version 12.0.012, Schr\u0026ouml;dinger, LLC, New York, NY), a GPU-enabled high-performance molecular dynamics suite [27]. Initially, the protein underwent preprocessing and refinement in the protein preparation wizard, where water beyond 5 angstroms was removed. Moreover, each complex was solvated in a water box of size 10 with periodic boundary conditions (PBC) using the TIP3P water model. An OPLS force field and salt ions (Na\u003csup\u003e+\u003c/sup\u003e and Cl\u003csup\u003e-\u003c/sup\u003e) were incorporated. Subsequently, the prepared system underwent a 100-step energy minimization process before the simulation run. Further, the prepared system was then loaded into the MD window module, where parameters were set for a simulation time of 50 nanoseconds (ns) at a default temperature of 300K and pressure bar of 1 atmospheric pressure (atm). The remaining parameters were unchanged and can be found in the Desmond user guide [28]. Lastly, the trajectory file from the simulation was loaded into the simulation interaction diagram module tool in the Desmond package to conduct post-simulation analysis, including the calculation of root mean square deviation (RMSD) and root mean square fluctuations (RMSF). The binding capabilities of the molecules were observed throughout the simulation run by generating snapshots every 50th frame.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3. Experimental Animals\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSwiss albino male mice weighing 30-40g were used for this study. These animals were housed in Shifa College of Pharmaceutical Sciences, Shifa Tameer e Millat University, Islamabad. Mice were maintained in a controlled environment with 5-6 animals per cage, a 12-hour light/dark cycle, and unrestricted access to food and water.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4. Experimental Design\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animals were randomly assigned to six groups, each comprising 10 mice. Group 1: Sham group received citrate buffer 0.01 mL/kg intracerebroventricular (ICV); Group II STZ group 3 mg/kg ICV; Group III: Donepezil (Positive Control) 3 mg/kg i.p; Group IV: Loperamide 2.5 mg/kg; Group V: Loperamide 5 mg/kg; Group VI: Loperamide 10 mg/ kg; respectively through intraperitoneal route. Treatments were given to III, IV, V, and VI groups for 23 days. All groups except the control received STZ 3mg/kg via the ICV route on day 1 and day 3. The experimental animals received weight-based doses. The animals were monitored daily for signs of morbidity and mortality.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5. Intracerebroventricular injection of Streptozocin\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMice were anesthetized using ketamine (100mg/kg) and xylazine (10mg/kg) and restrained onto the stereotaxic apparatus. The scalp was incised to expose the skull. After locating Bregma, a unilateral hole was drilled into the mouse skull according to coordinates -1.0 mm lateral, -0.3 mm posterior, and -2.5 mm ventral, and 3mg/kg STZ solution in citrate buffer (pH 4.5) was administered [29]. Sham-operated mice received vehicle solution of the same volume.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6. Behavioural Tests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6.1. Novel object recognition test (NORT)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe NORT was performed in a 30 cm \u0026times; 30 cm \u0026times; 30 cm wooden enclosure to evaluate the non-spatial memory of animals. This test comprised 3 phases conducted on three consecutive days. During phase one the animal was allowed to habituate, allowing it to freely explore the apparatus and get familiarized with the environment. The second phase was a training session, where two similar objects were placed in the apparatus and each mouse was allowed to explore the objects for 10 minutes. Testing takes place on the third day where one of the familiar objects was replaced by the novel object that differed significantly from the previous object in terms of size, shape, and color. Each mouse was left to explore the object for 5 min. After each experiment, the objects and arena were thoroughly sanitized with a 70% ethanol solution to eliminate any residual odors that might potentially affect the mice\u0026apos;s behavior during subsequent trials [30].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6.2. Morris water maze (MWM) test\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe spatial memory of mice was assessed using MWM according to the protocol described previously [29]. A round pool having a diameter of 180 cm was filled with water maintained at 21 \u0026plusmn; 2\u0026deg;C was used. The pool was divided into four quadrants (target, left, right, and opposite) and four visible cues were placed on the walls of the pool. A 14cm diameter platform was submerged 1 cm below the surface of water for 4 trials per day over four consecutive days during training. The start position randomly varied across the four quadrants of the pool. For each trial mice were given 60 sec. to reach the hidden platform. If mice failed to locate the platform they were gently guided towards it. The mice were kept for 20 seconds on the platform for spatial orientation. Latencies to find the platform were recorded during the training period. A probe trial was conducted 24 hr. after the final training day. During probe trial the platform was removed and the animal was allowed to swim in water for 60 sec. The amount of time spent in the platform quadrant (target) was compared to the time spent in the other three quadrants.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6.3. Elevated plus maze (EPM) test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe EPM test was performed to assess anxiety like behavior experienced during neurodegenerative diseases following method described previously [31]. The apparatus consisted of two open arms (25 cm\u0026thinsp;\u0026times;\u0026thinsp;5 cm) and two closed arms of the same size with 15-cm-high walls and a central square (5 cm\u0026thinsp;\u0026times;\u0026thinsp;5 cm) connecting the arms. The mouse was placed at the distal end of one of the open arms, with its back to the central square platform. Transfer latency was then measured, which refers to the time it takes for the mouse to enter any one of the closed arms using all four paws. Number of entries in either of the arms was calculated in EPM test [32].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7. Brain tissue collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter completion of behavioral tests, all the animals were euthanized and decapitated. Brains were removed for further molecular and histological analysis. The brains of four animals were fixed in 4% formalin solution for at least 24 hours before processing for histological examination. The remaining brains were kept at -80 \u0026deg;C until molecular studies were performed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8. Congo red Staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCongo red staining is a widely used qualitative method that enables detection of amyloid deposits in brain tissue sections. Briefly the paraffin-embedded brain slices were deparafinized by immersing in xylene, then rehydrated using series of graded ethanol solutions followed by rinse with distilled water. Subsequently these hydrated sections were stained with 0.5 % Congo red solution for 30 sec. The stained sections were sequentially incubated for 1 minute in 50% ethanol, 70% ethanol and finally dehydrated with 100% ethanol. Finally cleared with xylene and coversliped using mountant media and photographed under microscope [33]. These images were analyzed using ImageJ software for presence of amyloid plaque.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9. Haematoxylin eosin staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXylene was used to deparafinize paraffin embedded tissue sections. These sections were hydrated using gradient solution of ethanol 100%, 90%, 80% and 75%. Hematoxylin and eosin solution was used for staining these sections and then rinsed with distilled water. Subsequently these sections were dehydrated in absolute alcohol, cleared in xylene and coversliped. Cortex, hippocampal CA1 and DG regions were observed under light microscope and photographed [34]. The photographed images were further analyzed using ImageJ software while focusing on survival of neuronal cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.10. Nissl staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCoronal sections of brain fixed on slides were deparafinized in xylene and hydrated in serial grades of ethanol. The tissue was stained with Nissl stain for 3 minutes, followed by dehydration, clearing, and coversliped. Later on these slides were observed under microscope and photographed [35]. ImageJ software was used for further analysis of these images.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.11. RNA extraction and gene expression determination\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTrizol reagent was used to extract total RNA from cerebral cortex. RNA was reverse-transcribed into cDNA using a reverse transcriptase-PCR kit, following the manufacturer\u0026apos;s instructions for optimal conversion. The purity and yield of RNA was determined using NanoDrop\u0026trade; ND-1000 apparatus (Thermo Fisher, Waltham, MA, USA). Quantitative polymerase chain reaction (qPCR) was carried out using a reaction mixture comprising of Sybr Green PCR Master Mix cDNA, nuclease-free water, and primers. Data was analyzed using comparative cycle threshold (Ct) (\u0026Delta;\u0026Delta;Ct) method. Expression levels were normalized using \u0026beta;-actin as the endogenous reference gene. The primer sequences used in this study are listed in Table 1. Each sample was analyzed in duplicate and the results represent the n-fold difference in the transcript levels among different groups [36].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1\u003c/strong\u003e Primers sequence of genes used for expression analysis\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eSequence\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eAmyloid precursor protein (App)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTCCGTGTGATCTACGAGCGCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGCCAAGACATCGTCGGAGTAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eSynaptic Vesicle Glycoprotein 2A\u003c/strong\u003e (sv2a)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTCCAGTCTGACACAGGAACCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGCCGATACTCTGGACTGAAGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eTau\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCCAACATTGCCTCTGGTGAGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGCACCACTTGATGGACGGGATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eNeprilysin (Nep)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eACCAGAACCTGTCCAAGGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCATCAGGTCCATTCGGTGGTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eInsulin degrading enzyme (Ide)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCAAACCTCTCCTTCCAAGTCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTGTTCTCCGAGGTGCTCTGCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eDiscs Large MAGUK Scaffold Protein 4\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(\u003c/strong\u003eDlg4\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTCAGACGGTCACGATCATCGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGTTGCTTCGCAGAGATGCAGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eBrain derived neurotrophic factor (Bdnf)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGGCTGACACTTTTGAGCACGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCTCCAAAGGCACTTGACTGCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eFyn\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCAGTTGACTCCATCCAGGCAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCACGGATGGAAAGTGAGTAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eGlial Fibrillary Acidic Protein\u003c/strong\u003e(Gfap)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCACCTACAGGAAATTGCTGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCCACGATGTTCCTCTTGAGGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eCalbindin 1 (\u003c/strong\u003ecal-1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCTTGCTGCTCTTTCGATGCCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGTTCCTCGGTTTCGATGAAGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eBeta actin (Actb)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCTGAATGGCCCAGGTCTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCCCTGGCTGCCTCAACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e2.12. Statistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll values are expressed as the mean \u0026plusmn; SEM. Statistical analyses were performed using GraphPad Prism 6.0 software (La Jolla, CA, USA). Percentage time spent with novel object vs. familiar object in NORT, number of entries in close arm vs open arm in EPM, and MWM behaviour data were assessed by two-way ANOVA followed by Tukey\u0026rsquo;s post hoc analysis for multiple comparisons. The other parameters were executed using one-way ANOVA followed by Tukey\u0026rsquo;s post-hoc test for multiple comparisons. Probability values P \u0026lt; 0.05 were considered statistically significant.\u003c/p\u003e"},{"header":"3.\tResults","content":"\u003cp\u003e\u003cstrong\u003e3.1. Insilico studies\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.1.1. Protein domain analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe InterPro database was utilized to analyse the protein domains and gain insight into the functional characteristics of the fyn protein. Seven domains were found, including SH3 Domain (82-143), Fyn/Yrk, SH3 Domain (85-140), SH2 Domain (147-246), Fyn/Yrk SH2 Domain (145-245), Protein Kinase Domain (271-524), Serine-threonine/tyrosine-protein kinase, catalytic Domain (271-518), and Tyrosine-protein kinase, catalytic domain (271-520), as shown in Figure 1a. The fyn protein domains and their sequence lengths are mentioned below in Table 2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2\u0026nbsp;\u003c/strong\u003eThe domains of fyn protein along with their sequence lengths.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"624\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eDomains\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePositions\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eSH3 Domain\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003e82-143\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eFyn/Yrk, SH3 Domain\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003e85-140\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eSH2 Domain\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003e147-246s\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eFyn/Yrk SH2 Domain\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003e145-245\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eProtein Kinase Domain\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003e271-524\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eSerine-threonine/tyrosine-protein kinase, catalytic Domain\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003e271-518\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eTyrosine-protein kinase, catalytic domain\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003e271-520\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e3.1.2. Structural evaluation and molecular docking of Fyn\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe predicted protein structure of fyn was observed to have an overall \u0026nbsp;high-quality score on all three web servers (UCLA-DOE LAB \u0026mdash; SAVES v6.0, ProSA web, and QMEAN). The ERRAT and Verify3D resulted in a good quality score of the fyn protein, while the ProSA web and QMEAN also showed significant results. The ERRAT score on SAVES was 74.06, while the ProSA web exhibited -10.6 Z-score and QMEAN showed a score of 0.76, respectively. The fyn protein structure evaluation scores are mentioned in Table 3.\u003c/p\u003e\n\u003cp\u003eLastly, the molecular docking of the fyn protein with loperamide resulted in 9 distinct poses with binding affinity scores ranging from -8.28 kcal /mol to -10.11 kcal /mol. The top pose (-10.11 kcal /mol) which exhibited interactions with the fyn protein was selected, as shown in Figure 1 (b-c). It was observed that the loperamide interacted with the ASN protein residue at position 333 which was found within the protein kinase domain, serine-threonine/tyrosine-protein kinase, catalytic domain, and tyrosine-protein kinase, catalytic domain region, indicating that loperamide might be implicated in the hindrance of fyn as the aforementioned domains are implicated in a multitude of cellular processes, including division, proliferation, apoptosis, and differentiation. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3\u003c/strong\u003e The Fyn protein structure evaluation scores using SAVES, ProSA web and QMEAN.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"624\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 125px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eProtein\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 125px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSAVES (ERRAT)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 125px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSAVES (Verify3D)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 125px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eProSA web\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 125px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eQMEAN\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 125px;\"\u003e\n \u003cp\u003e\u003cem\u003eFyn\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 125px;\"\u003e\n \u003cp\u003e74.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 125px;\"\u003e\n \u003cp\u003e93.26% of residues have averaged 3D-1D score\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 125px;\"\u003e\n \u003cp\u003e-10.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 125px;\"\u003e\n \u003cp\u003e0.76\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e3.1.3. Molecular dynamics simulations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe MD simulations of the wild-type fyn protein and the docked complex (fyn-loperamide) were performed to observe the flexibility and stability of the protein before and after binding with loperamide. The wild-type fyn protein showed that the protein was stable from 11.30 ns to 22.60 ns time. The RMSD value of the protein at the end of the simulation time was 9.23 \u0026Aring;. Moreover, the Fyn-Loperamide complex indicated that the protein was stable from 25.10 ns to 40.15 ns during the simulation time. Moreover, the minimum RMSD difference between the protein and the ligand was found at 26.80 ns. Additionally, the RMSD values of the protein and the ligand at the end of the simulation time were 7.92 \u0026Aring; and 12.34 \u0026Aring;, respectively. While comparing the RMSDs of wild-type fyn and fyn-loperamide complex, it was found that the protein was unstable before docked with loperamide, while after docking, the complex showed a slight decrease in RMSD value, indicating that the binding of loperamide with fyn provides stability to the protein complex, as shown in Figure 2. Moreover, the flexibility of the wild-type fyn protein and fyn-loperamide was assessed through RMSF graphs obtained from MD simulations. The wild-type fyn protein showed a slight decrease in RMSF value, whereas the fyn-loperamide showed a slight increase in RMSF value compared to wild-type fyn. In this regard, fyn-loperamide was found to be more flexible than the wild-type fyn, as shown in Figure 3.\u003c/p\u003e\n\u003cp\u003eFurthermore, the PL-contacts showed 26 interacting protein residues, while MET-283 and ASP-290 exhibited interaction fractions for more than 40% of the simulation. The highest interactions were exhibited by ASP-290 (Hydrogen bonds = 0.036, Water bridges = 0.837, Ionic = 0.024), followed by MET-283 (Hydrogen bonds = 0.001, Water bridges = 0.476), LEU-215 (Hydrogen bonds = 0.068, Hydrophobic = 0.111, Water bridges = 0.135). Additionally, the timeline plot also showed that the ASP-290 and MET-283 protein residues interacted with loperamide over the simulation time, as shown in Figure 4 (a-b). Subsequently, the LP contacts indicated that loperamide interacted with the ASP-290 and MET-283 protein residues for 50% and 46% of the simulation time, respectively, as shown in Figure 4c. Lastly, the fyn-loperamide complex simulation snapshots indicated that the loperamide remained in the binding pocket of the fyn, suggesting a stable complex throughout the simulation. This indicated that the loperamide might be implicated in the functional hindrance of fyn by inhibiting its binding to its actual targets. The simulation snapshot of fyn -fyn-loperamide is shown in Figure 4d.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2. Loperamide mitigates cognitive decline in stz-induced AD mouse model:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNORT was conducted to assess cognitive impairment induced in mice and to assess the effects of loperamide treatment on cognition. Mice have an intrinsic tendency to interact more with new objects as compared to familiar ones. Conversely, when memory impairment is present, mice do not differentiate and engage equally with both new and familiar objects. We observed that loperamide 10 mg/ kg treated mice spent a higher percentage of time (70%) with a novel object when compared to stz-induced AD mice (30%) (Figure 5). \u0026nbsp; Moreover, improvement in cognition was also obvious through an increase in the discrimination index of loperamide-treated mice while diseased mice spent equal time with novel and familiar objects. Nonetheless, no significant difference was observed between the loperamide-treated and stz-induced AD group in the EPM test, which assesses the anxiety-like behavior associated with neurodegenerative diseases (Figure 5).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eResults from the MWM test demonstrated that loperamide treatment alleviated the learning and spatial memory deficits induced by icv stz administration (Figure 6 A). With each passing day, loperamide treatment improved latencies to the hidden platform while no significant difference was observed in stz treated group from day 1 to day 4 (Figure 6 B). During the probe trial, the loperamide-treated group showed a preference towards the target quadrant, particularly showing marked effects at the dose of 10 mg /kg. In a probe trial, the loperamide-treated group preferred the target quadrant with the most prominent effects observed in loperamide 10mg /kg.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3. Effect of Loperamide treatment on histopathological features of the cerebral cortex and hippocampus:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Congo red is a histological stain known for its ability to bind to amyloid fibers and produce a characteristic red coloration. A notable difference between A\u0026beta; aggregates in stz-induced AD and the loperamide-treated group was observed. The number of A\u0026beta; deposits was significantly reduced after the administration of loperamide at a dosage of 10 mg/kg, as evidenced by the results of Congo red staining in the cortex, dentate gyrus (DG), and cornu ammonis 1 (CA1) regions of the brain (Figure 7).\u003c/p\u003e\n\u003cp\u003eBased on H \u0026amp; E staining, morphological changes in neuronal cells of the cerebral cortex and hippocampus (dentate gyrus: DG and cornu ammonis 1: CA1) were assessed. Microscopic examination of the sham group revealed a normal appearance with round-shaped cells and lightly stained cytoplasm. Histopathological analysis of STZ group showed pyknosis, characterized by darkly stained irregularly shaped neuronal cells in the cortex region. In the DG and CA1 regions, condensed nuclei with empty spaces around them were predominant. In comparison to the STZ group, Donepezil treatment did not improve neuronal death in the cortex region. In the treatment group, administration of Loperamide at the dose of 10 mg/kg enhanced the neuronal survival in the cerebral cortex and increased neuronal density in the DG and CA1 region (Figure 8).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNissl staining was then used to compare the presence of nissl bodies in normal, stz-induced AD and Loperamide-treated mice. In normal mice, nissl staining showed well-defined nissl bodies in the cortex and hippocampus regions. Conversely, stz-induced AD mice exhibited a significant reduction in the presence of nissl bodies in the cortex and hippocampus. The neurodegeneration in AD group was characterized by shrunken nuclei, pyknosis, and loss of structure. In comparison with other treatment groups\u0026rsquo; neuronal loss in Loperamide 10 mg/ kg group was significantly reduced (Figure 9)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4. Modulation of AD Pathology-Related Gene Expression by Fyn Kinase Inhibition\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFyn kinase in collaboration with A\u0026beta; and tau is found to exacerbate AD related pathology. We evaluated the expression of Fyn kinase and other genes that are critically involved in AD using qPcr (Figure 10). Fyn kinase levels were notably elevated in the stz-induced AD mice that strongly correlated with impaired performance in the MWM and NORT. In our study, we found a significant increase in the expression of App and tau, which are the key genes that are altered prior to the onset of cognitive impairment. This overexpression is significantly reduced in mice treated with Loperamide 10 mg/ kg. Moreover, we found a signification increase in the expression of genes Dlg4, Gfap, Cal1, and Sv2a in AD mice that were suppressed by Loperamide 10 mg/ kg treatment. On the other hand, genes encoding enzymes involved in the processing of App were decreased in the stz-induced AD mice group which were restored after treatment with Loperamide 10 mg/ kg. Bdnf is crucial for synaptic plasticity and neuronal survival. We found an increase in levels of Bdnf after treatment with Loperamide as well as donepezil. However, these findings did not reach statistical significance due to considerable variability in obtained data.\u003c/p\u003e"},{"header":" 4. Discussion","content":"\u003cp\u003eAD is age related, progressive neurodegenerative disease marked by cognitive loss, behavioral challenges and ultimately death [37]. Current treatment for AD merely serve to delay disease progression [38]. Despite extensive research, AD has intricate etiology and pathogenesis is not fully understood. The most widely accepted theory states that aberrant deposition of beta-amyloid proteins; tau hyper phosphorylation and neuronal inflammation are the key contributors of AD pathology [38]. Currently Fyn kinase has gained significant attention as a key mediator of tau-dependent synaptic toxicity, triggered by Aβ and is found to be overexpressed in brain of AD patients [39]. Moreover, Fyn kinase inhibition has shown significant potential in addressing AD pathology and this approach has advanced to clinical trials [39, 40]. The association of Fyn with key hallmarks of AD, Aβ and tau has prompted us to explore potential Fyn kinase inhibitors from FDA-approved agents. We aimed to evaluate impact of selected Fyn kinase inhibitors on cognition and other memory related aspects of AD. \u003c/p\u003e\n\u003cp\u003eRepositioning of FDA approved drugs accelerates the drug discovery process by enabling researcher to identify new therapeutic target and indications using existing knowledge of these drugs [41]. In line with this approach, ligand-based virtual screening of 2,508 FDA-approved drugs from Drug Bank was conducted to identify potential Fyn kinase inhibitors. Based on binding affinity, ability to cross blood brain barrier ease of availability and results of simulation study, we selected Loperamide for further investigation through stz-induced AD mouse model. Loperamide is an over-the-counter drug primarily used to manage various forms of diarrhea. Donepezil was used as standard drug that is approved by FDA for symptomatic treatment of AD. \u003c/p\u003e\n\u003cp\u003eThe icv injected stz induced brain state in mice is widely used as model of sporadic AD and has been beneficial in predicting the outcomes of pharmacological interventions [42]. ICV administration of stz recapitulates key features of AD including formation of amyloid beta fragments, hyper phosphorylated tau, neuroinflammation, oxidative stress and biochemical alterations [43]. The effective induction of AD following stz icv administration and therapeutic efficacy of loperamide were evaluated using several behavioral assessments. The NORT is the most widely used test to assess cognition in rodents based on their natural inclination to explore a new object more than a familiar one [44]. The results of nort indicated that loperamide treatment (10mg/ kg) mitigated the cognitive deficits induced by stz. This was obvious through the increased exploratory behavior exhibited by the loperamide-treated mice toward the novel object. Furthermore the ability of to discriminate between novel and familiar object was enhanced in loperamide treated mice. This increase in discrimination ability underscores the potential of loperamide to improve cognitive performance, possibly by modulating neurochemical pathways that are disrupted in models of cognitive dysfunction [45]. In AD, spatial disorientation is among the earliest symptoms, with allocentric deficits noticeable in the preclinical asymptomatic stages [46]. MWM test is a valuable tool used in scientific research to assess spatial reference memory in animal model. The results of MWM test indicated decrease in latency to reach the hidden platform after 4 days of training in loperamide and donepezil treated mice. This indicates improvement in spatial learning. Correspondingly, the time spent in target quadrant increased in loperamide treated mice, indicating stronger memory retention. These findings prompt further exploration of mechanism underlying the neuroprotective potential of loperamide.\u003c/p\u003e\n\u003cp\u003eWhile cognitive decline is the hallmark of AD, it is also associated with neuropsychiatric symptoms like psychological distress, anxiety, and depression [47]. Therefore we used the EPM, a widely accepted tool, in this study to evaluate anxiety-like behavior linked to neurodegenerative diseases like AD. However, loperamide did not demonstrate any anti-anxiety effects, as no significant differences in number of entries in open and closed arm were observed between any of the groups.\u003c/p\u003e\n\u003cp\u003eA major pathological finding in AD is the accumulation of amyloid plaques that leads to neurodegeneration and impaired cognition [37]. Congo red is histological stain that allows for detection and visualization of amyloidal deposits in tissues by staining them red [48]. In the present study, we identified a substantial increase in stained amyloid beta plaques in the brains of stz-induced AD’s mice; however, treatment with loperamide (10 mg/kg) caused a significant reduction in these plaques. Moreover, autopsy findings in AD patients show significant neuronal loss, evidenced by cortical volume shrinkage, a reduction in gyri size of up to 50%, and enlarged sulci [49]. In line with the previous studies, amyloid beta deposits in brain triggers oxidative stress, and disrupts ionic homeostasis leading to neuronal dysfunction, synaptotoxicity and ultimately neuronal death [50]. H\u0026amp;E staining demonstrated increased neuronal loss in the cortex and hippocampus of AD mice. However, treatment with loperamide (5 mg/kg, 10 mg/kg) and donepezil there was notable reduction in this neuronal loss. These findings highlight neuroprotective potential of loperamide, suggesting it may be useful in therapeutic approach designed to prevent neuronal loss in AD. Additionally neuronal density increased in loperamide treated group in comparison to stz-induced AD group. Nissl staining is used to visualize nissl bodies and assess neuronal health, density, and morphology, which is essential for understanding neurodegenerative changes in AD [51]. Our study showed that number of nissl bodies reduced in stz-induced AD mice while loperamide treated group prevented loss of nissl bodies at the dose of 10 mg/ kg. Preserved Nissl bodies imply that loperamide could potentially sustain neuron functionality and reduce chance of neurodegeneration.\u003c/p\u003e\n\u003cp\u003eAnalyzing gene expression in brain is the key to understand cellular changes implicated in AD pathogenesis, its mechanism and the role of pharmacological treatments. Through comprehensive literature review we identified 10 dysregulated genes linked to AD pathology and cognition and evaluated the treatment effect on their expression [52-58]. App overexpression is the primary event in amyloid-beta-induced neurotoxicity and neurodegeneration [59]. Amyloid beta aggregation induces tau hyper phosphorylation that form neurofibrillary tangles and disrupt the transcription of genes regulating synaptic function [60]. Synaptic toxicity induced by Aβ and tau is linked through non-receptor tyrosine kinase Fyn that belongs to Src family and offers potential target for AD treatment [39, 61]. Studies indicate that Fyn overexpression contributes to synaptic deficits and cognitive impairment [39, 52]. In this study to evaluate the effect of loperamide on Aβ-fyn-tau toxic triad we measured their gene expression levels in stz-induced AD mouse model and treated groups. We found significantly increased expression of fyn, App and tau in the AD mice. Interestingly loperamide treatment led to substantial decrease in expression of these genes, suggesting potential of loperamide to counteract the toxic effects associated with their overexpression. These findings corroborated the findings of behavior studies that showed loperamide in dose of 10 mg/ kg reduced cognitive deterioration and enhanced memory function in treated mice. [8, 62] state that Aβ, tau, and fyn jointly disrupt synaptic function, suggesting that targeting their co-pathogenic interactions could offer therapeutic benefits by restoring synapse density and reversing memory deficits, a result that is evident in our findings as well. \u003c/p\u003e\n\u003cp\u003eThe role of fyn in neuroinflammation has been less studied however, it has been reported earlier that presence of Aβ deposits in brain trigger proinflammatory response through fyn [63]. Besides fyn kinase inhibitor AZD 0530 in AD mice showed improvement in cognitive deficits through decreasing synapse loss, tau phosphorylation and astrogliosis [64]. In AD clinical research, Gfap levels are commonly assessed and regarded as reliable biomarker for reactive astrogliosis [65]. The neuroinflammatory response caused by AD pathology was assessed through measuring the glial fibrillary acidic protein (Gfap) expression. Loperamide and donepezil treatment showed anti-inflammatory potential in brain through reducing expression of Gfap. \u003c/p\u003e\n\u003cp\u003eBdnf is a neurotrophin that supports neuronal survival and development [66] and is predominantly expressed in cortex, hippocampus and basal brain which play key roles in memory and learning. Previous studies on Bdnf levels in AD patients have produced conflicting results [66]. We found significant increase in expression of Bdnf after inducing AD in mice when compared to sham group. The increase in BDNF might reflect a compensatory mechanism against neurodegeneration induced by stz [67]. However after treatment with loperamide as well as donepezil, no change in level of Bdnf was observed indicating loperamide has no effect on Bdnf. \u003c/p\u003e\n\u003cp\u003eDlg4 gene encodes PSD-95, a scaffolding protein at the postsynaptic density, crucial for maintaining synaptic plasticity and integrity [68]. According to previous studies increased levels of PSD-95 are positively correlated with Aβ and phosphorylated tau in AD patients, particularly in initial stages of disease [68-70]. In our study, PSD-95 levels increased in stz-induced AD mice as compared to sham group while loperamide (10 mg/ kg) group showed a significant trend towards normalization. This enhanced PSD-95 may be a compensatory response to neurotoxic effect of Aβ aimed at preserving synaptic function [68].\u003c/p\u003e\n\u003cp\u003eDuring early stage of AD, accumulation of Aβ and tau accompanied by calcium dysregulation leads to synaptic loss and disrupted neuronal network [71]. Research shows that cal-1 expression may increase in brain of transgenic Alzheimer's mouse models, as a compensatory response to calcium dysregulation caused by Aβ accumulation [72]. We observed increased cal-1 levels in the diseased group and a decrease in the loperamide-treated group. Decrease in cal-1 following loperamide treatment implies restoration of normal calcium signaling. While cal-1 buffers excessive calcium, sv2a functions as a glycoprotein that ensures proper neurotransmitter release, potentially reducing some synaptic disturbances induced by Aβ. In AD dysfunctional sv2a leads to accumulation of presynaptic Ca2+, which triggers the release of irregular neurotransmitters and destabilize the synaptic system [73]. We noted a significant increase in sv2a expression in both AD and treated mice as compared to sham group, however loperamide treatment showed no substantial effect on sv2a over expression, leaving the results inconclusive. \u003c/p\u003e\n\u003cp\u003eSince Aβ aggregation contributes to neuronal toxicity associated with AD, its clearance is imperative for therapeutic strategies. Numerous enzymes have been reported to degrade Aβ with Ide and Nep being the most significant [74]. It has been reported that levels of these enzymes decline in patients diagnosed with sporadic AD [75]. In the non-treated group of stz-induced AD mice, we observed a marked suppression of Nep and Ide expression levels. Conversely, there was a significant increase in the expression levels of both Nep and Ide in the group of mice treated with loperamide. This enhancement suggests that loperamide may play a role in upregulating the activity of these enzymes, which are crucial for the degradation of amyloid-beta (Aβ) peptides associated with AD.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, we present experimental data showing the significant anti-AD potential of loperamide. Treatment with loperamide improved cognitive behavior accompanied by reduced amyloid beta deposits and neuronal death. The decreased expression of key genes, including Fyn, APP, tau, Dlg4, cal-1, and Gfap, after loperamide treatment, suggests a mechanism by which it may alleviate neurodegeneration associated with AD. Additionally, increased expression of Nep and Ide indicates loperamide treatment may aid in amyloid clearance and provide neuroprotection. Overall, these findings highlight the therapeutic potential of loperamide as a promising candidate for Alzheimer's treatment, warranting further investigation into its mechanisms and long-term effects.\u003c/p\u003e"},{"header":"Statements and Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions:\u003c/strong\u003e All authors equally contributed to the design, collection, analysis, formatting, and reviewing of the manuscript\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed significantly to the work presented in this article. [H.U] conceived the study and designed the experiments. [H.U, H.H and A.G] conducted the experiments and collected data. [H.U, S.A and F.S] analysed the data and interpreted the results. [H.U] wrote the manuscript and [S.A and F.S] provided critical revisions. All authors reviewed and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThe author (s) received no financial support for the research,authorship, or publication of this work.\u003c/p\u003e\n\u003cp\u003eNo funds, grants, or other support were received during the preparation of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e I would like to express my gratitude to Shifa Tameer-e-Millat University for providing the resources and support necessary for the completion of this research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eI have nothing to declare.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003cstrong\u003e:\u0026nbsp;\u003c/strong\u003eThe datasets generated during and/or analyzed during the current study are not publicly available due to [data confidentiality] but are available from the corresponding author at reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003cstrong\u003e:\u0026nbsp;\u003c/strong\u003eThe study obtained ethical approval by the Research Ethical Committee of Shifa International Hospital, Islamabad, with a reference number of IRB 0300-23. This approval was granted in accordance with the guidelines for the care and use of laboratory animals set by the National Institute of Health.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u003c/strong\u003e All Authors have checked and agreed for the publication of this manuscript without any conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials:\u0026nbsp;\u003c/strong\u003eThe data that support the findings of this study are available on request from the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe proposed research methods were reviewed and approved by the Research Ethical Committee of Shifa International Hospital, Islamabad, with a reference number of IRB 0300-23. This approval was granted in accordance with the guidelines for the care and use of laboratory animals set by the National Institute of Health.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003ePetersen C, Nolan A L, De Paula Fran\u0026ccedil;a Resende E, Miller Z, Ehrenberg A J, Gorno-Tempini M L, Rosen H J, Kramer J H, Spina S, and Rabinovici G D (2019) Alzheimer\u0026rsquo;s disease clinical variants show distinct regional patterns of neurofibrillary tangle accumulation. Acta neuropathologica \u003cstrong\u003e138\u003c/strong\u003e: 597-612\u003c/li\u003e\n\u003cli\u003eZvěřov\u0026aacute; M (2019) Clinical aspects of Alzheimer\u0026apos;s disease. Clinical Biochemistry \u003cstrong\u003e72\u003c/strong\u003e: 3-6.https://doi.org/10.1016/j.clinbiochem.2019.04.015\u003c/li\u003e\n\u003cli\u003eLane C A, Hardy J, and Schott J M (2018) Alzheimer\u0026apos;s disease. European journal of neurology \u003cstrong\u003e25\u003c/strong\u003e: 59-70\u003c/li\u003e\n\u003cli\u003eWeller J and Budson A (2018) Current understanding of Alzheimer\u0026apos;s disease diagnosis and treatment. F1000Res \u003cstrong\u003e7\u003c/strong\u003e.10.12688/f1000research.14506.1\u003c/li\u003e\n\u003cli\u003eAmeen T B, Kashif S N, Abbas S M I, Babar K, Ali S M S, and Raheem A (2024) Unraveling Alzheimer\u0026rsquo;s: the promise of aducanumab, lecanemab, and donanemab. The Egyptian Journal of Neurology, Psychiatry and Neurosurgery \u003cstrong\u003e60\u003c/strong\u003e: 72.10.1186/s41983-024-00845-5\u003c/li\u003e\n\u003cli\u003eNygaard H B (2018) Targeting Fyn Kinase in Alzheimer\u0026apos;s Disease. Biol Psychiatry \u003cstrong\u003e83\u003c/strong\u003e: 369-376.10.1016/j.biopsych.2017.06.004\u003c/li\u003e\n\u003cli\u003eLiang X, Yao Y, Lin Y, Kong L, Xiao H, Shi Y, and Yang J (2019) Panaxadiol inhibits synaptic dysfunction in Alzheimer\u0026apos;s disease and targets the Fyn protein in APP/PS1 mice and APP-SH-SY5Y cells. Life Sciences \u003cstrong\u003e221\u003c/strong\u003e: 35-46.https://doi.org/10.1016/j.lfs.2019.02.012\u003c/li\u003e\n\u003cli\u003eKaufman A C, Salazar S V, Haas L T, Yang J, Kostylev M A, Jeng A T, Robinson S A, Gunther E C, Van Dyck C H, Nygaard H B, and Strittmatter S M (2015) Fyn inhibition rescues established memory and synapse loss in Alzheimer mice. Ann Neurol \u003cstrong\u003e77\u003c/strong\u003e: 953-71.10.1002/ana.24394\u003c/li\u003e\n\u003cli\u003eChen R J, Chang W W, Lin Y C, Cheng P L, and Chen Y R (2013) Alzheimer\u0026apos;s amyloid-\u0026beta; oligomers rescue cellular prion protein induced tau reduction via the Fyn pathway. ACS Chem Neurosci \u003cstrong\u003e4\u003c/strong\u003e: 1287-96.10.1021/cn400085q\u003c/li\u003e\n\u003cli\u003eWu P E and Juurlink D N (2017) Clinical Review: Loperamide Toxicity. Annals of Emergency Medicine \u003cstrong\u003e70\u003c/strong\u003e: 245-252.https://doi.org/10.1016/j.annemergmed.2017.04.008\u003c/li\u003e\n\u003cli\u003eDas A K K, Sharma D, and Sharma L (2021) Drug repurposing strategy for treating Alzheimer\u0026rsquo;s disease. Alzheimer\u0026apos;s \u0026amp; Dementia \u003cstrong\u003e17\u003c/strong\u003e: e058503.https://doi.org/10.1002/alz.058503\u003c/li\u003e\n\u003cli\u003eCuesta S A, Mora J R, and M\u0026aacute;rquez E A (2021) In Silico Screening of the DrugBank Database to Search for Possible Drugs against SARS-CoV-2. Molecules \u003cstrong\u003e26\u003c/strong\u003e: 1100\u003c/li\u003e\n\u003cli\u003eWebb B and Sali A (2016) Comparative Protein Structure Modeling Using MODELLER. Curr Protoc Bioinformatics \u003cstrong\u003e54\u003c/strong\u003e: 5.6.1-5.6.37.10.1002/cpbi.3\u003c/li\u003e\n\u003cli\u003eSegura J, Rose Y, Bi C, Duarte J, Burley S K, and Bittrich S (2023) RCSB Protein Data Bank: visualizing groups of experimentally determined PDB structures alongside computed structure models of proteins. Frontiers in Bioinformatics \u003cstrong\u003e3\u003c/strong\u003e.10.3389/fbinf.2023.1311287\u003c/li\u003e\n\u003cli\u003eWiederstein M and Sippl M J (2007) ProSA-web: interactive web service for the recognition of errors in three-dimensional structures of proteins. Nucleic Acids Research \u003cstrong\u003e35\u003c/strong\u003e: W407-W410.10.1093/nar/gkm290\u003c/li\u003e\n\u003cli\u003eHaron F N, Azazi A, Chua K H, Lim Y a L, Lee P C, and Chew C H (2022) In silico structural modeling and quality assessment of Plasmodium knowlesi apical membrane antigen 1 using comparative protein models. Trop Biomed \u003cstrong\u003e39\u003c/strong\u003e: 394-401.10.47665/tb.39.3.009\u003c/li\u003e\n\u003cli\u003eMessaoudi A, Belguith H, and Ben Hamida J (2013) Homology modeling and virtual screening approaches to identify potent inhibitors of VEB-1 \u0026beta;-lactamase. Theor Biol Med Model \u003cstrong\u003e10\u003c/strong\u003e: 22.10.1186/1742-4682-10-22\u003c/li\u003e\n\u003cli\u003eBenkert P, K\u0026uuml;nzli M, and Schwede T (2009) QMEAN server for protein model quality estimation. Nucleic Acids Res \u003cstrong\u003e37\u003c/strong\u003e: W510-4.10.1093/nar/gkp322\u003c/li\u003e\n\u003cli\u003eEberhardt J, Santos-Martins D, Tillack A F, and Forli S (2021) AutoDock Vina 1.2.0: New Docking Methods, Expanded Force Field, and Python Bindings. J Chem Inf Model \u003cstrong\u003e61\u003c/strong\u003e: 3891-3898.10.1021/acs.jcim.1c00203\u003c/li\u003e\n\u003cli\u003eTrott O and Olson A J (2010) AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J Comput Chem \u003cstrong\u003e31\u003c/strong\u003e: 455-61.10.1002/jcc.21334\u003c/li\u003e\n\u003cli\u003eRosignoli S and Paiardini A (2022) Boosting the Full Potential of PyMOL with Structural Biology Plugins. Biomolecules \u003cstrong\u003e12\u003c/strong\u003e.10.3390/biom12121764\u003c/li\u003e\n\u003cli\u003eYang H, Lou C, Sun L, Li J, Cai Y, Wang Z, Li W, Liu G, and Tang Y (2019) admetSAR 2.0: web-service for prediction and optimization of chemical ADMET properties. Bioinformatics \u003cstrong\u003e35\u003c/strong\u003e: 1067-1069.10.1093/bioinformatics/bty707\u003c/li\u003e\n\u003cli\u003eJia C Y, Li J Y, Hao G F, and Yang G F (2020) A drug-likeness toolbox facilitates ADMET study in drug discovery. Drug Discov Today \u003cstrong\u003e25\u003c/strong\u003e: 248-258.10.1016/j.drudis.2019.10.014\u003c/li\u003e\n\u003cli\u003eBlum M, Chang H Y, Chuguransky S, Grego T, Kandasaamy S, Mitchell A, Nuka G, Paysan-Lafosse T, Qureshi M, Raj S, Richardson L, Salazar G A, Williams L, Bork P, Bridge A, Gough J, Haft D H, Letunic I, Marchler-Bauer A, Mi H, Natale D A, Necci M, Orengo C A, Pandurangan A P, Rivoire C, Sigrist C J A, Sillitoe I, Thanki N, Thomas P D, Tosatto S C E, Wu C H, Bateman A, and Finn R D (2021) The InterPro protein families and domains database: 20 years on. Nucleic Acids Res \u003cstrong\u003e49\u003c/strong\u003e: D344-d354.10.1093/nar/gkaa977\u003c/li\u003e\n\u003cli\u003eAdasme M F, Linnemann K L, Bolz S N, Kaiser F, Salentin S, Haupt V J, and Schroeder M (2021) PLIP 2021: expanding the scope of the protein-ligand interaction profiler to DNA and RNA. Nucleic Acids Res \u003cstrong\u003e49\u003c/strong\u003e: W530-w534.10.1093/nar/gkab294\u003c/li\u003e\n\u003cli\u003eCarmena-Bargue\u0026ntilde;o M, Mart\u0026iacute;nez-Cort\u0026eacute;s C, Banegas-Luna A J, and P\u0026eacute;rez-S\u0026aacute;nchez H (2023) TOLEDO: Accelerated Maestro GUI molecular dynamics simulations. \u003c/li\u003e\n\u003cli\u003eAbdelmoniem N, M H A, R M M, Moutasim F, Rafie Ahmed A, Edris A, Ibraheem W, Makki A A, E M E, Elhag R, Osman W, R A M, and Alzain A A (2023) Identification of Novel Natural Dual HDAC and Hsp90 Inhibitors for Metastatic TNBC Using e-Pharmacophore Modeling, Molecular Docking, and Molecular Dynamics Studies. Molecules \u003cstrong\u003e28\u003c/strong\u003e.10.3390/molecules28041771\u003c/li\u003e\n\u003cli\u003eBurger P B, Hu X, Balabin I, Muller M, Stanley M, Joubert F, and Kaiser T M (2024) FEP Augmentation as a Means to Solve Data Paucity Problems for Machine Learning in Chemical Biology. Journal of Chemical Information and Modeling \u003cstrong\u003e64\u003c/strong\u003e: 3812-3825.10.1021/acs.jcim.4c00071\u003c/li\u003e\n\u003cli\u003eChen Y, Liang Z, Tian Z, Blanchard J, Dai C L, Chalbot S, Iqbal K, Liu F, and Gong C X (2014) Intracerebroventricular streptozotocin exacerbates Alzheimer-like changes of 3xTg-AD mice. Mol Neurobiol \u003cstrong\u003e49\u003c/strong\u003e: 547-62.10.1007/s12035-013-8539-y\u003c/li\u003e\n\u003cli\u003eLueptow L M (2017) Novel Object Recognition Test for the Investigation of Learning and Memory in Mice. J Vis Exp.10.3791/55718\u003c/li\u003e\n\u003cli\u003eShoji H and Miyakawa T (2021) Effects of test experience, closed-arm wall color, and illumination level on behavior and plasma corticosterone response in an elevated plus maze in male C57BL/6J mice: a challenge against conventional interpretation of the test. Molecular Brain \u003cstrong\u003e14\u003c/strong\u003e: 34.10.1186/s13041-020-00721-2\u003c/li\u003e\n\u003cli\u003eVasilopoulou F, Companys-Alemany J, Canudas A-M, Palomera-\u0026Aacute;valos V, Ortu\u0026ntilde;o-Sahag\u0026uacute;n D, Pall\u0026agrave;s M, and Gri\u0026ntilde;\u0026aacute;n-Ferr\u0026eacute; C (2021) Anxiety, impaired social and aggressive behaviour correlates with cognitive decline accompanied by molecular alterations in older SAMP8 males. \u003c/li\u003e\n\u003cli\u003eSarkar S, Raymick J, Cuevas E, Rosas-Hernandez H, and Hanig J (2020) Modification of methods to use Congo-red stain to simultaneously visualize amyloid plaques and tangles in human and rodent brain tissue sections. Metabolic brain disease \u003cstrong\u003e35\u003c/strong\u003e: 1371-1383\u003c/li\u003e\n\u003cli\u003eLian Q, Nie Y, Zhang X, Tan B, Cao H, Chen W, Gao W, Chen J, Liang Z, Lai H, Huang S, Xu Y, Jiang W, and Huang P (2016) Effects of grape seed proanthocyanidin on Alzheimer\u0026apos;s disease in?vitro and in?vivo. Experimental and Therapeutic Medicine \u003cstrong\u003e12\u003c/strong\u003e.10.3892/etm.2016.3530\u003c/li\u003e\n\u003cli\u003eEl Sayed N, Kandil E, and Ghoneum M (2021) Enhancement of Insulin/PI3K/Akt Signaling Pathway and Modulation of Gut Microbiome by Probiotics Fermentation Technology, a Kefir Grain Product, in Sporadic Alzheimer\u0026rsquo;s Disease Model in Mice. Frontiers in Pharmacology \u003cstrong\u003e12\u003c/strong\u003e: 666502.10.3389/fphar.2021.666502\u003c/li\u003e\n\u003cli\u003eVasilopoulou F, Rodr\u0026iacute;guez-Ar\u0026eacute;valo S, Bag\u0026aacute;n A, Escolano C, Gri\u0026ntilde;\u0026aacute;n-Ferr\u0026eacute; C, and Pall\u0026agrave;s M (2021) Disease-modifying treatment with I(2) imidazoline receptor ligand LSL60101 in an Alzheimer\u0026apos;s disease mouse model: a comparative study with donepezil. Br J Pharmacol \u003cstrong\u003e178\u003c/strong\u003e: 3017-3033.10.1111/bph.15478\u003c/li\u003e\n\u003cli\u003ePaladugu L, Gharaibeh A, Kolli N, Learman C, Hall T C, Li L, Rossignol J, Maiti P, and Dunbar G L (2021) Liraglutide Has Anti-Inflammatory and Anti-Amyloid Properties in Streptozotocin-Induced and 5xFAD Mouse Models of Alzheimer\u0026rsquo;s Disease. International Journal of Molecular Sciences \u003cstrong\u003e22\u003c/strong\u003e: 860\u003c/li\u003e\n\u003cli\u003ePeng Y, Jin H, Xue Y-H, Chen Q, Yao S-Y, Du M-Q, and Liu S (2023) Current and future therapeutic strategies for Alzheimer\u0026rsquo;s disease: an overview of drug development bottlenecks. Frontiers in Aging Neuroscience \u003cstrong\u003e15\u003c/strong\u003e.10.3389/fnagi.2023.1206572\u003c/li\u003e\n\u003cli\u003eBriner A, G\u0026ouml;tz J, and Polanco J C (2020) Fyn Kinase Controls Tau Aggregation In Vivo. Cell Reports \u003cstrong\u003e32\u003c/strong\u003e: 108045.https://doi.org/10.1016/j.celrep.2020.108045\u003c/li\u003e\n\u003cli\u003eNygaard H B, Van Dyck C H, and Strittmatter S M (2014) Fyn kinase inhibition as a novel therapy for Alzheimer\u0026rsquo;s disease. Alzheimer\u0026apos;s Research \u0026amp; Therapy \u003cstrong\u003e6\u003c/strong\u003e: 8.10.1186/alzrt238\u003c/li\u003e\n\u003cli\u003eShamsi A, Khan M S, Yadav D K, and Shahwan M (2024) Structure-based screening of FDA-approved drugs identifies potential histone deacetylase 3 repurposed inhibitor: molecular docking and molecular dynamic simulation approaches. Frontiers in Pharmacology \u003cstrong\u003e15\u003c/strong\u003e.10.3389/fphar.2024.1424175\u003c/li\u003e\n\u003cli\u003eG\u0026aacute;sp\u0026aacute;r A, Hutka B, Ernyey A J, Tajti B T, Varga B T, Z\u0026aacute;dori Z S, and Gyerty\u0026aacute;n I (2022) Performance of the intracerebroventricularly injected streptozotocin Alzheimer\u0026rsquo;s disease model in a translationally relevant, aged and experienced rat population. Scientific Reports \u003cstrong\u003e12\u003c/strong\u003e: 20247.10.1038/s41598-022-24292-5\u003c/li\u003e\n\u003cli\u003eKadhim H J, Al-Mumen H, Nahi H H, and Hamidi S M (2022) Streptozotocin-induced Alzheimer\u0026apos;s disease investigation by one-dimensional plasmonic grating chip. Scientific Reports \u003cstrong\u003e12\u003c/strong\u003e: 21878.10.1038/s41598-022-26607-y\u003c/li\u003e\n\u003cli\u003eSzczepańska K, Bojarski A J, Popik P, and Malikowska-Racia N (2023) Novel object recognition test as an alternative approach to assessing the pharmacological profile of sigma-1 receptor ligands. Pharmacological Reports \u003cstrong\u003e75\u003c/strong\u003e: 1291-1298.10.1007/s43440-023-00516-x\u003c/li\u003e\n\u003cli\u003eBroadbelt T, Mutlu-Smith M, Carnicero-Senabre D, Saido T C, Saito T, and Wang S-H (2022) Impairment in novelty-promoted memory via behavioral tagging and capture before apparent memory loss in a knock-in model of Alzheimer\u0026rsquo;s disease. Scientific Reports \u003cstrong\u003e12\u003c/strong\u003e: 22298.10.1038/s41598-022-26113-1\u003c/li\u003e\n\u003cli\u003eCurdt N, Schmitt F W, Bouter C, Iseni T, Weile H C, Altunok B, Beindorff N, Bayer T A, Cooke M B, and Bouter Y (2022) Search strategy analysis of Tg4-42 Alzheimer Mice in the Morris Water Maze reveals early spatial navigation deficits. Scientific Reports \u003cstrong\u003e12\u003c/strong\u003e: 5451.10.1038/s41598-022-09270-1\u003c/li\u003e\n\u003cli\u003ePentkowski N S, Rogge-Obando K K, Donaldson T N, Bouquin S J, and Clark B J (2021) Anxiety and Alzheimer\u0026apos;s disease: Behavioral analysis and neural basis in rodent models of Alzheimer\u0026apos;s-related neuropathology. Neurosci Biobehav Rev \u003cstrong\u003e127\u003c/strong\u003e: 647-658.10.1016/j.neubiorev.2021.05.005\u003c/li\u003e\n\u003cli\u003eSarkar S, Raymick J, Cuevas E, Rosas-Hernandez H, and Hanig J (2020) Modification of methods to use Congo-red stain to simultaneously visualize amyloid plaques and tangles in human and rodent brain tissue sections. Metab Brain Dis \u003cstrong\u003e35\u003c/strong\u003e: 1371-1383.10.1007/s11011-020-00608-0\u003c/li\u003e\n\u003cli\u003eGoel P, Chakrabarti S, Goel K, Bhutani K, Chopra T, and Bali S (2022) Neuronal cell death mechanisms in Alzheimer\u0026apos;s disease: An insight. Front Mol Neurosci \u003cstrong\u003e15\u003c/strong\u003e: 937133.10.3389/fnmol.2022.937133\u003c/li\u003e\n\u003cli\u003eNie J, Tian Y, Zhang Y, Lu Y-L, Li L-S, and Shi J-S (2016) Dendrobium alkaloids prevent A\u0026beta; 25\u0026ndash;35 -induced neuronal and synaptic loss via promoting neurotrophic factors expression in mice. PeerJ \u003cstrong\u003e4\u003c/strong\u003e: e2739.10.7717/peerj.2739\u003c/li\u003e\n\u003cli\u003eBrasnjevic I, Lardenoije R, Schmitz C, Kolk N, Dickstein D, Takahashi H, Hof P, Steinbusch H, and Rutten B (2013) Region-specific neuron and synapse loss in the hippocampus of APPSL/PS1 knock-in mice. Translational Neuroscience \u003cstrong\u003e4\u003c/strong\u003e.10.2478/s13380-013-0111-8\u003c/li\u003e\n\u003cli\u003eChin J, Palop J J, Puoliv\u0026auml;li J, Massaro C, Bien-Ly N, Gerstein H, Scearce-Levie K, Masliah E, and Mucke L (2005) Fyn kinase induces synaptic and cognitive impairments in a transgenic mouse model of Alzheimer\u0026apos;s disease. Journal of Neuroscience \u003cstrong\u003e25\u003c/strong\u003e: 9694-9703\u003c/li\u003e\n\u003cli\u003eBustos F J, Ampuero E, Jury N, Aguilar R, Falahi F, Toledo J, Ahumada J, Lata J, Cubillos P, Henr\u0026iacute;quez B, Guerra M V, Stehberg J, Neve R L, Inestrosa N C, Wyneken U, Fuenzalida M, H\u0026auml;rtel S, Sena-Esteves M, Varela-Nallar L, Rots M G, Montecino M, and Van Zundert B (2017) Epigenetic editing of the Dlg4/PSD95 gene improves cognition in aged and Alzheimer\u0026rsquo;s disease mice. Brain \u003cstrong\u003e140\u003c/strong\u003e: 3252-3268.10.1093/brain/awx272\u003c/li\u003e\n\u003cli\u003eWes P D, Easton A, Corradi J, Barten D M, Devidze N, Decarr L B, Truong A, He A, Barrezueta N X, and Polson C (2014) Tau overexpression impacts a neuroinflammation gene expression network perturbed in Alzheimer\u0026rsquo;s disease. PloS one \u003cstrong\u003e9\u003c/strong\u003e: e106050\u003c/li\u003e\n\u003cli\u003eMikkelsen J D, Kaad S, Aripaka S S, and Finsen B (2023) Synaptic vesicle glycoprotein 2A (SV2A) levels in the cerebral cortex in patients with Alzheimer\u0026apos;s disease: a radioligand binding study in postmortem brains. Neurobiology of Aging \u003cstrong\u003e129\u003c/strong\u003e: 50-57.https://doi.org/10.1016/j.neurobiolaging.2023.05.003\u003c/li\u003e\n\u003cli\u003eYamamoto N, Nakazawa M, Nunono N, Yoshida N, Obuchi A, Tanida M, Suzuki K, Ikeda-Matsuo Y, and Sobue K (2021) Protein kinases A and C regulate amyloid-\u0026beta; degradation by modulating protein levels of neprilysin and insulin-degrading enzyme in astrocytes. Neuroscience Research \u003cstrong\u003e166\u003c/strong\u003e: 62-72\u003c/li\u003e\n\u003cli\u003eAmidfar M, De Oliveira J, Kucharska E, Budni J, and Kim Y-K (2020) The role of CREB and BDNF in neurobiology and treatment of Alzheimer\u0026apos;s disease. Life sciences \u003cstrong\u003e257\u003c/strong\u003e: 118020\u003c/li\u003e\n\u003cli\u003eLow C Y, Lee J H, Lim F T, Lee C, Ballard C, Francis P T, Lai M K, and Tan M G (2021) Isoform‐specific upregulation of FynT kinase expression is associated with tauopathy and glial activation in Alzheimer\u0026apos;s disease and Lewy body dementias. Brain Pathology \u003cstrong\u003e31\u003c/strong\u003e: 253-266\u003c/li\u003e\n\u003cli\u003eAbid N B, Naseer M I, and Kim M O (2019) Comparative Gene-Expression Analysis of Alzheimer\u0026apos;s Disease Progression with Aging in Transgenic Mouse Model. Int J Mol Sci \u003cstrong\u003e20\u003c/strong\u003e.10.3390/ijms20051219\u003c/li\u003e\n\u003cli\u003eRoda A R, Serra-Mir G, Montoliu-Gaya L, Tiessler L, and Villegas S (2022) Amyloid-beta peptide and tau protein crosstalk in Alzheimer\u0026rsquo;s disease. Neural Regeneration Research \u003cstrong\u003e17\u003c/strong\u003e: 1666-1674.10.4103/1673-5374.332127\u003c/li\u003e\n\u003cli\u003eMeur S and Karati D (2024) Fyn Kinase in Alzheimer\u0026apos;s Disease: Unraveling Molecular Mechanisms and Therapeutic Implications. Mol Neurobiol.10.1007/s12035-024-04286-2\u003c/li\u003e\n\u003cli\u003eRoberson E D, Halabisky B, Yoo J W, Yao J, Chin J, Yan F, Wu T, Hamto P, Devidze N, Yu G-Q, Palop J J, Noebels J L, and Mucke L (2011) Amyloid-\u0026beta;/Fyn\u0026ndash;Induced Synaptic, Network, and Cognitive Impairments Depend on Tau Levels in Multiple Mouse Models of Alzheimer\u0026apos;s Disease. The Journal of Neuroscience \u003cstrong\u003e31\u003c/strong\u003e: 700-711.10.1523/jneurosci.4152-10.2011\u003c/li\u003e\n\u003cli\u003eMoore K J, El Khoury J, Medeiros L A, Terada K, Geula C, Luster A D, and Freeman M W (2002) A CD36-initiated signaling cascade mediates inflammatory effects of \u0026beta;-amyloid. Journal of Biological Chemistry \u003cstrong\u003e277\u003c/strong\u003e: 47373-47379\u003c/li\u003e\n\u003cli\u003eLee C, Low C Y B, Wong S Y, Lai M K P, and Tan M G K (2017) Selective induction of alternatively spliced FynT isoform by TNF facilitates persistent inflammatory responses in astrocytes. Scientific Reports \u003cstrong\u003e7\u003c/strong\u003e: 43651.10.1038/srep43651\u003c/li\u003e\n\u003cli\u003eDe Bastiani M A, Bellaver B, Brum W S, Souza D G, Ferreira P C L, Rocha A S, Povala G, Ferrari-Souza J P, Benedet A L, Ashton N J, Karikari T K, Zetterberg H, Blennow K, Rosa-Neto P, Pascoal T A, and Zimmer E R (2023) Hippocampal GFAP-positive astrocyte responses to amyloid and tau pathologies. Brain, Behavior, and Immunity \u003cstrong\u003e110\u003c/strong\u003e: 175-184.https://doi.org/10.1016/j.bbi.2023.03.001\u003c/li\u003e\n\u003cli\u003eNg T K S, Ho C S H, Tam W W S, Kua E H, and Ho R C-M (2019) Decreased Serum Brain-Derived Neurotrophic Factor (BDNF) Levels in Patients with Alzheimer\u0026rsquo;s Disease (AD): A Systematic Review and Meta-Analysis. International Journal of Molecular Sciences \u003cstrong\u003e20\u003c/strong\u003e: 257\u003c/li\u003e\n\u003cli\u003eFaria M C, Gon\u0026ccedil;alves G S, Rocha N P, Moraes E N, Bicalho M A, Gualberto Cintra M T, Jardim De Paula J, Jos\u0026eacute; Ravic De Miranda L F, Clayton De Souza Ferreira A, Teixeira A L, Gomes K B, Carvalho M D G, and Sousa L P (2014) Increased plasma levels of BDNF and inflammatory markers in Alzheimer\u0026apos;s disease. Journal of Psychiatric Research \u003cstrong\u003e53\u003c/strong\u003e: 166-172.https://doi.org/10.1016/j.jpsychires.2014.01.019\u003c/li\u003e\n\u003cli\u003eKivis\u0026auml;kk P, Carlyle B C, Sweeney T, Quinn J P, Ramirez C E, Trombetta B A, Mendes M, Brock M, Rubel C, Czerkowicz J, Graham D, and Arnold S E (2022) Increased levels of the synaptic proteins PSD-95, SNAP-25, and neurogranin in the cerebrospinal fluid of patients with Alzheimer\u0026rsquo;s disease. Alzheimer\u0026apos;s Research \u0026amp; Therapy \u003cstrong\u003e14\u003c/strong\u003e: 58.10.1186/s13195-022-01002-x\u003c/li\u003e\n\u003cli\u003eLeuba G, Walzer C, Vernay A, Carnal B, Kraftsik R, Piotton F, Marin P, Bouras C, and Savioz A (2008) Postsynaptic density protein PSD-95 expression in Alzheimer\u0026apos;s disease and okadaic acid induced neuritic retraction. Neurobiol Dis \u003cstrong\u003e30\u003c/strong\u003e: 408-419.10.1016/j.nbd.2008.02.012\u003c/li\u003e\n\u003cli\u003eSavioz A, Leuba G, and Vallet P G (2014) A framework to understand the variations of PSD-95 expression in brain aging and in Alzheimer\u0026apos;s disease. Ageing Research Reviews \u003cstrong\u003e18\u003c/strong\u003e: 86-94.https://doi.org/10.1016/j.arr.2014.09.004\u003c/li\u003e\n\u003cli\u003eMroczko B, Kulczynska-Przybik A, Borawska R, Dulewicz M, Doroszkiewicz J, Karpiuk M, and Slowik A (2023) The significance of the Calbindin-D in Alzheimer\u0026rsquo;s disease. Alzheimer\u0026apos;s \u0026amp; Dementia \u003cstrong\u003e19\u003c/strong\u003e: e062132.https://doi.org/10.1002/alz.062132\u003c/li\u003e\n\u003cli\u003eOdero G L, Oikawa K, Glazner K A, Schapansky J, Grossman D, Thiessen J D, Motnenko A, Ge N, Martin M, Glazner G W, and Albensi B C (2010) Evidence for the involvement of calbindin D28k in the presenilin 1 model of Alzheimer\u0026apos;s disease. Neuroscience \u003cstrong\u003e169\u003c/strong\u003e: 532-43.10.1016/j.neuroscience.2010.04.004\u003c/li\u003e\n\u003cli\u003eBavarsad M S and Grinberg L T (2024) SV2A PET imaging in human neurodegenerative diseases. Frontiers in Aging Neuroscience \u003cstrong\u003e16\u003c/strong\u003e.10.3389/fnagi.2024.1380561\u003c/li\u003e\n\u003cli\u003eJha N K, Jha S K, Kumar D, Kejriwal N, Sharma R, Ambasta R K, and Kumar P (2015) Impact of Insulin Degrading Enzyme and Neprilysin in Alzheimer\u0026apos;s Disease Biology: Characterization of Putative Cognates for Therapeutic Applications. J Alzheimers Dis \u003cstrong\u003e48\u003c/strong\u003e: 891-917.10.3233/jad-150379\u003c/li\u003e\n\u003cli\u003eMiners J S, Baig S, Tayler H, Kehoe P G, and Love S (2009) Neprilysin and insulin-degrading enzyme levels are increased in Alzheimer disease in relation to disease severity. J Neuropathol Exp Neurol \u003cstrong\u003e68\u003c/strong\u003e: 902-14.10.1097/NEN.0b013e3181afe475\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"neurochemical-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nere","sideBox":"Learn more about [Neurochemical Research](https://www.springer.com/journal/11064)","snPcode":"11064","submissionUrl":"https://submission.nature.com/new-submission/11064/3","title":"Neurochemical Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Alzheimer’s disease, fyn kinase, loperamide, molecular docking, molecular dynamic simulation.","lastPublishedDoi":"10.21203/rs.3.rs-6268540/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6268540/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAlzheimer’s disease (AD) is a complex, progressive neurodegenerative disorder that leads to irreversible deterioration of neuronal cells over time. It is the most frequent cause of dementia in elderly individuals globally. Current treatment drugs exhibit a modest effect on AD patients. Fyn kinase is implicated in AD pathogenesis, and its interactions with both AD hallmarks Aβ and tau make it a unique therapeutic target. To explore small molecule inhibitors effective in treating AD, FDA-approved drugs were evaluated using molecular docking to determine their affinity for fyn kinase. The findings of molecular simulations support the repurposing of loperamide for treating AD. Swiss albino mice were divided into six groups, including sham control, STZ group, donepezil-treated positive control, and three loperamide-treated groups with varying doses (2.5, 5, 10 mg/kg). Cognitive functions were assessed using Novel Object Recognition (NOR), Morris Water Maze (MWM), and Elevated Plus Maze (EPM) tests. Histological analyses were performed using Congo red, hematoxylin-eosin, and nissl staining. Gene expression of AD markers including Fyn, App, tau, Dlg4, Gfap, Bdnf, Cal1, Ide, Nep, and Sv2a were evaluated using qPCR. Our results show that Loperamide treatment significantly improved cognitive function in mice, reduced amyloid accumulation and neuronal loss, and enhanced Aβ clearance most probably by upregulating Nep and IDE. Additionally, qPCR results revealed a significant decrease in Fyn expression. We conclude from these investigations that Loperamide may serve as a promising therapeutic agent for AD by potentially targeting Fyn kinase, suggesting that further research is needed to explore its effectiveness in treating AD.\u003c/p\u003e","manuscriptTitle":"Targeting Fyn kinase for alleviation of cognitive impairment in Streptozocin-induced Alzheimer’s disease in mice by Loperamide; An Experimental and In silico analysis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-03 11:13:25","doi":"10.21203/rs.3.rs-6268540/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-04-22T14:28:32+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-18T14:25:40+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-15T16:07:17+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-14T14:41:37+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-14T11:23:21+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"214557355786919982292903606194415338003","date":"2025-03-28T08:34:32+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"175356394925504074321100928237251575728","date":"2025-03-24T22:46:18+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"10248393780881970601194255740900786372","date":"2025-03-24T19:44:01+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"20748230944734023051300771501317156433","date":"2025-03-24T16:22:23+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-03-24T16:20:14+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-03-24T16:06:55+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-03-21T06:05:19+00:00","index":"","fulltext":""},{"type":"submitted","content":"Neurochemical Research","date":"2025-03-20T10:01:30+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"neurochemical-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nere","sideBox":"Learn more about [Neurochemical Research](https://www.springer.com/journal/11064)","snPcode":"11064","submissionUrl":"https://submission.nature.com/new-submission/11064/3","title":"Neurochemical Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"62551cc2-f7d5-4953-baaf-79a142d2514c","owner":[],"postedDate":"April 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-06-30T16:02:55+00:00","versionOfRecord":{"articleIdentity":"rs-6268540","link":"https://doi.org/10.1007/s11064-025-04465-0","journal":{"identity":"neurochemical-research","isVorOnly":false,"title":"Neurochemical Research"},"publishedOn":"2025-06-26 15:57:33","publishedOnDateReadable":"June 26th, 2025"},"versionCreatedAt":"2025-04-03 11:13:25","video":"","vorDoi":"10.1007/s11064-025-04465-0","vorDoiUrl":"https://doi.org/10.1007/s11064-025-04465-0","workflowStages":[]},"version":"v1","identity":"rs-6268540","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6268540","identity":"rs-6268540","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}