The lncRNA HMMR-AS1 promotes the malignant progression of ovarian cancer cells by regulating the miR-627-3p/PTN axis

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background Long non-coding RNAs (lncRNAs) are crucial regulators of ovarian cancer(OC), playing a significant role in malignant transformation and closely linked to poor prognosis. Therefore, it is crucial to investigate the impact of lncRNAs on the malignant biological behavior of ovarian cancer and to understand their underlying molecular mechanisms. Methods The binding sites of target genes were predicted through bioinformatics analysis, and gene expression levels were measured using qRT-PCR. The malignant biological behavior of cells was assessed through cell biological function assays. Gene targeting relationships were verified using a dual-luciferase reporter gene(DLRG) assay. Protein expression levels were analyzed using Western blotting. Results Hyaluronan-mediated motility receptor antisense RNA1(HMMR-AS1) expression is upregulated in ovarian cancer cells. Cell biological function experiments demonstrated that HMMR-AS1 promotes malignant biological behaviors in ovarian cancer cells. DLRG experiments demonstrated that HMMR-AS1 targets miR-627-3p, which in turn targets pleiotrophin(PTN). Furthermore, we discovered that HMMR-AS1 functions as a competing endogenous RNA (ceRNA) for miR-627-3p, regulating the expression of PTN and thereby promoting the malignant phenotypes of ovarian cancer cells. Conclusions In summary, our study indicates that lncRNA HMMR-AS1 is highly expressed in ovarian cancer and plays a carcinogenic role. Targeting the lncRNA HMMR-AS1 may offer a novel therapeutic strategy for treating ovarian cancer.
Full text 115,921 characters · extracted from preprint-html · click to expand
The lncRNA HMMR-AS1 promotes the malignant progression of ovarian cancer cells by regulating the miR-627-3p/PTN axis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The lncRNA HMMR-AS1 promotes the malignant progression of ovarian cancer cells by regulating the miR-627-3p/PTN axis Jiaren He, Fei Tian, Jie Li, Yunxia Zhang, Zhaoping Chu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5773326/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Jun, 2025 Read the published version in Journal of Ovarian Research → Version 1 posted 8 You are reading this latest preprint version Abstract Background Long non-coding RNAs (lncRNAs) are crucial regulators of ovarian cancer(OC), playing a significant role in malignant transformation and closely linked to poor prognosis. Therefore, it is crucial to investigate the impact of lncRNAs on the malignant biological behavior of ovarian cancer and to understand their underlying molecular mechanisms. Methods The binding sites of target genes were predicted through bioinformatics analysis, and gene expression levels were measured using qRT-PCR. The malignant biological behavior of cells was assessed through cell biological function assays. Gene targeting relationships were verified using a dual-luciferase reporter gene(DLRG) assay. Protein expression levels were analyzed using Western blotting. Results Hyaluronan-mediated motility receptor antisense RNA1(HMMR-AS1) expression is upregulated in ovarian cancer cells. Cell biological function experiments demonstrated that HMMR-AS1 promotes malignant biological behaviors in ovarian cancer cells. DLRG experiments demonstrated that HMMR-AS1 targets miR-627-3p, which in turn targets pleiotrophin(PTN). Furthermore, we discovered that HMMR-AS1 functions as a competing endogenous RNA (ceRNA) for miR-627-3p, regulating the expression of PTN and thereby promoting the malignant phenotypes of ovarian cancer cells. Conclusions In summary, our study indicates that lncRNA HMMR-AS1 is highly expressed in ovarian cancer and plays a carcinogenic role. Targeting the lncRNA HMMR-AS1 may offer a novel therapeutic strategy for treating ovarian cancer. HMMR-AS1 malignant progression miR-627-3p ovarian cancer PTN Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1 Introduction OC is one of the three primary malignant tumors of the female reproductive system in China, and it has the highest mortality rate among them [ 1 ] . Early symptoms of OC are often atypical, and more than two-thirds of cases are diagnosed at advanced stages, resulting in a five-year survival rate of less than 50% [ 2 ] . Surgery combined with chemotherapy remains the primary clinical treatment for OC; however, the recurrence rate is high, and the prognosis is poor [ 3 , 4 ] . Therefore, investigating the molecular mechanisms that contribute to the development of OC and establishing a more compelling foundation for enhancing clinical prevention and treatment strategies has been a major focus of exploration for medical researchers. lncRNAs are a class of non-coding RNAs that exceed 200 nucleotides in length and are commonly found in eukaryotic organisms, unlike messenger RNAs, lncRNAs do not serve a function in protein translation [ 5 ] . However, their dysregulation has been linked to the onset and progression of various diseases. It has been found that lncRNAs are important players in tumors and are indirectly associated with tumor cell proliferation, invasion, and chemoresistance [ 6 , 7 ] . In addition, lncRNAs influence tumorigenesis and progression by targeting downstream microRNAs (miRNAs), and the mechanisms underlying their action are being extensively studied in tumor biology [ 8 ] . For instance, in pancreatic cancer, lncRNA H19 facilitates the polarization of tumor-associated macrophages to the M2 type and the secretion of some certain cytokines, thereby indirectly promoting tumor proliferation and metastasis. Mechanistically, lncRNA H19 competes with miR-107 for binding to YTHDC1 mRNA and also interacts with the YTHDC1 protein to regulate the stability of SRSF1, which in turn affects the selective splicing of IL-6 and IL-10 [ 9 ] . The lncRNA HMMR-AS1 is located on chromosome 5q34 and is approximately 1,269 bp in length. It is a neighboring gene to the mRNA HMMR [ 10 ] . It has been found that the expression of HMMR-AS1 is upregulated in various malignant tumors and is closely associated with tumor growth, metastasis, and prognosis [ 11 – 13 ] . miRNAs are a class of non-coding RNAs consisting of 18 to 25 nucleotides [ 14 ] , and they play a crucial role in regulating gene expression and protein translation [ 15 ] . miRNAs are highly conserved molecules that act a significant part in the biological processes associated with tumors, functioning as post-transcriptional regulators and can exhibit either oncostatic or oncogenic effects [ 16 , 17 ] . As a tumor suppressor, miR-627-3p plays a crucial regulatory role in the malignant progression of lung, colorectal, esophageal, and colon adenocarcinomas. Mechanistically, it can act by mediating the functions of other non-coding RNAs, including lncRNAs and circRNAs [ 18 – 21 ] . PTN is a member of the two-member heparin-binding growth factor family, which is highly conserved across mammalian species [ 22 ] . It is an 18 kDa protein composed of 168 amino acids [ 23 ] and is encoded by the PTN gene, which is located on human chromosome 7q33 and spans approximately 116 kb [ 24 ] . PTN is a multifunctional growth factor that exhibits potent mitogenic and angiogenic activities. It plays a crucial role in regulating various cellular functions, including cell growth [ 25 ] , differentiation and metastasis [ 26 ] , angiogenesis [ 27 ] , and inflammatory responses [ 28 ] . In recent years, several studies have demonstrated that the expression level of PTN is regulated by miRNAs. Specifically, miR-182, miR-384, and miR-137 have been shown to target PTN and reduce its expression, which correlates with endometrial development, the metastasis of cancer cells, and chondrogenic differentiation [ 29 – 31 ] . Therefore, the functions and potential regulatory mechanisms of miRNAs and PTN in tumors deserve attention. Due to their positional and sequence correlations, lncRNAs and miRNAs exhibit a complex regulatory relationship. LncRNAs can function as ceRNAs to regulate the expression of miRNAs, thereby influencing the biological functions of cells [ 32 – 35 ] . Our previous study demonstrated that HMMR-AS1 is highly expressed in human OC tissues and is negatively correlated with overall survival and progression-free survival. This finding suggests a close relationship between HMMR-AS1 and the malignant progression of OC and is expected to be a novel biomarker for the diagnosis and prognosis of OC [ 36 ] . Bioinformatics analysis has revealed that HMMR-AS1 and PTN possess specific binding sites for miR-627-3p. However, the effect of HMMR-AS1 on the biological behavior of OC remains unclear, and whether HMMR-AS1's involvement in the pathogenesis and progression of OC is related to miR-627-3p/PTN axis has not been confirmed. Therefore, the aim of this study was to conduct a preliminary exploration of these issues and to serve as a reference for optimizing the diagnosis, treatment, and prognostic assessment of OC. 2 Materials and methods 2.1 Cell culture Human normal ovarian epithelial cell line IOSE80 and human ovarian cancer cell lines OVCAR3 and SKOV3 (both obtained from iCell Bioscience, China) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (Cyagen, China) and 1% penicillin-streptomycin. The cells were incubated at 37°C in a 5% CO2 incubator. Passaging of the culture can be performed when the cell growth density reaches 80% to 90%. 2.2 Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) Total RNA and miRNA were extracted from the cells using an RNA extraction kit (Tiangen, China). The cDNA was synthesized using a cDNA synthesis kit (Tiangen, China). qRT-PCR analysis was conducted using a PCR instrument (ABI Corp, USA) in accordance with the instructions provided by the SuperReal PreMix Plus reagent (Tiangen, China). The relative expression of target genes was calculated using the 2-ΔΔCt method. The primers for miR-627-3p and U6 were designed and synthesized by RiboBio, China, whlie the primers for HMMR-AS1, PTN, and β-actin were obtained from Generalbiol, China. All the primers utilized in this study are specific and the primers sequences information are presented in Table 1. Table 1 Primers in this study are as follows Gene Direction Sequence(5’-3’) HMMR-AS1 Forward Reverse CCACATCACATTGGTCCATTACA GCAGACCAAGTCAGCACTAAAGG PTN Forward Reverse GGAGCTGAGTGCAAGCAAAC CTCGCTTCAGACTTCCAGTTC β-actin Forward Reverse CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT miR-627-3p Forward Reverse TCTTTTCTTTGAGA TGGTGTCGTGGAGTCG U6 Forward Reverse CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT 2.3 Transfection and grouping miR-627-3p, PTN, and the corresponding negative control(NC) plasmids were designed and synthesized by RiboBio(China). miR-627-3p, PTN, and the corresponding negative control plasmids were designed and synthesized by RiboBio(China), while si-HMMR-AS1 and its NC plasmid were designed and synthesized by GenePharma(China). SKOV3 and OVCAR3 cells were transfected at a logarithmic growth density of 70% to 80% using Lipofectamine™ 2000 (Thermo Fisher Scientific, USA). The transfected cells were categorized into the following groups: si-HMMR-AS1 group, si-NC group, miR-627-3p mimics group, mimics NC group, miR-627-3p inhibitor group, inhibitor NC group, ov-PTN group, ov-NC-PTN group, si-PTN group, si-NC-PTN group, si-HMMR-AS1 + miR-627-3p inhibitor(si-HMMR-AS1 + in) group, and si-HMMR-AS1 + PTN overexpression(si-HMMR-AS1 + PTN) group. 2.4 Cell proliferation assay After 24 hours of transfection, the cells were resuspended into single-cell suspensions and inoculated into 96-well plates at a density of 8 × 10^3 cells per well. Four replicate plates were established, corresponding to the addition of CCK-8 reagent (APExBIO Corp, USA) at 0, 24, 48, and 72 hours of incubation, respectively. After incubating the cells with 10 μL of CCK-8 solution per well for 2 hours, the optical density at 450 nm was measured. 2.5 Cell migration assay When the cell density in the 6-well plate reached approximately 90% post-transfection, three parallel lines with consistent spacing were drawn in the wells using a sterile pipette tip. The detached cells in the scratched area was washed away and then serum-free medium was added to continue the cell culture. 2.6 Cell invasion assay After 48 hours of transfection, the cells were resuspended in serum-free medium. Matrigel substrate (Solarbio, China) was added to Transwell chambers (Corning, USA), and after incubation at 37°C for 30 minutes a cell suspension of 200 µL with a cell count of (2.5-3) × 10^4 was added. Then 500 µL of medium containing 20% FBS was added to the bottom of the Transwell chambers. After 48 hours of culture, the cells at the upper surface of the chamber were wiped out, and the cells at the lower surface of the chambers were fixed with 4% paraformaldehyde for 1 hour and stained with a 1% crystal violet solution for 1 hour. The cells were observed under a microscope, photographed, and the number of cells that penetrated the membrane was counted. 2.7 Cell apoptosis assay After 48 h of transfection, the cells were resuspended in PBS at a density of (2-3) × 10^6 cells/mL. Then, propidium iodide (PI) and membrane-linked protein V-fluorescein isothiocyanate (Annexin V-FITC) were added to the mixture. The apoptosis rate was detected after 15 minutes of incubation at 37°C in the absence of light. 2.8 Double luciferase reporter gene (DLRG) assay The bioinformatics tools OECloud and TargetScan8.0 were utilized to predict the binding sites of HMMR-AS1 with miR-627-3p, as well as the interaction between miR-627-3p and PTN. Wild-type (WT) and mutant (MUT) HMMR-AS1 fragments, along with PTN 3′-UTR fragments, were constructed into the corresponding psiCHECK2 and pmirGLO luciferase reporter vectors (Promega, USA), respectively. Then, miR-627-3p mimics or NC, and vectors were co-transfected into 293T cells. The luciferase activity of the cells was measured after 48 hours of culture. 2.9 Western blotting analysis After 48 hours of transfection, proteins from the si-HMMR-AS1 group, miR-627-3p mimics group, miR-627-3p inhibitor group, and their corresponding NC groups were extracted using RIPA lysis buffer (Solarbio, China). Protein concentrations were quantified using a BCA kit (Abbkine, USA). Proteins were subsequently separated using SDS-PAGE gel electrophoresis (Solarbio, China) and transferred to a PVDF membrane. The PVDF membrane was blocked with 5% skimmed milk for 1.5h hours at room temperature. Subsequently, the antibodies PTN (1:1500, Origene, USA) and β-actin (1:10,000, Zenbio, China) were added and incubated at 4°C. After 24 hours, the PVDF membrane was incubated with a secondary antibody for 1 hour at room temperature. It was then rinsed three times, after which an ECL color development solution was added. The PVDF membrane was subsequently exposed for imaging, and the western blotting analysis was quantified. Statistical analysis All data were derived from three replicated experiments and were statistically analyzed using SPSS version 27.0. Data conforming to a normal distribution were expressed as mean ± SD(x̄±s). Comparisons between multiple groups and between two groups were respectively performed using one-way analysis of variance(ANOVA) and Student’s t-test, with P<0.05 considered to indicate a statistically significant difference. one-way analysis of variance 3 Results 3.1 Expression of HMMR-AS1, miR-627-3p and PTN in OVCAR3 and SKOV3 cells The qRT-PCR results indicated that the expression levels of HMMR-AS1 and PTN mRNA were significantly upregulated in OVCAR3 and SKOV3 cells compared to IOSE80 cells, in contrast, the expression of miR-627-3p was downregulated, with all differences being more significant in SKOV3 cells (Figure 1A-C). Therefore, HMMR-AS1, miR-627-3p, and PTN may be linked to the onset and progression of OC. 3.2 Effect of knockdown of HMMR-AS1 on the malignant phenotype of OVCAR3 and SKOV3 cells To investigate the biological function of HMMR-AS1 in OC, we knocked down HMMR-AS1 in OVCAR3 and SKOV3 cell lines (Figure 2A). The cell proliferation assay, migration assay, and transwell assay demonstrated that, compared to the NC group, the proliferation, migration, and invasion abilities were significantly reduced in the si-HMMR-AS1 group, while the apoptosis rate was increased (Figure 2B-E). Taken together, HMMR-AS1 plays a pro-carcinogenic role in OC cells. 3.3 HMMR-AS1 directly targets miR-627-3p and regulates its expression To investigate the mechanism of action of HMMR-AS1 in OC, we utilized the online database OECloud tools (https://cloud.oebiotech.com/#/home) for analysis and discovered complementary binding sequences for HMMR-AS1 and miR-627-3p (Figure 3A). Therefore, we hypothesized that HMMR-AS1 affects the malignant progression of OC cells by regulating miR-627-3p. DLRG assays demonstrated that miR-627-3p mimics reduced luciferase activity in the HMMR-AS1-WT group, while showing no significant effect on the HMMR-AS1-MUT group (Figure 3B). Furthermore, qRT-PCR demonstrated that the knockdown of HMMR-AS1 significantly increased the expression of miR-627-3p in OVCAR3 and SKOV3 cells (Figure 3C). These results suggest that miR-627-3p is a target gene of HMMR-AS1 and is negatively regulated by it. 3.4 Effect of overexpression or knockdown of miR-627-3p on the malignant phenotype of OVCAR3 and SKOV3 cells To investigate the biological function of miR-627-3p in OC, we established models for both overexpression and knockdown of miR-627-3p in OVCAR3 and SKOV3 cell lines (Figure 4A). The results of the cell function experiments indicated that cells in the miR-627-3p mimics group had reduced proliferation, migration, and invasion abilities, along with increased apoptosis rates compared to the control group, wheras the miR-627-3p inhibitor had the opposite effect on the cells compared with miR-627-3p mimics (Figure 4B-E). In summary, miR-627-3p It has a cancer-suppressing effect in OC cells. 3.5 Targeting relationship between miR-627-3p and PTN Prediction from the TargetScan8.0 website (https://www.targetscan.org/) indicates that PTN has a specific binding site for miR-627-3p (Figure 5A). DLRG assay demonstrated that the overexpression of miR-627-3p significantly decreased the luciferase activity in cells with the wild-type PTN 3' UTR, while having no effect on the mutant PTN 3' UTR group (Figure 5B). Furthermore, the overexpression of miR-627-3p significantly decreased the mRNA and protein levels of PTN in OC cells. However, exactly the opposite result was observed when the expression of miR-627-3p was inhibited (Figure 5C-D). The results above indicate that miR-627-3p targets PTN and negatively regulates its expression. 3.6 Effect of PTN overexpression or knockdown on the malignant phenotype of OVCAR3 and SKOV3 cells To investigate the role of PTN in the biological functions of OC, we knocked down and overexpressed PTN in OVCAR3 and SKOV3 cells, and the transfection efficiency was verified using qRT-PCR (Figure 6A). Cell biological function experiments demonstrated that the proliferation, migration, and invasion of cells in the ov-PTN group were significantly enhanced, while the apoptosis rate was markedly reduced compared to the control group. Conversely, when PTN was knocked down, the effects on the cells were opposite to those observed above (Figure 6B-E). These findings suggest that PTN has a pro-carcinogenic effect on OC cells. 3.7 HMMR-AS1 regulates the malignant phenotype of OVCAR3 and SKOV3 cells through the miR-627-3p/PTN axis qRT-PCR and Western blotting analysis demonstrated that the expression levels of PTN mRNA and PTN protein were downregulated following the knockdown of HMMR-AS1 (Figure 7A-B). In addition, the miR-627-3p inhibitor was found to partially reverse the suppression of PTN mRNA expression caused by the knockdown of HMMR-AS1 (Figure. 7A). To confirm that the miR-627-3p/PTN axis functions as a downstream regulator influencing the modulatory effect of HMMR-AS1 on the biological behavior of OC cells, we co-transfected OVCAR3 and SKOV3 cells with either a miR-627-3p inhibitor or ov-PTN along with si-HMMR-AS1. It was observed that both the miR-627-3p inhibitor and ov-PTN could partially restored the effects of si-HMMR-AS1 on the proliferation, migration, invasion, and apoptosis of OVCAR3 and SKOV3 cells (Figure. 7C-F). Overall, our data suggest that HMMR-AS1 may regulates the downstream target gene PTN through competitive binding to miR-627-3p, thereby influencing the malignant biological behavior of OC cells. 4 Discussion After years of painstaking exploration, significant progress has been achieved in the treatment of OC. However, due to the fact that OC is difficult to detect, difficult to diagnose, easy to metastasize, easy to recur, and easy to be drug-resistant, the majority of therapies for patients ultimately result in failure, leading to a high mortality rate. Therefore, the clinical management of OC continues to face significant challenges. It is particularly urgent to investigate the mechanisms underlying OC development to formulate effective diagnostic and treatment strategies. Tumor metastasis and invasion are closely associated with abnormal gene expression. Increasing evidence suggests that the dysregulation of lncRNA expression is mechanistically linked to a wide range of diseases, including cancer, and may serve as a potential biomarker and a new therapeutic target [ 37 ] . Abnormal expression of lncRNAs can lead to tumorigenesis or even uncontrolled disease progression. Detecting changes in the expression levels of one or more lncRNAs may serve as an effective method for the early diagnosis of various diseases [ 38 ] . It has been suggested that lncRNAs may influence cytokine and growth factor activities by modulating the microenvironment of glioblastoma [ 39 ] . In prostate cancer, SNHG21 enhances mitochondrial homeostasis by binding to and preventing the ubiquitin-proteasome-dependent degradation of the PIM1 protein [ 40 ] . In another study, lncRNA MIR503HG was identified as a novel suppressor gene of supraphysiologic androgen levels, which inhibits androgen-mediated cellular senescence in prostate cancer. It may also serve as a biomarker for responsiveness to bipolar androgen therapy [ 41 ] . In gastric cancer, the expression of LINC01094 is upregulated and plays a role in the regulation of the LINC01094-miR-128-3p-RUNX1 positive feedback loop. This loop downregulates CDKN1A by interacting with RBMS2 and HDAC1, respectively, thereby promoting malignant behavior and poor prognosis in gastric cancer [ 42 ] . Glucose-induced LINC01419 promotes the growth and metastasis of hepatocellular carcinoma cells by driving metabolic reprogramming. Mechanistically, LINC01419 facilitates the binding of YBX1 to PDK1 mRNA, which enhances the stability of PDK1 mRNA and increases lactate production [ 43 ] . HMMR-AS1 has been found to be aberrantly expressed in various tumors, including breast cancer, lung adenocarcinoma, hepatocellular carcinoma, and glioblastoma. It is closely associated with the progression of these cancers [ 9 , 11 , 44 , 45 ] . Our data indicated that the expression of HMMR-AS1 was upregulated in OC cells compared to normal ovarian epithelial cells, which is consistent with our previous findings [ 36 ] . We also found that the downregulation of HMMR-AS1 inhibited OC cell proliferation, migration, and invasion, while promoting apoptosis. This suggests that HMMR-AS1 acts as a pro-carcinogenic factor in OC, and may serve as a potential therapeutic target for OC. Many studies have demonstrated that lncRNAs influence both physiological and pathological processes in organisms by regulating the expression and function of downstream genes [ 46 , 47 ] . For example, lncRNAs can regulate the activity of downstream mRNAs by competitively binding to miRNAs, thereby influencing tumorigenesis and progression [ 48 ] . Cai et al. [ 12 ] reported that HMMR-AS1 promotes the proliferation of lung adenocarcinoma cells and inhibits apoptosis by regulating the miR-138/SIRT6 axis. Therefore, HMMR-AS1 may serve as a potential therapeutic target for lung adenocarcinoma. A study found that HMMR-AS1 is overexpressed in hepatocellular carcinoma and is associated with a poor prognosis. Exosomal HMMR-AS1 competitively binds to miR-147a, influences ARID3A-mediated macrophage M2-type polarization, accelerates the progression of hepatocellular carcinoma, and is further enhanced by hypoxic conditions [ 13 ] . Li's team demonstrated that HMMR-AS1 was aberrantly overexpressed in glioblastoma cells. The knockdown of HMMR-AS1 in vitro inhibited tumor cell proliferation and the mesenchymal phenotype. Furthermore, HMMR-AS1 enhanced the radiosensitivity of glioblastoma by reducing the levels of DNA repair proteins [ 45 ] . In this study, we found that the interaction between HMMR-AS1 and miR-627-3p plays a significant role in tumor progression in OC. HMMR-AS1 directly targets miR-627-3p and negatively regulates its expression, which, in turn, exerts pro-oncogenic effects. It has been demonstrated that miR-627-3p is expressed at low levels in various malignant tumors and plays an oncogenic role. miR-627-3p was significantly downregulated in lung cancer cells and was involved in the pro-carcinogenic effects mediated by RP11-284F21.9. RP11-284F21.9 enhances the proliferative and invasive capacity of lung cancer cells by directly regulating miR-627-3p expression. In contrast, the overexpression of miR-627-3p partially mitigated the pro-carcinogenic effects of RP11-284F21.9 [ 18 ] . In studies of esophageal squamous cell carcinoma, miR-627-3p inhibited tumor progression by downregulating the expression of ZEB1. This effect was mediated by the inhibition of TGFB2 expression and TGF-β secretion, as well as the suppression of TGF-β-induced EMT [ 20 ] . The data of our study suggest that miR-627-3p is expressed at low levels in OC cells. Furthermore, the overexpression of miR-627-3p inhibits the malignant biological behavior of these cells, while the inhibitor of miR-627-3p generates opposite effects. However, these results are different from those of Zhao et al [ 49 ] . This may be attributed to the distinct molecular mechanisms investigated by our two research teams, which mediate the varying expression levels of miR-627-3p. That is, miRNAs involved in various regulatory mechanisms may have difference expression level and opposing roles, or there may be additional factors contributing to the results that require further exploration. PTN exhibits oncogenic potential and is regarded as a potential biomarker for various malignant tumors. A study found a correlation between PTN expression levels and advanced breast cancer, suggesting that it may serve as an independent predictor of tumor prognosis [ 50 ] . PTN levels in the serum of breast cancer patients correlate with TNM stage, histopathologic grade, and the presence or absence of distant metastasis. Elevated PTN concentrations are associated with a higher likelihood of distant metastasis, emphasizing the strong relationship between PTN levels and distant metastasis in breast cancer [ 51 – 52 ] . Meanwhile, we discovered that PTN expression was upregulated in OC cells. The overexpression of PTN enhanced the malignant biological behavior of these cells, suggesting a positive correlation between PTN expression and tumor progression. PTN is involved in various microRNA regulatory mechanisms and plays a significant role in cancer development and tumor progression. Yao et al. [ 53 ] identified PTN as a downstream target of miR-384 in their study on rectal cancer and the antitumor effects of lidocaine were mediated through the miR-384/PTN axis. We discovered that the upregulation or downregulation of PTN expression correlated with varying levels of miR-627-3p expression, suggesting that miR-627-3p may function as a promoter of PTN in its oncogenic role. We further confirmed that PTN is a target of miR-627-3p, which can directly interact with the 3' UTR region of PTN mRNA, thereby negatively regulating PTN expression. Furthermore, we discovered that the suppression of PTN mRNA expression, resulting from the knockdown of HMMR-AS1, could be partially reversed by the miR-627-3p inhibitor. The downregulation of miR-627-3p and the overexpression of PTN partially reversed the effects of HMMR-AS1 knockdown on OC cell proliferation, migration, invasion, and apoptosis. These results suggest that HHMR-AS1-induced PTN expression may be mediated by miR-627-3p, where HMR-AS1 acts as a molecular sponge for miR-627-3p, and miR-627-3p serves as an antagonistic mediator in this mechanism. Overall, the mechanism by which lncRNA HMMR-AS1 promotes the malignant progression of ovarian cancer may be associated with miR-627-3p/PTN axis. However, our study has several limitations. We only investigated the mechanisms at the in vitro cellular level without incorporating clinical data analysis or studies involving clinical tissue. Additionally, we lacked research at the in vivo animal level. Future studies that address these aspects may validate our conclusions more comprehensively and enhance our understanding of the pathogenic mechanisms of OC. In conclusion, our study demonstrates that lncRNA HMMR-AS1 expression is upregulated in OC cells and promotes the malignant progression of OC cells. Therefore, lncRNA HMMR-AS1 may be a potential therapeutic target for OC. Abbreviations lncRNAs long non-coding RNAs OC ovarian cancer DLRG dual-luciferase reporter gene HMMR-AS1 Hyaluronan-mediated motility receptor antisense RNA1 PTN pleiotrophin ceRNA competing endogenous RNA miRNAs microRNAs NC negative control qRT-PCR quantitative reverse transcription polymerase chain reaction Declarations Acknowledgements All authors appreciated the support from the Clinical Medicine Research Center of Hebei General Hospital. Authors’ contributions Jiaren He: Investigation, Writing–original draft. Fei Tian: Formal analysis, Investigation, Software. Jie Li: Formal analysis, Investigation. Yunxia Zhang: Supervision, Writing–review & editing. Zhaoping Chu: Supervision, Writing–review & editing. All authors contributed to the article and approved the submitted version. Funding This research was funded by the Hebei Province medical science research project(20230022) and the the government of Hebei Province funded the clinical medical talents project(ZF2023180). Data availability No datasets were generated or analysed during the current study. Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare no competing interests. Footnotes Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. References Farinella F, Merone M, Bacco L, Capirchio A, Ciccozzi M, Caligiore D. Machine Learning analysis of high-grade serous ovarian cancer proteomic dataset reveals novel candidate biomarkers. Sci Rep. 2022;12(1):3041. Published 2022 Feb 23. doi:10.1038/s41598-022-06788-2. Majidi A, Na R, Jordan SJ, DeFazio A, Obermair A, Friedlander M, Grant P, Webb PM. Common analgesics and ovarian cancer survival: the Ovarian cancer Prognosis And Lifestyle (OPAL) Study. J Natl Cancer Inst. 2023 May 8;115(5):570-577. doi: 10.1093/jnci/djac239. Yang L, Xie HJ, Li YY, Wang X, Liu XX, Mai J. Molecular mechanisms of platinum‑based chemotherapy resistance in ovarian cancer (Review). Oncol Rep. 2022;47(4):82. doi:10.3892/or.2022.8293. Yang C, Xia BR, Zhang ZC, Zhang YJ, Lou G, Jin WL. Immunotherapy for Ovarian Cancer: Adjuvant, Combination, and Neoadjuvant. Front Immunol. 2020;11:577869. Published 2020 Oct 6. doi:10.3389/fimmu.2020.577869. Zheng Z, Liu H, Xu Q, Cui W, Liu K. Comprehensive identification of a migrasomes-associated long non-coding RNA signature to predict the prognosis and treatment options in colon adenocarcinoma. Discov Oncol. 2025 Mar 27;16(1):409. doi: 10.1007/s12672-025-02197-9. Cai J, Ji Z, Wu J, Chen L, Zheng D, Chen Y, Zhang X, Xie W, Huang J, Chen M, Lin R, Lin W, Chen Y, Li Z. Development and validation of a novel endoplasmic reticulum stress-related lncRNA prognostic signature and candidate drugs in breast cancer. Front Genet. 2022 Aug 25;13:949314. doi: 10.3389/fgene.2022.949314. Wu W, Zhang S, He J. The Mechanism of Long Non-coding RNA in Cancer Radioresistance/Radiosensitivity: A Systematic Review. Front Pharmacol. 2022;13:879704. Published 2022 May 5. doi:10.3389/fphar.2022.879704. Alghazali T, Ahmed AT, Hussein UA, Sanghvi G, Uthirapathy S, Edan RT, Lal M, Shit D, Naidu KS, Al-Hamairy AK. Noncoding RNA (ncRNA)-mediated regulation of TLRs: critical regulator of inflammation in tumor microenvironment. Med Oncol. 2025 Mar 31;42(5):144. doi: 10.1007/s12032-025-02690-9. Liu P, Gao X, Yu Z, Liu Y, Liu Y, Lin J, Cao Y, Zhai S, Li J, Huang Y, Zou S, Wen C, Fu D, Lin J, Shen B. H19 promotes polarization and alternative splicing in tumor-associated macrophages, facilitating pancreatic cancer progression. Cancer Lett. 2024 Dec 7;611:217389. doi: 10.1016/j.canlet.2024.217389. Liu W, Ma J, Cheng Y, Zhang H, Luo W, Zhang H. HMMR antisense RNA 1, a novel long noncoding RNA, regulates the progression of basal-like breast cancer cells. Breast Cancer (Dove Med Press). 2016;8:223-229. Published 2016 Nov 24. doi:10.2147/BCTT.S119997. Bao X, Peng Y, Shen J, Yang L. Sevoflurane inhibits progression of glioma via regulating the HMMR antisense RNA 1/microRNA-7/cyclin dependent kinase 4 axis. Bioengineered. 2021 Dec;12(1):7893-7906. doi: 10.1080/21655979.2021.1976712. Cai Y, Sheng Z, Chen Y, Wang J. LncRNA HMMR-AS1 promotes proliferation and metastasis of lung adenocarcinoma by regulating MiR-138/sirt6 axis. Aging (Albany NY). 2019;11(10):3041-3054. doi:10.18632/aging.101958. Wang X, Zhou Y, Dong K, Zhang H, Gong J, Wang S. Exosomal lncRNA HMMR-AS1 mediates macrophage polarization through miR-147a/ARID3A axis under hypoxia and affects the progression of hepatocellular carcinoma. Environ Toxicol. 2022;37(6):1357-1372. doi:10.1002/tox.23489. Song Q, Xue L, Ren J, Liu X, Li G, Liu C, Meng X. Clinical significance of microRNA-328-3p and bone metabolism biomarkers in gout patients with different musculoskeletal ultrasonography imaging. J Orthop Surg Res. 2025 Apr 1;20(1):329. doi: 10.1186/s13018-025-05691-6. Wang Y, Huang D, Li M, Yang M. MicroRNA-99 family in cancer: molecular mechanisms for clinical applications. PeerJ. 2025 Mar 27;13:e19188. doi: 10.7717/peerj.19188. Solaimani M, Hosseinzadeh S, Abasi M. Non-coding RNAs, a double-edged sword in breast cancer prognosis. Cancer Cell Int. 2025 Apr 1;25(1):123. doi: 10.1186/s12935-025-03679-0. Hossam Abdelmonem B, Kamal LT, Wardy LW, Ragheb M, Hanna MM, Elsharkawy M, Abdelnaser A. Non-coding RNAs: emerging biomarkers and therapeutic targets in cancer and inflammatory diseases. Front Oncol. 2025 Mar 10;15:1534862. doi: 10.3389/fonc.2025.1534862. Li D, Wang L, Feng J, Shen YW, Liu LN, Wang Y. RP11-284F21.9 promotes lung carcinoma proliferation and invasion via the regulation of miR‑627‑3p/CCAR1. Oncol Rep. 2020;44(4):1638-1648. doi:10.3892/or.2020.7732. Liu H, Li J, Zhao H, Liu X, Ye X. DNAJC2 is reversely regulated by miR‑627‑3p, promoting the proliferation of colorectal cancer. Mol Med Rep. 2021;24(2):589. doi:10.3892/mmr.2021.12228. Meng L, Zheng Y, Liu S, Ju Y, Ren S, Sang Y, Zhu Y, Gu L, Liu F, Zhao Y, Zhang X, Sang M. ZEB1 represses biogenesis of circ-DOCK5 to facilitate metastasis in esophageal squamous cell carcinoma via a positive feedback loop with TGF-β. Cancer Lett. 2021 Oct 28;519:117-129. doi: 10.1016/j.canlet.2021.06.026. Wang Z, Cao Z, Wang Z. Significance of long non-coding RNA IFNG-AS1 in the progression and clinical prognosis in colon adenocarcinoma. Bioengineered. 2021;12(2):11342-11350. doi:10.1080/21655979.2021.2003944. Sorrelle N, Dominguez ATA, Brekken RA. From top to bottom: midkine and pleiotrophin as emerging players in immune regulation. J Leukoc Biol. 2017;102(2):277-286. doi:10.1189/jlb.3MR1116-475R. Wang P, Mao YM, Zhao CN, Wang JB, Li XM, Ye DQ, Pan HF. Association of Midkine and Pleiotrophin Gene Polymorphisms With Systemic Lupus Erythematosus Susceptibility in Chinese Han Population. Front Immunol. 2020 Feb 21;11:110. doi: 10.3389/fimmu.2020.00110. Li YS, Hoffman RM, Le Beau MM, Espinosa R 3rd, Jenkins NA, Gilbert DJ, Copeland NG, Deuel TF. Characterization of the human pleiotrophin gene. Promoter region and chromosomal localization. J Biol Chem. 1992 Dec 25;267(36):26011-6. Tian Z, Du Z, Bai G, Gong Q, You Y, Xu G, Liu J, Xiao M, Wang Y, He Y. Schwann cell derived pleiotrophin stimulates fibroblast for proliferation and excessive collagen deposition in plexiform neurofibroma. Cancer Gene Ther. 2024 Apr;31(4):627-640. doi: 10.1038/s41417-024-00727-1. Sevillano J, Sánchez-Alonso MG, Zapatería B, Calderón M, Alcalá M, Limones M, Pita J, Gramage E, Vicente-Rodríguez M, Horrillo D, Medina-Gómez G, Obregón MJ, Viana M, Valladolid-Acebes I, Herradón G, Ramos-Álvarez MP. Pleiotrophin deletion alters glucose homeostasis, energy metabolism and brown fat thermogenic function in mice. Diabetologia. 2019 Jan;62(1):123-135. doi: 10.1007/s00125-018-4746-4. Zhang M, Zhou K, Wang Z, Liu T, Stevens LE, Lynce F, Chen WY, Peng S, Xie Y, Zhai D, Chen Q, Shi Y, Shi H, Yuan Z, Li X, Xu J, Cai Z, Guo J, Shao N, Lin Y. A Subpopulation of Luminal Progenitors Secretes Pleiotrophin to Promote Angiogenesis and Metastasis in Inflammatory Breast Cancer. Cancer Res. 2024 Jun 4;84(11):1781-1798. doi: 10.1158/0008-5472.CAN-23-2640. de Medeiros MC, Liu M, Banerjee R, Bellile E, D'Silva NJ, Rossa C Jr. Galanin mediates tumor-induced immunosuppression in head and neck squamous cell carcinoma. Cell Oncol (Dordr). 2022;45(2):241-256. doi:10.1007/s13402-021-00631-y. Bai PS, Xia N, Sun H, Kong Y. Pleiotrophin, a target of miR-384, promotes proliferation, metastasis and lipogenesis in HBV-related hepatocellular carcinoma. J Cell Mol Med. 2017;21(11):3023-3043. doi:10.1111/jcmm.13213. Zhang L, Liu X, Liu J, Zhou Z, Song Y, Cao B, An X. miR-182 aids in receptive endometrium development in dairy goats by down-regulating PTN expression. PLoS One. 2017 Jul 5;12(7):e0179783. doi: 10.1371/journal.pone.0179783. Liu C, Zhang L, Zheng X, Zhu J, Jin L, Gao R. Pleiotrophin inhibited chondrogenic differentiation potential of dental pulp stem cells. Oral Dis. 2024;30(3):1439-1450. doi:10.1111/odi.14554. Rahmani F, Mohammed Al-Asady A, Hanaie R, Zandigohar M, Faridnejad H, Payazdan M, Safavi P, Ryzhikov M, Hassanian SM. Interplay between lncRNA/miRNA and Wnt/ß-catenin signaling in brain cancer tumorigenesis. EXCLI J. 2023 Nov 28;22:1211-1222. doi: 10.17179/excli2023-6490. Zhang Y, Dai J, Huang W, Chen Q, Chen W, He Q, Chen F, Zhang P. Identification of a competing endogenous RNA network related to immune signature in clear cell renal cell carcinoma. Aging (Albany NY). 2021 Dec 27;13(24):25980-26002. doi: 10.18632/aging.203784. Li Y, Zhong H, Luo L, Gan M, Liang L, Que L, Zheng S, Zhong J, Liang L. Integrated analysis of the lncRNA-miRNA-mRNA ceRNA network in nasopharyngeal carcinoma. Transl Cancer Res. 2024 Aug 31;13(8):4372-4388. doi: 10.21037/tcr-24-263. Shetty A, Venkatesh T, Kabbekodu SP, Tsutsumi R, Suresh PS. LncRNA-miRNA-mRNA regulatory axes in endometrial cancer: a comprehensive overview. Arch Gynecol Obstet. 2022;306(5):1431-1447. doi:10.1007/s00404-022-06423-5. Chu ZP, Dai J, Jia LG, Li J, Zhang Y, Zhang ZY, Yan P. Increased expression of long noncoding RNA HMMR-AS1 in epithelial ovarian cancer: an independent prognostic factor. Eur Rev Med Pharmacol Sci. 2018 Dec;22(23):8145-8150. doi: 10.26355/eurrev_201812_16506. Costa S, La Rocca G, Cavalieri V. Epigenetic Regulation of Chromatin Functions by MicroRNAs and Long Noncoding RNAs and Implications in Human Diseases. Biomedicines. 2025 Mar 16;13(3):725. doi: 10.3390/biomedicines13030725. Pokorná M, Černá M, Boussios S, Ovsepian SV, O'Leary VB. lncRNA Biomarkers of Glioblastoma Multiforme. Biomedicines. 2024 Apr 23;12(5):932. doi: 10.3390/biomedicines12050932. Liu X, Xiao X, Han X, Yao L, Lan W. Natural flavonoids alleviate glioblastoma multiforme by regulating long non-coding RNA. Biomed Pharmacother. 2023 May;161:114477. doi: 10.1016/j.biopha.2023.114477. Zhuang W, Xu S, He Q, Su Q, Chen H, Chen J, Huang C, You Z. RBM19 promotes the progression of prostate cancer under docetaxel treatment via SNHG21/PIM1 axis. Cell Biol Toxicol. 2024 Dec 27;41(1):19. doi: 10.1007/s10565-024-09985-z. Kallenbach J, Rasa M, Heidari Horestani M, Atri Roozbahani G, Schindler K, Baniahmad A. The oncogenic lncRNA MIR503HG suppresses cellular senescence counteracting supraphysiological androgen treatment in prostate cancer. J Exp Clin Cancer Res. 2024 Dec 16;43(1):321. doi: 10.1186/s13046-024-03233-2. Zhou X, Gu C, Xiao L, Hu L, Chen G, Zuo F, Shao H, Fei B. LINC01094 promotes gastric cancer through dual targeting of CDKN1A by directly binding RBMS2 and HDAC1. Biol Direct. 2024 Dec 25;19(1):137. doi: 10.1186/s13062-024-00582-y. Liu Y, Song J, Shi Q, Chen B, Qiu W, Liu Y, Huang S, He X. Glucose-induced LINC01419 reprograms the glycolytic pathway by recruiting YBX1 to enhance PDK1 mRNA stability in hepatocellular carcinoma. Clin Transl Med. 2024 Dec;14(12):e70122. doi: 10.1002/ctm2.70122. Zhuang H, Ma X, Liu X, Li C, Li X, Wu L, Wen M, Shi W, Yang X. Hyaluronan-mediated motility receptor antisense RNA 1 promotes hepatitis B virus-related hepatocellular carcinoma progression by regulating miR-627-3p/High Mobility Group AT-hook 2 axis. Bioengineered. 2022 Apr;13(4):8617-8630. doi: 10.1080/21655979.2022.2054151. Li J, Ji X, Wang H. Targeting Long Noncoding RNA HMMR-AS1 Suppresses and Radiosensitizes Glioblastoma. Neoplasia. 2018;20(5):456-466. doi:10.1016/j.neo.2018.02.010 Yang J, Zhang D, Jiang W. Long noncoding RNA as an emerging regulator of endoderm differentiation: progress and perspectives. Cell Regen. 2025 Mar 26;14(1):11. doi: 10.1186/s13619-025-00230-4. Zhang X, Hong R, Chen W, Xu M, Wang L. The role of long noncoding RNA in major human disease. Bioorg Chem. 2019;92:103214. doi:10.1016/j.bioorg.2019.103214 Yu L, Zhang W, Wang P, Zhang Q, Cong A, Yang X, Sang K. LncRNA SNHG11 aggravates cell proliferation and migration in triple-negative breast cancer via sponging miR-2355-5p and targeting CBX5. Exp Ther Med. 2021 Aug;22(2):892. doi: 10.3892/etm.2021.10324. Zhao P, Wang Y, Yu X, Nan Y, Liu S, Li B, Cui Z, Liu Z. Long noncoding RNA LOC646029 functions as a ceRNA to suppress ovarian cancer progression through the miR-627-3p/SPRED1 axis. Front Med. 2023 Oct;17(5):924-938. doi: 10.1007/s11684-023-1004-z. Zhou J, Yang Y, Zhang Y, Liu H, Dou Q. A meta-analysis on the role of pleiotrophin (PTN) as a prognostic factor in cancer. PLoS One. 2018;13(11):e0207473. Published 2018 Nov 14. doi:10.1371/journal.pone.0207473 Li X, Gao Z, Yang M, Yang C, Yang D, Cui W, Wu D, Zhou J. Unraveling the metastatic niche in breast cancer bone metastasis through single-cell RNA sequencing. Clin Transl Oncol. 2024 Jul 27. doi: 10.1007/s12094-024-03594-2. Ikhlas M, Ferianto D, Syamsu SA, Ganda IJ, Smaradania N, Sampepajung E, Anggita CA, Faruk M. Pleiotrophin serum level and metastasis occurrence in breast cancer patients. Breast Dis. 2024;43(1):93-98. doi: 10.3233/BD-249003. Yao Y, Rao C, Zheng G, Wang S. Luteolin suppresses colorectal cancer cell metastasis via regulation of the miR‑384/pleiotrophin axis. Oncol Rep. 2019;42(1):131-141. doi:10.3892/or.2019.7136. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 03 Jun, 2025 Read the published version in Journal of Ovarian Research → Version 1 posted Editorial decision: Revision requested 22 Apr, 2025 Reviews received at journal 21 Apr, 2025 Reviewers agreed at journal 21 Apr, 2025 Reviews received at journal 19 Apr, 2025 Reviewers agreed at journal 19 Apr, 2025 Reviewers invited by journal 17 Apr, 2025 Submission checks completed at journal 06 Apr, 2025 First submitted to journal 04 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5773326","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":445032125,"identity":"099dcb81-998e-4b8f-8dba-9d997f3fbfe2","order_by":0,"name":"Jiaren He","email":"","orcid":"","institution":"HeBei General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jiaren","middleName":"","lastName":"He","suffix":""},{"id":445032128,"identity":"51b53d0f-d34a-4125-b83a-ce0a8eb40c72","order_by":1,"name":"Fei Tian","email":"","orcid":"","institution":"HeBei General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Fei","middleName":"","lastName":"Tian","suffix":""},{"id":445032131,"identity":"a9bd723c-d53d-440c-9e45-683e8413d122","order_by":2,"name":"Jie Li","email":"","orcid":"","institution":"HeBei General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Li","suffix":""},{"id":445032136,"identity":"f701df84-9230-4fa7-8280-f8061c3fcb88","order_by":3,"name":"Yunxia Zhang","email":"","orcid":"","institution":"HeBei General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yunxia","middleName":"","lastName":"Zhang","suffix":""},{"id":445032139,"identity":"d104ccbe-5673-40fb-89e5-e73d8e778676","order_by":4,"name":"Zhaoping Chu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABC0lEQVRIiWNgGAWjYBAC/hkMDMwgBhsDA+PDj38k5NjY2w/g1SJxA6GF2ViywcaYj+dMAl4tBhFQLSBdErwNaYnzJBwM8GuR7jH+XFBjk8cn3X7ZQHLH4fQ2CYYEhh8V23BrkTljYDzjWFoxm8yZwgeFZw7ntkk3HmDsOXMbtxaJHINkHrbDiW0SOckGEmxALTIHEpgZ2/BrOczzD6wlTQKoN51NIsEAv5aIHMNm3jaQlvRjErxtaQkEtUjcSCtm5u0D+kUih9lY4oyNYRswkA/i8wv/jOTNn3m+2eTJz0h/+PBDhYS8fHv7wQc/KnBrgYEEBgYeRHQcIKgeooX9ATEKR8EoGAWjYAQCAMtZVwZPzS/eAAAAAElFTkSuQmCC","orcid":"","institution":"HeBei General Hospital","correspondingAuthor":true,"prefix":"","firstName":"Zhaoping","middleName":"","lastName":"Chu","suffix":""}],"badges":[],"createdAt":"2025-01-06 11:23:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5773326/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5773326/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13048-025-01691-6","type":"published","date":"2025-06-03T15:57:26+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":81021396,"identity":"42f88a1b-899e-4601-bdda-53f5b17bf954","added_by":"auto","created_at":"2025-04-21 09:52:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":955773,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHMMR-AS1 and PTN expression were upregulated, while miR-627-3p expression was downregulated in OC cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. qRT-PCR to measure the expression levels of HMMR-AS1 in IOSE, OVCAR3, and SKOV3 cells. B. qRT-PCR was conducted to assess the expression levels of miR-627-3p in IOSE, OVCAR3, and SKOV3 cells. C. qRT-PCR was utilized to evaluate the expression of PTNmRNA in IOSE, OVCAR3, and SKOV3 cells. The data were presented as mean ± SD, with n = 3 per group. *** \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001 compared with the control group.\u003c/p\u003e","description":"","filename":"F1.png","url":"https://assets-eu.researchsquare.com/files/rs-5773326/v1/4edf44bdfc862d11d4a28546.png"},{"id":81022550,"identity":"d61307ff-4396-4985-a9f5-3958c82b1ec6","added_by":"auto","created_at":"2025-04-21 10:00:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":4648244,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe knockdown of HMMR-AS1 inhibits the malignant biological behavior of OC cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. The transfection efficiency of HMMR-AS1 knockdown was verified using qRT-PCR. B. The cell proliferation assay demonstrated that HMMR-AS1 knockdown inhibited the proliferation of OVCAR3 and SKOV3 cells. C. The cell migration assay revealed that HMMR-AS1 knockdown resulted in slower wound healing in OVCAR3 and SKOV3 scratched wounds, with an image magnification of ×100 and a scale bar of 200 μm. D. The cell invasion assay indicated that HMMR-AS1 knockdown inhibited the invasive ability of OVCAR3 and SKOV3 cells, with an image magnification of ×200 and a scale bar of 200 μm. E. The cell apoptosis assay showed that HMMR-AS1 knockdown resulted in a significantly higher apoptosis rate in OVCAR3 and SKOV3 cells. The data were presented as mean ± SD, with n = 3 per group. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05; **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001 compared with the control group.\u003c/p\u003e","description":"","filename":"F2.png","url":"https://assets-eu.researchsquare.com/files/rs-5773326/v1/2546795b5b9816e7c3982dfb.png"},{"id":81021408,"identity":"18d780eb-0cd3-41fb-93b4-45e34187e2dc","added_by":"auto","created_at":"2025-04-21 09:52:51","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2499263,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHMMR-AS1 targets miR-627-3p and regulates its expression.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. The binding site of HMMR-AS1 to miR-627-3p was predicted using OECloud tools. B. DLRG experiments were conducted to verify the targeting relationship between HMMR-AS1 and miR-627-3p. C. qRT-PCR analysis of miR-627-3p was performed in OVCAR3 and SKOV3 cells after HMMR-AS1 knockdown. The data were presented as mean ± SD, with n=3 per group. **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001 compared with the control group.\u003c/p\u003e","description":"","filename":"F3.png","url":"https://assets-eu.researchsquare.com/files/rs-5773326/v1/7486e1799fb24f5b73e31a96.png"},{"id":81023637,"identity":"1c617ad2-0b82-4e61-b374-6184b2e2d316","added_by":"auto","created_at":"2025-04-21 10:08:51","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":6051222,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of miR-627-3p on malignant biological behavior of OC cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. The transfection efficiency of miR-627-3p overexpression and knockdown was verified by qRT-PCR. B. The cell proliferation assay was performed to assess the proliferation of SKOV3 and OVCAR3 cells after transfection with miR-627-3p mimics or inhibitors. C. The cell migration assay was utilized to evaluate the wound healing of SKOV3 and OVCAR3 cells following transfection with miR-627-3p mimics or inhibitors, with a magnification of ×100 and a scale bar of 200 μm. D. The cell invasion assay demonstrated the impact of transfection with miR-627-3p mimics or inhibitors on cellular invasion, with a magnification of ×200 and a scale bar of 200 μm. E. The cell apoptosis assay was utilized to assess the impact of miR-627-3p mimics or inhibitors on the apoptosis of OVCAR3 and SKOV3 cells. The data are expressed as mean ± SD, with n = 3 per group. ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001 compared with the control group.\u003c/p\u003e","description":"","filename":"F4.png","url":"https://assets-eu.researchsquare.com/files/rs-5773326/v1/1fcfad22356dd33471a63ce5.png"},{"id":81021406,"identity":"ad92e00f-9da5-4104-85a4-558a8496f4b2","added_by":"auto","created_at":"2025-04-21 09:52:51","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2167900,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePTN is the target gene of miR-627-3p.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Prediction of PTN binding sites to miR-627-3p was conducted using the TargetScan online tool. B. DLRG experiments were conducted to verify the targeting relationship between PTN and miR-627-3p. C. RT-qPCR was performed to measure PTN mRNA expression after transfection with miR-627-3p mimics or inhibitors. D. Western blot analysis was conducted to evaluate PTN protein expression levels in ovarian cancer cells post-transfection with miR-627-3p. The data were presented as mean ± SD, with n=3 per group. **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001 compared with the control group.\u003c/p\u003e","description":"","filename":"F5.png","url":"https://assets-eu.researchsquare.com/files/rs-5773326/v1/468a664306140b6b3f47b5fd.png"},{"id":81024357,"identity":"a6aa7e20-19f7-4b0e-8e5d-2410f7a54af6","added_by":"auto","created_at":"2025-04-21 10:16:51","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":5929132,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effect of PTN on the malignant biological behavior of OC cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. qRT-PCR to verify the transfection efficiency of PTN in OVCAR3 and SKOV3 cells. B. The cell proliferation assay was performed to assess the proliferation of OVCAR3 and SKOV3 cells following transfection with PTN. C. The cell migration assay was utilized to evaluate the healing of scratch wounds in OVCAR3 and SKOV3 cells after PTN transfection; the image was taken at a magnification of ×100, with a scale bar of 200 μm. D. The cell invasion assay demonstrated the effect of transfected PTN on the invasive ability of the cells, with an image magnification of ×200 and a scale bar of 200 μm. E. The cell apoptosis assay was conducted to observe changes in apoptosis in OVCAR3 and SKOV3 cells after PTN transfection. The data were presented as mean ± SD, with n = 3 per group. ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001 compared with the control group.\u003c/p\u003e","description":"","filename":"F6.png","url":"https://assets-eu.researchsquare.com/files/rs-5773326/v1/9a7c22da5701d216eb76a468.png"},{"id":81021410,"identity":"83dc1c59-2a60-4a91-a272-20a7097ac4fa","added_by":"auto","created_at":"2025-04-21 09:52:51","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":6065016,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHMMR-AS1 promotes the malignant biological behavior of OC cells by regulating the miR-627-3p/PTN axis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. The effect of si-HMMR-AS1 on PTN mRNA expression as well as the effect of co-existence of si-HMMR-AS1 and miR-627-3p inhibitor on PTN mRNA expression following the transfection of OVCAR3 and SKOV3 cells. B. The effect of si-HMMR-AS1 on PTN protein expression levels in OVCAR3 and SKOV3 cells after transfection. C-F. miR-627-3p inhibitor, ov-PTN could partially reversed the effects of si-HMMR-AS1 on cell proliferation, migration, invasion, and apoptosis in OVCAR3 and SKOV3 cells. The magnifications for the cell migration assayand invasion assay were ×100 and ×200, respectively, with a scale bar of 200 μm. Data are expressed as mean ± SD, with n = 3 per group. ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001 compared with the control group.\u003c/p\u003e","description":"","filename":"F7.png","url":"https://assets-eu.researchsquare.com/files/rs-5773326/v1/3cd754763fcf5224aab3e877.png"},{"id":84243430,"identity":"e008a1dc-1754-452c-b324-b171e00b631c","added_by":"auto","created_at":"2025-06-09 16:13:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":13794569,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5773326/v1/19d25809-2243-4484-af88-fdaaf60df3c3.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The lncRNA HMMR-AS1 promotes the malignant progression of ovarian cancer cells by regulating the miR-627-3p/PTN axis","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eOC is one of the three primary malignant tumors of the female reproductive system in China, and it has the highest mortality rate among them\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. Early symptoms of OC are often atypical, and more than two-thirds of cases are diagnosed at advanced stages, resulting in a five-year survival rate of less than 50%\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Surgery combined with chemotherapy remains the primary clinical treatment for OC; however, the recurrence rate is high, and the prognosis is poor\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Therefore, investigating the molecular mechanisms that contribute to the development of OC and establishing a more compelling foundation for enhancing clinical prevention and treatment strategies has been a major focus of exploration for medical researchers.\u003c/p\u003e \u003cp\u003elncRNAs are a class of non-coding RNAs that exceed 200 nucleotides in length and are commonly found in eukaryotic organisms, unlike messenger RNAs, lncRNAs do not serve a function in protein translation\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. However, their dysregulation has been linked to the onset and progression of various diseases. It has been found that lncRNAs are important players in tumors and are indirectly associated with tumor cell proliferation, invasion, and chemoresistance\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. In addition, lncRNAs influence tumorigenesis and progression by targeting downstream microRNAs (miRNAs), and the mechanisms underlying their action are being extensively studied in tumor biology\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. For instance, in pancreatic cancer, lncRNA H19 facilitates the polarization of tumor-associated macrophages to the M2 type and the secretion of some certain cytokines, thereby indirectly promoting tumor proliferation and metastasis. Mechanistically, lncRNA H19 competes with miR-107 for binding to YTHDC1 mRNA and also interacts with the YTHDC1 protein to regulate the stability of SRSF1, which in turn affects the selective splicing of IL-6 and IL-10\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe lncRNA HMMR-AS1 is located on chromosome 5q34 and is approximately 1,269 bp in length. It is a neighboring gene to the mRNA HMMR\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. It has been found that the expression of HMMR-AS1 is upregulated in various malignant tumors and is closely associated with tumor growth, metastasis, and prognosis\u003csup\u003e[\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003emiRNAs are a class of non-coding RNAs consisting of 18 to 25 nucleotides\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e, and they play a crucial role in regulating gene expression and protein translation\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. miRNAs are highly conserved molecules that act a significant part in the biological processes associated with tumors, functioning as post-transcriptional regulators and can exhibit either oncostatic or oncogenic effects\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. As a tumor suppressor, miR-627-3p plays a crucial regulatory role in the malignant progression of lung, colorectal, esophageal, and colon adenocarcinomas. Mechanistically, it can act by mediating the functions of other non-coding RNAs, including lncRNAs and circRNAs\u003csup\u003e[\u003cspan additionalcitationids=\"CR19 CR20\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePTN is a member of the two-member heparin-binding growth factor family, which is highly conserved across mammalian species\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. It is an 18 kDa protein composed of 168 amino acids\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e and is encoded by the PTN gene, which is located on human chromosome 7q33 and spans approximately 116 kb\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. PTN is a multifunctional growth factor that exhibits potent mitogenic and angiogenic activities. It plays a crucial role in regulating various cellular functions, including cell growth\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e, differentiation and metastasis\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e, angiogenesis\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e, and inflammatory responses\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. In recent years, several studies have demonstrated that the expression level of PTN is regulated by miRNAs. Specifically, miR-182, miR-384, and miR-137 have been shown to target PTN and reduce its expression, which correlates with endometrial development, the metastasis of cancer cells, and chondrogenic differentiation\u003csup\u003e[\u003cspan additionalcitationids=\"CR30\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. Therefore, the functions and potential regulatory mechanisms of miRNAs and PTN in tumors deserve attention.\u003c/p\u003e \u003cp\u003eDue to their positional and sequence correlations, lncRNAs and miRNAs exhibit a complex regulatory relationship. LncRNAs can function as ceRNAs to regulate the expression of miRNAs, thereby influencing the biological functions of cells\u003csup\u003e[\u003cspan additionalcitationids=\"CR33 CR34\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. Our previous study demonstrated that HMMR-AS1 is highly expressed in human OC tissues and is negatively correlated with overall survival and progression-free survival. This finding suggests a close relationship between HMMR-AS1 and the malignant progression of OC and is expected to be a novel biomarker for the diagnosis and prognosis of OC\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. Bioinformatics analysis has revealed that HMMR-AS1 and PTN possess specific binding sites for miR-627-3p. However, the effect of HMMR-AS1 on the biological behavior of OC remains unclear, and whether HMMR-AS1's involvement in the pathogenesis and progression of OC is related to miR-627-3p/PTN axis has not been confirmed. Therefore, the aim of this study was to conduct a preliminary exploration of these issues and to serve as a reference for optimizing the diagnosis, treatment, and prognostic assessment of OC.\u003c/p\u003e"},{"header":"2 Materials and methods","content":"\u003cp\u003e\u003cstrong\u003e2.1 Cell culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman normal ovarian epithelial cell line IOSE80 and human ovarian cancer cell lines OVCAR3 and SKOV3 (both obtained from iCell Bioscience, China) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (Cyagen, China) and 1% penicillin-streptomycin. The cells were incubated at 37\u0026deg;C in a 5% CO2 incubator. Passaging of the culture can be performed when the cell growth density reaches 80% to 90%.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA and miRNA were extracted from the cells using an RNA extraction kit (Tiangen, China). The cDNA was synthesized using a cDNA synthesis kit (Tiangen, China). qRT-PCR analysis was conducted using a PCR instrument (ABI Corp, USA) in accordance with the instructions provided by the SuperReal PreMix Plus reagent (Tiangen, China). The relative expression of target genes was calculated using the 2-\u0026Delta;\u0026Delta;Ct method. The primers for miR-627-3p and U6 were designed and synthesized by RiboBio, China, whlie the primers for HMMR-AS1, PTN, and \u0026beta;-actin were obtained from Generalbiol, China. All the primers utilized in this study\u0026nbsp;are specific\u0026nbsp;and the primers sequences information are presented in Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1 Primers in this study are as follows\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"587\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 159px;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 138px;\"\u003e\n \u003cp\u003eDirection\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 289px;\"\u003e\n \u003cp\u003eSequence(5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 159px;\"\u003e\n \u003cp\u003eHMMR-AS1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 138px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 289px;\"\u003e\n \u003cp\u003eCCACATCACATTGGTCCATTACA\u003c/p\u003e\n \u003cp\u003eGCAGACCAAGTCAGCACTAAAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 159px;\"\u003ePTN\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 138px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 289px;\"\u003e\n \u003cp\u003eGGAGCTGAGTGCAAGCAAAC\u003c/p\u003e\n \u003cp\u003eCTCGCTTCAGACTTCCAGTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 159px;\"\u003e\u0026beta;-actin\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 138px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 289px;\"\u003e\n \u003cp\u003eCATGTACGTTGCTATCCAGGC\u003c/p\u003e\n \u003cp\u003eCTCCTTAATGTCACGCACGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 159px;\"\u003emiR-627-3p\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 138px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 289px;\"\u003e\n \u003cp\u003eTCTTTTCTTTGAGA\u003c/p\u003e\n \u003cp\u003eTGGTGTCGTGGAGTCG \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 159px;\"\u003e\n \u003cp\u003eU6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 138px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 289px;\"\u003e\n \u003cp\u003eCTCGCTTCGGCAGCACA\u003c/p\u003e\n \u003cp\u003eAACGCTTCACGAATTTGCGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 Transfection and grouping\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003emiR-627-3p, PTN, and the corresponding negative control(NC) plasmids were designed and synthesized by RiboBio(China). miR-627-3p, PTN, and the corresponding negative control plasmids were designed and synthesized by RiboBio(China), while si-HMMR-AS1 and its NC plasmid were designed and synthesized by GenePharma(China). SKOV3 and OVCAR3 cells were transfected at a logarithmic growth density of 70% to 80% using Lipofectamine\u0026trade; 2000 (Thermo Fisher Scientific, USA). The transfected cells were categorized into the following groups: si-HMMR-AS1 group, si-NC group, miR-627-3p mimics group, mimics NC group, miR-627-3p inhibitor group, inhibitor NC group, ov-PTN group, ov-NC-PTN group, si-PTN group, si-NC-PTN group, si-HMMR-AS1 + miR-627-3p inhibitor(si-HMMR-AS1 + in) group, and si-HMMR-AS1 + PTN overexpression(si-HMMR-AS1 + PTN) group.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Cell proliferation assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter 24 hours of transfection, the cells were resuspended into single-cell suspensions and inoculated into 96-well plates at a density of 8 \u0026times; 10^3 cells per well. Four replicate plates were established, corresponding to the addition of CCK-8 reagent (APExBIO Corp, USA) at 0, 24, 48, and 72 hours of incubation, respectively. After incubating the cells with 10 \u0026mu;L of CCK-8 solution per well for 2 hours, the optical density at 450 nm was measured.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5 Cell migration assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWhen the cell density in the 6-well plate reached approximately 90% post-transfection, three parallel lines with consistent spacing were drawn in the wells using a sterile pipette tip. The detached cells in the scratched area was washed away and then serum-free medium was added to continue the cell culture.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6 Cell invasion assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter 48 hours of transfection, the cells were resuspended in serum-free medium. Matrigel substrate (Solarbio, China) was added to Transwell chambers (Corning, USA), and after incubation at 37\u0026deg;C for 30 minutes a cell suspension of 200 \u0026micro;L with a cell count of (2.5-3) \u0026times; 10^4 was added. Then 500 \u0026micro;L of medium containing 20% FBS was added to the bottom of the Transwell chambers. After 48 hours of culture, the cells at the upper surface of the chamber were wiped out, and the cells at the lower surface of the chambers were fixed with 4% paraformaldehyde for 1 hour and stained with a 1% crystal violet solution for 1 hour. The cells were observed under a microscope, photographed, and the number of cells that penetrated the membrane was counted.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7 Cell apoptosis assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter 48 h of transfection, the cells were resuspended in PBS at a density of (2-3) \u0026times; 10^6 cells/mL. Then, propidium iodide (PI) and membrane-linked protein V-fluorescein isothiocyanate (Annexin V-FITC) were added to the mixture. The apoptosis rate was detected after 15 minutes of incubation at 37\u0026deg;C in the absence of light.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8 Double luciferase reporter gene (DLRG) assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe bioinformatics tools OECloud and TargetScan8.0 were utilized to predict the binding sites of HMMR-AS1 with miR-627-3p, as well as the interaction between miR-627-3p and PTN. Wild-type (WT) and mutant (MUT) HMMR-AS1 fragments, along with PTN 3\u0026prime;-UTR fragments, were constructed into the corresponding psiCHECK2 and pmirGLO luciferase reporter vectors (Promega, USA), respectively. Then, miR-627-3p mimics or NC, and vectors were co-transfected into 293T cells. The luciferase activity of the cells was measured after 48 hours of culture.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9 Western blotting analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter 48 hours of transfection, proteins from the si-HMMR-AS1 group, miR-627-3p mimics group, miR-627-3p inhibitor group, and their corresponding NC groups were extracted using RIPA lysis buffer (Solarbio, China). Protein concentrations were quantified using a BCA kit (Abbkine, USA). Proteins were subsequently separated using SDS-PAGE gel electrophoresis (Solarbio, China) and transferred to a PVDF membrane. The PVDF membrane was blocked with 5% skimmed milk for 1.5h hours at room temperature. Subsequently, the antibodies PTN (1:1500, Origene, USA) and \u0026beta;-actin (1:10,000, Zenbio, China) were added and incubated at 4\u0026deg;C. After 24 hours, the PVDF membrane was incubated with a secondary antibody for 1 hour at room temperature. It was then rinsed three times, after which an ECL color development solution was added. The PVDF membrane was subsequently exposed for imaging, and the western blotting analysis was quantified.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data were derived from three replicated experiments and were statistically analyzed using SPSS version 27.0. Data conforming to a normal distribution were expressed as mean \u0026plusmn; SD(x̄\u0026plusmn;s). Comparisons between multiple groups and between two groups were respectively performed using one-way analysis of variance(ANOVA) and Student\u0026rsquo;s t-test, with P\u0026lt;0.05 considered to indicate a statistically significant difference. one-way analysis of variance\u003c/p\u003e"},{"header":"3 Results","content":"\u003cp\u003e\u003cstrong\u003e3.1 Expression of HMMR-AS1, miR-627-3p and PTN in OVCAR3 and SKOV3 cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe qRT-PCR results indicated that the expression levels of HMMR-AS1 and PTN mRNA were significantly upregulated in OVCAR3 and SKOV3 cells compared to IOSE80 cells, in contrast, the expression of miR-627-3p was downregulated, with all differences being more significant in SKOV3 cells (Figure 1A-C). Therefore, HMMR-AS1, miR-627-3p, and PTN may be linked to the onset and progression of OC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 Effect of knockdown of HMMR-AS1 on the malignant phenotype of OVCAR3 and SKOV3 cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the biological function of HMMR-AS1 in OC, we knocked down HMMR-AS1 in OVCAR3 and SKOV3 cell lines (Figure 2A). The cell proliferation assay, migration assay, and transwell assay demonstrated that, compared to the NC group, the proliferation, migration, and invasion abilities were significantly reduced in the si-HMMR-AS1 group, while the apoptosis rate was increased (Figure 2B-E). Taken together, HMMR-AS1 plays a pro-carcinogenic role in OC cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 HMMR-AS1 directly targets miR-627-3p and regulates its expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the mechanism of action of HMMR-AS1 in OC, we utilized the online database OECloud tools (https://cloud.oebiotech.com/#/home) for analysis and discovered complementary binding sequences for HMMR-AS1 and miR-627-3p (Figure 3A). Therefore, we hypothesized that HMMR-AS1 affects the malignant progression of OC cells by regulating miR-627-3p. DLRG assays demonstrated that miR-627-3p mimics reduced luciferase activity in the HMMR-AS1-WT group, while showing no significant effect on the HMMR-AS1-MUT group (Figure 3B). Furthermore, qRT-PCR demonstrated that the knockdown of HMMR-AS1 significantly increased the expression of miR-627-3p in OVCAR3 and SKOV3 cells (Figure 3C). These results suggest that miR-627-3p is a target gene of HMMR-AS1 and is negatively regulated by it.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4 Effect of overexpression or knockdown of miR-627-3p on the malignant phenotype of OVCAR3 and SKOV3 cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the biological function of miR-627-3p in OC, we established models for both overexpression and knockdown of miR-627-3p in OVCAR3 and SKOV3 cell lines (Figure 4A). The results of the cell function experiments indicated that cells in the miR-627-3p mimics group had reduced proliferation, migration, and invasion abilities, along with increased apoptosis rates compared to the control group, wheras the miR-627-3p inhibitor had the opposite effect on the cells compared with miR-627-3p mimics (Figure 4B-E). In summary, miR-627-3p It has a cancer-suppressing effect in OC cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5 Targeting relationship between miR-627-3p and PTN\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrediction from the TargetScan8.0 website (https://www.targetscan.org/) indicates that PTN has a specific binding site for miR-627-3p (Figure 5A). DLRG assay demonstrated that the overexpression of miR-627-3p significantly decreased the luciferase activity in cells with the wild-type PTN 3\u0026apos; UTR, while having no effect on the mutant PTN 3\u0026apos; UTR group (Figure 5B). Furthermore, the overexpression of miR-627-3p significantly decreased the mRNA and protein levels of PTN in OC cells. However, exactly the opposite result was observed when the expression of miR-627-3p was inhibited (Figure 5C-D). The results above indicate that miR-627-3p targets PTN and negatively regulates its expression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6 Effect of PTN overexpression or knockdown on the malignant phenotype of OVCAR3 and SKOV3 cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the role of PTN in the biological functions of OC, we knocked down and overexpressed PTN in OVCAR3 and SKOV3 cells, and the transfection efficiency was verified using qRT-PCR (Figure 6A). Cell biological function experiments demonstrated that the proliferation, migration, and invasion of cells in the ov-PTN group were significantly enhanced, while the apoptosis rate was markedly reduced compared to the control group. Conversely, when PTN was knocked down, the effects on the cells were opposite to those observed above (Figure 6B-E). These findings suggest that PTN has a pro-carcinogenic effect on OC cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.7 HMMR-AS1 regulates the malignant phenotype of OVCAR3 and SKOV3 cells through the miR-627-3p/PTN axis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eqRT-PCR and Western blotting analysis demonstrated that the expression levels of PTN mRNA and PTN protein were downregulated following the knockdown of HMMR-AS1 (Figure 7A-B). In addition, the miR-627-3p inhibitor was found to partially reverse the suppression of PTN mRNA expression caused by the knockdown of HMMR-AS1 (Figure. 7A). To confirm that the miR-627-3p/PTN axis functions as a downstream regulator influencing the modulatory effect of HMMR-AS1 on the biological behavior of OC cells, we co-transfected OVCAR3 and SKOV3 cells with either a miR-627-3p inhibitor or ov-PTN along with si-HMMR-AS1. It was observed that both the miR-627-3p inhibitor and ov-PTN could partially restored the effects of si-HMMR-AS1 on the proliferation, migration, invasion, and apoptosis of OVCAR3 and SKOV3 cells (Figure. 7C-F). Overall, our data suggest that HMMR-AS1 may regulates the downstream target gene PTN through competitive binding to miR-627-3p, thereby influencing the malignant biological behavior of OC cells.\u003c/p\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eAfter years of painstaking exploration, significant progress has been achieved in the treatment of OC. However, due to the fact that OC is difficult to detect, difficult to diagnose, easy to metastasize, easy to recur, and easy to be drug-resistant, the majority of therapies for patients ultimately result in failure, leading to a high mortality rate. Therefore, the clinical management of OC continues to face significant challenges. It is particularly urgent to investigate the mechanisms underlying OC development to formulate effective diagnostic and treatment strategies. Tumor metastasis and invasion are closely associated with abnormal gene expression. Increasing evidence suggests that the dysregulation of lncRNA expression is mechanistically linked to a wide range of diseases, including cancer, and may serve as a potential biomarker and a new therapeutic target\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e. Abnormal expression of lncRNAs can lead to tumorigenesis or even uncontrolled disease progression. Detecting changes in the expression levels of one or more lncRNAs may serve as an effective method for the early diagnosis of various diseases\u003csup\u003e[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e. It has been suggested that lncRNAs may influence cytokine and growth factor activities by modulating the microenvironment of glioblastoma\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. In prostate cancer, SNHG21 enhances mitochondrial homeostasis by binding to and preventing the ubiquitin-proteasome-dependent degradation of the PIM1 protein\u003csup\u003e[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e. In another study, lncRNA MIR503HG was identified as a novel suppressor gene of supraphysiologic androgen levels, which inhibits androgen-mediated cellular senescence in prostate cancer. It may also serve as a biomarker for responsiveness to bipolar androgen therapy\u003csup\u003e[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e. In gastric cancer, the expression of LINC01094 is upregulated and plays a role in the regulation of the LINC01094-miR-128-3p-RUNX1 positive feedback loop. This loop downregulates CDKN1A by interacting with RBMS2 and HDAC1, respectively, thereby promoting malignant behavior and poor prognosis in gastric cancer\u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e. Glucose-induced LINC01419 promotes the growth and metastasis of hepatocellular carcinoma cells by driving metabolic reprogramming. Mechanistically, LINC01419 facilitates the binding of YBX1 to PDK1 mRNA, which enhances the stability of PDK1 mRNA and increases lactate production\u003csup\u003e[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eHMMR-AS1 has been found to be aberrantly expressed in various tumors, including breast cancer, lung adenocarcinoma, hepatocellular carcinoma, and glioblastoma. It is closely associated with the progression of these cancers\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]\u003c/sup\u003e. Our data indicated that the expression of HMMR-AS1 was upregulated in OC cells compared to normal ovarian epithelial cells, which is consistent with our previous findings\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. We also found that the downregulation of HMMR-AS1 inhibited OC cell proliferation, migration, and invasion, while promoting apoptosis. This suggests that HMMR-AS1 acts as a pro-carcinogenic factor in OC, and may serve as a potential therapeutic target for OC. Many studies have demonstrated that lncRNAs influence both physiological and pathological processes in organisms by regulating the expression and function of downstream genes\u003csup\u003e[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/sup\u003e. For example, lncRNAs can regulate the activity of downstream mRNAs by competitively binding to miRNAs, thereby influencing tumorigenesis and progression\u003csup\u003e[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/sup\u003e. Cai et al.\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e reported that HMMR-AS1 promotes the proliferation of lung adenocarcinoma cells and inhibits apoptosis by regulating the miR-138/SIRT6 axis. Therefore, HMMR-AS1 may serve as a potential therapeutic target for lung adenocarcinoma. A study found that HMMR-AS1 is overexpressed in hepatocellular carcinoma and is associated with a poor prognosis. Exosomal HMMR-AS1 competitively binds to miR-147a, influences ARID3A-mediated macrophage M2-type polarization, accelerates the progression of hepatocellular carcinoma, and is further enhanced by hypoxic conditions\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. Li's team demonstrated that HMMR-AS1 was aberrantly overexpressed in glioblastoma cells. The knockdown of HMMR-AS1 in vitro inhibited tumor cell proliferation and the mesenchymal phenotype. Furthermore, HMMR-AS1 enhanced the radiosensitivity of glioblastoma by reducing the levels of DNA repair proteins\u003csup\u003e[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]\u003c/sup\u003e. In this study, we found that the interaction between HMMR-AS1 and miR-627-3p plays a significant role in tumor progression in OC. HMMR-AS1 directly targets miR-627-3p and negatively regulates its expression, which, in turn, exerts pro-oncogenic effects.\u003c/p\u003e \u003cp\u003eIt has been demonstrated that miR-627-3p is expressed at low levels in various malignant tumors and plays an oncogenic role. miR-627-3p was significantly downregulated in lung cancer cells and was involved in the pro-carcinogenic effects mediated by RP11-284F21.9. RP11-284F21.9 enhances the proliferative and invasive capacity of lung cancer cells by directly regulating miR-627-3p expression. In contrast, the overexpression of miR-627-3p partially mitigated the pro-carcinogenic effects of RP11-284F21.9\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. In studies of esophageal squamous cell carcinoma, miR-627-3p inhibited tumor progression by downregulating the expression of ZEB1. This effect was mediated by the inhibition of TGFB2 expression and TGF-β secretion, as well as the suppression of TGF-β-induced EMT\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. The data of our study suggest that miR-627-3p is expressed at low levels in OC cells. Furthermore, the overexpression of miR-627-3p inhibits the malignant biological behavior of these cells, while the inhibitor of miR-627-3p generates opposite effects. However, these results are different from those of Zhao et al\u003csup\u003e[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/sup\u003e. This may be attributed to the distinct molecular mechanisms investigated by our two research teams, which mediate the varying expression levels of miR-627-3p. That is, miRNAs involved in various regulatory mechanisms may have difference expression level and opposing roles, or there may be additional factors contributing to the results that require further exploration.\u003c/p\u003e \u003cp\u003ePTN exhibits oncogenic potential and is regarded as a potential biomarker for various malignant tumors. A study found a correlation between PTN expression levels and advanced breast cancer, suggesting that it may serve as an independent predictor of tumor prognosis\u003csup\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/sup\u003e. PTN levels in the serum of breast cancer patients correlate with TNM stage, histopathologic grade, and the presence or absence of distant metastasis. Elevated PTN concentrations are associated with a higher likelihood of distant metastasis, emphasizing the strong relationship between PTN levels and distant metastasis in breast cancer\u003csup\u003e[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]\u003c/sup\u003e. Meanwhile, we discovered that PTN expression was upregulated in OC cells. The overexpression of PTN enhanced the malignant biological behavior of these cells, suggesting a positive correlation between PTN expression and tumor progression. PTN is involved in various microRNA regulatory mechanisms and plays a significant role in cancer development and tumor progression. Yao et al.\u003csup\u003e[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]\u003c/sup\u003e identified PTN as a downstream target of miR-384 in their study on rectal cancer and the antitumor effects of lidocaine were mediated through the miR-384/PTN axis. We discovered that the upregulation or downregulation of PTN expression correlated with varying levels of miR-627-3p expression, suggesting that miR-627-3p may function as a promoter of PTN in its oncogenic role. We further confirmed that PTN is a target of miR-627-3p, which can directly interact with the 3' UTR region of PTN mRNA, thereby negatively regulating PTN expression. Furthermore, we discovered that the suppression of PTN mRNA expression, resulting from the knockdown of HMMR-AS1, could be partially reversed by the miR-627-3p inhibitor. The downregulation of miR-627-3p and the overexpression of PTN partially reversed the effects of HMMR-AS1 knockdown on OC cell proliferation, migration, invasion, and apoptosis. These results suggest that HHMR-AS1-induced PTN expression may be mediated by miR-627-3p, where HMR-AS1 acts as a molecular sponge for miR-627-3p, and miR-627-3p serves as an antagonistic mediator in this mechanism. Overall, the mechanism by which lncRNA HMMR-AS1 promotes the malignant progression of ovarian cancer may be associated with miR-627-3p/PTN axis. However, our study has several limitations. We only investigated the mechanisms at the in vitro cellular level without incorporating clinical data analysis or studies involving clinical tissue. Additionally, we lacked research at the in vivo animal level. Future studies that address these aspects may validate our conclusions more comprehensively and enhance our understanding of the pathogenic mechanisms of OC.\u003c/p\u003e \u003cp\u003eIn conclusion, our study demonstrates that lncRNA HMMR-AS1 expression is upregulated in OC cells and promotes the malignant progression of OC cells. Therefore, lncRNA HMMR-AS1 may be a potential therapeutic target for OC.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cstrong\u003elncRNAs\u0026nbsp;\u003c/strong\u003elong non-coding RNAs\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOC\u0026nbsp;\u003c/strong\u003e ovarian cancer\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDLRG\u0026nbsp;\u003c/strong\u003edual-luciferase reporter gene\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHMMR-AS1\u0026nbsp;\u003c/strong\u003eHyaluronan-mediated motility receptor antisense RNA1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePTN\u0026nbsp;\u003c/strong\u003e pleiotrophin\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eceRNA\u0026nbsp;\u003c/strong\u003e\u0026nbsp; competing endogenous RNA\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003emiRNAs\u0026nbsp;\u003c/strong\u003e\u0026nbsp; microRNAs\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNC\u0026nbsp;\u003c/strong\u003e negative control\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eqRT-PCR\u0026nbsp;\u003c/strong\u003e quantitative reverse transcription polymerase chain reaction\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors appreciated the support from the Clinical Medicine Research Center of Hebei\u003c/p\u003e\n\u003cp\u003eGeneral Hospital.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJiaren He: Investigation, Writing\u0026ndash;original draft. Fei Tian: Formal analysis, Investigation, Software. Jie Li: Formal analysis, Investigation. Yunxia Zhang: Supervision, Writing\u0026ndash;review \u0026amp; editing. Zhaoping Chu: Supervision, Writing\u0026ndash;review \u0026amp; editing. All authors contributed to the article and approved the submitted version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by the Hebei Province medical science research project(20230022) and the the government of Hebei Province funded the clinical medical talents project(ZF2023180).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo datasets were generated or analysed during the current study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFootnotes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eFarinella F, Merone M, Bacco L, Capirchio A, Ciccozzi M, Caligiore D. Machine Learning analysis of high-grade serous ovarian cancer proteomic dataset reveals novel candidate biomarkers. Sci Rep. 2022;12(1):3041. Published 2022 Feb 23. doi:10.1038/s41598-022-06788-2.\u003c/li\u003e\n\u003cli\u003eMajidi A, Na R, Jordan SJ, DeFazio A, Obermair A, Friedlander M, Grant P, Webb PM. Common analgesics and ovarian cancer survival: the Ovarian cancer Prognosis And Lifestyle (OPAL) Study. J Natl Cancer Inst. 2023 May 8;115(5):570-577. doi: 10.1093/jnci/djac239. \u003c/li\u003e\n\u003cli\u003eYang L, Xie HJ, Li YY, Wang X, Liu XX, Mai J. Molecular mechanisms of platinum‑based chemotherapy resistance in ovarian cancer (Review). Oncol Rep. 2022;47(4):82. doi:10.3892/or.2022.8293.\u003c/li\u003e\n\u003cli\u003eYang C, Xia BR, Zhang ZC, Zhang YJ, Lou G, Jin WL. Immunotherapy for Ovarian Cancer: Adjuvant, Combination, and Neoadjuvant. Front Immunol. 2020;11:577869. Published 2020 Oct 6. doi:10.3389/fimmu.2020.577869.\u003c/li\u003e\n\u003cli\u003eZheng Z, Liu H, Xu Q, Cui W, Liu K. Comprehensive identification of a migrasomes-associated long non-coding RNA signature to predict the prognosis and treatment options in colon adenocarcinoma. Discov Oncol. 2025 Mar 27;16(1):409. doi: 10.1007/s12672-025-02197-9.\u003c/li\u003e\n\u003cli\u003eCai J, Ji Z, Wu J, Chen L, Zheng D, Chen Y, Zhang X, Xie W, Huang J, Chen M, Lin R, Lin W, Chen Y, Li Z. Development and validation of a novel endoplasmic reticulum stress-related lncRNA prognostic signature and candidate drugs in breast cancer. Front Genet. 2022 Aug 25;13:949314. doi: 10.3389/fgene.2022.949314. \u003c/li\u003e\n\u003cli\u003eWu W, Zhang S, He J. The Mechanism of Long Non-coding RNA in Cancer Radioresistance/Radiosensitivity: A Systematic Review. Front Pharmacol. 2022;13:879704. Published 2022 May 5. doi:10.3389/fphar.2022.879704.\u003c/li\u003e\n\u003cli\u003eAlghazali T, Ahmed AT, Hussein UA, Sanghvi G, Uthirapathy S, Edan RT, Lal M, Shit D, Naidu KS, Al-Hamairy AK. Noncoding RNA (ncRNA)-mediated regulation of TLRs: critical regulator of inflammation in tumor microenvironment. Med Oncol. 2025 Mar 31;42(5):144. doi: 10.1007/s12032-025-02690-9.\u003c/li\u003e\n\u003cli\u003eLiu P, Gao X, Yu Z, Liu Y, Liu Y, Lin J, Cao Y, Zhai S, Li J, Huang Y, Zou S, Wen C, Fu D, Lin J, Shen B. H19 promotes polarization and alternative splicing in tumor-associated macrophages, facilitating pancreatic cancer progression. Cancer Lett. 2024 Dec 7;611:217389. doi: 10.1016/j.canlet.2024.217389.\u003c/li\u003e\n\u003cli\u003eLiu W, Ma J, Cheng Y, Zhang H, Luo W, Zhang H. HMMR antisense RNA 1, a novel long noncoding RNA, regulates the progression of basal-like breast cancer cells. Breast Cancer (Dove Med Press). 2016;8:223-229. Published 2016 Nov 24. doi:10.2147/BCTT.S119997.\u003c/li\u003e\n\u003cli\u003eBao X, Peng Y, Shen J, Yang L. Sevoflurane inhibits progression of glioma via regulating the HMMR antisense RNA 1/microRNA-7/cyclin dependent kinase 4 axis. Bioengineered. 2021 Dec;12(1):7893-7906. doi: 10.1080/21655979.2021.1976712.\u003c/li\u003e\n\u003cli\u003eCai Y, Sheng Z, Chen Y, Wang J. LncRNA HMMR-AS1 promotes proliferation and metastasis of lung adenocarcinoma by regulating MiR-138/sirt6 axis. Aging (Albany NY). 2019;11(10):3041-3054. doi:10.18632/aging.101958.\u003c/li\u003e\n\u003cli\u003eWang X, Zhou Y, Dong K, Zhang H, Gong J, Wang S. Exosomal lncRNA HMMR-AS1 mediates macrophage polarization through miR-147a/ARID3A axis under hypoxia and affects the progression of hepatocellular carcinoma. Environ Toxicol. 2022;37(6):1357-1372. doi:10.1002/tox.23489.\u003c/li\u003e\n\u003cli\u003eSong Q, Xue L, Ren J, Liu X, Li G, Liu C, Meng X. Clinical significance of microRNA-328-3p and bone metabolism biomarkers in gout patients with different musculoskeletal ultrasonography imaging. J Orthop Surg Res. 2025 Apr 1;20(1):329. doi: 10.1186/s13018-025-05691-6. \u003c/li\u003e\n\u003cli\u003eWang Y, Huang D, Li M, Yang M. MicroRNA-99 family in cancer: molecular mechanisms for clinical applications. PeerJ. 2025 Mar 27;13:e19188. doi: 10.7717/peerj.19188.\u003c/li\u003e\n\u003cli\u003eSolaimani M, Hosseinzadeh S, Abasi M. Non-coding RNAs, a double-edged sword in breast cancer prognosis. Cancer Cell Int. 2025 Apr 1;25(1):123. doi: 10.1186/s12935-025-03679-0. \u003c/li\u003e\n\u003cli\u003eHossam Abdelmonem B, Kamal LT, Wardy LW, Ragheb M, Hanna MM, Elsharkawy M, Abdelnaser A. Non-coding RNAs: emerging biomarkers and therapeutic targets in cancer and inflammatory diseases. Front Oncol. 2025 Mar 10;15:1534862. doi: 10.3389/fonc.2025.1534862. \u003c/li\u003e\n\u003cli\u003eLi D, Wang L, Feng J, Shen YW, Liu LN, Wang Y. RP11-284F21.9 promotes lung carcinoma proliferation and invasion via the regulation of miR‑627‑3p/CCAR1. Oncol Rep. 2020;44(4):1638-1648. doi:10.3892/or.2020.7732.\u003c/li\u003e\n\u003cli\u003eLiu H, Li J, Zhao H, Liu X, Ye X. DNAJC2 is reversely regulated by miR‑627‑3p, promoting the proliferation of colorectal cancer. Mol Med Rep. 2021;24(2):589. doi:10.3892/mmr.2021.12228.\u003c/li\u003e\n\u003cli\u003eMeng L, Zheng Y, Liu S, Ju Y, Ren S, Sang Y, Zhu Y, Gu L, Liu F, Zhao Y, Zhang X, Sang M. ZEB1 represses biogenesis of circ-DOCK5 to facilitate metastasis in esophageal squamous cell carcinoma via a positive feedback loop with TGF-\u0026beta;. Cancer Lett. 2021 Oct 28;519:117-129. doi: 10.1016/j.canlet.2021.06.026. \u003c/li\u003e\n\u003cli\u003eWang Z, Cao Z, Wang Z. Significance of long non-coding RNA IFNG-AS1 in the progression and clinical prognosis in colon adenocarcinoma. Bioengineered. 2021;12(2):11342-11350. doi:10.1080/21655979.2021.2003944.\u003c/li\u003e\n\u003cli\u003eSorrelle N, Dominguez ATA, Brekken RA. From top to bottom: midkine and pleiotrophin as emerging players in immune regulation. J Leukoc Biol. 2017;102(2):277-286. doi:10.1189/jlb.3MR1116-475R.\u003c/li\u003e\n\u003cli\u003eWang P, Mao YM, Zhao CN, Wang JB, Li XM, Ye DQ, Pan HF. Association of Midkine and Pleiotrophin Gene Polymorphisms With Systemic Lupus Erythematosus Susceptibility in Chinese Han Population. Front Immunol. 2020 Feb 21;11:110. doi: 10.3389/fimmu.2020.00110.\u003c/li\u003e\n\u003cli\u003eLi YS, Hoffman RM, Le Beau MM, Espinosa R 3rd, Jenkins NA, Gilbert DJ, Copeland NG, Deuel TF. Characterization of the human pleiotrophin gene. Promoter region and chromosomal localization. J Biol Chem. 1992 Dec 25;267(36):26011-6. \u003c/li\u003e\n\u003cli\u003eTian Z, Du Z, Bai G, Gong Q, You Y, Xu G, Liu J, Xiao M, Wang Y, He Y. Schwann cell derived pleiotrophin stimulates fibroblast for proliferation and excessive collagen deposition in plexiform neurofibroma. Cancer Gene Ther. 2024 Apr;31(4):627-640. doi: 10.1038/s41417-024-00727-1. \u003c/li\u003e\n\u003cli\u003eSevillano J, S\u0026aacute;nchez-Alonso MG, Zapater\u0026iacute;a B, Calder\u0026oacute;n M, Alcal\u0026aacute; M, Limones M, Pita J, Gramage E, Vicente-Rodr\u0026iacute;guez M, Horrillo D, Medina-G\u0026oacute;mez G, Obreg\u0026oacute;n MJ, Viana M, Valladolid-Acebes I, Herrad\u0026oacute;n G, Ramos-\u0026Aacute;lvarez MP. Pleiotrophin deletion alters glucose homeostasis, energy metabolism and brown fat thermogenic function in mice. Diabetologia. 2019 Jan;62(1):123-135. doi: 10.1007/s00125-018-4746-4.\u003c/li\u003e\n\u003cli\u003eZhang M, Zhou K, Wang Z, Liu T, Stevens LE, Lynce F, Chen WY, Peng S, Xie Y, Zhai D, Chen Q, Shi Y, Shi H, Yuan Z, Li X, Xu J, Cai Z, Guo J, Shao N, Lin Y. A Subpopulation of Luminal Progenitors Secretes Pleiotrophin to Promote Angiogenesis and Metastasis in Inflammatory Breast Cancer. Cancer Res. 2024 Jun 4;84(11):1781-1798. doi: 10.1158/0008-5472.CAN-23-2640.\u003c/li\u003e\n\u003cli\u003ede Medeiros MC, Liu M, Banerjee R, Bellile E, D\u0026apos;Silva NJ, Rossa C Jr. Galanin mediates tumor-induced immunosuppression in head and neck squamous cell carcinoma. Cell Oncol (Dordr). 2022;45(2):241-256. doi:10.1007/s13402-021-00631-y.\u003c/li\u003e\n\u003cli\u003eBai PS, Xia N, Sun H, Kong Y. Pleiotrophin, a target of miR-384, promotes proliferation, metastasis and lipogenesis in HBV-related hepatocellular carcinoma. J Cell Mol Med. 2017;21(11):3023-3043. doi:10.1111/jcmm.13213.\u003c/li\u003e\n\u003cli\u003eZhang L, Liu X, Liu J, Zhou Z, Song Y, Cao B, An X. miR-182 aids in receptive endometrium development in dairy goats by down-regulating PTN expression. PLoS One. 2017 Jul 5;12(7):e0179783. doi: 10.1371/journal.pone.0179783. \u003c/li\u003e\n\u003cli\u003eLiu C, Zhang L, Zheng X, Zhu J, Jin L, Gao R. Pleiotrophin inhibited chondrogenic differentiation potential of dental pulp stem cells. Oral Dis. 2024;30(3):1439-1450. doi:10.1111/odi.14554.\u003c/li\u003e\n\u003cli\u003eRahmani F, Mohammed Al-Asady A, Hanaie R, Zandigohar M, Faridnejad H, Payazdan M, Safavi P, Ryzhikov M, Hassanian SM. Interplay between lncRNA/miRNA and Wnt/\u0026szlig;-catenin signaling in brain cancer tumorigenesis. EXCLI J. 2023 Nov 28;22:1211-1222. doi: 10.17179/excli2023-6490. \u003c/li\u003e\n\u003cli\u003eZhang Y, Dai J, Huang W, Chen Q, Chen W, He Q, Chen F, Zhang P. Identification of a competing endogenous RNA network related to immune signature in clear cell renal cell carcinoma. Aging (Albany NY). 2021 Dec 27;13(24):25980-26002. doi: 10.18632/aging.203784. \u003c/li\u003e\n\u003cli\u003eLi Y, Zhong H, Luo L, Gan M, Liang L, Que L, Zheng S, Zhong J, Liang L. Integrated analysis of the lncRNA-miRNA-mRNA ceRNA network in nasopharyngeal carcinoma. Transl Cancer Res. 2024 Aug 31;13(8):4372-4388. doi: 10.21037/tcr-24-263.\u003c/li\u003e\n\u003cli\u003eShetty A, Venkatesh T, Kabbekodu SP, Tsutsumi R, Suresh PS. LncRNA-miRNA-mRNA regulatory axes in endometrial cancer: a comprehensive overview. Arch Gynecol Obstet. 2022;306(5):1431-1447. doi:10.1007/s00404-022-06423-5.\u003c/li\u003e\n\u003cli\u003eChu ZP, Dai J, Jia LG, Li J, Zhang Y, Zhang ZY, Yan P. Increased expression of long noncoding RNA HMMR-AS1 in epithelial ovarian cancer: an independent prognostic factor. Eur Rev Med Pharmacol Sci. 2018 Dec;22(23):8145-8150. doi: 10.26355/eurrev_201812_16506. \u003c/li\u003e\n\u003cli\u003eCosta S, La Rocca G, Cavalieri V. Epigenetic Regulation of Chromatin Functions by MicroRNAs and Long Noncoding RNAs and Implications in Human Diseases. Biomedicines. 2025 Mar 16;13(3):725. doi: 10.3390/biomedicines13030725.\u003c/li\u003e\n\u003cli\u003ePokorn\u0026aacute; M, Čern\u0026aacute; M, Boussios S, Ovsepian SV, O\u0026apos;Leary VB. lncRNA Biomarkers of Glioblastoma Multiforme. Biomedicines. 2024 Apr 23;12(5):932. doi: 10.3390/biomedicines12050932.\u003c/li\u003e\n\u003cli\u003eLiu X, Xiao X, Han X, Yao L, Lan W. Natural flavonoids alleviate glioblastoma multiforme by regulating long non-coding RNA. Biomed Pharmacother. 2023 May;161:114477. doi: 10.1016/j.biopha.2023.114477.\u003c/li\u003e\n\u003cli\u003eZhuang W, Xu S, He Q, Su Q, Chen H, Chen J, Huang C, You Z. RBM19 promotes the progression of prostate cancer under docetaxel treatment via SNHG21/PIM1 axis. Cell Biol Toxicol. 2024 Dec 27;41(1):19. doi: 10.1007/s10565-024-09985-z.\u003c/li\u003e\n\u003cli\u003eKallenbach J, Rasa M, Heidari Horestani M, Atri Roozbahani G, Schindler K, Baniahmad A. The oncogenic lncRNA MIR503HG suppresses cellular senescence counteracting supraphysiological androgen treatment in prostate cancer. J Exp Clin Cancer Res. 2024 Dec 16;43(1):321. doi: 10.1186/s13046-024-03233-2.\u003c/li\u003e\n\u003cli\u003eZhou X, Gu C, Xiao L, Hu L, Chen G, Zuo F, Shao H, Fei B. LINC01094 promotes gastric cancer through dual targeting of CDKN1A by directly binding RBMS2 and HDAC1. Biol Direct. 2024 Dec 25;19(1):137. doi: 10.1186/s13062-024-00582-y. \u003c/li\u003e\n\u003cli\u003eLiu Y, Song J, Shi Q, Chen B, Qiu W, Liu Y, Huang S, He X. Glucose-induced LINC01419 reprograms the glycolytic pathway by recruiting YBX1 to enhance PDK1 mRNA stability in hepatocellular carcinoma. Clin Transl Med. 2024 Dec;14(12):e70122. doi: 10.1002/ctm2.70122.\u003c/li\u003e\n\u003cli\u003eZhuang H, Ma X, Liu X, Li C, Li X, Wu L, Wen M, Shi W, Yang X. Hyaluronan-mediated motility receptor antisense RNA 1 promotes hepatitis B virus-related hepatocellular carcinoma progression by regulating miR-627-3p/High Mobility Group AT-hook 2 axis. Bioengineered. 2022 Apr;13(4):8617-8630. doi: 10.1080/21655979.2022.2054151.\u003c/li\u003e\n\u003cli\u003eLi J, Ji X, Wang H. Targeting Long Noncoding RNA HMMR-AS1 Suppresses and Radiosensitizes Glioblastoma. Neoplasia. 2018;20(5):456-466. doi:10.1016/j.neo.2018.02.010\u003c/li\u003e\n\u003cli\u003eYang J, Zhang D, Jiang W. Long noncoding RNA as an emerging regulator of endoderm differentiation: progress and perspectives. Cell Regen. 2025 Mar 26;14(1):11. doi: 10.1186/s13619-025-00230-4. \u003c/li\u003e\n\u003cli\u003eZhang X, Hong R, Chen W, Xu M, Wang L. The role of long noncoding RNA in major human disease. Bioorg Chem. 2019;92:103214. doi:10.1016/j.bioorg.2019.103214 \u003c/li\u003e\n\u003cli\u003eYu L, Zhang W, Wang P, Zhang Q, Cong A, Yang X, Sang K. LncRNA SNHG11 aggravates cell proliferation and migration in triple-negative breast cancer via sponging miR-2355-5p and targeting CBX5. Exp Ther Med. 2021 Aug;22(2):892. doi: 10.3892/etm.2021.10324.\u003c/li\u003e\n\u003cli\u003eZhao P, Wang Y, Yu X, Nan Y, Liu S, Li B, Cui Z, Liu Z. Long noncoding RNA LOC646029 functions as a ceRNA to suppress ovarian cancer progression through the miR-627-3p/SPRED1 axis. Front Med. 2023 Oct;17(5):924-938. doi: 10.1007/s11684-023-1004-z. \u003c/li\u003e\n\u003cli\u003eZhou J, Yang Y, Zhang Y, Liu H, Dou Q. A meta-analysis on the role of pleiotrophin (PTN) as a prognostic factor in cancer. PLoS One. 2018;13(11):e0207473. Published 2018 Nov 14. doi:10.1371/journal.pone.0207473\u003c/li\u003e\n\u003cli\u003eLi X, Gao Z, Yang M, Yang C, Yang D, Cui W, Wu D, Zhou J. Unraveling the metastatic niche in breast cancer bone metastasis through single-cell RNA sequencing. Clin Transl Oncol. 2024 Jul 27. doi: 10.1007/s12094-024-03594-2.\u003c/li\u003e\n\u003cli\u003eIkhlas M, Ferianto D, Syamsu SA, Ganda IJ, Smaradania N, Sampepajung E, Anggita CA, Faruk M. Pleiotrophin serum level and metastasis occurrence in breast cancer patients. Breast Dis. 2024;43(1):93-98. doi: 10.3233/BD-249003.\u003c/li\u003e\n\u003cli\u003eYao Y, Rao C, Zheng G, Wang S. Luteolin suppresses colorectal cancer cell metastasis via regulation of the miR‑384/pleiotrophin axis. Oncol Rep. 2019;42(1):131-141. doi:10.3892/or.2019.7136.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-ovarian-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jovr","sideBox":"Learn more about [Journal of Ovarian Research](http://ovarianresearch.biomedcentral.com)","snPcode":"13048","submissionUrl":"https://submission.nature.com/new-submission/13048/3","title":"Journal of Ovarian Research","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"HMMR-AS1, malignant progression, miR-627-3p, ovarian cancer, PTN","lastPublishedDoi":"10.21203/rs.3.rs-5773326/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5773326/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground \u003c/strong\u003eLong non-coding RNAs (lncRNAs) are crucial regulators of ovarian cancer(OC), \u0026nbsp;playing a significant role in malignant transformation and closely linked to poor prognosis. Therefore, it is crucial to investigate the impact of lncRNAs on the malignant biological behavior of ovarian cancer and to understand their underlying molecular mechanisms.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e The binding sites of target genes were predicted through bioinformatics analysis, and gene expression levels were measured using qRT-PCR. The malignant biological behavior of cells was assessed through cell biological function assays. Gene targeting relationships were verified using a dual-luciferase reporter gene(DLRG) assay. Protein expression levels were analyzed using Western blotting.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e Hyaluronan-mediated motility receptor antisense RNA1(HMMR-AS1) expression is upregulated in ovarian cancer cells. Cell biological function experiments demonstrated that HMMR-AS1 promotes malignant biological behaviors in ovarian cancer cells. DLRG experiments demonstrated that HMMR-AS1 targets miR-627-3p, which in turn targets pleiotrophin(PTN). Furthermore, we discovered that HMMR-AS1 functions as a competing endogenous RNA (ceRNA) for miR-627-3p, regulating the expression of PTN and thereby promoting the malignant phenotypes of ovarian cancer cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions\u003c/strong\u003e In summary, our study indicates that lncRNA HMMR-AS1 is highly expressed in ovarian cancer and plays a carcinogenic role. Targeting the lncRNA HMMR-AS1 may offer a novel therapeutic strategy for treating ovarian cancer.\u003c/p\u003e","manuscriptTitle":"The lncRNA HMMR-AS1 promotes the malignant progression of ovarian cancer cells by regulating the miR-627-3p/PTN axis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-21 09:52:46","doi":"10.21203/rs.3.rs-5773326/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-04-22T17:30:07+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-21T08:53:47+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"88578094256112762227996897356132760866","date":"2025-04-21T06:07:02+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-19T05:16:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"245369833170450667396346788505169976237","date":"2025-04-19T04:46:04+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-17T18:11:42+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-04-07T03:07:25+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Ovarian Research","date":"2025-04-04T14:55:20+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-ovarian-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jovr","sideBox":"Learn more about [Journal of Ovarian Research](http://ovarianresearch.biomedcentral.com)","snPcode":"13048","submissionUrl":"https://submission.nature.com/new-submission/13048/3","title":"Journal of Ovarian Research","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ce9ff85b-ea07-41de-9b33-5a0c91c0c141","owner":[],"postedDate":"April 21st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-06-09T16:12:23+00:00","versionOfRecord":{"articleIdentity":"rs-5773326","link":"https://doi.org/10.1186/s13048-025-01691-6","journal":{"identity":"journal-of-ovarian-research","isVorOnly":false,"title":"Journal of Ovarian Research"},"publishedOn":"2025-06-03 15:57:26","publishedOnDateReadable":"June 3rd, 2025"},"versionCreatedAt":"2025-04-21 09:52:46","video":"","vorDoi":"10.1186/s13048-025-01691-6","vorDoiUrl":"https://doi.org/10.1186/s13048-025-01691-6","workflowStages":[]},"version":"v1","identity":"rs-5773326","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5773326","identity":"rs-5773326","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00