Establishment of triplex real-time quantitative PCR assay for African swine fever virus genotype I/II recombinants

Establishment of triplex real-time quantitative PCR assay for African swine fever virus genotype I/II recombinants | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Establishment of triplex real-time quantitative PCR assay for African swine fever virus genotype I/II recombinants Zhuyun Sun, Jiezhen Guo, Yao Li, Tong Sun, Jingyi Liu, Yingnan Liu, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8879756/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 11 You are reading this latest preprint version Abstract African swine fever (ASFV) leads a highly contagious and lethal hemorrhagic disease, causing a huge economic loss to the global pig industry. Recently, lethal genotype I/II recombinants were isolated and characterized in China and Vietnam. To differentiate the three genotypes (I, II and I/II recombinants) of ASFV in China, a triplex quantitative PCR (qPCR) assay was developed by targeting B646L, A151R and MGF360-14L genes. The detection limitation for the A151R, MGF360-14L , and B646L genes were 10 copies/µl, demonstrating a high sensitivity. Meanwhile, no cross-reactivity was observed with nucleic acids from ASFV genotype I and II or other swine viruses, confirming a high specificity for this assay. The coefficient of assay variation was below 2%, indicating an excellent repeatability. Importantly, when piglets were challenged with ASFV genotype I/II recombinant virus, the method could be used to detect the virus shedding as early as 3 dpi. In summary, a highly sensitive and specific detection method was established, which holds significant potential for rapid diagnosis and early warning of ASFV genotype I/II recombinant infection. African swine fever virus genotype I genotype II genotype I/II recombinant real-time quantitative PCR Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction African swine fever (ASF) is a highly contagious and acute disease caused by the African swine fever virus (ASFV), classified as a reportable animal disease by the World Organization for Animal Health [ 1 , 2 ]. ASFV is an icosahedral enveloped DNA virus with a total length of 170-190kb for its genome, containing 151–167 open reading frames[ 3 ]. Based on the variations in C-terminus of the B646L gene (encoding p72 capsid protein), ASFV in Africa is classified into at least 24 genotypes[ 4 , 5 ]. In 2018, ASF was firstly reported in China, which was caused by a high virulent genotype II Georgia07-like strain [ 6 ]. In 2021, an attenuated genotype I ASFV strain was isolated that exhibited a high transmission efficiency and a propensity for [ 1 ]asymptomatic infections[ 7 ]. Subsequently, three natural recombinant strains derived from genotypes I and II ASFV were identified, exhibiting increased virulence, elevated lethality rates, and accelerated transmission kinetics [ 8 ]. In the absence of commercially available vaccines or effective therapeutic treatments, China's current control strategy of ASFV relies predominantly on real-time quantitative PCR (qPCR) for early detection and culling of infected individual from herds to prevent further spreading [ 9 ]. Although qPCR targeting the B646L gene is the main method for ASFV detection, its utility in ASFV genotype differentiation is severely constrained by the exceptionally high sequence conservation (> 98%) of this gene across diverse viral isolates [ 10 , 11 ]. To date, for the detection of genotypes I and II ASFV in the field, several multiplex qPCR based on the E296R, B646L , and/or E183L genes have been reported[ 12 – 14 ]. Moreover, triplex qPCR methods based on B646L/F1055L/E183L or X64R/MGF360-14L/B646L genes were developed for detection and rapid differentiation [ 14 , 15 ]. Although the highly virulent genotype II ASFV is still the dominant strain in China, the prevalence of highly virulent genotype I/II recombinant ASFV is gradually increasing, which highlights significant limitations for current diagnostic approaches [ 8 ]. Given the escalating genetic diversity observed in field, it highlights the urgent need to develop molecular assays capable for rapid and accurate strain identification of genotype I/II. In this study, we developed a triplex quantitative PCR (qPCR) assay for detection and genotyping of ASFV simultaneously. The assay integrates CAHEC-recommended B646L primers and probes, genotype II-specific targets amplifying conserved regions of MGF360-14L gene and genotype I-discriminatory probes targeting unique sequences of A151R gene. This method enables differention of genotype I, genotype II, and genotype I /II recombinants through distinct fluorescent channels, providing a powerful tool for rapid diagnosis and epidemiological surveillance of ASFV. Materials and methods Viruses and Viral nucleic acids Genotype II strain GZ201801 (ASFV-GZ) and Genotype I/II recombinant strain ASFV-HN10005 (ASFV-HN) were isolated and provided by the National African Swine Fever Regional Laboratory at South China Agricultural University. The viruses were permitted and transferred to Spirit Jinyu Biopharmaceutical Co., Ltd. The virus was propagated in the primary BMDMs. Viral titers (TCID 50 and HAD 50 ) were subsequently determined using these primary BMDMs and calculated according to the Reed-Muench method [ 16 ]. The genomic DNA of genotype I attenuated NH/P68-like strain ACDC-29 (ASFV-A29) was provided by China Animal Disease Control Centre. Porcine reproductive and respiratory syndrome virus (PRRSV), Swine fever virus (CSFV), Japanese encephalitis virus (JEV), Porcine pseudorabies virus (PRV), Porcine adenoviruses (PADV) and Porcine epidemic diarrhea virus (PEDV) positive samples are preserved by the Shanghai Veterinary Research Institute of the Chinese Academy of Agricultural Sciences. Design of primers and probes Genome sequence analysis revealed that there were differences for A151R gene between ASFV genotype I, ASFV genotype II or ASFV genotype I/II recombinants via SnapGene 6.0.2. The location of the primers and probes were indicated in Fig. 1A. On the basis of comparison result of A151R gene of ASFV genotype I, genotype II and I/II recombinant viruses, MGF360-14L gene (which from genotype II and I/II recombinant), primers and probes were designed via PrimerQuest Tool shown in Fig. 1B. For B646L gene, primers and probes were recommended by China Animal Health and Epidemiology Center(CAHEC). The three probes for the A151R , MGF360-14L and B646L genes were labeled with FOX, VIC and FAM, respectively. All primers and probes were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. Figure 1 The location of the primers and probes designed for the triplex PCR. The nucleotide sequence alignments of A151R gene (A) and the partial MGF360-14L gene (B) of ASFV show the location of the primers and probes. F, P and R indicate the forward primer, TaqMan probe, and reverse primer, respectively. Construction of the standard plasmids A151R gene from ASFV genotype I attenuated NH/P68 strain was synthesized and subcloned into pUC57 plasmid named as pUC-A151R by GenScript Biotechnology Co., LTD. MGF360-14 L and B646L genes from ASFV genotype II virulent strain GZ201801 were subcloned into p3×Flag-CMV-7.1 plasmid, designated respectively as pFlag-14L and pFlag-B646L, which were preserved by our lab. The standard plasmid constructs were double-confirmed by Sanger sequence analysis. Development and optimization of triplex qPCR assay The reaction conditions, including the primers and probes concentration and cycling conditions, were optimized for triplex qPCR assay. The reaction system volume was 20 µl: 10 µl of TOROIVD®5G qPCR Premix with UNG (TOROIVD, China), 0.5µl of each primer (10 µmol/l), 0.2µl of each probe (10 µmol/l), 2 µl of template DNA, and 4.4 µl of ddH 2 O. Triplex qPCR was performed with Applied Biosystems QS5 Fluorescence Quantitative PCR Instrument. The reaction conditions were below: 37°C for 2min, 95°C for 3min, followed by 45 cycles of 95°C for 10s and 60°C for 30s. Standard curve generation The standard plasmid constructs were measured using NanoDrop spectrophotometer (Thermo Fisher Scientific Inc.) at 260 nm and 280 nm, and determined their concentrations using the formula as follows: copy number (copies/µl) = (plasmid construct concentration × 10 − 9 × 6.02 × 10 23 ) / (660 Dalton/bases × DNA length). Three standard plasmid constructs of pUC-A151R, pFlag-MGF360-14L, and pFlag-B646L were mixed as templates at the concentration of 1×10 8 copies/µl for each plasmid. Real-time quantitative PCR was performed from 1×10 8 to 1×10 2 copies/µl. Three replicates were performed for each dilution, and the standard curve was generated using the logarithm of the starting template concentration and the Ct value as the horizontal and vertical coordinates. Determination of specificity and sensitivity of the assay The total nucleic acids of PRRSV, CSFV, JEV, PRV, PADV, PEDV, ASFV-A29, ASFV-GZ and ASFV-HN were extracted from positive clinical samples using Blood/cell/tissue genomic DNA extraction kit and viral genomic DNA/RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., LTD.) according to the manufacturer's constructions, and stored at -80°C until use. The DNA/cDNA of PRRSV, CSFV, JEV, PRV, PADV, PEDV and ASFV was used as templates to analyze the specificity of the assay, and ddH 2 O was used as negative control. To evaluate the sensitivity of the method, the plasmids of pUC-A151R, pFlag-MGF360-14L, and pFlag-B646L were mixed and then 10-fold serially diluted from 1×10 8 to 1×10 0 copies/µl as templates. To access the limit of detection (LOD), the genomic DNAs of ASFV-A29 (genotype I), ASFV-GZ (genotype II), ASFV-HN (genotype I/II recombinant) were extracted and used as templates. Serial dilutions were performed at the following dilutions with 10, 100, 1000, 10 000, 100 000 and 1000 000-fold. Determination of repeatability of the assay To assess the repeatability of the triplex qPCR assay, the mixtures of three plasmid pUC-A151R, pFlag-MGF360-14L and pFlag-B646L at the concentrations from 1.0×10 8 to 1.0×10 2 copies/µl were used as templates. For intra-assay variation, each dilution was tested in triplicate, and the coefficients of variation (CVs) were determined. Detection of virus shedding in piglets The established triplex qPCR assay was used to detect virus shedding in piglets challenged with ASFV genotype I/II recombinants. The clinical samples were collected from the piglets challenged intramuscularly with 10 3.0 HAD 50 of ASFV-HN, including heparin-anticoagulated whole blood, oral swabs, nasal swabs, and anal swabs at 3, 5, 7, 10, and 14 days post-infection (dpi). The pigs were anesthetized by Xylazine hydrochloride injection (5mL each) intramuscularly and then euthanized following blood collection at 28 dpi.The swabs were resuspended in 1 ml PBS containing 1% Penicillin and Streptomycin and centrifuged at 8000 × g and 4°C for 4 min. Blood was collected with EDTA as an anticoagulant and mixed thoroughly. The DNA of each sample was extracted via the TIANamp virus DNA/RNA kit and TIANamp Genomic DNA kit (Blood / Cell / Tissue Genomic DNA) and tested by the triplex qPCR assay. Results were analyzed using GraphPad Prism version 5.0 (GraphPad Software, San Diego, CA, USA) . Results Design of primers and probes for the triplex qPCR assay According to the genetic variation in A151R gene from different genotypes, the primer and probe were designed at the unique region of genotype I and I/II recombinants, which was shown in Fig. 1A. The MGF360-14L gene is present exclusively in ASFV genotype II or genotype I/II recombinant, whereas is absent in ASFV genotype I. The specific primers and probe were chosen to target the conserved regions of MGF360-14L gene. For the B646L gene, the primers and probes were the same as those specified as previous studies (Table 1 ). The three probes for the A151R, B646L and MGF360-14L genes were labeled with ROX, FAM and CY5 fluorophores, respectively. Table 1 The designed primers and probes Name Sequence (5'→3') Product (bp) A151R- 24F CCCGCCAATAGAGGTGATTT 117 A151R- 46P ROX-AATGAGGTGCTTAGCGGTGGTACA-BHQ2 A151R- 140R GCGCACCACCTATTAACAAAG M14L- 453F CCCGCCAATAGAGGTGATTT 89 M14L- 516P CY5-TTTGGTTTGCCCTGGCATTACGAC-BHQ2 M14L- 541R GCGCACCACCTATTAACAAAG B646L- F GCTTTCAGGATAGAGATACAGCTCT 181 B646L- P FAM-CCGTAACTGCTCATGGTATCAATCTTATCG-BHQ1 B646L- R CCGTAGTGGAAGGGTATGTAAGAG Construction of the standard control plasmids The concentrations of the three standard plasmid constructs named pFlag-B646L, pUC-A151R, and pFlag-MGF360-14L were determined to be 0.63×10 9 , 2.88×10 9 , and 1.24×10 10 copies/µl (original concentration), respectively. The three standard plasmid constructs were diluted to 1×10 8 ,1×10 9 and 1×10 9 copies/µl, and stored at − 80°C until used. The mixed plasmids of pFlag-B646L, pUC-A151R, and pFlag-MGF360-14L at the concentration from 1×10 8 to 1×10 2 copies/µl was used as templates, and the triplex qPCR was performed. The standard curves are shown in Fig. 2 D. The slopes and correlation coefficients (R 2 ) were − 3.4275 and 0.9975 for A151R gene (Fig. 2 A); -3.3713 and 0.9997 for MGF360-14L gene (Fig. 2 B); -3.5335 and 0.9971 for B646L gene (Fig. 2 C). (A) The amplification curves based on the standard pUC-A151R plasmid, (B) pFlag-B646L, (C) pFlag-MGF360-14L, (D) standard curves of the triplex qPCR method. 1–7: The concentrations of the standard plasmid constructs ranged from 1× 10 8 to 1× 10 2 copies/µl. Specificity analysis The nucleic acids extracted from ASFV-A29 (ASFV genotypes I), ASFV-GZ (genotypes II), ASFV-HN (I/II recombinant), PRRSV, CSFV, JEV, PRV, PADV, PEDV and the mixed plasmids (pFlag-B646L, pUC-A151R, and pFlag-MGF360-14L) were used as templates for amplification. The results showed that there were positive amplification curves only for ASFV genomic DNAs and the mixed plasmids (Fig. 3 A, labelled with 1a, 1b, 1c), while no amplification curve was obtained from the other porcine viruses and the negative control (Fig. 3 A, labelled with 2 to 7).The positive amplifications were presented as follows: A151R and B646L for ASFV genotype I viruses (Fig. 3 B), B646L and MGF360-14L for ASFV genotype II (Fig. 3 C), A151R, B646L and MGF360-14L gene for ASFV genotype I/II recombinant (Fig. 3 D) and the mixed plasmids (Fig. 3 A). (A) Compared to the results of PRRSV, CSFV, JEV, PRV, PADV, PEDV genomes, the amplification curve of the mixed plasmids of pUC-A151R, pFlag-B646L and pFlag-MGF360-14L. 1a: pASFV-A151R, 1b: pASFV-MGF360-14L, 1c: pASFV-B646L, 2–7: PRRSV, CSFV, JEV, PRV, PADV, and PEDV, respectively. (B) Amplification curve of genotype I NH/P68-like strain ASFV-A29, (C) Amplification curve of genotype II strain ASFV-GZ, (D) Amplification curve of genotype I/II recombinant strain ASFV-HN. Note The red amplification curves corresponding to B646L gene, the blue amplification curves representing A151R gene, the green amplification curves based on MGF360-14L gene. Sensitivity analysis The mixed plasmids of pUC-A151R, pFlag-MGF360-14L and pFlag-B646L were used as templates and were diluted at a multiple ratio of 1×10 8 ~1×10 0 copies/µl. The triplex qPCR showed that the minimum detection limit of A151R, MGF360-14L and B646L was 10 copies (Fig. 4 ). The concentrations of the standard plasmid constructs pUC-A151R (A), pFlag-B646L (B), pFlag-MGF360-14L (C), which were ranged from 1×10 8 to 1×10 0 copies/µl (from line 1 to line 9); Line 10 represents negative control. To access the LOD, the genomic DNAs were extracted from the viruses amplified in PAM cells. By titration, the titer of genotype I ASFV-A29 virus was 10 6.667 TCID 50 /ml, and the titer of genotype II ASFV-GZ or genotype I/II recombinant strain ASFV-HN was 10 7 TCID 50 /ml. The genomic DNAs of the viruses were extracted and determined by the triplex qPCR method established in this study. The results showed that the assay could be used to differentiate the three genotypes (Fig. 5 ), and the LOD of ASFV-HN virus was as below as 10 2 TCID 50 /ml (Fig. 5 C). (A) Amplification curve of genotype I NH/P68-like strain ASFV-A29; (B) Amplification curve of genotype II strain ASFV-GZ; (C) Amplification curve of genotype I/II recombinant strain ASFV-HN with a serial dilution ranging from 10 6 TCID 50 to 10 1 TCID 50 . Repeatability analysis The mixed plasmids with a dilution ratio of 1.0×10 8 ~ 1.0×10 2 copies/µl were used as the template for repeatability test. The coefficient of variation was calculated according to the Ct values of qPCR with different concentrations. The inter-assay CVs ranged from 0.198% to 0.941% for the A151R gene (ROX), 0.117%-1.769% for the B646L gene, 0.209%-1.909% for the MGF360-14L gene (VIC). These results showed the CVs of the triplex was 0.117%~1.909% (Table 2 ), which was less than 2%. It was proved that the method demonstrated high repeatability. Table 2 Repeatability analysis of triplex qPCR Concentration (copies/µl) Gene Ct value SD CV (%) Ct1 Ct2 Ct3 Mean of Ct value 1.0×10 2 A151R 34.152 34.328 33.578 34.019 0.320 0.941 B646L 33.162 33.566 33.552 33.427 0.187 0.560 MGF360-14L 36.671 37.611 35.896 36.726 0.701 1.909 1.0×10 3 A151R 30.705 30.741 30.325 30.590 0.188 0.615 B646L 29.257 29.786 29.798 29.614 0.252 0.852 MGF360-14L 32.303 32.139 32.052 32.165 0.104 0.324 1.0×10 4 A151R 27.364 26.854 27.2 27.139 0.213 0.783 B646L 26.624 25.503 25.955 26.027 0.460 1.769 MGF360-14L 28.694 28.624 28.829 28.716 0.085 0.296 1.0×10 5 A151R 23.777 23.591 23.8 23.723 0.094 0.394 B646L 22.672 22.731 22.678 22.694 0.027 0.117 MGF360-14L 25.119 25.124 25.233 25.159 0.053 0.209 1.0×10 6 A151R 20.374 20.273 20.479 20.375 0.084 0.413 B646L 18.976 18.716 19.067 18.920 0.149 0.786 MGF360-14L 21.755 21.697 21.855 21.769 0.065 0.300 1.0×10 7 A151R 16.986 16.918 16.912 16.939 0.034 0.198 B646L 15.531 15.75 15.67 15.650 0.090 0.578 MGF360-14L 18.175 18.17 18.458 18.268 0.135 0.737 1.0×10 8 A151R 13.953 13.819 13.957 13.910 0.064 0.461 B646L 13.246 12.884 13.213 13.114 0.163 1.246 MGF360-14L 15.485 15.252 15.243 15.327 0.112 0.731 Detection of virus shedding using the triplex qPCR assay The established triplex qPCR was used to test the blood, oral swabs, nasal swabs, and anal swabs from experimental piglets inoculated intramuscularly with 10 3.0 HAD 50 of ASFV-HN virus. All the piglets died in 14 dpi with classical symptoms of ASFV. A total 120 samples were serially collected and tested by the triplex qPCR assay. The results showed viral nucleic acids were first detected in blood at 3 dpi as low as 10.42 copies/µl (for A151R ), 225.94 copies/µl (for MGF360-14L ) and 13.09 copies/µl (for B646L ). At 5 dpi, the viremia increased 780.07 folds ( A151R ), 230.68 folds ( MGF360-14L ) and 835.72 folds ( B646L ) compared to those at 3 dpi. At 10 dpi, the viremia increased up to 10 5.76 copies/µl ( A151R ), 10 6.61 copies/µl, ( MGF360-14L ), and 10 5.85 ( B646L ) copies/µl. Comparison of the sensitivity of different samples, taking A151R gene as example, the positive detection from blood samples were 3 dpi, but the oral, nasal and anal swab specimens were positive at 7dpi later. The virus copies from the oral swab samples were 18390 folds less than those in blood samples. Compared with MGF360-14L gene , it showed that no detectable values of B646L and A151R genes were found from the oral/nasal/anal swab specimens at 3dpi. After that, it showed that the infection with ASFV-HN resulted in persistent viral shedding, with viral load progressively increasing over the course of infection (Fig. 6 ). Virus copies of blood, oral, nasal, and anal samples were calculated at 3, 5, 7, 10 and 14 dpi based on A151R gene (A), MGF360-14L gene (B) and B646L gene (C). Discussion Since the initial outbreak of ASF in China in 2018, it has severely undermined the development of the nation's swine industry [ 17 – 19 ]. Currently, there are still no commercially available vaccines and antiviral drugs for clinical application[ 20 , 21 ]. The prevention and control of ASFV primarily depend on the rapid detection and culling of infected pigs and those in contact with the virus, which exerts a substantial influence on China's swine industry [ 9 , 22 ]. With the emergence of genotype I and genotype I/II recombinants, the complexity of diagnosis has been further exacerbated [ 8 ]. There is an urgent need for a detection method capable of rapidly identifying genotype I, genotype II, and genotype I/II recombinant viruses to facilitate the early detection of ASF and achieve precise prevention and control of ASFV. Several multiplex qPCR assays have been established to differentiate ASFV genotype I and II viruses [ 12 – 15 , 23 , 24 ]. The previous assay was used the primers and probes based on the X64R/MGF360-14L/B646L gene clusters with a sensitivity of 10 copies/reaction[ 15 ]. However, X64R gene seems be located in regions with very high genetic diversity, which was associated with antigenic drift [ 25 , 26 ]. Additionally, E296R gene was also chosen for differentiation of genotypes I and II ASFV with a sensitivity of 10 copies/µl [ 13 ]. Another differentiation method based on B646L gene of genotypes I and II, or the E183L gene of genotype I ASFV, demonstrated a the sensitivity of about 1.07×10 2 and 3.13×10 4 copies/µl for genotype I and genotype II, respectively [ 24 ]. Especially, in another assay based on B646L/F1055L/E183L targets, the result showed that this assay had a sensitivity of 5.120, 4.218, 4.588 copies/reaction for B646L, F1055L, and E183L gene [ 14 ]. Therefore, an assay with improved sensitivity for accurate differentiation of genotype I and genotype II ASFV as well as genotype I/II recombinants was required. In this study, specific primers and probes were designed based on the unique region of the genotype I A151R gene and genotype II MGF360-14L gene of ASFV. These were combined with the B646L primers and probe recommended by China Animal Health and Epidemiology Center, establishing a TaqMan probe triplex real-time quantitative PCR method. Compared to X64R, A151R, a non-structural protein of ASFV, is stable expressed during both early and late phases of viral infection and is implicated in critical stages of viral replication and assembly [ 27 ]. MGF360-14L, a member of the multifunctional multigene family (MGF360), has been demonstrated to play significant role in viral replication dynamics, immune evasion strategies, and pathogenic manifestations of ASFV[ 28 , 29 ]. The B646L gene, encoding the structurally essential capsid protein p72, exhibits high sequence conservation across ASFV genotypes and has been designated by WOAH as the primary target for molecular diagnostics of ASFV [ 30 ]. The minimum detection limits for the A151R , B646L and MGF360-14L genes were 10 copies indicating a high sensitivity for detecting ASFV. The method specifically amplifies ASFV, does not cross-react with PRRSV, CSFV, JEV, PRV, PADV, or PEDV, demonstrating good specificity; the coefficient of variation was less than 2%, and repeatability was good. Positive nucleic acid samples can be effectively identified. Our assay resulted in similar sensitivity to the assays established previously. Importantly, when the piglets were challenged with ASFV genotype I/II recombinant virus, the method could be used to detect the virus shedding as early as 3 dpi. In conclusion, a triplex quantitative PCR method established in this study was highly specific, sensitive, reproducible, which can assist in the rapid differential diagnosis and early detection of ASFV genotype I/II recombinant virus infection in the future. Declarations Acknowledgments We especially thank Mr. Chongyu Zhang, Dr. Li Jie, Dr. Dongdong Di and Ms. Jing Zhang for their kind assistance. Declaration of interest statement No potential conflict of interest was reported by the author (s). Consent to Publish declaration not applicable Ethics declaration and Biosafety Statement The animal experiments were approved by the Animal Ethics Committee of Spirit Jinyu Company(ethics number:JY/ABSL3/IV/A/416/A24010710). Piglets about 15− 20 kg were purchased from a local farm with high biosecurity standard and hygiene,which possessing a production and operation license. Animal experiments and ASFV infection were performed at the Animal Biosafety Level 3 (ABSL-3) facilities of Spirit Jinyu Biological Pharmaceutical Co., Ltd. In addition to the China National Accreditation Service for Conformity Assessment (CNAS) (license number: CNAS-BL0101), these experiments have also been recognized by the Ministry of Agriculture and Rural Affairs. Data availability All data generated or analyzed during this study are included in this published article. Author contributions WC, HC and SZ conceived and designed the experiments. SZ, GJ, and L. Yao performed the experiments. analyzed the data. L. Ying, ST and NY contributed reagents/materials/analysis tools. SZ, LJ, WC, and HC wrote the paper. All authors contributed to the article and approved the submitted version. Funding This study was supported by the National Key Research and Development Program of China (2023YFD1802600, 2022YFD1800500 and 2021YFD1800100), the National Natural Science Foundation of China (32172842, 32400124 and 32170161), the Chinese Universities Scientific Fund (1051-15055008, 1051-15055010 and 1051-00115331). References <1 a-african-. swine-fever-v2-0.pdf https://www.woah.org/en/ ?s=&_search=ASF Galindo I, Alonso C. African Swine Fever Virus: A Review. Viruses. 2017;9(5):103. Qu H, Ge S, Zhang Y, Wu X, Wang Z. A systematic review of genotypes and serogroups of African swine fever virus. Virus Genes. 2022;58:77–87. O'Donnell V, Spinard E, Xu L, Berninger A, Barrette RW, Gladue DP, Faburay B. Full-Length ASFV B646L Gene Sequencing by Nanopore Offers a Simple and Rapid Approach for Identifying ASFV Genotypes. Viruses. 2024;16(10):1522. Zhao D, Liu R, Zhang X, Li F, Wang J, Zhang J, Liu X, Wang L, Zhang J, Wu X, et al. Replication and virulence in pigs of the first African swine fever virus isolated in China. Emerg Microbes Infec. 2019;8(1):438–47. Sun E, Zhang Z, Wang Z, He X, Zhang X, Wang L, Wang W, Huang L, Xi F, Huangfu H, et al. Emergence and prevalence of naturally occurring lower virulent African swine fever viruses in domestic pigs in China in 2020. Sci China Life Sci. 2021;64(5):752–65. Zhao D, Sun E, Huang L, Ding L, Zhu Y, Zhang J, Shen D, Zhang X, Zhang Z, Ren T, et al. Highly lethal genotype I and II recombinant African swine fever viruses detected in pigs. Nat Commun. 2023;14(1):3096. Du X, Liu Y, Duan L, Tsai S-Y, Yaros JP, Wu F. Elimination of ASFV via Precise Culling in a Large-Scale Breeding Herd in China: A Field Experience. Animals. 2025;15(17):2521. Westbury MYCJM. Strong sequence conservation of African swine fever virus p72 protein provides the molecular basis for its antigenic stability. Arch Virol. 1996;141:1795–802. Wang Y, Kang W, Yang W, Zhang J, Li D, Zheng H. Structure of African Swine Fever Virus and Associated Molecular Mechanisms Underlying Infection and Immunosuppression: A Review. Fronti Immunol. 2021;12:715582. Hu Z, Lai R, Tian X, Guan R, Li X. A duplex fluorescent quantitative PCR assay to distinguish the genotype I, II and I/II recombinant strains of African swine fever virus in China. Front Vet Sci. 2024;11:1422757. Li X, Hu Y, Liu P, Zhu Z, Liu P, Chen C, Wu X. Development and application of a duplex real-time PCR assay for differentiation of genotypes I and II African swine fever viruses. Transbound Emerg Dis. 2022;69(5):9. Shi K, Qian X, Shi Y, Wei H, Pan Y, Long F, Zhou Q, Mo S, Hu L, Li Z. A triplex crystal digital PCR for the detection of genotypes I and II African swine fever virus. Front Vet Sci. 2024;11:1351596. Ding L, Ren T, Bing G, Wang Z, Wang B, Ni J, Liu Y, Zhao R, Zhu Y, Li F, et al. Establishment of a Triplex qPCR Assay for Differentiating Highly Virulent Genotype I Recombinant Virus From Low-Virulence Genotype I and Genotype II African Swine Fever Viruses Circulating in China. Transbound Emerg Dis. 2024;2024(1):6206857. Reed LJ, Muench H. A simple method of estimating fifty percent endpoints. Am J Hygiene. 1938;27(3):5. You S, Liu T, Zhang M, Zhao X, Dong Y, Wu B, Wang Y, Li J, Wei X, Shi B. African swine fever outbreaks in China led to gross domestic product and economic losses. Nat Food. 2021;2(10):802–8. Zhou X, Li N, Luo Y, Liu Y, Miao F, Chen T, Zhang S, Cao P, Li X, Tian K, et al. Emergence of African Swine Fever in China, 2018. Transbound Emerg Dis. 2018;65(6):1482–4. Salling M. Assessing the price effects of African swine fever in the China market. Explor Foods Foodomics. 2025;2025(3):101064. Sun AJ, Wang R, Zhu XJ, Meng ZK, Liu SY, Zhang S, Jin JX, Zhang GP, Zhuang GQ. Review on African swine fever⁃associated detection and pig farm biosecurity control measurement development. Chin J Vet Sci. 2021;41(5):1023–30. Urbano AC, Ferreira F. African swine fever control and prevention: an update on vaccine development. Emerg Microbes Infect. 2022;11(1):2021–33. Danzetta ML, Marenzoni ML, Iannetti S, Tizzani P, Calistri P, Feliziani F. African Swine Fever: Lessons to Learn From Past Eradication Experiences. A Systematic Review. Front Vet Sci. 2020;7:296. Hwang HJ, Choi YS, Song K, Frant M, Kim JH. Development and validation of a fast quantitative real-time PCR assay for the detection of African swine fever virus. Front Vet Sci. 2022;9:1037728. Gao Q, Feng Y, Yang Y, Luo Y, Gong T, Wang H, Gong L, Zhang G, Zheng Z. Establishment of a Dual Real-Time PCR Assay for the Identification of African Swine Fever Virus Genotypes I and II in China. FrontiersVet Sci. 2022;9:882824. Ge S, Zuo Y, Han N, Lü Y, Qu H, Lu H, Wu X, Wang Z. Advances in Researches on African Swine Fever Virus Genotyping and Serogrouping. China Anim Health Inspection. 2022;39(9):97–104. Phadphon P, Sonthirod C, Thaweerattanasinp T, Shearman JR, Saenboonrueng SUT, Wanitchang J, Tangphatsornruang A, Jongkaewwattana S, Pootakham A. Hairpin loop to hairpin loop: a full-length assembly of the ASFV genome using Oxford Nanopore long-read sequencing. Front Microbiol. 2025;16:1615977. Huang J-W, Niu D, Liu K, Wang Q, Ma L, Chen C-C, Zhang L, Liu W, Zhou S, Min J, et al. Structure basis of non-structural protein pA151R from African Swine Fever Virus. Biochem BiophResCo. 2020;532(1):108–13. Liu Y, Xie Z, Li Y, Song Y, Di D, Liu J, Gong L, Chen Z, Wu J, Ye Z, et al. Evaluation of an I177L gene-based five-gene-deleted African swine fever virus as a live attenuated vaccine in pigs. Emerg Microbes Infect. 2022;12(1):e2148560. Wang Y, Cui S, Xin T, Wang X, Yu H, Chen S, Jiang Y, Gao X, Jiang Y, Guo X, et al. African Swine Fever Virus MGF360-14L Negatively Regulates Type I Interferon Signaling by Targeting IRF3. Front Cell Infect Microbiol. 2022;11:818969. Aguero M, Fernandez J, Romero L, Sanchez Mascaraque C, Arias M, Sanchez-Vizcaino JM. Highly sensitive PCR assay for routine diagnosis of African swine fever virus in clinical samples. J Clin Microbiol. 2003;41(9):4431–4. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 24 Mar, 2026 Reviews received at journal 21 Mar, 2026 Reviews received at journal 17 Mar, 2026 Reviewers agreed at journal 14 Mar, 2026 Reviewers agreed at journal 04 Mar, 2026 Reviewers agreed at journal 04 Mar, 2026 Reviewers invited by journal 04 Mar, 2026 Editor assigned by journal 04 Mar, 2026 Editor invited by journal 04 Mar, 2026 Submission checks completed at journal 03 Mar, 2026 First submitted to journal 03 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8879756","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":603150915,"identity":"8c68b9a1-f763-40b1-aecb-abff6cd5bd2c","order_by":0,"name":"Zhuyun Sun","email":"","orcid":"","institution":"Northwest A \u0026 F University","correspondingAuthor":false,"prefix":"","firstName":"Zhuyun","middleName":"","lastName":"Sun","suffix":""},{"id":603150916,"identity":"c7495330-23f6-4bfa-bec8-35d794a42f3b","order_by":1,"name":"Jiezhen Guo","email":"","orcid":"","institution":"Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Jiezhen","middleName":"","lastName":"Guo","suffix":""},{"id":603150917,"identity":"24b5eb88-3aa4-4c21-b52e-8f008684d423","order_by":2,"name":"Yao Li","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yao","middleName":"","lastName":"Li","suffix":""},{"id":603150918,"identity":"84226015-fef9-4aa4-b0c7-dc431e665fc0","order_by":3,"name":"Tong Sun","email":"","orcid":"","institution":"Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Tong","middleName":"","lastName":"Sun","suffix":""},{"id":603150919,"identity":"c9488486-7965-48b9-a3d0-63a45000914f","order_by":4,"name":"Jingyi Liu","email":"","orcid":"","institution":"Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Jingyi","middleName":"","lastName":"Liu","suffix":""},{"id":603150924,"identity":"e97d9f68-1bfb-4a3e-9046-a09ab702ac60","order_by":5,"name":"Yingnan Liu","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yingnan","middleName":"","lastName":"Liu","suffix":""},{"id":603150926,"identity":"893fcb0a-4b7c-4c9e-9975-943d07b6ff45","order_by":6,"name":"Yuchen Nan","email":"","orcid":"","institution":"Northwest A \u0026 F University","correspondingAuthor":false,"prefix":"","firstName":"Yuchen","middleName":"","lastName":"Nan","suffix":""},{"id":603150927,"identity":"8325cc4a-ccd1-4607-8c5a-0eb502792cdf","order_by":7,"name":"Hongjun Chen","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Hongjun","middleName":"","lastName":"Chen","suffix":""},{"id":603150929,"identity":"53f248c5-9e3a-46ac-89c9-09f4de061df7","order_by":8,"name":"Chunyan Wu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA80lEQVRIiWNgGAWjYDACCRiDvQFM8QOxAZFaeA6AKckG4rVIJBCphX92j9ljnpo7iRtuvj0m+bPNToKBvXmbBEPNHdyW3Dljbsxz7Fnihtt5adK8bckSDDzHyiQYjj3DqcVAIsdMmoftcO6G2zlmtxnbmOsYgCISjA2HCWj5B9Ry84zZzZ9t9RIM8m+I0MLbBtRyg8fsBpAhwSDBg1+LxI20Msm5fYfrZ57JMf/Nc+64BBtPWrFFwjHcWvhnJG+TePPtsDHf8TPGhj/KqiX42Q9vvPGhBrcWEGDiQeaxgYgEvBoYGBh/EFAwCkbBKBgFIxwAALX0UckX1NTNAAAAAElFTkSuQmCC","orcid":"","institution":"Northwest A \u0026 F University","correspondingAuthor":true,"prefix":"","firstName":"Chunyan","middleName":"","lastName":"Wu","suffix":""}],"badges":[],"createdAt":"2026-02-14 12:08:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8879756/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8879756/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":104347635,"identity":"f03cba7e-75c2-4866-a575-894f587b9ddb","added_by":"auto","created_at":"2026-03-10 18:14:53","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":303067,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe location of the primers and probes designed for the triplex PCR.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe nucleotide sequence alignments of \u003cem\u003eA151R\u003c/em\u003e gene (A) and the partial \u003cem\u003eMGF360-14L\u003c/em\u003e gene (B) of ASFV show the location of the primers and probes. F, P and R indicate the forward primer, TaqMan probe, and reverse primer, respectively.\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8879756/v1/4fae0caf55cd3512bcd4de0f.jpg"},{"id":104406050,"identity":"0f0b5be9-c5b6-4acc-9cae-0e5e071d6e95","added_by":"auto","created_at":"2026-03-11 12:24:40","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":103326,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGeneration of the standard curves\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) The amplification curves based on the standard pUC-A151R plasmid, (B) pFlag-B646L, (C) pFlag-MGF360-14L, (D) standard curves of the triplex qPCR method. 1–7: The concentrations of the standard plasmid constructs ranged from 1× 10\u003csup\u003e8\u003c/sup\u003e to 1× 10\u003csup\u003e2\u003c/sup\u003ecopies/μl.\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8879756/v1/53a422f20da1b1d48d145e07.jpg"},{"id":104406044,"identity":"2a25b368-e907-48d0-8503-3aa0740d4b1c","added_by":"auto","created_at":"2026-03-11 12:24:39","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":77791,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSpecificity analysis of the triplex qPCR assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Compared to the results of PRRSV, CSFV, JEV, PRV, PADV, PEDV genomes, the amplification curve of the mixed plasmids of pUC-A151R, pFlag-B646L and pFlag-MGF360-14L. 1a: pASFV-A151R, 1b: pASFV-MGF360-14L, 1c: pASFV-B646L, 2-7: PRRSV, CSFV, JEV, PRV, PADV, and PEDV, respectively. (B) Amplification curve of genotype I NH/P68-like strain ASFV-A29, (C) Amplification curve of genotype II strain ASFV-GZ, (D) Amplification curve of genotype I/II recombinant strain ASFV-HN.\u003c/p\u003e\n\u003cp\u003eNote: The red amplification curves corresponding to \u003cem\u003eB646L\u003c/em\u003egene, the blue amplification curves representing \u003cem\u003eA151R\u003c/em\u003e gene, the green amplification curves based on MGF360-14L gene.\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8879756/v1/2769fe0f781a9346e2feb256.jpg"},{"id":104347633,"identity":"6fdb6ec2-a071-46f2-9523-44b5861d00bb","added_by":"auto","created_at":"2026-03-10 18:14:53","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":127860,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSensitivity analysis of the triplex qPCR assay for standard plasmids\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe concentrations of the standard plasmid constructs pUC-A151R (A), pFlag-B646L (B), pFlag-MGF360-14L (C), which were ranged from 1×10\u003csup\u003e8\u003c/sup\u003e to 1×10\u003csup\u003e0 \u003c/sup\u003ecopies/μl (from line 1 to line 9); Line 10 represents negative control.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8879756/v1/4ef309008cd1ef1657f7fa97.jpg"},{"id":104347637,"identity":"9dc143e8-060b-4cbf-a2af-8b5a0736d71f","added_by":"auto","created_at":"2026-03-10 18:14:53","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":180370,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSensitivity analysis of the triplex qPCR assay based on ASFV genotypes.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Amplification curve of genotype I NH/P68-like strain ASFV-A29; (B) Amplification curve of genotype II strain ASFV-GZ; (C) Amplification curve of genotype I/II recombinant strain ASFV-HN with a serial dilution ranging from 10\u003csup\u003e6\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e to 10\u003csup\u003e1\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e.\u003c/p\u003e","description":"","filename":"Picture5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8879756/v1/9f9216002762c37bf3d7f9b5.jpg"},{"id":104347638,"identity":"01000088-7e3e-4316-886e-df8dc0448c51","added_by":"auto","created_at":"2026-03-10 18:14:53","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":38874,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDetection of virus shedding by the triplex qPCR assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eVirus copies of blood, oral, nasal, and anal samples were calculated at 3, 5, 7, 10 and 14 dpi based on A151R gene (A), MGF360-14L gene (B) and B646L gene (C).\u003c/p\u003e","description":"","filename":"Picture6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8879756/v1/1b5e153f9cc9e0925a51ac1d.jpg"},{"id":104409596,"identity":"0f2e2fed-9d78-4d90-95d4-ea1988a7db57","added_by":"auto","created_at":"2026-03-11 12:46:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1875578,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8879756/v1/e92d117c-dd71-4010-9a4d-1266c4c6236a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Establishment of triplex real-time quantitative PCR assay for African swine fever virus genotype I/II recombinants","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAfrican swine fever (ASF) is a highly contagious and acute disease caused by the African swine fever virus (ASFV), classified as a reportable animal disease by the World Organization for Animal Health [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. ASFV is an icosahedral enveloped DNA virus with a total length of 170-190kb for its genome, containing 151\u0026ndash;167 open reading frames[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Based on the variations in C-terminus of the \u003cem\u003eB646L\u003c/em\u003e gene (encoding p72 capsid protein), ASFV in Africa is classified into at least 24 genotypes[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn 2018, ASF was firstly reported in China, which was caused by a high virulent genotype II Georgia07-like strain [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In 2021, an attenuated genotype I ASFV strain was isolated that exhibited a high transmission efficiency and a propensity for [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]asymptomatic infections[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Subsequently, three natural recombinant strains derived from genotypes I and II ASFV were identified, exhibiting increased virulence, elevated lethality rates, and accelerated transmission kinetics [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the absence of commercially available vaccines or effective therapeutic treatments, China's current control strategy of ASFV relies predominantly on real-time quantitative PCR (qPCR) for early detection and culling of infected individual from herds to prevent further spreading [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Although qPCR targeting the \u003cem\u003eB646L\u003c/em\u003e gene is the main method for ASFV detection, its utility in ASFV genotype differentiation is severely constrained by the exceptionally high sequence conservation (\u0026gt;\u0026thinsp;98%) of this gene across diverse viral isolates [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. To date, for the detection of genotypes I and II ASFV in the field, several multiplex qPCR based on the \u003cem\u003eE296R, B646L\u003c/em\u003e, and/or \u003cem\u003eE183L\u003c/em\u003e genes have been reported[\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Moreover, triplex qPCR methods based on \u003cem\u003eB646L/F1055L/E183L\u003c/em\u003e or \u003cem\u003eX64R/MGF360-14L/B646L\u003c/em\u003e genes were developed for detection and rapid differentiation [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Although the highly virulent genotype II ASFV is still the dominant strain in China, the prevalence of highly virulent genotype I/II recombinant ASFV is gradually increasing, which highlights significant limitations for current diagnostic approaches [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Given the escalating genetic diversity observed in field, it highlights the urgent need to develop molecular assays capable for rapid and accurate strain identification of genotype I/II.\u003c/p\u003e \u003cp\u003eIn this study, we developed a triplex quantitative PCR (qPCR) assay for detection and genotyping of ASFV simultaneously. The assay integrates CAHEC-recommended B646L primers and probes, genotype II-specific targets amplifying conserved regions of \u003cem\u003eMGF360-14L\u003c/em\u003e gene and genotype I-discriminatory probes targeting unique sequences of A151R gene. This method enables differention of genotype I, genotype II, and genotype I /II recombinants through distinct fluorescent channels, providing a powerful tool for rapid diagnosis and epidemiological surveillance of ASFV.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eViruses and Viral nucleic acids\u003c/h2\u003e \u003cp\u003eGenotype II strain GZ201801 (ASFV-GZ) and Genotype I/II recombinant strain ASFV-HN10005 (ASFV-HN) were isolated and provided by the National African Swine Fever Regional Laboratory at South China Agricultural University. The viruses were permitted and transferred to Spirit Jinyu Biopharmaceutical Co., Ltd. The virus was propagated in the primary BMDMs. Viral titers (TCID\u003csub\u003e50\u003c/sub\u003e and HAD\u003csub\u003e50\u003c/sub\u003e) were subsequently determined using these primary BMDMs and calculated according to the Reed-Muench method [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The genomic DNA of genotype I attenuated NH/P68-like strain ACDC-29 (ASFV-A29) was provided by China Animal Disease Control Centre. Porcine reproductive and respiratory syndrome virus (PRRSV), Swine fever virus (CSFV), Japanese encephalitis virus (JEV), Porcine pseudorabies virus (PRV), Porcine adenoviruses (PADV) and Porcine epidemic diarrhea virus (PEDV) positive samples are preserved by the Shanghai Veterinary Research Institute of the Chinese Academy of Agricultural Sciences.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDesign of primers and probes\u003c/h3\u003e\n\u003cp\u003eGenome sequence analysis revealed that there were differences for \u003cem\u003eA151R\u003c/em\u003e gene between ASFV genotype I, ASFV genotype II or ASFV genotype I/II recombinants via SnapGene 6.0.2. The location of the primers and probes were indicated in Fig.\u0026nbsp;1A. On the basis of comparison result of \u003cem\u003eA151R\u003c/em\u003e gene of ASFV genotype I, genotype II and I/II recombinant viruses, \u003cem\u003eMGF360-14L\u003c/em\u003e gene (which from genotype II and I/II recombinant), primers and probes were designed via PrimerQuest Tool shown in Fig.\u0026nbsp;1B. For \u003cem\u003eB646L\u003c/em\u003e gene, primers and probes were recommended by China Animal Health and Epidemiology Center(CAHEC). The three probes for the \u003cem\u003eA151R\u003c/em\u003e, \u003cem\u003eMGF360-14L\u003c/em\u003e and \u003cem\u003eB646L\u003c/em\u003e genes were labeled with FOX, VIC and FAM, respectively. All primers and probes were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.\u003cdiv description=\"Figure 1_01\" class=\"Drawing\" id=\"6\" name=\"图片 6\"\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003e \u003cb\u003eFigure 1 The location of the primers and probes designed for the triplex PCR.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe nucleotide sequence alignments of \u003cem\u003eA151R\u003c/em\u003e gene (A) and the partial \u003cem\u003eMGF360-14L\u003c/em\u003e gene (B) of ASFV show the location of the primers and probes. F, P and R indicate the forward primer, TaqMan probe, and reverse primer, respectively.\u003c/p\u003e\n\u003ch3\u003eConstruction of the standard plasmids\u003c/h3\u003e\n\u003cp\u003e \u003cem\u003eA151R\u003c/em\u003e gene from ASFV genotype I attenuated NH/P68 strain was synthesized and subcloned into pUC57 plasmid named as pUC-A151R by GenScript Biotechnology Co., LTD. \u003cem\u003eMGF360-14\u003c/em\u003eL and \u003cem\u003eB646L\u003c/em\u003e genes from ASFV genotype II virulent strain GZ201801 were subcloned into p3\u0026times;Flag-CMV-7.1 plasmid, designated respectively as pFlag-14L and pFlag-B646L, which were preserved by our lab. The standard plasmid constructs were double-confirmed by Sanger sequence analysis.\u003c/p\u003e\n\u003ch3\u003eDevelopment and optimization of triplex qPCR assay\u003c/h3\u003e\n\u003cp\u003eThe reaction conditions, including the primers and probes concentration and cycling conditions, were optimized for triplex qPCR assay. The reaction system volume was 20 \u0026micro;l: 10 \u0026micro;l of TOROIVD\u0026reg;5G qPCR Premix with UNG (TOROIVD, China), 0.5\u0026micro;l of each primer (10 \u0026micro;mol/l), 0.2\u0026micro;l of each probe (10 \u0026micro;mol/l), 2 \u0026micro;l of template DNA, and 4.4 \u0026micro;l of ddH\u003csub\u003e2\u003c/sub\u003eO. Triplex qPCR was performed with Applied Biosystems QS5 Fluorescence Quantitative PCR Instrument. The reaction conditions were below: 37\u0026deg;C for 2min, 95\u0026deg;C for 3min, followed by 45 cycles of 95\u0026deg;C for 10s and 60\u0026deg;C for 30s.\u003c/p\u003e\n\u003ch3\u003eStandard curve generation\u003c/h3\u003e\n\u003cp\u003eThe standard plasmid constructs were measured using NanoDrop spectrophotometer (Thermo Fisher Scientific Inc.) at 260 nm and 280 nm, and determined their concentrations using the formula as follows: copy number (copies/\u0026micro;l) = (plasmid construct concentration \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;9\u003c/sup\u003e \u0026times; 6.02 \u0026times; 10\u003csup\u003e23\u003c/sup\u003e) / (660 Dalton/bases \u0026times; DNA length). Three standard plasmid constructs of pUC-A151R, pFlag-MGF360-14L, and pFlag-B646L were mixed as templates at the concentration of 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e copies/\u0026micro;l for each plasmid. Real-time quantitative PCR was performed from 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e to 1\u0026times;10\u003csup\u003e2\u003c/sup\u003e copies/\u0026micro;l. Three replicates were performed for each dilution, and the standard curve was generated using the logarithm of the starting template concentration and the Ct value as the horizontal and vertical coordinates.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of specificity and sensitivity of the assay\u003c/h2\u003e \u003cp\u003eThe total nucleic acids of PRRSV, CSFV, JEV, PRV, PADV, PEDV, ASFV-A29, ASFV-GZ and ASFV-HN were extracted from positive clinical samples using Blood/cell/tissue genomic DNA extraction kit and viral genomic DNA/RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., LTD.) according to the manufacturer's constructions, and stored at -80\u0026deg;C until use. The DNA/cDNA of PRRSV, CSFV, JEV, PRV, PADV, PEDV and ASFV was used as templates to analyze the specificity of the assay, and ddH\u003csub\u003e2\u003c/sub\u003eO was used as negative control.\u003c/p\u003e \u003cp\u003eTo evaluate the sensitivity of the method, the plasmids of pUC-A151R, pFlag-MGF360-14L, and pFlag-B646L were mixed and then 10-fold serially diluted from 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e to 1\u0026times;10\u003csup\u003e0\u003c/sup\u003e copies/\u0026micro;l as templates. To access the limit of detection (LOD), the genomic DNAs of ASFV-A29 (genotype I), ASFV-GZ (genotype II), ASFV-HN (genotype I/II recombinant) were extracted and used as templates. Serial dilutions were performed at the following dilutions with 10, 100, 1000, 10 000, 100 000 and 1000 000-fold.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDetermination of repeatability of the assay\u003c/h3\u003e\n\u003cp\u003eTo assess the repeatability of the triplex qPCR assay, the mixtures of three plasmid pUC-A151R, pFlag-MGF360-14L and pFlag-B646L at the concentrations from 1.0\u0026times;10\u003csup\u003e8\u003c/sup\u003e to 1.0\u0026times;10\u003csup\u003e2\u003c/sup\u003ecopies/\u0026micro;l were used as templates. For intra-assay variation, each dilution was tested in triplicate, and the coefficients of variation (CVs) were determined.\u003c/p\u003e\n\u003ch3\u003eDetection of virus shedding in piglets\u003c/h3\u003e\n\u003cp\u003eThe established triplex qPCR assay was used to detect virus shedding in piglets challenged with ASFV genotype I/II recombinants. The clinical samples were collected from the piglets challenged intramuscularly with 10\u003csup\u003e3.0\u003c/sup\u003e HAD\u003csub\u003e50\u003c/sub\u003e of ASFV-HN, including heparin-anticoagulated whole blood, oral swabs, nasal swabs, and anal swabs at 3, 5, 7, 10, and 14 days post-infection (dpi). The pigs were anesthetized by Xylazine hydrochloride injection (5mL each) intramuscularly and then euthanized following blood collection at 28 dpi.The swabs were resuspended in 1 ml PBS containing 1% Penicillin and Streptomycin and centrifuged at 8000 \u0026times; \u003cem\u003eg\u003c/em\u003e and 4\u0026deg;C for 4 min. Blood was collected with EDTA as an anticoagulant and mixed thoroughly. The DNA of each sample was extracted via the TIANamp virus DNA/RNA kit and TIANamp Genomic DNA kit (Blood / Cell / Tissue Genomic DNA) and tested by the triplex qPCR assay. Results were analyzed using GraphPad Prism version 5.0 (GraphPad Software, San Diego, CA, USA) .\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eDesign of primers and probes for the triplex qPCR assay\u003c/h2\u003e \u003cp\u003eAccording to the genetic variation in \u003cem\u003eA151R\u003c/em\u003e gene from different genotypes, the primer and probe were designed at the unique region of genotype I and I/II recombinants, which was shown in Fig.\u0026nbsp;1A. The \u003cem\u003eMGF360-14L\u003c/em\u003e gene is present exclusively in ASFV genotype II or genotype I/II recombinant, whereas is absent in ASFV genotype I. The specific primers and probe were chosen to target the conserved regions of \u003cem\u003eMGF360-14L\u003c/em\u003e gene. For the \u003cem\u003eB646L\u003c/em\u003e gene, the primers and probes were the same as those specified as previous studies (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The three probes for the \u003cem\u003eA151R, B646L\u003c/em\u003e and \u003cem\u003eMGF360-14L\u003c/em\u003e genes were labeled with ROX, FAM and CY5 fluorophores, respectively.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe designed primers and probes\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5'\u0026rarr;3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProduct (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eA151R-\u003c/em\u003e24F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCGCCAATAGAGGTGATTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e117\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eA151R-\u003c/em\u003e46P\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eROX-AATGAGGTGCTTAGCGGTGGTACA-BHQ2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eA151R-\u003c/em\u003e140R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCGCACCACCTATTAACAAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eM14L-\u003c/em\u003e453F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCGCCAATAGAGGTGATTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e89\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eM14L-\u003c/em\u003e516P\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCY5-TTTGGTTTGCCCTGGCATTACGAC-BHQ2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eM14L-\u003c/em\u003e541R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCGCACCACCTATTAACAAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eB646L-\u003c/em\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTTTCAGGATAGAGATACAGCTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e181\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eB646L-\u003c/em\u003eP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFAM-CCGTAACTGCTCATGGTATCAATCTTATCG-BHQ1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eB646L-\u003c/em\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGTAGTGGAAGGGTATGTAAGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eConstruction of the standard control plasmids\u003c/h2\u003e \u003cp\u003eThe concentrations of the three standard plasmid constructs named pFlag-B646L, pUC-A151R, and pFlag-MGF360-14L were determined to be 0.63\u0026times;10\u003csup\u003e9\u003c/sup\u003e, 2.88\u0026times;10\u003csup\u003e9\u003c/sup\u003e, and 1.24\u0026times;10\u003csup\u003e10\u003c/sup\u003e copies/\u0026micro;l (original concentration), respectively. The three standard plasmid constructs were diluted to 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e,1\u0026times;10\u003csup\u003e9\u003c/sup\u003e and 1\u0026times;10\u003csup\u003e9\u003c/sup\u003e copies/\u0026micro;l, and stored at \u0026minus;\u0026thinsp;80\u0026deg;C until used. The mixed plasmids of pFlag-B646L, pUC-A151R, and pFlag-MGF360-14L at the concentration from 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e to 1\u0026times;10\u003csup\u003e2\u003c/sup\u003e copies/\u0026micro;l was used as templates, and the triplex qPCR was performed. The standard curves are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eD. The slopes and correlation coefficients (R\u003csup\u003e2\u003c/sup\u003e) were \u0026minus;\u0026thinsp;3.4275 and 0.9975 for \u003cem\u003eA151R\u003c/em\u003e gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eA); -3.3713 and 0.9997 for \u003cem\u003eMGF360-14L\u003c/em\u003e gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eB); -3.5335 and 0.9971 for \u003cem\u003eB646L\u003c/em\u003e gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e(A) The amplification curves based on the standard pUC-A151R plasmid, (B) pFlag-B646L, (C) pFlag-MGF360-14L, (D) standard curves of the triplex qPCR method. 1\u0026ndash;7: The concentrations of the standard plasmid constructs ranged from 1\u0026times; 10\u003csup\u003e8\u003c/sup\u003e to 1\u0026times; 10\u003csup\u003e2\u003c/sup\u003ecopies/\u0026micro;l.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eSpecificity analysis\u003c/h2\u003e \u003cp\u003eThe nucleic acids extracted from ASFV-A29 (ASFV genotypes I), ASFV-GZ (genotypes II), ASFV-HN (I/II recombinant), PRRSV, CSFV, JEV, PRV, PADV, PEDV and the mixed plasmids (pFlag-B646L, pUC-A151R, and pFlag-MGF360-14L) were used as templates for amplification. The results showed that there were positive amplification curves only for ASFV genomic DNAs and the mixed plasmids (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, labelled with 1a, 1b, 1c), while no amplification curve was obtained from the other porcine viruses and the negative control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, labelled with 2 to 7).The positive amplifications were presented as follows: \u003cem\u003eA151R\u003c/em\u003e and \u003cem\u003eB646L\u003c/em\u003e for ASFV genotype I viruses (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), \u003cem\u003eB646L\u003c/em\u003e and \u003cem\u003eMGF360-14L\u003c/em\u003e for ASFV genotype II (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), \u003cem\u003eA151R, B646L\u003c/em\u003e and \u003cem\u003eMGF360-14L\u003c/em\u003e gene for ASFV genotype I/II recombinant (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eD) and the mixed plasmids (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e(A) Compared to the results of PRRSV, CSFV, JEV, PRV, PADV, PEDV genomes, the amplification curve of the mixed plasmids of pUC-A151R, pFlag-B646L and pFlag-MGF360-14L. 1a: pASFV-A151R, 1b: pASFV-MGF360-14L, 1c: pASFV-B646L, 2\u0026ndash;7: PRRSV, CSFV, JEV, PRV, PADV, and PEDV, respectively. (B) Amplification curve of genotype I NH/P68-like strain ASFV-A29, (C) Amplification curve of genotype II strain ASFV-GZ, (D) Amplification curve of genotype I/II recombinant strain ASFV-HN.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eNote\u003c/strong\u003e \u003cp\u003eThe red amplification curves corresponding to \u003cem\u003eB646L\u003c/em\u003e gene, the blue amplification curves representing \u003cem\u003eA151R\u003c/em\u003e gene, the green amplification curves based on MGF360-14L gene.\u003c/p\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eSensitivity analysis\u003c/h2\u003e \u003cp\u003eThe mixed plasmids of pUC-A151R, pFlag-MGF360-14L and pFlag-B646L were used as templates and were diluted at a multiple ratio of 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e~1\u0026times;10\u003csup\u003e0\u003c/sup\u003e copies/\u0026micro;l. The triplex qPCR showed that the minimum detection limit of \u003cem\u003eA151R, MGF360-14L\u003c/em\u003e and \u003cem\u003eB646L\u003c/em\u003e was 10 copies (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe concentrations of the standard plasmid constructs pUC-A151R (A), pFlag-B646L (B), pFlag-MGF360-14L (C), which were ranged from 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e to 1\u0026times;10\u003csup\u003e0\u003c/sup\u003e copies/\u0026micro;l (from line 1 to line 9); Line 10 represents negative control.\u003c/p\u003e \u003cp\u003eTo access the LOD, the genomic DNAs were extracted from the viruses amplified in PAM cells. By titration, the titer of genotype I ASFV-A29 virus was 10\u003csup\u003e6.667\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/ml, and the titer of genotype II ASFV-GZ or genotype I/II recombinant strain ASFV-HN was 10\u003csup\u003e7\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/ml. The genomic DNAs of the viruses were extracted and determined by the triplex qPCR method established in this study. The results showed that the assay could be used to differentiate the three genotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003e), and the LOD of ASFV-HN virus was as below as 10\u003csup\u003e2\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/ml (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e(A) Amplification curve of genotype I NH/P68-like strain ASFV-A29; (B) Amplification curve of genotype II strain ASFV-GZ; (C) Amplification curve of genotype I/II recombinant strain ASFV-HN with a serial dilution ranging from 10\u003csup\u003e6\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e to 10\u003csup\u003e1\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eRepeatability analysis\u003c/h2\u003e \u003cp\u003eThe mixed plasmids with a dilution ratio of 1.0\u0026times;10\u003csup\u003e8\u003c/sup\u003e ~ 1.0\u0026times;10\u003csup\u003e2\u003c/sup\u003e copies/\u0026micro;l were used as the template for repeatability test. The coefficient of variation was calculated according to the Ct values of qPCR with different concentrations. The inter-assay CVs ranged from 0.198% to 0.941% for the \u003cem\u003eA151R\u003c/em\u003e gene (ROX), 0.117%-1.769% for the \u003cem\u003eB646L\u003c/em\u003e gene, 0.209%-1.909% for the \u003cem\u003eMGF360-14L\u003c/em\u003e gene (VIC). These results showed the CVs of the triplex was 0.117%~1.909% (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), which was less than 2%. It was proved that the method demonstrated high repeatability.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eRepeatability analysis of triplex qPCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eConcentration\u003c/p\u003e \u003cp\u003e(copies/\u0026micro;l)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c6\" namest=\"c3\"\u003e \u003cp\u003eCt value\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCV (%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCt1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCt2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCt3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMean of Ct value\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e1.0\u0026times;10\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eA151R\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e34.152\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e34.328\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e33.578\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e34.019\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.320\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.941\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eB646L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e33.162\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e33.566\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e33.552\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e33.427\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.187\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.560\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMGF360-14L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e36.671\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e37.611\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e35.896\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e36.726\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.701\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.909\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e1.0\u0026times;10\u003csup\u003e3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eA151R\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30.705\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30.741\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e30.325\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e30.590\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.188\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.615\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eB646L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e29.257\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e29.786\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e29.798\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e29.614\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.252\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.852\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMGF360-14L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e32.303\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e32.139\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e32.052\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e32.165\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.104\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.324\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e1.0\u0026times;10\u003csup\u003e4\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eA151R\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e27.364\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e26.854\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e27.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e27.139\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.213\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.783\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eB646L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26.624\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25.503\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e25.955\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e26.027\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.460\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.769\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMGF360-14L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28.694\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e28.624\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e28.829\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e28.716\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.085\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.296\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e1.0\u0026times;10\u003csup\u003e5\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eA151R\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e23.777\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e23.591\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e23.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e23.723\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.094\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.394\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eB646L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22.672\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e22.731\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e22.678\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e22.694\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.027\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.117\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMGF360-14L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25.119\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25.124\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e25.233\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e25.159\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.053\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.209\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e1.0\u0026times;10\u003csup\u003e6\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eA151R\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20.374\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20.273\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e20.479\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20.375\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.084\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.413\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eB646L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18.976\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18.716\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e19.067\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e18.920\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.149\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.786\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMGF360-14L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21.755\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e21.697\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e21.855\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e21.769\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.065\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.300\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e1.0\u0026times;10\u003csup\u003e7\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eA151R\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16.986\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e16.918\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16.912\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e16.939\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.034\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.198\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eB646L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15.531\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e15.650\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.090\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.578\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMGF360-14L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18.175\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e18.458\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e18.268\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.135\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.737\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e1.0\u0026times;10\u003csup\u003e8\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eA151R\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13.953\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13.819\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13.957\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e13.910\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.064\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.461\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eB646L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13.246\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12.884\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13.213\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e13.114\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.163\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.246\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMGF360-14L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15.485\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15.252\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15.243\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e15.327\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.112\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.731\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eDetection of virus shedding using the triplex qPCR assay\u003c/h2\u003e \u003cp\u003eThe established triplex qPCR was used to test the blood, oral swabs, nasal swabs, and anal swabs from experimental piglets inoculated intramuscularly with 10\u003csup\u003e3.0\u003c/sup\u003e HAD\u003csub\u003e50\u003c/sub\u003e of ASFV-HN virus. All the piglets died in 14 dpi with classical symptoms of ASFV. A total 120 samples were serially collected and tested by the triplex qPCR assay. The results showed viral nucleic acids were first detected in blood at 3 dpi as low as 10.42 copies/\u0026micro;l (for \u003cem\u003eA151R\u003c/em\u003e), 225.94 copies/\u0026micro;l (for \u003cem\u003eMGF360-14L\u003c/em\u003e) and 13.09 copies/\u0026micro;l (for \u003cem\u003eB646L\u003c/em\u003e). At 5 dpi, the viremia increased 780.07 folds (\u003cem\u003eA151R\u003c/em\u003e), 230.68 folds (\u003cem\u003eMGF360-14L\u003c/em\u003e) and 835.72 folds (\u003cem\u003eB646L\u003c/em\u003e) compared to those at 3 dpi. At 10 dpi, the viremia increased up to 10\u003csup\u003e5.76\u003c/sup\u003e copies/\u0026micro;l (\u003cem\u003eA151R\u003c/em\u003e), 10\u003csup\u003e6.61\u003c/sup\u003e copies/\u0026micro;l, (\u003cem\u003eMGF360-14L\u003c/em\u003e), and 10\u003csup\u003e5.85\u003c/sup\u003e (\u003cem\u003eB646L\u003c/em\u003e) copies/\u0026micro;l. Comparison of the sensitivity of different samples, taking \u003cem\u003eA151R\u003c/em\u003e gene as example, the positive detection from blood samples were 3 dpi, but the oral, nasal and anal swab specimens were positive at 7dpi later. The virus copies from the oral swab samples were 18390 folds less than those in blood samples. Compared with \u003cem\u003eMGF360-14L gene\u003c/em\u003e, it showed that no detectable values of \u003cem\u003eB646L\u003c/em\u003e and \u003cem\u003eA151R\u003c/em\u003e genes were found from the oral/nasal/anal swab specimens at 3dpi. After that, it showed that the infection with ASFV-HN resulted in persistent viral shedding, with viral load progressively increasing over the course of infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eVirus copies of blood, oral, nasal, and anal samples were calculated at 3, 5, 7, 10 and 14 dpi based on A151R gene (A), MGF360-14L gene (B) and B646L gene (C).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eSince the initial outbreak of ASF in China in 2018, it has severely undermined the development of the nation's swine industry [\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Currently, there are still no commercially available vaccines and antiviral drugs for clinical application[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The prevention and control of ASFV primarily depend on the rapid detection and culling of infected pigs and those in contact with the virus, which exerts a substantial influence on China's swine industry [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. With the emergence of genotype I and genotype I/II recombinants, the complexity of diagnosis has been further exacerbated [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. There is an urgent need for a detection method capable of rapidly identifying genotype I, genotype II, and genotype I/II recombinant viruses to facilitate the early detection of ASF and achieve precise prevention and control of ASFV.\u003c/p\u003e \u003cp\u003eSeveral multiplex qPCR assays have been established to differentiate ASFV genotype I and II viruses [\u003cspan additionalcitationids=\"CR13 CR14\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The previous assay was used the primers and probes based on the \u003cem\u003eX64R/MGF360-14L/B646L\u003c/em\u003e gene clusters with a sensitivity of 10 copies/reaction[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. However, \u003cem\u003eX64R\u003c/em\u003e gene seems be located in regions with very high genetic diversity, which was associated with antigenic drift [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Additionally, \u003cem\u003eE296R\u003c/em\u003e gene was also chosen for differentiation of genotypes I and II ASFV with a sensitivity of 10 copies/\u0026micro;l [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Another differentiation method based on \u003cem\u003eB646L\u003c/em\u003e gene of genotypes I and II, or the \u003cem\u003eE183L\u003c/em\u003e gene of genotype I ASFV, demonstrated a the sensitivity of about 1.07\u0026times;10\u003csup\u003e2\u003c/sup\u003e and 3.13\u0026times;10\u003csup\u003e4\u003c/sup\u003e copies/\u0026micro;l for genotype I and genotype II, respectively [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Especially, in another assay based on \u003cem\u003eB646L/F1055L/E183L\u003c/em\u003e targets, the result showed that this assay had a sensitivity of 5.120, 4.218, 4.588 copies/reaction for B646L, F1055L, and E183L gene [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Therefore, an assay with improved sensitivity for accurate differentiation of genotype I and genotype II ASFV as well as genotype I/II recombinants was required.\u003c/p\u003e \u003cp\u003eIn this study, specific primers and probes were designed based on the unique region of the genotype I \u003cem\u003eA151R\u003c/em\u003e gene and genotype II \u003cem\u003eMGF360-14L\u003c/em\u003e gene of ASFV. These were combined with the \u003cem\u003eB646L\u003c/em\u003e primers and probe recommended by China Animal Health and Epidemiology Center, establishing a TaqMan probe triplex real-time quantitative PCR method. Compared to X64R, A151R, a non-structural protein of ASFV, is stable expressed during both early and late phases of viral infection and is implicated in critical stages of viral replication and assembly [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. MGF360-14L, a member of the multifunctional multigene family (MGF360), has been demonstrated to play significant role in viral replication dynamics, immune evasion strategies, and pathogenic manifestations of ASFV[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The B646L gene, encoding the structurally essential capsid protein p72, exhibits high sequence conservation across ASFV genotypes and has been designated by WOAH as the primary target for molecular diagnostics of ASFV [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The minimum detection limits for the \u003cem\u003eA151R\u003c/em\u003e, \u003cem\u003eB646L\u003c/em\u003e and \u003cem\u003eMGF360-14L\u003c/em\u003e genes were 10 copies indicating a high sensitivity for detecting ASFV. The method specifically amplifies ASFV, does not cross-react with PRRSV, CSFV, JEV, PRV, PADV, or PEDV, demonstrating good specificity; the coefficient of variation was less than 2%, and repeatability was good. Positive nucleic acid samples can be effectively identified. Our assay resulted in similar sensitivity to the assays established previously. Importantly, when the piglets were challenged with ASFV genotype I/II recombinant virus, the method could be used to detect the virus shedding as early as 3 dpi.\u003c/p\u003e \u003cp\u003eIn conclusion, a triplex quantitative PCR method established in this study was highly specific, sensitive, reproducible, which can assist in the rapid differential diagnosis and early detection of ASFV genotype I/II recombinant virus infection in the future.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe especially thank Mr. Chongyu Zhang, Dr. Li Jie, Dr. Dongdong Di and Ms. Jing Zhang for their kind assistance.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of interest statement \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo potential conflict of interest was reported by the author (s).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Publish declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003enot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declaration and Biosafety Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal experiments were approved by the Animal Ethics Committee of Spirit Jinyu Company(ethics number:JY/ABSL3/IV/A/416/A24010710).\u0026nbsp;Piglets about 15− 20 kg were purchased from a local farm with high biosecurity standard and hygiene,which possessing a production and operation license.\u003cbr\u003e\u0026nbsp;Animal experiments and ASFV infection were performed at the Animal Biosafety Level 3 (ABSL-3) facilities of Spirit Jinyu Biological Pharmaceutical Co., Ltd. In addition to the China National Accreditation Service for Conformity Assessment (CNAS) (license number: CNAS-BL0101), these experiments have also been recognized by the Ministry of Agriculture and Rural Affairs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWC, HC and SZ conceived and designed the experiments. SZ, GJ, and L. Yao performed the experiments. analyzed the data. L. Ying, ST and NY contributed reagents/materials/analysis tools. SZ, LJ, WC, and HC wrote the paper. All authors contributed to the article and approved the submitted version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the National Key Research and Development Program of China (2023YFD1802600, 2022YFD1800500 and 2021YFD1800100), the National Natural Science Foundation of China (32172842, 32400124 and 32170161), the Chinese Universities Scientific Fund (1051-15055008, 1051-15055010 and 1051-00115331).\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003e\u0026lt;1 a-african-. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003eswine-fever-v2-0.pdf\u003c/span\u003e\u003cspan address=\"http://swine-fever-v2-0.pdf\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.woah.org/en/\u003c/span\u003e\u003cspan address=\"https://www.woah.org/en/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e?s=\u0026amp;_search=ASF\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalindo I, Alonso C. African Swine Fever Virus: A Review. Viruses. 2017;9(5):103.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQu H, Ge S, Zhang Y, Wu X, Wang Z. A systematic review of genotypes and serogroups of African swine fever virus. Virus Genes. 2022;58:77\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO'Donnell V, Spinard E, Xu L, Berninger A, Barrette RW, Gladue DP, Faburay B. Full-Length ASFV B646L Gene Sequencing by Nanopore Offers a Simple and Rapid Approach for Identifying ASFV Genotypes. Viruses. 2024;16(10):1522.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao D, Liu R, Zhang X, Li F, Wang J, Zhang J, Liu X, Wang L, Zhang J, Wu X, et al. Replication and virulence in pigs of the first African swine fever virus isolated in China. Emerg Microbes Infec. 2019;8(1):438\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun E, Zhang Z, Wang Z, He X, Zhang X, Wang L, Wang W, Huang L, Xi F, Huangfu H, et al. Emergence and prevalence of naturally occurring lower virulent African swine fever viruses in domestic pigs in China in 2020. Sci China Life Sci. 2021;64(5):752\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao D, Sun E, Huang L, Ding L, Zhu Y, Zhang J, Shen D, Zhang X, Zhang Z, Ren T, et al. Highly lethal genotype I and II recombinant African swine fever viruses detected in pigs. Nat Commun. 2023;14(1):3096.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu X, Liu Y, Duan L, Tsai S-Y, Yaros JP, Wu F. Elimination of ASFV via Precise Culling in a Large-Scale Breeding Herd in China: A Field Experience. Animals. 2025;15(17):2521.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWestbury MYCJM. Strong sequence conservation of African swine fever virus p72 protein provides the molecular basis for its antigenic stability. Arch Virol. 1996;141:1795\u0026ndash;802.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Kang W, Yang W, Zhang J, Li D, Zheng H. Structure of African Swine Fever Virus and Associated Molecular Mechanisms Underlying Infection and Immunosuppression: A Review. Fronti Immunol. 2021;12:715582.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu Z, Lai R, Tian X, Guan R, Li X. A duplex fluorescent quantitative PCR assay to distinguish the genotype I, II and I/II recombinant strains of African swine fever virus in China. Front Vet Sci. 2024;11:1422757.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Hu Y, Liu P, Zhu Z, Liu P, Chen C, Wu X. Development and application of a duplex real-time PCR assay for differentiation of genotypes I and II African swine fever viruses. Transbound Emerg Dis. 2022;69(5):9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi K, Qian X, Shi Y, Wei H, Pan Y, Long F, Zhou Q, Mo S, Hu L, Li Z. A triplex crystal digital PCR for the detection of genotypes I and II African swine fever virus. Front Vet Sci. 2024;11:1351596.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDing L, Ren T, Bing G, Wang Z, Wang B, Ni J, Liu Y, Zhao R, Zhu Y, Li F, et al. Establishment of a Triplex qPCR Assay for Differentiating Highly Virulent Genotype I Recombinant Virus From Low-Virulence Genotype I and Genotype II African Swine Fever Viruses Circulating in China. Transbound Emerg Dis. 2024;2024(1):6206857.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReed LJ, Muench H. A simple method of estimating fifty percent endpoints. Am J Hygiene. 1938;27(3):5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYou S, Liu T, Zhang M, Zhao X, Dong Y, Wu B, Wang Y, Li J, Wei X, Shi B. African swine fever outbreaks in China led to gross domestic product and economic losses. Nat Food. 2021;2(10):802\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou X, Li N, Luo Y, Liu Y, Miao F, Chen T, Zhang S, Cao P, Li X, Tian K, et al. Emergence of African Swine Fever in China, 2018. Transbound Emerg Dis. 2018;65(6):1482\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalling M. Assessing the price effects of African swine fever in the China market. Explor Foods Foodomics. 2025;2025(3):101064.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun AJ, Wang R, Zhu XJ, Meng ZK, Liu SY, Zhang S, Jin JX, Zhang GP, Zhuang GQ. Review on African swine fever⁃associated detection and pig farm biosecurity control measurement development. Chin J Vet Sci. 2021;41(5):1023\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUrbano AC, Ferreira F. African swine fever control and prevention: an update on vaccine development. Emerg Microbes Infect. 2022;11(1):2021\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDanzetta ML, Marenzoni ML, Iannetti S, Tizzani P, Calistri P, Feliziani F. African Swine Fever: Lessons to Learn From Past Eradication Experiences. A Systematic Review. Front Vet Sci. 2020;7:296.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHwang HJ, Choi YS, Song K, Frant M, Kim JH. Development and validation of a fast quantitative real-time PCR assay for the detection of African swine fever virus. Front Vet Sci. 2022;9:1037728.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao Q, Feng Y, Yang Y, Luo Y, Gong T, Wang H, Gong L, Zhang G, Zheng Z. Establishment of a Dual Real-Time PCR Assay for the Identification of African Swine Fever Virus Genotypes I and II in China. FrontiersVet Sci. 2022;9:882824.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGe S, Zuo Y, Han N, L\u0026uuml; Y, Qu H, Lu H, Wu X, Wang Z. Advances in Researches on African Swine Fever Virus Genotyping and Serogrouping. China Anim Health Inspection. 2022;39(9):97\u0026ndash;104.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePhadphon P, Sonthirod C, Thaweerattanasinp T, Shearman JR, Saenboonrueng SUT, Wanitchang J, Tangphatsornruang A, Jongkaewwattana S, Pootakham A. Hairpin loop to hairpin loop: a full-length assembly of the ASFV genome using Oxford Nanopore long-read sequencing. Front Microbiol. 2025;16:1615977.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang J-W, Niu D, Liu K, Wang Q, Ma L, Chen C-C, Zhang L, Liu W, Zhou S, Min J, et al. Structure basis of non-structural protein pA151R from African Swine Fever Virus. Biochem BiophResCo. 2020;532(1):108\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Xie Z, Li Y, Song Y, Di D, Liu J, Gong L, Chen Z, Wu J, Ye Z, et al. Evaluation of an I177L gene-based five-gene-deleted African swine fever virus as a live attenuated vaccine in pigs. Emerg Microbes Infect. 2022;12(1):e2148560.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Cui S, Xin T, Wang X, Yu H, Chen S, Jiang Y, Gao X, Jiang Y, Guo X, et al. African Swine Fever Virus MGF360-14L Negatively Regulates Type I Interferon Signaling by Targeting IRF3. Front Cell Infect Microbiol. 2022;11:818969.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAguero M, Fernandez J, Romero L, Sanchez Mascaraque C, Arias M, Sanchez-Vizcaino JM. Highly sensitive PCR assay for routine diagnosis of African swine fever virus in clinical samples. J Clin Microbiol. 2003;41(9):4431\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"African swine fever virus, genotype I, genotype II, genotype I/II recombinant; real-time quantitative PCR","lastPublishedDoi":"10.21203/rs.3.rs-8879756/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8879756/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAfrican swine fever (ASFV) leads a highly contagious and lethal hemorrhagic disease, causing a huge economic loss to the global pig industry. Recently, lethal genotype I/II recombinants were isolated and characterized in China and Vietnam. To differentiate the three genotypes (I, II and I/II recombinants) of ASFV in China, a triplex quantitative PCR (qPCR) assay was developed by targeting \u003cem\u003eB646L, A151R\u003c/em\u003e and \u003cem\u003eMGF360-14L\u003c/em\u003e genes. The detection limitation for the \u003cem\u003eA151R, MGF360-14L\u003c/em\u003e, and \u003cem\u003eB646L\u003c/em\u003e genes were 10 copies/\u0026micro;l, demonstrating a high sensitivity. Meanwhile, no cross-reactivity was observed with nucleic acids from ASFV genotype I and II or other swine viruses, confirming a high specificity for this assay. The coefficient of assay variation was below 2%, indicating an excellent repeatability. Importantly, when piglets were challenged with ASFV genotype I/II recombinant virus, the method could be used to detect the virus shedding as early as 3 dpi. In summary, a highly sensitive and specific detection method was established, which holds significant potential for rapid diagnosis and early warning of ASFV genotype I/II recombinant infection.\u003c/p\u003e","manuscriptTitle":"Establishment of triplex real-time quantitative PCR assay for African swine fever virus genotype I/II recombinants","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-10 18:14:48","doi":"10.21203/rs.3.rs-8879756/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-03-24T04:59:06+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-21T20:06:00+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-17T06:12:31+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"218986475587086322868721794008410720996","date":"2026-03-14T06:35:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"231902361240198026756873842843041319868","date":"2026-03-05T01:23:22+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"270682086891078274879101286377632378388","date":"2026-03-04T20:35:53+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-04T20:28:42+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-04T20:25:57+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-03-04T05:50:57+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-03T16:38:34+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Veterinary Research","date":"2026-03-03T10:10:20+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7ed72419-c067-4744-80f5-29a9a686d1dc","owner":[],"postedDate":"March 10th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-15T04:24:23+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-10 18:14:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8879756","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8879756","identity":"rs-8879756","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}