Effects of dietary betaine supplementation on reproductive performance of tibetan chickens and serum lipid metabolism-related indexes of its offspring

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract The purpose of this study was to investigate the effects of dietary betaine supplementation on reproductive axis-related hormones, relative gene expression levels, offspring growth performance and lipid metabolism in Tibetan chickens. A total of 180 30-week-old laying Tibetan chickens were randomly assigned to three dietary treatments with six replicates per treatment (10 hens per replicate). The control diet consisted of corn-soybean meal, whereas Experimental Groups 1 and 2 received diets containing 1 g/kg and 3 g/kg betaine supplementation, respectively. After one week of environmental adaptation, the formal experiment proceeded for seven consecutive weeks. The results showed that betaine significantly increased the number of large white follicles and total follicles of Tibetan chickens, and up-regulated the gonadotropin-releasing hormone mRNA expression in the hypothalamus of Tibetan chickens ( P  < 0.05). The content of follicle-stimulating hormone and luteinizing hormone in serum of 3 g/kg group was significantly improved by the betaine compared with other groups ( P  < 0.05). The relative expression of genes for estrogen receptor β, follicle-stimulating hormone receptor and luteinizing hormone receptor in the ovary was significantly up-regulated in the 3 g/kg group compared with the control group ( P  < 0.05). Betaine significantly promoted hatching weight, liver index and the content of total cholesterol in the serum of the Tibetan chicken offspring ( P  < 0.05). In conclusion, the dietary supplement betaine can promote the reproductive performance of Tibetan chickens and regulate hepatic lipid metabolism in offspring of Tibetan chickens.
Full text 159,253 characters · extracted from preprint-html · click to expand
Effects of dietary betaine supplementation on reproductive performance of tibetan chickens and serum lipid metabolism-related indexes of its offspring | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effects of dietary betaine supplementation on reproductive performance of tibetan chickens and serum lipid metabolism-related indexes of its offspring Nawei Jike, Zhichao Hei, Weimei Ma, Yuxing Chen, Yongliang Zhang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8212700/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 12 Mar, 2026 Read the published version in Tropical Animal Health and Production → Version 1 posted 4 You are reading this latest preprint version Abstract The purpose of this study was to investigate the effects of dietary betaine supplementation on reproductive axis-related hormones, relative gene expression levels, offspring growth performance and lipid metabolism in Tibetan chickens. A total of 180 30-week-old laying Tibetan chickens were randomly assigned to three dietary treatments with six replicates per treatment (10 hens per replicate). The control diet consisted of corn-soybean meal, whereas Experimental Groups 1 and 2 received diets containing 1 g/kg and 3 g/kg betaine supplementation, respectively. After one week of environmental adaptation, the formal experiment proceeded for seven consecutive weeks. The results showed that betaine significantly increased the number of large white follicles and total follicles of Tibetan chickens, and up-regulated the gonadotropin-releasing hormone mRNA expression in the hypothalamus of Tibetan chickens ( P < 0.05). The content of follicle-stimulating hormone and luteinizing hormone in serum of 3 g/kg group was significantly improved by the betaine compared with other groups ( P < 0.05). The relative expression of genes for estrogen receptor β, follicle-stimulating hormone receptor and luteinizing hormone receptor in the ovary was significantly up-regulated in the 3 g/kg group compared with the control group ( P < 0.05). Betaine significantly promoted hatching weight, liver index and the content of total cholesterol in the serum of the Tibetan chicken offspring ( P < 0.05). In conclusion, the dietary supplement betaine can promote the reproductive performance of Tibetan chickens and regulate hepatic lipid metabolism in offspring of Tibetan chickens. Tibetan chicken Betaine Reproductive performance Offspring development Lipid metabolism Figures Figure 1 Figure 2 Introduction Tibetan chicken is a small primitive local breed traditionally and extensively raised in Tibetan plateau region of China. It shows excellent adapting to plateau environment and crude feed tolerance. In 2006, it was listed as a national animal and poultry-protected breed (Yin et al. 2008 ). Tibetan chicken grows in the plateau environment, 2200 meters above sea level. The eggs and meat of Tibetan chicken are considered to be natural and nutritious. Compared with common varieties, they have higher nutritional value and delicious taste and are deeply loved by consumers. They have great development and utilization value (Chen et al. 2009 ). It has been reported that laying hens can produce 250 eggs per year (Jiang et al. 2020 ). However, Tibetan chickens produce an average of about 40 to 80 eggs per year, and only 120 if the breeding environment is very good (Jayang et al. 2021). The reproductive capacity of Tibetan hens is weak and the egg production performance of laying is also low, so it is very important to find green feed additives that can improve the laying performance of Tibetan chickens. Betaine was found in Europe, and originally isolated from sugar beet molasses, therefore it was called betaine (Bao et al. 1989 ). The molecular formula of betaine is C 5 H 11 NO 2 , which is similar to choline and methionine. Betaine was originally used as a food attractant for aquatic animals. More and more studies have found that it has various physiological functions in animals. At present, betaine, as a feed additive, has been studied and applied at home and abroad, and has been an economical alternative to methionine and choline in poultry nutrition (Wang et al. 2025 ). The hypothalamus-pituitary-gonad reproductive axis often regulates the reproductive performance of animals in vivo. Betaine supplementation from five days pre-farrowing through lactation cessation may shorten the weaning-to-estrus interval and enhance sow reproductive efficiency (Ramis et al. 2011 ). Moreover, in the progression and maturation of progeny,an instrumental role is fulfilled by betaine. Supplementing betaine in pregnant sows' diet significantly increased plasma catalase and glutathione peroxidase activities in newborn piglets (Mou et al. 2017). Dietary betaine supplementation exhibited dual effects, demonstrating potent antioxidant activity while concurrently improving litter weight in offspring (Qian et al. 2000; Ven Wettere et al. 2013 ; Jia et al. 2015 ). The nutrition of the fertilized eggs is crucial for post-hatch growth. Studies have found that betaine was injected before hatching the fertilized eggs, alleviating the chicken's CORT-induced fatty liver through epigenetic and glucocorticoid receptor-mediated regulation of mitochondrial β-oxidation and oxidative phosphorylation genes (Hu et al. 2017 ). Moreover, increasing betaine in laying hens' summer diet enhanced both egg production and quality (Ding et al. 2025). Anthropological studies have further revealed an association between betaine content in breast milk and the long-term metabolic health of offspring, manifested through increased intestinal goblet cell counts, reduced adiposity, and improved glucose homeostasis in adulthood. (Ribo et al. 2021 ). In addition, the dietary betaine hydrochloride supplementation in sow diets can also enhance intestinal morphology development, improve immunity, and alter the intestinal microbiota of suckling piglets (Azad et al. 2021). Cholesterol is an important component of cells and is crucial for the development of embryos. Previous studies have shown that hepatic lipid metabolism in the offspring of betaine-treated sows involves DNA methylation and histone modification (Cai et al. 2015). In addition, Dietary supplement of 3000 mg/kg betaine can regulate the lipid metabolism of Tibetan chicken by down-regulated the expression of fat synthesis-related genes and inhibiting fatty acid synthesis (Yao et al. 2021 ). Also, in ovo injection of betaine mediates epigenetic regulation of hepatic cholesterol metabolism in newly hatched chicks (Hu et al. 2015 ). However, there is no report on the effect of dietary betaine on fat metabolism in offspring of Tibetan chickens, which needs further study. Betaine is a natural constituent of common feed ingredients, including wheat bran and various cereal grains, which is low in bioavailability. Most animals can synthesize choline in vivo, but the amount and speed of synthesis cannot meet their biological needs. Therefore, adding betaine to the feed of Tibetan chickens to explore its influence and mechanism of reproductive performance of Tibetan chickens and the growth, fat metabolism of offspring of Tibetan chickens. This research is not only conducive to finding ways to improve the reproductive performance of Tibetan chickens but also conducive to providing data support for exploring the mechanism of the effects of betaine on reproductive performance of poultry. Materials and methods Experimental Animals and Design A total of 180 30-week-old laying began breeder chickens(Tibetan chickens that grow on the plateau at an altitude of 3 800 meters have been domesticated in the plains for 9 years) were raised at the Jungle Tibetan Chicken Breeding Farm (Pengzhou, 32°96′9455 North, 103°91′0802 East, 596 m above sea level) with similar body weight were randomly divided into three treatment groups, each comprising six replicates. Every replicate contained ten chicks that were raised in a single cage. The size of an individual cage is 146 cm(length) ×153 cm(width) × 58 cm(height). The 18 floor pens were divided into 6 blocks based on their locations in the chicken house (3 pens/block). The basal diet was supplemented with betaine at 1 and 3 g/kg for experimental Groups 1 and 2, respectively, whereas the control group received the unsupplemented basal diet. The birds were maintained on a 16 L: 8 D photoperiod with an incandescent lamp of 15 lx/m 2 . The temperature in the chicken house was 21 ± 1.5℃, and the humidity was 60%. Feed intake and mortality were recorded daily. Tibetan chickens were weighed and recorded weekly in a repeat cage. Preventive immunization was carried out according to routine procedures. The preparatory experiment period was one week, and the experimental period was seven weeks. The basal diet was formulated according to the NRC (1994; Table 1 ). The study was approved by the Academic Ethics and Integrity Committee of Southwest Minzu University(Permit number: SMU-202501218) and conducted according to the Regulations of the Experimental Animal Administration issued by the State Committee of Science and Technology of the People’s Republic of China. Table 1 Ingredient composition and nutrient content of the basal diet (Air-dried Basis). Items Content(%) Ingredients Corn 63.00 Soybean meal 22.00 soybean oil 1.01 Corn gluten meal 1.00 Limestone 9.50 Calcium hydrophosphate 2.00 Salt 0.40 Methionine 0.19 Premix 1 0.90 Total 100.00 Calculated nutrient levels 2 Apparent metabolisable energy(MJ/kg) 11.26 Crude protein 15.59 Calcium 4.17 Total phosphorus 0.75 Available phosphorus 0.56 Lysine 0.87 Methionine 0.43 1 Premix provided per kilogram of diet: vitamin A 7000 IU, vitamin D 30000 IU, vitamin E 5 IU, vitamin K 0.5 IU, vitamin B 1 0.8 mg, vitamin B 2 2 mg, D-pantothenic acid 2.2 mg, nicotinic acid 20 mg, vitamin B 6 3.0 mg, biotin 0.10 mg, folic acid 0.25 mg, vitamin B 12 0.004 mg, choline 500 mg, Mn(as manganese sulfate)60 mg, I(as potassium iodide)0.35 mg, Fe(as ferrous sulfate)60 mg, Cu(as copper sulfate)8 mg, Zn(as zinc sulfate)80 mg, Se(as sodium selenite)0.30 mg. 2 Nutrient levels were analyzed values Table 1 Sample Collections and Preparations Upon completion of the trial, two Tibetan chickens per replicate were euthanized via cervical dislocation. Blood collected from the jugular vein (5 mL per bird) was centrifuged at 3,000 × g for 15 min at 4°C. The resulting serum was stored at -20°C pending subsequent biochemical analysis. The birth vagina and ovary were weighed, and the number of follicles was recorded according to classification, the hypothalamus and ovary were taken and stored in the refrigerator at -80℃ for subsequent analysis. Follicular classification criteria: diameter > 10 mm for grade follicular; Large white follicular with a diameter of 2 to 5 mm. Determination of reproductive hormones At the end of the feeding experiment, two female Tibetan chicken from each replicate were randomly selected and their blood was collected from jugular veins, and then they were euthanized. Blood samples (5 mL each) were taken from the jugular vein and centrifuged at 3,000 g at 4℃ for 15 min. Then the serum was stored at -20℃ for further analysis. The plasma concentrations of follicle-stimulating hormone (FSH, 101-1-2), luteinizing hormone (LH, H206-1-2), estradiol (E2, H102-1-2), and progesterone (P4, H089) were measured using commercial ELISA kits (Shanghai BIUE GENE Biotechnology Co., LTD) according to the manufacturer's instructions. Total RNA Isolation and Real-time PCR Total RNA was extracted by TRIzol reagent of TianGen Company. The extracted total RNA was detected by a micro-spectrophotometer and stored at -80°C in an ultra-low temperature freezer. We detected the relative expression of gonadotropin-releasing hormone (GnRH) in the hypothalamus, as well as the genes for follicle-stimulating hormone receptor (FSHR), luteinizing hormone receptor (LHR), prolactin receptor (PRLR), and estrogen receptor beta (ESRβ) in the ovary. Real-time fluorescence quantitative analysis was performed on Line Gene 9600 fluorescence quantitative PCR system using TB Green™ Premix Ex Taq™ II (Til RNase Plus) kit (Dalian Bao Biological Co., Ltd.). The primers were synthesized by Jinweizhi Biological Co., Ltd. The primer sequence design is shown in Table 2 . The reaction system is 10 µL. A two-step method was used in the PCR reaction. The reaction procedure was: at 95℃ for 30 s, denatured at 95℃ for 10 s, annealed at 60℃ for 30 s and 40 cycles; estrogen receptor beta and prolactin receptor were denatured at 95℃ for 30 s, denatured at 95℃. Using β-actin as the internal reference gene, the relative gene expression was calculated by the 2 −△△Ct method. Table 2 Gene primer sequences information. Target genes Primer sequences (5′to3′) GenBank accession β-actin F: TGCGTGACATCAAGGAGAAG NM-205518 R:TGCCAGGGTACATTGTGGTA GnRH F:GTCTGTGGAAATCTGCTTGGCTC DQ023158 R: CAGACTTGCCATGGCTTCCTTCA FSHR F:CGGCTACGGAAATGCTATGA EF621308 R:GCACTTGATCTTCTGAATTGCG LHR F: TTCATCTGCCAGGAGATCAAG NM-205079 R:CAGAAGTCCTGTGAAAGATC ESRβ F: GGCTACGGAAATGCTATGAA Ab036415.1 R: GACTGACTGTGCTGAGGAGG PRLR F:TACAACATTACTGTCAGGGCAACTA NM-204854 R:AACGATCCACACAATCATATCTTTT Table 2 Collection of egg laying and artificial fertilization In the sixth week of the normal feeding period, 26-week-old roosters were selected to be reared alone, given 15 h light every day, and familiar with the method of massaging dorsi once every 2 to 3 days to collect semen. At the seventh week of the feeding period, the roosters were deprived of water and feed for 3 ~ 4 hours, and scrubbed the anus with distilled water, then wiped the anus with alcohol cotton balls, and then collected semen with the dorsum abdominal method. After semen collection, semen quality was identified and pollution-free semen was selected to make a mixed solution. The method of intravaginal insemination was performed with fresh semen after the hen's cloaca was everted, and 1mL of diluted mixed semen (effective sperm count of 200 million) was injected into the hen's vagina from 4 to 5 p.m. Seven eggs from each replicate were selected for routine incubation. After disinfection, the eggs were incubated in the incubator under the conditions of 37.6 ~ 38.2℃ and 60%~75% relative humidity. In the early, middle and late stages of incubation, the incubator temperature and relative humidity were adjusted according to the incubation requirements. The hatching time was calculated by recording the time from the 24 h of begin with hatching and the time of chicken emergence. Calculated the chick time by recording the chick start time and the chick birth time. During the incubation of the eggs, the number of hatched out of eggs, dead embryos, and unfertilized eggs were recorded. On the 21st day of hatching, after being weighed and slaughtered, blood was collected, and breast, leg muscles, heart, and liver tissues were collected and weighed (same method as above for Tibetan hens). Fertilization rate (%) = 100× number of fertilized eggs/number of incubated eggs; Hatchability (%) = 100× number of brood/number of fertilized eggs. Determination of the birth weight and serum lipid metabolism-related indexes in offspring Meanwhile, after the Tibetan chicken eggs had hatched, the chicks were one day old. One of these chicks (close to the average body weight of the chicks in the pen) was slaughtered for jugular vein blood collection. For each group, two birds were sampled per replicate, resulting in a total of ten birds per group. After collection, the blood was kept at room temperature for 1 ~ 2 hours and centrifuged at 3000 rpm for 15 minutes. The supernatant was taken and placed at -20℃ for storage. The serum sample was determined by blood biochemical index, which included Total protein (TP, A095-1-1), total cholesterol (T-CHO, A111-1-1), triglyceride (TG, A110-1-1), low-density lipoprotein (LDL, A113-1-1), and high-density lipoprotein (HDL, A112-1-1) (Nanjing Jiancheng Institute of Bioengineering, Nanjing, Jiangsu, P. R. China) following the manufacturer’s instructions to detect. The pectoral muscles (muscles attached to the forelimbs located on the floor wall of the chest cavity) and leg muscles (muscles below the kneecap and above the ankle) were stripped, and fascia and bone were removed and weighed with electronic balance. The liver and heart were cut and weighed. The tissue or organ index was calculated according to the following formula: tissue/organ index (g/kg) = tissue weight/body weight Statistical Analysis Statistical analyses were carried out with SPSS 20.0 for Windows, the T-test was used to analyze the relative expression of mRNA in reproductive axis-related genes among groups, fertilization rate, and hatchability by χ 2 test, and the other indicators were analyzed by single-factor analysis of variance. Duncan’s method was used for multiple comparisons. P < 0.01 was considered a significant difference. Data are presented as the mean ± SEM. Results Reproductive hormones Table 3 showed that dietary betaine had no significant effect on E2 and P4 in the serum of Tibetan chickens ( P > 0.05). The content of FSH of serum in experimental group 2 was significantly higher than that of experimental group 1 and the control group ( P < 0.05), and the content of LH in experimental group 1 was significantly higher than that of experimental group 2 and the control group ( P < 0.05) Table 3 Effects of dietary betaine supplementation on reproductive Hormones in serum of Tibetan Chickens. Items Control 1 g/kg 3 g/kg P-value FSH(ng/mL) 27.36 ± 7.03 a 31.01 ± 5.23 a 42.93 ± 8.45 b 0.042 E2(pg/mL) 435.64 ± 67.37 426.53 ± 126.36 521.7 ± 87.92 0.684 LH(ng/mL) 1.54 ± 0.01 a 1.56 ± 0.01 b 1.54 ± 0.02 a 0.044 P4(ng/mL) 2.11 ± 0.02 2.12 ± 0.03 2.12 ± 0.02 0.308 Note: 1 In the same line means within a row lacking a common superscript differ ( P 0.05), and values with different letters are significantly different for all possible combinations of these different groups ( P < 0.05). The same as below. 2 FSH: follicle-stimulating hormone; LH: luteinizing hormone; E2: estradiol; P4: progesterone. Table 3 Apparent Indicators of Reproductive Performance Table 4 showed that dietary betaine had no significant effect on the weight of the oviduct and ovary ( P > 0.05). There was no significant difference in grade follicle between the groups 1 and 2 compared with the control group ( P > 0.05). However, the total number of large white follicle and follicle in the experimental groups 1 and 2 was significantly higher than that of the control group ( P 0.05) Table 4 Effects of dietary betaine supplementation on apparent reproductive performance of Tibetan Chickens. Items Control 1 g/kg 3 g/kg P-value Vagina weight (g) 31.48 ± 11.3 28.73 ± 8.65 30.47 ± 4.02 0.768 Ovarian weight (g) 34 ± 14.10 33.04 ± 5.91 27.48 ± 10.20 0.346 Total follicle number 17.47 ± 3.87 a 21.61 ± 5.70 b 22.59 ± 8.27 b < 0.010 Grade follicle 3.9 ± 0.57 3.4 ± 1.07 4.2 ± 1.55 0.299 Large white follicle 9.3 ± 4.62 a 13.5 ± 3.13 b 14 ± 6.70 b 0.038 Fertilization rate (%) 90.00 92.50 90.00 0.916 Hatching rate (%) 88.13 85.83 85.62 0.852 Incubation time (h) 475.76 ± 7.27 471.21 ± 4.56 474.53 ± 5.76 0.309 Note: 1 In the same line means within a row lacking a common superscript differ ( P 0.05), and values with different letters are significantly different for all possible combinations of these different groups ( P < 0.05). The same as below. 2Vagina weight(g): It's the last part of the fallopian tube opening on the left side of the back of the cloaca; Ovarian weight (g): Including follicular base, follicle, follicular zone and follicular membrane composition size and color: >10 mm, grade follicles; 4–10 mm, small yellow follicles; 2–4 mm, large white follicles. Fertilization rate (%) = 100× number of fertilized eggs/number of incubated eggs; Hatchability (%) = 100× number of brood/number of fertilized eggs. Incubation time (h): Calculate the time from 24 hours when the eggs enter hatching to the time when the chicks emerge from the shell. Table 4 Reproduction-related gene expression From Fig. 1 , dietary betaine in experimental groups 1 and 2 significantly up-regulated the relative expression of GnRH gene in the hypothalamus of Tibetan chickens compared to the control group. Figure 1 From Fig. 2 , in ovaries, the relative expression of ESRβ and FSHR genes in experimental group 2 were significantly up-regulated, compared with the control group ( P < 0.05), and the relative expression of LH gene in experimental group 1 was up-regulated significantly, compared with the control group ( P 0.05) Figure 2 Effects of dietary betaine supplementation of Tibetan chickens on growth performance and serum biochemical indicators of its offspring As shown in Table 5 , the hatch weight and liver index of chicks in the experimental 2 groups were significantly higher than that of the control group and experimental 1 group ( P 0.05) Table 5 Effects of dietary betaine supplementation of Tibetan chickens on birth weight and tissue/ organ index of offspring. Items Control 1 g/kg 3 g/kg P-value Hatch weight (g) 30.05 ± 2.4 a 28.50 ± 1.65 a 32.90 ± 2.64 b 0.001 Chest muscle index(%) 3.35 ± 1.33 3.87 ± 0.97 3.30 ± 1.22 0.499 Leg muscle index(%) 3.48 ± 0.03 3.69 ± 0.52 3.87 ± 0.36 0.250 Liver index(%) 42.07 ± 4.85 a 38.21 ± 4.83 a 49.81 ± 5.95 b 0.010 Heart index(%) 8.42 ± 0.83 8.96 ± 0.97 9.15 ± 0.99 0.239 Note: 1 In the same line means within a row lacking a common superscript differ ( P 0.05), and values with different letters are significantly different for all possible combinations of these different groups ( P < 0.05). The same as below. 2Hatch weight (g): the chick weighs out of its shell 3Pectoral muscle index (%) = Chest muscle weight /hatch weight(mg/g); Leg muscle index (%) = Leg muscle weight/hatch weight(mg/g); Liver index (%) = Liver weight/hatch weight(mg/g); Heart index (%) = Heart weight/hatch weight(mg/g); Table 5 As shown in Table 6 , dietary betaine supplementation of Tibetan chickens significantly increased serum T-CHO content of offspring ( P 0.05) Table 6 Effects of dietary betaine supplementation of Tibetan chickens on serum lipid metabolism-related indexes of offspring. Items Control 1 g/kg 3 g/kg P-value TP(g/L) 23.56 ± 0.86 23.26 ± 1.03 24.30 ± 1.54 0.658 T-CHO(mmol/L) 1.98 ± 0.25 a 2.46 ± 0.30 b 2.37 ± 0.23 b 0.030 TG(mmol/L) 2.57 ± 0.23 3.07 ± 0.66 # 2.12 ± 0.84 0.099 LDL(mmol/L) 3.05 ± 0.73 3.28 ± 0.17 3.27 ± 0.41 0.428 HDL(mmol/L) 1.97 ± 0.17 1.92 ± 0.19 2.18 ± 0.34 0.235 Note: 1 In the same line means within a row lacking a common superscript differ ( P 0.05), and values with different letters are significantly different for all possible combinations of these different groups ( P < 0.05). The same as below. 2TP: Total protein; T-CHO: total cholesterol; TG: triglyceride; LDL: low-density lipoprotein; HDL: high-density lipoprotein. Table 6 Discussion The mechanism of betaine improving laying performance is multifaceted. First, Betaine acts as a methyl donor, which reduces blood homocysteine levels by remethylating homocysteine to methionine in the presence of homocysteine methyltransferase (Chen et al. 2020 ). Therefore, adding betaine indirectly increases methionine's content and provides more nutrients for the body. It was found that betaine could replace 25% of methionine, which was beneficial to the growth of broilers (Sun et al. 2008). Replacing 25% DL-methionine with betaine in broiler feed does not affect broiler performance and could improve the apparent utilization rate of crude protein (Su et al. 2015 ). Dietary betaine supplementation can promote the growth performance of broilers (Leng et al. 2016 ; Mendoza et al. 2017 ; Chen et al. 2018 ). Second, betaine can increase the release of hormones related to the reproductive axis by trans-methylation, thus promoting the formation and development of follicles (Zou et al. 2001). Third, betaine may enhance fat metabolism and oxidation by increasing the carnitine content in the body, thereby enhancing the fat transport and oxidation of laying hens, and improving the efficiency of laying eggs and feed conversion. Fourth, betaine may also improve laying performance by alleviating heat stress in laying hens. Poultry is a relatively sensitive animal, with a strong response and stress to environmental stimuli. Studies have shown that betaine positively affects broilers' growth performance under stressful conditions (Wen et al. 2019 ; Chen et al. 2020 ). Dietary betaine supplementation can regulate the body fluid balance of laying hens under heat stress and increase egg production. It stabilized the metabolic balance and physiological regulation of chickens during the laying period, thus further reducing the influence of the environment on laying performance. Dietary betaine supplementation alleviates heat stress in broilers by improving intestinal health. This improvement is achieved through the regulation of cytokine synthesis and up-regulation of tight junction-associated genes (Alhotan et al. 2021 ). Moreover, In-ovo betaine injection enhanced intestinal morphology by improving jejunal villus length, villus height-to-width ratio, and absorptive surface area (El-Shater et al. 2024 ). Recent studies show that adding betaine to the diet of laying hens improves their egg production performance. As the literature suggests, dietary betaine supplementation significantly increased the average egg production rate, while daily gain and egg quality were unchanged (Abobaker et al. 2017 ). In our pre-research, finding betaine supplementation in the feed of Tibetan chickens can also significantly improve the egg production rate and tends to reduce the feed-egg ratio. Dietary betaine did not affect production parameters in Tibetan chickens, including feed consumption, average egg weight, feed conversion ratio, and egg breakage rate. (Chen et al. 2018 ). Other studies found that adding 1500 mg/kg betaine to the diet of 55-week-old laying chickens significantly increased the egg production rate by 8.13% (Wang et al. 2009 ). The egg production rate of Tibetan chickens was not as high as that of Wang's experiment, which may be related to the differences among breeds. It has been found that betaine can promote the synthesis of carnitine in vivo (Nakev et al. 2009 ), and carnitine can regulate the secretion of growth and reproductive-related hormones in vivo (Deng et al. 2011 ). This study found that the number of follicle in trial groups 1 and 2 increased significantly. No significant influence of betaine supplementation was observed on the development of reproductive organs in Tibetan chickens. In terms of hatchability, this study found that betaine had no significant effect on fertilization rate, hatchability, and hatching time in fertilized eggs of laying Tibetan chickens. Some studies have found that glucocorticoid injection can significantly improve egg hatching rate and shorten incubation time (Gao et al. 2008). It has also been reported that betaine can regulate the expression of the glucocorticoid receptor (GR) through methylation, so betaine may change the glucocorticoid content in vivo through the regulation of GR to increase the hatching rate. It is possible that the regulation of betaine has a great relationship with the dose of administration, so betaine has no significant effect on the hatchability of Tibetan chickens in this experiment. Our experiment found that betaine significantly increased the total number of large white follicle and follicle in Tibetan chickens, and promoted follicle development. In the later experiments, it was found that the addition of betaine 3 g/kg to Tibetan chicken feed significantly increased the content of follicle estrogen in the blood of Tibetan chickens, and the addition of betaine 1 g/kg significantly increased the luteinizing hormone in the blood of Tibetan chickens. Although it was found that betaine could influence the reproductive hormone level of the Tibetan blood serum, the development of related organs had been completed in the 30-week-old Tibetan chickens, and it wasn’t easy to promote their growth by regulating the level of nutrition and hormones. Therefore, betaine may promote follicle development and growth by regulating of multiple reproductive hormones. Supplementation of 150 g/d (head/day) betaine during the perinatal period can significantly increase milk yield and the birth weight of calves (Du et al. 2021 ). Therefore, animal species may also influence the action effects of betaine. Betaine (trimethylglycine) is a stable compound that serves as a methyl donor for betaine-homocysteine S-methyltransferase. It regulates gene expression by altering the methylation status of target gene promoters (Figueroa-Soto et al. 2018). This study found that with betaine up-regulating the expression of the gonadotropin-releasing hormone (GnRH) gene, the gene expression of LHR in group 1 and FSHR in group 2 was significantly up-regulated. Therefore, the up-regulation of GnRH gene expression may increase the level of GnRH, thereby promoting the release of FSH and LH, and improving the expression level of FSHR and LHR genes in ovaries. However, the expression of FSHR and LHR genes did not change significantly in the low-dose group, which may be because the low-dose betaine has little effect on the reproductive performance of the body. At the same time, the pathway to promote GnRH on betaine may be related to its methyl supply. Betaine promotes the synthesis of methionine through transmethylation but also increases the content of SAM, which can increase the content of N-methyl-D-aspartate (NMDA) in vivo. It was found that GnRH and NMDA were affected by the content of receptors (Abbud R et al. 1995), so the increase of NMDA increased the expression of the NMDA receptor gene, thereby promoting the release of GnRH. At the same time, glycine was produced in the process of betaine transmethylation, and glycine also affected the activation of the NMDA receptor. In this study, we found that 3 g/kg betaine could significantly increase the gene expression of ESRβ in Tibetan chicken’s ovary. Some studies have shown that ESRβ can promote the release of follicles inside and outside the ovary and affect the development of follicle (Pepe G J et al. 2013). Therefore, under a high dose of betaine, Tibetan chickens may affect follicle development and ovulation by increasing the gene expression level of ESRβ in ovaries, thereby improving the laying rate and reproductive performance. Among the hormones related to the reproductive axis, prolactin (PRL) may reduce the secretion of LH in vivo and thus inhibit ovulation and follicle development (Wang et al. 2007). The down-regulation of prolactin receptor gene’s expression can reduce the nesting time of hens and thus increase the number of laying eggs (March J B et al. 1994). This study found that betaine had no significant effect on the PRLR gene expression of ovaries in Tibetan chickens. Therefore, the result showed that betaine promotes the reproductive performance of Tibetan chickens may not be related to PRLR gene expression. Serum metabolites are an important index that reflects the physiological and metabolic status of animals. This study revealed that dietary betaine did not significantly alter total protein levels in Tibetan chickens, suggesting its minimal impact on protein absorption and metabolism. As an important substance for methionine synthesis in vivo, Betaine could increase the serum cholesterol content (Hirche et al. 2006 ). In this study, Tibetan chickens supplemented with 3 g/kg betaine significantly increased the birth weight, liver index and serum total cholesterol content of offspring. Similar to methionine, the increase of serum total cholesterol content of Tibetan chickens by betaine may be related to the activation of cholesterol synthase (Olthof et al. 2005). After 6–24 weeks of supplementation with 4 g/d betaine, adults exhibited elevated plasma T-CHO. In contrast, lipid parameters including LDL, HDL, and TG remained unaffected (Zawieja et al. 2019 ). These findings align with existing experimental data, corroborating reports that associate betaine supplementation with potential adverse effects on blood lipid profiles. Elevated serum cholesterol represents a well-characterized risk determinant for coronary heart disease, as extensively documented in epidemiological studies (Jeong et al. 2018 ). However, betaine supplementation did not affect on blood lipids, whereas a high-dose betaine in the diet decreased total cholesterol levels over time (Atkinson et al. 2009 ). Fish fed diet supplemented with 1.4 g/kg betaine also significantly up-regulated gene expression of fat metabolism in fish liver compared to other groups (Shi et al. 2021 ). Current evidence most strongly supports a mechanism of betaine-induced hepatic lipid export into circulation. The contents of triglyceride, LDL, and high-density lipoprotein in serum are closely related to fat metabolism. Studies document a positive correlation between betaine supplementation dosage and plasma triglyceride elevation in poultry (Ghasemi et al. 2019;Yusuf et al. 2018 ). At the same time, some studies found that 0.2% betaine significantly reduced the serum triglyceride content and significantly increased the serum high-density lipoprotein content (Ma et al. 2015 ). Our findings demonstrate that maternal betaine intake did not significantly influence offspring lipid parameters (TG, LDL-C, HDL-C) in this avian species. It may be that different supplemental doses have other effects on serum triglycerides. On the other hand, the related indexes of fat metabolism in serum of hens may differ from that of their offspring. Interestingly, other studies have shown that betaine supplements can increase serum triglycerides in feed-deprived chicks, possibly due to increased lipid mobilization from both the liver and yolk sac in response to energy demand (Al-Sagan et al. 2021 ). The mechanism by which dietary betaine supplementation does not alter triglycerides is unknown and requires further investigation. Serum cholesterol levels remained unaltered in Hu sheep administered 1 g/d or 3 g/d betaine supplements (Cai et al. 2021). Dietary betaine at 250 ~ 1 000 mg/kg linearly decreased total cholesterol concentration in serum (Wen et al. 2021 ). Notably, HDL concentrations exhibited significant reductions in both the 1 g/kg and 3 g/kg treatment groups. It may be due to the different dosages. The observed discrepancies could potentially stem from variations in metabolic states or dosage inaccuracies, potentially leading to impaired nutrient assimilation. Meanwhile, betaine demonstrates broad-spectrum anti-inflammatory properties against multiple pathologies. Further investigation is required to establish its optimal dosing regimen. Conclusion This study demonstrates that betaine up-regulated the gene expression of hypothalamic GnRH and ovarian ESRβ/FSHR/LHR, thereby enhancing the ovulation. Meanwhile, it increased the large white follicle number and serum FSH/LH levels, futher improving the reproductive performance of Tibetan chicken. In terms of offspring, maternal betaine boosted the hatching weight and liver index, which indicating enhanced embryonic development. Additionally, betaine elevated serum total cholesterol in offspring, suggesting a regulatory role in lipid metabolism. Declarations Author contributions Jike Nawei:Methodology, Data curation, Writing – Original Draft, Writing – review and Editing, Visualization, Project administration. Hei Zhichao : Methodology, Data Curation, Writing – Original Draft, Writing – review and Editing, Visualization, Project administration. Ma Weimei : Methodology, Data Curation, Writing – review and Editing. Chen Yuxing : Data Curation, Writing – Original Draft. Zhang Yongliang : Writing Reviewing and Editing. Sun Yucai : Methodology, Writing Reviewing and Editing. Liu Tingting : Methodology, Writing Reviewing and Editing. Feng Weidong: Resources, Data Curation, Funding acquisition. Rao Kaiqing: Resources, Conceptualization, Funding acquisition. Funding This study was supported by "the Fundamental Research Funds for the Central Universities", Southwest Minzu University (ZYN2025096). Data availability Upon reasonable request, the datasets of this study can be available from the corresponding author. Ethical approval The study was approved by the Academic Ethics and Integrity Committee of Southwest Minzu University(Permit number: SMU-202501218). Competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Conflict of interest The authors declare that they have no conflict of interest. References Abbud R, Smith MS (1995) Do GnRH neurons express the gene for the NMDA receptor? Brain Research. 690(1):117–120. Atkinson W, Slow S, Elmslie J, Lever M, Chambers ST, George PM (2009) Dietary and supplementary betaine: Effects on betaine and homocysteine concentrations in males. Nutr Metab Cardiovasc Dis. 19(11):767–773. Abobaker H, Hu Y, Hou Z, Sun Q, Idriss A A, Omer NA, Zong Y, Zhao R (2017) Dietary betaine supplementation increases adrenal expression of steroidogenic acute regulatory protein and yolk deposition of corticosterone in laying hens. Poultry Science.96(12). Alhotan RA, Sulaiman A, Alharthi AS, Abudabos AM (2021) Protective influence of betaine on intestinal health by regulating inflammation and improving barrier function in broilers under heat stress. Poultry Science. 100(9):101337. Al-Sagan AA, Al-Abdullatif A, Hussein EOS, Saadeldin IM, Al-Mufarrej SI, Qaid M, Albaadani HH (2021) “Effects of Betaine Supplementation on Live Performance, Selected Blood Parameters, and Expression of Water Channel and Stress-Related mRNA Transcripts of Delayed Placement Broiler Chicks.” Frontiers in veterinary science. 7:632101. Azad AK, Gao Q, Ma C, Wang K, Kong X (2022) Betaine hydrochloride addition in Bama mini-pig's diets during gestation and lactation enhances immunity and alters intestine microbiota of suckling piglets. Journal of the Science of Food and Agriculture. Bao WF, Gao SK, Fan ZY, Jiang ZR (1989) Isolation, identification and content determination of betaine in molasses. Journal of Shenyang Pharmaceutical College.01: 16–19(in Chinese). Chen FF, Yang K, Zhao XGAZ, Ren B, Dong P (2009) Tibetan Eggs and the Nutritional Composition of Ordinary Eggs. Journal of Southwest University for Nationalities (Natural Science Edition). 35 (05): 1013–1016(in Chinese). Cai DM (2015) Effects of Betaine on Liver Glucose and Lipid Metabolism in Newborn Piglets and Its Genetic Mechanisms. Nanjing:Nanjing Agricultural University (in Chinese). Cai D, Wang J, Jia Y, Liu H, Yuan M, Dong H, Zhao R (2016) Gestational dietary betaine supplementation suppresses hepatic expression of lipogenic genes in neonatal piglets through epigenetic and glucocorticoid receptor-dependent mechanisms. Biochim Biophys Acta. 1861(1):41–50. Chen R, Zhuang S, Chen YP, Cheng YF, Wen C, Zhou YM (2018) Betaine improves the growth performance and muscle growth of partridge shank broiler chickens via altering myogenic gene expression and insulin-like growth factor-1 signaling pathway. Poultry Sci. 97(12):4297–4305 Chen YX, Zheng YC, Xu YO, Li ZX, Zhang DY, Xiang FC, Rao KQ (2018) Effects of Dietary Betaine on Laying Performance and Egg Quality of Tibetan Chicken. China Poultry. 40(23):23–26. Chen R, Wen C, Gu Y, Wang C, Chen Y, Zhuang S (2020) Dietary betaine supplementation improves the meat quality of transported broilers by altering muscle anaerobic glycolysis and antioxidant capacity. J Sci Food Agric. 100(6):2656–2663. Chen Q, Wang Y, Jiao F, Shi C, Pei M, Wang L, Gong Z (2020) Betaine inhibits Toll-like receptor 4 responses and restores intestinal microbiota in acute liver failure mice. Scientific Reports. 10(1):21850–21853. Deng QH, Jia G, Wang KN (2011) The effects of L-carnitine on sow reproductive performance and its mechanism. Chinese Journal of Animal Husbandry. 47(21): 64–68(in Chinese). Du C, Liang J, Wang YC, Hou MJ, Wu ZH, Bu DP, Zhang WJ (2021) Effects of supplementary feeding rumen bypass methionine, betaine and vitamin B complex on health and performance of perinatal dairy cows. Chinese Journal of Animal Nutrition.33(7):3885–3895(in Chinese). Ding Z, Kim IH (2025) Impact of Betaine Supplementation on Growth Performance, Nutrient Digestibility, Egg Quality, Gas Emissions, and Blood Profile in Laying Hens Under Heat Stress Conditions. Animals (Basel). 15(17):2565. El-Shater SN, Abo-El-Sooud K, Tolba A, Gamal M, Awad MA, Ibrahim M, Tayeh M, Swielim GA (2024) Effect of in-ovo inoculation of betaine on hatchability, serum antioxidant levels, muscle gene expression and intestinal development of broiler chicks. J Anim Physiol Anim Nutr (Berl). 108(4):883–890. Figueroa-Soto CG, Valenzuela-Soto EM (2018) Glycine betaine rather than acting only as an osmolyte also plays a role as regulator in cellular metabolism. Biochimie. 147:89–97. Gao J (2008) Study on the programmed effect of glucocorticoid-induced metabolism in Broilers. Taian: Shandong Agricultural University (in Chinese). Hirche F, Schröder A, Knoth B, Stangl GI, Eder K (2006) Effect of dietary methionine on plasma and liver cholesterol concentrations in rats and expression of hepatic genes involved in cholesterol metabolism. British Journal of Nutrition. 95(5):879–888. Hu Y, Sun QW, Li XL, Wang M, Cai D, Li X, Zhao R (2015) In ovo injection of betaine affects hepatic cholesterol metabolism through epigenetic gene regulation in newly hatched chicks. PloS one. 10(4):0122643. Hu Y, Sun QW, Liu J, Jia YM, Cai D, Idriss AA, Omer NA, Zhao R (2017) In ovo injection of betaine alleviates corticosterone-induced fatty liver in chickens through epigenetic modifications. Sci Rep. 7:40251–402516. Jia Y, Song H, Gao G, Cai D, Yang X, Zha R (2015) Maternal betaine supplementation during gestation enhances the expression of mtDNA-encoded genes through D-loop DNA hypomethylation in skeletal muscle of newborn piglets. Journal of Agricultural & Food Chemistry. 63(46):10152. Jeong SM, Choi S, Kim K, Kim SM, Lee G, Park SJ, Kim YY, Son JS, Yun JM, Park SM (2018) Effect of change in total cholesterol levels on cardiovascular disease among young adults. J Am Heart Assoc. 7(12): 008819. Jiang YJ, Wu JG, Ding L, Shen YS, Mei WD, Wang KY (2020) Investigation and promotion strategy of laying industry in Zhejiang Province. Zhejiang Animal Husbandry and Veterinarian. 45(04):16–20(in Chinese). Jayang Deji (2021) Analysis of technical measures for improving egg production of Tibetan chickens. Livestock and Poultry Industry, 2021, 32(04):74–75. Leng Z, Fu Q, Yang X, Ding L, Wen C, Zhou Y (2016) Increased fatty acid oxidation as a possible mechanism for the fat-reducing effect of betaine in broilers. Animal Sci J. 87(8):1005–1010. March JB, Sharp PJ, Wilson PW, Sang HM (1994) Effect of active immunization against recombinant-derived chicken prolactin fusion protein on the onset of broodiness and photoinduced egg-laying in bantam hens. Journal of Reproduction & Fertility 101(1):227–33. Ma JS, Chang WH, Zhang S, Zheng AJ, Liu GH, Cai HY (2015) Effects of betaine on growth performance, lipid metabolism, and muscle flavor quality of broilers. Chinese Journal of animal nutrition. 27(1):185–195(in Chinese). Mendoza SM, Boyd RD, Ferket PR, Van HE (2017) Effects of dietary supplementation of the osmolyte betaine on growing pig performance and serological and hematological indices during thermos neutral and heat-stressed conditions. J Animal Sci. 95(11):5040–5053. Mou DL (2017) Effects of methyl donor supplementation on reproductive performance and antioxidant capacity of sows during pregnancy. Chengdu:Sichuan Agricultural University(in Chinese). Nakev J, Popova T, Vasileva V (2009) Influence of dietary betaine supplementation on the growth performance and carcass characteristics in male and female growing-finishing pigs. Bulgarian Journal of Agricultural Science. 15(3):263–268. Olthof MR, Verhoef P (2005) Effects of betaine intake on plasma homocysteine concentrations and consequences for health. Current Drug Metabolism. 6(1):15–22. Pepe GJ, Billiar RB, Leavitt MG, Zachos NC, Gustafsson JA, Albrecht ED (2013) Expression of Estrogen Receptors α and β in the Baboon Fetal Ovary. Biology of Reproduction. 66(4):1054–60. Qian LC, Xu ZR (2000) Effects of Betaine on Reproductive Performance of Pregnant Sows. Pig Raising. 1:17–17(in Chinese). Ramis G, Evangelista JN, Quereda JJ, Pallarés FJ, Munoz A (2011) Use of betaine in gilt and sows during lactation: Effects on milk quality, reproductive parameters, and piglet performance. J Swine Health Prod. 19 (4):226–232. Ribo S, Sánchez-Infantes D, Martinez-Guino L, García-Mantrana I, Ramon-Krauel M, Tondo M, Arning E, Nofrarías M, Osorio-Conles Ó, Fernández-Pérez A et al (2021) Increasing breast milk betaine modulates Akkermansia abundance in mammalian neonates and improves long-term metabolic health. Science Translational Medicine, 13(587): eabb0322. Sun H, Yang WR, Yang ZB, Jiang SZ, Zhang GG, Liu L (2009) Effects of betaine substituting methionine on Broilers' growth performance and protein metabolism. Chinese Journal of Cereals and Oils. 24 (09): 90–96(in Chinese). Su Q, Leng ZX, Yang X, Bai JY, Wen C, Zhou YM (2015) Effects of betaine substituting methionine on growth, nutrient metabolism, and serum biochemical indexes of Broilers. Journal of Fujian Agricultural and Forestry University (Natural Science Edition). 44 (04): 396–401(in Chinese). Shi L, Wei L, Zhai H, Ren T, Han Y (2021) An evaluation on betaine and trimethylammonium hydrochloride in the diet of Carassius auratus: Growth, immunity, and fat metabolism gene expression. Aquaculture Reports, 19:100627. Van Wettere WHEJ, Smits RJ, Hughes PE (2013) Methyl donor supplementation of gestating sow diets improves pregnancy outcomes and litter size. Animal Production Science. 53(1):1–7(in Chinese). Wang F (2007) Expression of PRL and PRLR genes in chickens and their relationship with reproductive performance. Nanjing: Nanjing Agricultural University (in Chinese). Wang DP, Wang YH, Xia ZY, Li HY (2009) Effects of betaine on laying performance and egg quality of laying hens in later laying period. Gansu Animal Husbandry and Veterinary Medicine. 39(01):6–8(in Chinese). Wang H, Liu L, He X, Bian G (2025) Effect of betaine on growth performance, methionine metabolism, and methyl transfer in broilers aged 1 to 21 days and fed a low-methionine diet. J Poult Sci. 62:2025010. Wen C, Chen Y, Leng Z, Ding L, Wang T, Zhou Y (2019) Dietary betaine improves meat quality and oxidative status of broilers under heat stress. J Sci Food Agric. 99(2):620–623. Wen C, Chen RY, Ding L, Wang T, Zhou Y (2021) Betaine improves growth performance, liver health, antioxidant status, breast meat yield, and quality in broilers fed a mold-contaminated corn-based diet. Anim Nutr. 7(5):661–666. Yao H, Zheng YC, Li ZX, Tan YP, Wang YH, Chen YX, Xu YO, Xiang FC, Rao KQ (2021) Effects of betaine on lipid metabolism and related gene expression in Tibetan chicken[J]. Animal Husbandry and Veterinary Medicine. 53(07):25–31(in Chinese). Yin GP, Chen GH, Bian L, Silang QZ (2008) Current situation and development ideas of Tibetan chicken in Daocheng County [J]. Livestock and poultry industry. 10: 66–67. Yusuf, Mohamed S, Nabtiti Adel AEl, Hassan Marwa A, Mandour Mostafa A (2018) Supplementary outcomes of betaine on economic and productive performance, some biochemical parameters, and lipoprotein lipase gene expression in finishing male broilers. International Journal of Veterinary Science and Medicine. 6(2):213–218. Zou XT (2001) The endocrine mechanism of betaine promoting laying hens. Chinese Veterinary Journal. 21(3): 300–303(in Chinese). Zawieja EE, Zawieja B, Chmurzynska A (2019) Betaine supplementation moderately increases total cholesterol levels: A Systematic review and meta-analysis. J Diet (Suppl). 18(1):107–115. Supplementary Files data.xlsx Cite Share Download PDF Status: Published Journal Publication published 12 Mar, 2026 Read the published version in Tropical Animal Health and Production → Version 1 posted Reviewers agreed at journal 11 Dec, 2025 Reviewers invited by journal 11 Dec, 2025 Editor assigned by journal 27 Nov, 2025 First submitted to journal 26 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8212700","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":558794678,"identity":"c697be2e-d64d-4a1f-9596-024400ec1c44","order_by":0,"name":"Nawei Jike","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0klEQVRIie3RsQqCQBzH8f9xcC1/nY1CnyAwhEAQn0URmnyAxuIGl8DVwLcIXDu5tQdwaGmxxcFeQHKsyWsLuu/+gf+PP4BO94Mx5yFEj0NIOBVqxIQ0roulSGjGIjViQ+RJDATJcnQVDwMR1UV6owbHZ9NBaK/2U4Qcxi3X1pxz4+yXkHgbMUUoRPXpSOmaG9UCQcTVJGHgSmOg5CKxVSQ4EkRJDhyZIrFwnI/bhHDm+aWrsMUpZrLvMQhJLu9NtwvtSfKRpfqad/Kt0Ol0ur/oBTReQn2PMCKZAAAAAElFTkSuQmCC","orcid":"","institution":"Southwest Minzu University","correspondingAuthor":true,"prefix":"","firstName":"Nawei","middleName":"","lastName":"Jike","suffix":""},{"id":558794679,"identity":"00b5f1f6-bbf7-4f8b-9a78-bd26cc5f9e6e","order_by":1,"name":"Zhichao Hei","email":"","orcid":"","institution":"Southwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"Zhichao","middleName":"","lastName":"Hei","suffix":""},{"id":558794680,"identity":"91630c8f-f1e9-449f-8eb3-31d8cf3e50e8","order_by":2,"name":"Weimei Ma","email":"","orcid":"","institution":"Dingxi Vocational and Technical College","correspondingAuthor":false,"prefix":"","firstName":"Weimei","middleName":"","lastName":"Ma","suffix":""},{"id":558794681,"identity":"48a8db25-d451-4d61-9a41-9e3d4f9c57af","order_by":3,"name":"Yuxing Chen","email":"","orcid":"","institution":"Bureau of Agriculture and Rural Affairs of Jiangyou County","correspondingAuthor":false,"prefix":"","firstName":"Yuxing","middleName":"","lastName":"Chen","suffix":""},{"id":558794682,"identity":"ad625c72-cc22-4017-aeb9-6bee98c3bd7f","order_by":4,"name":"Yongliang Zhang","email":"","orcid":"","institution":"Southwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"Yongliang","middleName":"","lastName":"Zhang","suffix":""},{"id":558794683,"identity":"98e3f89d-c5cd-4fc2-b536-5591f6e662d2","order_by":5,"name":"Yucai Sun","email":"","orcid":"","institution":"Southwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"Yucai","middleName":"","lastName":"Sun","suffix":""},{"id":558794684,"identity":"c0f26666-b5e0-4d42-9913-cb8679b520ee","order_by":6,"name":"Tingting Liu","email":"","orcid":"","institution":"Southwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"Tingting","middleName":"","lastName":"Liu","suffix":""},{"id":558794685,"identity":"97a4ffb7-cc71-4f19-84d4-dc1bdc60f37f","order_by":7,"name":"Weidong Feng","email":"","orcid":"","institution":"Ganzi Tibetan Autonomous Prefecture Animal Husbandry Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Weidong","middleName":"","lastName":"Feng","suffix":""},{"id":558794686,"identity":"d50dd9c0-3ca3-48c8-8cfd-2965b149df74","order_by":8,"name":"Kaiqing Rao","email":"","orcid":"","institution":"Southwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"Kaiqing","middleName":"","lastName":"Rao","suffix":""}],"badges":[],"createdAt":"2025-11-26 12:04:53","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8212700/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8212700/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11250-026-04938-6","type":"published","date":"2026-03-12T16:00:22+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":98438582,"identity":"e7d4b254-40c0-4d35-84a7-5e761436a335","added_by":"auto","created_at":"2025-12-17 16:59:33","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":70324,"visible":true,"origin":"","legend":"","description":"","filename":"Figurelegends.docx","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/02bd47667d91d5432bdf5207.docx"},{"id":98437788,"identity":"d91b1c42-24b5-45c4-a5f3-51e4c713241f","added_by":"auto","created_at":"2025-12-17 16:57:47","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11123,"visible":true,"origin":"","legend":"","description":"","filename":"tropTROPD2502316.xml","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/ff3452e702fe540eaa77796a.xml"},{"id":98437780,"identity":"09ad8148-aac0-4c35-b0ba-59268d4fa8bd","added_by":"auto","created_at":"2025-12-17 16:57:45","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1002,"visible":true,"origin":"","legend":"","description":"","filename":"TROPD250231652872.go.xml","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/9ee1039611ab7634055b8f41.xml"},{"id":98335949,"identity":"91e64912-6d50-49af-94a9-44edcaf90195","added_by":"auto","created_at":"2025-12-16 16:21:16","extension":"xml","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":885,"visible":true,"origin":"","legend":"","description":"","filename":"TROPD2502316Import.xml","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/8f63b2b52c1f35ff5327c490.xml"},{"id":98335960,"identity":"90688477-bcd3-4dce-b7cf-b33bc37345a4","added_by":"auto","created_at":"2025-12-16 16:21:16","extension":"xml","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":146309,"visible":true,"origin":"","legend":"","description":"","filename":"TROPD25023160enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/888e572b28a8fed78f4171df.xml"},{"id":98438020,"identity":"dde8f342-a644-49e9-85be-0e4007e02f40","added_by":"auto","created_at":"2025-12-17 16:58:27","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":20414,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/89a26e194a10d1ad153da589.jpeg"},{"id":98438166,"identity":"3deed83d-7d1d-469e-b25a-eb922177713c","added_by":"auto","created_at":"2025-12-17 16:58:44","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":34685,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/5c9496b878c8886b9435dca7.jpeg"},{"id":98335953,"identity":"b4ac26da-c259-4959-a5f0-174ac33e751a","added_by":"auto","created_at":"2025-12-16 16:21:16","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":20414,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/bd869b39c0c5dd117ce93898.jpeg"},{"id":98438979,"identity":"06dac667-bb08-4939-abca-a56f338a037e","added_by":"auto","created_at":"2025-12-17 17:00:37","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":34685,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/32c61ef214ad9641be88299e.jpeg"},{"id":98438535,"identity":"11a11e7d-72cc-437f-9371-34234791c629","added_by":"auto","created_at":"2025-12-17 16:59:27","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7865,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/342dd91e1304f06d10420fa9.png"},{"id":98335951,"identity":"9d779587-0937-449c-9026-7d80f350d076","added_by":"auto","created_at":"2025-12-16 16:21:16","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12320,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/e9b846f1d3cf86b43fed387e.png"},{"id":98438660,"identity":"c7dd6061-e973-4037-9969-f2cb3a947c25","added_by":"auto","created_at":"2025-12-17 16:59:44","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7865,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/50277e4036118564b2b74a31.png"},{"id":98335957,"identity":"2ce84523-297a-4161-82ca-775247daf94f","added_by":"auto","created_at":"2025-12-16 16:21:16","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12320,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/2e388499594f8c9f818672ca.png"},{"id":98335963,"identity":"acb301f0-3e69-48bc-94b1-796e00bb12d5","added_by":"auto","created_at":"2025-12-16 16:21:16","extension":"xml","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":143608,"visible":true,"origin":"","legend":"","description":"","filename":"TROPD25023160structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/670ef1197f03df85ebb9512a.xml"},{"id":98335962,"identity":"485d284c-f689-450d-a72a-d41674f26adf","added_by":"auto","created_at":"2025-12-16 16:21:16","extension":"html","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":153459,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/cbd7e13dac3b4b3bcf556c19.html"},{"id":98335946,"identity":"cb7d8b59-b6b5-49fd-b4b9-7b2c3ed4646f","added_by":"auto","created_at":"2025-12-16 16:21:16","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":37778,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of dietary betaine supplementation on the relative expression of GnRH gene in the hypothalamus of Tibetan chicken.\u003c/p\u003e\n\u003cp\u003eNotes: \u003csup\u003e1\u003c/sup\u003eControl group was a corn-soybean meal-based diet; experimental 1 and 2 group feeds were with betaine supplemented with 1 g/kg and 3 g/kg respectively.\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e2\u003c/sup\u003eGnRH: gonadotropin-releasing hormone.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/e032b2b1bab6299c35d771bb.png"},{"id":98437913,"identity":"ceff7210-f938-4cb8-b23e-67729a05a61d","added_by":"auto","created_at":"2025-12-17 16:58:13","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":59827,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of dietary betaine supplementation on the relative expression of reproductive related genes in the ovaries of Tibetan chickens.\u003c/p\u003e\n\u003cp\u003eNotes:\u003csup\u003e1\u003c/sup\u003eControl group was a corn-soybean meal-based diet; experimental 1 and 2 group feeds were with betaine supplemented with 1 g/kg and 3 g/kg respectively.\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e2\u003c/sup\u003eESRβ: estrogen receptor beta; LHR: follicle-stimulating hormone receptor; PRLR: prolactin receptor; FSHR: follicle-stimulating hormone recept\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/37a3e9f584cbe527ed0d091e.png"},{"id":104739939,"identity":"230f06b5-e16c-44a2-9cd6-0852bf3a772a","added_by":"auto","created_at":"2026-03-16 16:13:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1042610,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/3315530c-42c2-436f-831d-92048e299cbe.pdf"},{"id":98437821,"identity":"17120eb9-3bb2-4e38-96fe-7a05ecae1121","added_by":"auto","created_at":"2025-12-17 16:58:05","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":37162,"visible":true,"origin":"","legend":"","description":"","filename":"data.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8212700/v1/8395ee55d11c4528b4960f85.xlsx"}],"financialInterests":"","formattedTitle":"Effects of dietary betaine supplementation on reproductive performance of tibetan chickens and serum lipid metabolism-related indexes of its offspring","fulltext":[{"header":"Introduction","content":"\u003cp\u003eTibetan chicken is a small primitive local breed traditionally and extensively raised in Tibetan plateau region of China. It shows excellent adapting to plateau environment and crude feed tolerance. In 2006, it was listed as a national animal and poultry-protected breed (Yin et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Tibetan chicken grows in the plateau environment, 2200 meters above sea level. The eggs and meat of Tibetan chicken are considered to be natural and nutritious. Compared with common varieties, they have higher nutritional value and delicious taste and are deeply loved by consumers. They have great development and utilization value (Chen et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). It has been reported that laying hens can produce 250 eggs per year (Jiang et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, Tibetan chickens produce an average of about 40 to 80 eggs per year, and only 120 if the breeding environment is very good (Jayang et al. 2021). The reproductive capacity of Tibetan hens is weak and the egg production performance of laying is also low, so it is very important to find green feed additives that can improve the laying performance of Tibetan chickens.\u003c/p\u003e \u003cp\u003eBetaine was found in Europe, and originally isolated from sugar beet molasses, therefore it was called betaine (Bao et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1989\u003c/span\u003e). The molecular formula of betaine is C\u003csub\u003e5\u003c/sub\u003eH\u003csub\u003e11\u003c/sub\u003eNO\u003csub\u003e2\u003c/sub\u003e, which is similar to choline and methionine. Betaine was originally used as a food attractant for aquatic animals. More and more studies have found that it has various physiological functions in animals. At present, betaine, as a feed additive, has been studied and applied at home and abroad, and has been an economical alternative to methionine and choline in poultry nutrition (Wang et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). The hypothalamus-pituitary-gonad reproductive axis often regulates the reproductive performance of animals in vivo. Betaine supplementation from five days pre-farrowing through lactation cessation may shorten the weaning-to-estrus interval and enhance sow reproductive efficiency (Ramis et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMoreover, in the progression and maturation of progeny,an instrumental role is fulfilled by betaine. Supplementing betaine in pregnant sows' diet significantly increased plasma catalase and glutathione peroxidase activities in newborn piglets (Mou et al. 2017). Dietary betaine supplementation exhibited dual effects, demonstrating potent antioxidant activity while concurrently improving litter weight in offspring (Qian et al. 2000; Ven Wettere et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Jia et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The nutrition of the fertilized eggs is crucial for post-hatch growth. Studies have found that betaine was injected before hatching the fertilized eggs, alleviating the chicken's CORT-induced fatty liver through epigenetic and glucocorticoid receptor-mediated regulation of mitochondrial β-oxidation and oxidative phosphorylation genes (Hu et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Moreover, increasing betaine in laying hens' summer diet enhanced both egg production and quality (Ding et al. 2025). Anthropological studies have further revealed an association between betaine content in breast milk and the long-term metabolic health of offspring, manifested through increased intestinal goblet cell counts, reduced adiposity, and improved glucose homeostasis in adulthood. (Ribo et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In addition, the dietary betaine hydrochloride supplementation in sow diets can also enhance intestinal morphology development, improve immunity, and alter the intestinal microbiota of suckling piglets (Azad et al. 2021). Cholesterol is an important component of cells and is crucial for the development of embryos. Previous studies have shown that hepatic lipid metabolism in the offspring of betaine-treated sows involves DNA methylation and histone modification (Cai et al. 2015). In addition, Dietary supplement of 3000 mg/kg betaine can regulate the lipid metabolism of Tibetan chicken by down-regulated the expression of fat synthesis-related genes and inhibiting fatty acid synthesis (Yao et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Also, in ovo injection of betaine mediates epigenetic regulation of hepatic cholesterol metabolism in newly hatched chicks (Hu et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). However, there is no report on the effect of dietary betaine on fat metabolism in offspring of Tibetan chickens, which needs further study.\u003c/p\u003e \u003cp\u003eBetaine is a natural constituent of common feed ingredients, including wheat bran and various cereal grains, which is low in bioavailability. Most animals can synthesize choline in vivo, but the amount and speed of synthesis cannot meet their biological needs. Therefore, adding betaine to the feed of Tibetan chickens to explore its influence and mechanism of reproductive performance of Tibetan chickens and the growth, fat metabolism of offspring of Tibetan chickens. This research is not only conducive to finding ways to improve the reproductive performance of Tibetan chickens but also conducive to providing data support for exploring the mechanism of the effects of betaine on reproductive performance of poultry.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eExperimental Animals and Design\u003c/h2\u003e \u003cp\u003eA total of 180 30-week-old laying began breeder chickens(Tibetan chickens that grow on the plateau at an altitude of 3 800 meters have been domesticated in the plains for 9 years) were raised at the Jungle Tibetan Chicken Breeding Farm (Pengzhou, 32\u0026deg;96\u0026prime;9455 North, 103\u0026deg;91\u0026prime;0802 East, 596 m above sea level) with similar body weight were randomly divided into three treatment groups, each comprising six replicates. Every replicate contained ten chicks that were raised in a single cage. The size of an individual cage is 146 cm(length) \u0026times;153 cm(width) \u0026times; 58 cm(height). The 18 floor pens were divided into 6 blocks based on their locations in the chicken house (3 pens/block). The basal diet was supplemented with betaine at 1 and 3 g/kg for experimental Groups 1 and 2, respectively, whereas the control group received the unsupplemented basal diet. The birds were maintained on a 16 L: 8 D photoperiod with an incandescent lamp of 15 lx/m\u003csup\u003e2\u003c/sup\u003e. The temperature in the chicken house was 21\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5℃, and the humidity was 60%. Feed intake and mortality were recorded daily. Tibetan chickens were weighed and recorded weekly in a repeat cage. Preventive immunization was carried out according to routine procedures. The preparatory experiment period was one week, and the experimental period was seven weeks. The basal diet was formulated according to the NRC (1994; Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The study was approved by the Academic Ethics and Integrity Committee of Southwest Minzu University(Permit number: SMU-202501218) and conducted according to the Regulations of the Experimental Animal Administration issued by the State Committee of Science and Technology of the People\u0026rsquo;s Republic of China.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eIngredient composition and nutrient content of the basal diet (Air-dried Basis).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eItems\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eContent(%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eIngredients\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCorn\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e63.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e22.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esoybean oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCorn gluten meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLimestone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9.50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCalcium hydrophosphate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSalt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMethionine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePremix\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.90\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eCalculated nutrient levels\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eApparent metabolisable energy(MJ/kg)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11.26\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15.59\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCalcium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.17\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal phosphorus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.75\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAvailable phosphorus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.56\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLysine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.87\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMethionine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.43\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003e\u003csup\u003e1\u003c/sup\u003ePremix provided per kilogram of diet: vitamin A 7000 IU, vitamin D 30000 IU, vitamin E 5 IU, vitamin K 0.5 IU, vitamin B\u003csub\u003e1\u003c/sub\u003e 0.8 mg, vitamin B\u003csub\u003e2\u003c/sub\u003e 2 mg, D-pantothenic acid 2.2 mg, nicotinic acid 20 mg, vitamin B\u003csub\u003e6\u003c/sub\u003e 3.0 mg, biotin 0.10 mg, folic acid 0.25 mg, vitamin B\u003csub\u003e12\u003c/sub\u003e 0.004 mg, choline 500 mg, Mn(as manganese sulfate)60 mg, I(as potassium iodide)0.35 mg, Fe(as ferrous sulfate)60 mg, Cu(as copper sulfate)8 mg, Zn(as zinc sulfate)80 mg, Se(as sodium selenite)0.30 mg.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003e\u003csup\u003e2\u003c/sup\u003eNutrient levels were analyzed values\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eSample Collections and Preparations\u003c/h3\u003e\n\u003cp\u003eUpon completion of the trial, two Tibetan chickens per replicate were euthanized via cervical dislocation. Blood collected from the jugular vein (5 mL per bird) was centrifuged at 3,000 \u0026times; g for 15 min at 4\u0026deg;C. The resulting serum was stored at -20\u0026deg;C pending subsequent biochemical analysis. The birth vagina and ovary were weighed, and the number of follicles was recorded according to classification, the hypothalamus and ovary were taken and stored in the refrigerator at -80℃ for subsequent analysis.\u003c/p\u003e \u003cp\u003eFollicular classification criteria: diameter\u0026thinsp;\u0026gt;\u0026thinsp;10 mm for grade follicular; Large white follicular with a diameter of 2 to 5 mm.\u003c/p\u003e\n\u003ch3\u003eDetermination of reproductive hormones\u003c/h3\u003e\n\u003cp\u003eAt the end of the feeding experiment, two female Tibetan chicken from each replicate were randomly selected and their blood was collected from jugular veins, and then they were euthanized. Blood samples (5 mL each) were taken from the jugular vein and centrifuged at 3,000 g at 4℃ for 15 min. Then the serum was stored at -20℃ for further analysis.\u003c/p\u003e \u003cp\u003eThe plasma concentrations of follicle-stimulating hormone (FSH, 101-1-2), luteinizing hormone (LH, H206-1-2), estradiol (E2, H102-1-2), and progesterone (P4, H089) were measured using commercial ELISA kits (Shanghai BIUE GENE Biotechnology Co., LTD) according to the manufacturer's instructions.\u003c/p\u003e\n\u003ch3\u003eTotal RNA Isolation and Real-time PCR\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted by TRIzol reagent of TianGen Company. The extracted total RNA was detected by a micro-spectrophotometer and stored at -80\u0026deg;C in an ultra-low temperature freezer. We detected the relative expression of gonadotropin-releasing hormone (GnRH) in the hypothalamus, as well as the genes for follicle-stimulating hormone receptor (FSHR), luteinizing hormone receptor (LHR), prolactin receptor (PRLR), and estrogen receptor beta (ESRβ) in the ovary.\u003c/p\u003e \u003cp\u003eReal-time fluorescence quantitative analysis was performed on Line Gene 9600 fluorescence quantitative PCR system using TB Green\u0026trade; Premix Ex Taq\u0026trade; II (Til RNase Plus) kit (Dalian Bao Biological Co., Ltd.). The primers were synthesized by Jinweizhi Biological Co., Ltd. The primer sequence design is shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The reaction system is 10 \u0026micro;L. A two-step method was used in the PCR reaction. The reaction procedure was: at 95℃ for 30 s, denatured at 95℃ for 10 s, annealed at 60℃ for 30 s and 40 cycles; estrogen receptor beta and prolactin receptor were denatured at 95℃ for 30 s, denatured at 95℃. Using β-actin as the internal reference gene, the relative gene expression was calculated by the 2\u003csup\u003e\u0026minus;△△Ct\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGene primer sequences information.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget genes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequences (5\u0026prime;to3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGenBank accession\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGCGTGACATCAAGGAGAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM-205518\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR:TGCCAGGGTACATTGTGGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGnRH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:GTCTGTGGAAATCTGCTTGGCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDQ023158\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CAGACTTGCCATGGCTTCCTTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFSHR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CGGCTACGGAAATGCTATGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eEF621308\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR:GCACTTGATCTTCTGAATTGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eLHR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TTCATCTGCCAGGAGATCAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM-205079\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR:CAGAAGTCCTGTGAAAGATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eESRβ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGCTACGGAAATGCTATGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAb036415.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GACTGACTGTGCTGAGGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePRLR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:TACAACATTACTGTCAGGGCAACTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM-204854\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR:AACGATCCACACAATCATATCTTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u003c/p\u003e\n\u003ch3\u003eCollection of egg laying and artificial fertilization\u003c/h3\u003e\n\u003cp\u003eIn the sixth week of the normal feeding period, 26-week-old roosters were selected to be reared alone, given 15 h light every day, and familiar with the method of massaging dorsi once every 2 to 3 days to collect semen. At the seventh week of the feeding period, the roosters were deprived of water and feed for 3\u0026thinsp;~\u0026thinsp;4 hours, and scrubbed the anus with distilled water, then wiped the anus with alcohol cotton balls, and then collected semen with the dorsum abdominal method. After semen collection, semen quality was identified and pollution-free semen was selected to make a mixed solution. The method of intravaginal insemination was performed with fresh semen after the hen's cloaca was everted, and 1mL of diluted mixed semen (effective sperm count of 200\u0026nbsp;million) was injected into the hen's vagina from 4 to 5 p.m.\u003c/p\u003e \u003cp\u003eSeven eggs from each replicate were selected for routine incubation. After disinfection, the eggs were incubated in the incubator under the conditions of 37.6\u0026thinsp;~\u0026thinsp;38.2℃ and 60%~75% relative humidity. In the early, middle and late stages of incubation, the incubator temperature and relative humidity were adjusted according to the incubation requirements. The hatching time was calculated by recording the time from the 24 h of begin with hatching and the time of chicken emergence. Calculated the chick time by recording the chick start time and the chick birth time. During the incubation of the eggs, the number of hatched out of eggs, dead embryos, and unfertilized eggs were recorded. On the 21st day of hatching, after being weighed and slaughtered, blood was collected, and breast, leg muscles, heart, and liver tissues were collected and weighed (same method as above for Tibetan hens).\u003c/p\u003e \u003cp\u003eFertilization rate (%)\u0026thinsp;=\u0026thinsp;100\u0026times; number of fertilized eggs/number of incubated eggs;\u003c/p\u003e \u003cp\u003eHatchability (%)\u0026thinsp;=\u0026thinsp;100\u0026times; number of brood/number of fertilized eggs.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of the birth weight and serum lipid metabolism-related indexes in offspring\u003c/h2\u003e \u003cp\u003eMeanwhile, after the Tibetan chicken eggs had hatched, the chicks were one day old. One of these chicks (close to the average body weight of the chicks in the pen) was slaughtered for jugular vein blood collection. For each group, two birds were sampled per replicate, resulting in a total of ten birds per group. After collection, the blood was kept at room temperature for 1\u0026thinsp;~\u0026thinsp;2 hours and centrifuged at 3000 rpm for 15 minutes. The supernatant was taken and placed at -20℃ for storage. The serum sample was determined by blood biochemical index, which included Total protein (TP, A095-1-1), total cholesterol (T-CHO, A111-1-1), triglyceride (TG, A110-1-1), low-density lipoprotein (LDL, A113-1-1), and high-density lipoprotein (HDL, A112-1-1) (Nanjing Jiancheng Institute of Bioengineering, Nanjing, Jiangsu, P. R. China) following the manufacturer\u0026rsquo;s instructions to detect.\u003c/p\u003e \u003cp\u003eThe pectoral muscles (muscles attached to the forelimbs located on the floor wall of the chest cavity) and leg muscles (muscles below the kneecap and above the ankle) were stripped, and fascia and bone were removed and weighed with electronic balance.\u003c/p\u003e \u003cp\u003eThe liver and heart were cut and weighed. The tissue or organ index was calculated according to the following formula:\u003c/p\u003e \u003cp\u003etissue/organ index (g/kg)\u0026thinsp;=\u0026thinsp;tissue weight/body weight\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses were carried out with SPSS 20.0 for Windows, the T-test was used to analyze the relative expression of mRNA in reproductive axis-related genes among groups, fertilization rate, and hatchability by χ\u003csup\u003e2\u003c/sup\u003e test, and the other indicators were analyzed by single-factor analysis of variance. Duncan\u0026rsquo;s method was used for multiple comparisons. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 was considered a significant difference. Data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eReproductive hormones\u003c/h2\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e showed that dietary betaine had no significant effect on E2 and P4 in the serum of Tibetan chickens (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The content of FSH of serum in experimental group 2 was significantly higher than that of experimental group 1 and the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the content of LH in experimental group 1 was significantly higher than that of experimental group 2 and the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05)\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of dietary betaine supplementation on reproductive Hormones in serum of Tibetan Chickens.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eItems\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 g/kg\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3 g/kg\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eP-value\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFSH(ng/mL)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e27.36\u0026thinsp;\u0026plusmn;\u0026thinsp;7.03 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e31.01\u0026thinsp;\u0026plusmn;\u0026thinsp;5.23 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e42.93\u0026thinsp;\u0026plusmn;\u0026thinsp;8.45 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.042\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE2(pg/mL)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e435.64\u0026thinsp;\u0026plusmn;\u0026thinsp;67.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e426.53\u0026thinsp;\u0026plusmn;\u0026thinsp;126.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e521.7\u0026thinsp;\u0026plusmn;\u0026thinsp;87.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.684\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLH(ng/mL)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.54\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.54\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.044\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP4(ng/mL)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.308\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eNote: \u003csup\u003e1\u003c/sup\u003eIn the same line means within a row lacking a common superscript differ (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) the values with the same letter are not significantly different for all possible combinations of these different groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), and values with different letters are significantly different for all possible combinations of these different groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The same as below.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e2 FSH: follicle-stimulating hormone; LH: luteinizing hormone; E2: estradiol; P4: progesterone.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eApparent Indicators of Reproductive Performance\u003c/h2\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e showed that dietary betaine had no significant effect on the weight of the oviduct and ovary (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). There was no significant difference in grade follicle between the groups 1 and 2 compared with the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). However, the total number of large white follicle and follicle in the experimental groups 1 and 2 was significantly higher than that of the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). There was no significant effect of betaine on the fertilization rate, hatching rate, and hatching time of Tibetan eggs (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05)\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of dietary betaine supplementation on apparent reproductive performance of Tibetan Chickens.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eItems\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 g/kg\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3 g/kg\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eP-value\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVagina weight (g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e31.48\u0026thinsp;\u0026plusmn;\u0026thinsp;11.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28.73\u0026thinsp;\u0026plusmn;\u0026thinsp;8.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30.47\u0026thinsp;\u0026plusmn;\u0026thinsp;4.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.768\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOvarian weight (g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e34\u0026thinsp;\u0026plusmn;\u0026thinsp;14.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e33.04\u0026thinsp;\u0026plusmn;\u0026thinsp;5.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e27.48\u0026thinsp;\u0026plusmn;\u0026thinsp;10.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.346\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal follicle number\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e17.47\u0026thinsp;\u0026plusmn;\u0026thinsp;3.87 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21.61\u0026thinsp;\u0026plusmn;\u0026thinsp;5.70 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e22.59\u0026thinsp;\u0026plusmn;\u0026thinsp;8.27 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.010\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGrade follicle\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.4\u0026thinsp;\u0026plusmn;\u0026thinsp;1.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.2\u0026thinsp;\u0026plusmn;\u0026thinsp;1.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.299\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLarge white follicle\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9.3\u0026thinsp;\u0026plusmn;\u0026thinsp;4.62 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13.5\u0026thinsp;\u0026plusmn;\u0026thinsp;3.13 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14\u0026thinsp;\u0026plusmn;\u0026thinsp;6.70 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.038\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFertilization rate (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e90.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e92.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e90.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.916\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHatching rate (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e88.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e85.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e85.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.852\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIncubation time (h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e475.76\u0026thinsp;\u0026plusmn;\u0026thinsp;7.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e471.21\u0026thinsp;\u0026plusmn;\u0026thinsp;4.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e474.53\u0026thinsp;\u0026plusmn;\u0026thinsp;5.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.309\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eNote: \u003csup\u003e1\u003c/sup\u003eIn the same line means within a row lacking a common superscript differ (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) the values with the same letter are not significantly different for all possible combinations of these different groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), and values with different letters are significantly different for all possible combinations of these different groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The same as below.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e2Vagina weight(g): It's the last part of the fallopian tube opening on the left side of the back of the cloaca; Ovarian weight (g): Including follicular base, follicle, follicular zone and follicular membrane composition\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003esize and color: \u0026gt;10 mm, grade follicles; 4\u0026ndash;10 mm, small yellow follicles; 2\u0026ndash;4 mm, large white follicles.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eFertilization rate (%)\u0026thinsp;=\u0026thinsp;100\u0026times; number of fertilized eggs/number of incubated eggs; Hatchability (%)\u0026thinsp;=\u0026thinsp;100\u0026times; number of brood/number of fertilized eggs.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eIncubation time (h): Calculate the time from 24 hours when the eggs enter hatching to the time when the chicks emerge from the shell.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eReproduction-related gene expression\u003c/h2\u003e \u003cp\u003eFrom Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, dietary betaine in experimental groups 1 and 2 significantly up-regulated the relative expression of GnRH gene in the hypothalamus of Tibetan chickens compared to the control group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003c/p\u003e \u003cp\u003eFrom Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, in ovaries, the relative expression of ESRβ and FSHR genes in experimental group 2 were significantly up-regulated, compared with the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the relative expression of LH gene in experimental group 1 was up-regulated significantly, compared with the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, dietary betaine had no significant effect on the expression of PRLR gene in the ovaries of Tibetan chickens (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05)\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u003c/p\u003e \u003cp\u003e \u003cb\u003eEffects of dietary betaine supplementation of Tibetan chickens on growth performance and serum biochemical indicators of its offspring\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAs shown in Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, the hatch weight and liver index of chicks in the experimental 2 groups were significantly higher than that of the control group and experimental 1 group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In muscle development, dietary betaine supplementation of Tibetan chickens had no significant effect on offspring\u0026rsquo;s breast muscle and leg muscle index (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05)\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of dietary betaine supplementation of Tibetan chickens on birth weight and tissue/ organ index of offspring.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eItems\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 g/kg\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3 g/kg\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eP-value\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHatch weight (g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e30.05\u0026thinsp;\u0026plusmn;\u0026thinsp;2.4 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28.50\u0026thinsp;\u0026plusmn;\u0026thinsp;1.65 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e32.90\u0026thinsp;\u0026plusmn;\u0026thinsp;2.64 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eChest muscle index(%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.35\u0026thinsp;\u0026plusmn;\u0026thinsp;1.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.30\u0026thinsp;\u0026plusmn;\u0026thinsp;1.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.499\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLeg muscle index(%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.250\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLiver index(%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e42.07\u0026thinsp;\u0026plusmn;\u0026thinsp;4.85 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e38.21\u0026thinsp;\u0026plusmn;\u0026thinsp;4.83 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e49.81\u0026thinsp;\u0026plusmn;\u0026thinsp;5.95 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.010\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHeart index(%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.239\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eNote: \u003csup\u003e1\u003c/sup\u003eIn the same line means within a row lacking a common superscript differ (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) the values with the same letter are not significantly different for all possible combinations of these different groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), and values with different letters are significantly different for all possible combinations of these different groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The same as below.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e2Hatch weight (g): the chick weighs out of its shell\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e3Pectoral muscle index (%)\u0026thinsp;=\u0026thinsp;Chest muscle weight /hatch weight(mg/g); Leg muscle index (%)\u0026thinsp;=\u0026thinsp;Leg muscle weight/hatch weight(mg/g); Liver index (%)\u0026thinsp;=\u0026thinsp;Liver weight/hatch weight(mg/g); Heart index (%)\u0026thinsp;=\u0026thinsp;Heart weight/hatch weight(mg/g);\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u003c/p\u003e \u003cp\u003eAs shown in Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, dietary betaine supplementation of Tibetan chickens significantly increased serum T-CHO content of offspring (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), while it had no significant effects on serum TP, TG, LDL, and HDL (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05)\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of dietary betaine supplementation of Tibetan chickens on serum lipid metabolism-related indexes of offspring.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eItems\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 g/kg\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3 g/kg\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eP-value\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTP(g/L)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e23.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e23.26\u0026thinsp;\u0026plusmn;\u0026thinsp;1.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e24.30\u0026thinsp;\u0026plusmn;\u0026thinsp;1.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.658\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT-CHO(mmol/L)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.30 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.030\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTG(mmol/L)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.66 \u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.099\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLDL(mmol/L)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.428\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHDL(mmol/L)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.97\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.235\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eNote: \u003csup\u003e1\u003c/sup\u003eIn the same line means within a row lacking a common superscript differ (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) the values with the same letter are not significantly different for all possible combinations of these different groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), and values with different letters are significantly different for all possible combinations of these different groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The same as below.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e2TP: Total protein; T-CHO: total cholesterol; TG: triglyceride; LDL: low-density lipoprotein; HDL: high-density lipoprotein.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe mechanism of betaine improving laying performance is multifaceted. First, Betaine acts as a methyl donor, which reduces blood homocysteine levels by remethylating homocysteine to methionine in the presence of homocysteine methyltransferase (Chen et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Therefore, adding betaine indirectly increases methionine's content and provides more nutrients for the body. It was found that betaine could replace 25% of methionine, which was beneficial to the growth of broilers (Sun et al. 2008). Replacing 25% DL-methionine with betaine in broiler feed does not affect broiler performance and could improve the apparent utilization rate of crude protein (Su et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Dietary betaine supplementation can promote the growth performance of broilers (Leng et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Mendoza et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Chen et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Second, betaine can increase the release of hormones related to the reproductive axis by trans-methylation, thus promoting the formation and development of follicles (Zou et al. 2001). Third, betaine may enhance fat metabolism and oxidation by increasing the carnitine content in the body, thereby enhancing the fat transport and oxidation of laying hens, and improving the efficiency of laying eggs and feed conversion. Fourth, betaine may also improve laying performance by alleviating heat stress in laying hens. Poultry is a relatively sensitive animal, with a strong response and stress to environmental stimuli. Studies have shown that betaine positively affects broilers' growth performance under stressful conditions (Wen et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Chen et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Dietary betaine supplementation can regulate the body fluid balance of laying hens under heat stress and increase egg production. It stabilized the metabolic balance and physiological regulation of chickens during the laying period, thus further reducing the influence of the environment on laying performance. Dietary betaine supplementation alleviates heat stress in broilers by improving intestinal health. This improvement is achieved through the regulation of cytokine synthesis and up-regulation of tight junction-associated genes (Alhotan et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Moreover, In-ovo betaine injection enhanced intestinal morphology by improving jejunal villus length, villus height-to-width ratio, and absorptive surface area (El-Shater et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRecent studies show that adding betaine to the diet of laying hens improves their egg production performance. As the literature suggests, dietary betaine supplementation significantly increased the average egg production rate, while daily gain and egg quality were unchanged (Abobaker et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In our pre-research, finding betaine supplementation in the feed of Tibetan chickens can also significantly improve the egg production rate and tends to reduce the feed-egg ratio. Dietary betaine did not affect production parameters in Tibetan chickens, including feed consumption, average egg weight, feed conversion ratio, and egg breakage rate. (Chen et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Other studies found that adding 1500 mg/kg betaine to the diet of 55-week-old laying chickens significantly increased the egg production rate by 8.13% (Wang et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The egg production rate of Tibetan chickens was not as high as that of Wang's experiment, which may be related to the differences among breeds.\u003c/p\u003e \u003cp\u003eIt has been found that betaine can promote the synthesis of carnitine in vivo (Nakev et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2009\u003c/span\u003e), and carnitine can regulate the secretion of growth and reproductive-related hormones in vivo (Deng et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). This study found that the number of follicle in trial groups 1 and 2 increased significantly. No significant influence of betaine supplementation was observed on the development of reproductive organs in Tibetan chickens. In terms of hatchability, this study found that betaine had no significant effect on fertilization rate, hatchability, and hatching time in fertilized eggs of laying Tibetan chickens. Some studies have found that glucocorticoid injection can significantly improve egg hatching rate and shorten incubation time (Gao et al. 2008). It has also been reported that betaine can regulate the expression of the glucocorticoid receptor (GR) through methylation, so betaine may change the glucocorticoid content in vivo through the regulation of GR to increase the hatching rate. It is possible that the regulation of betaine has a great relationship with the dose of administration, so betaine has no significant effect on the hatchability of Tibetan chickens in this experiment. Our experiment found that betaine significantly increased the total number of large white follicle and follicle in Tibetan chickens, and promoted follicle development. In the later experiments, it was found that the addition of betaine 3 g/kg to Tibetan chicken feed significantly increased the content of follicle estrogen in the blood of Tibetan chickens, and the addition of betaine 1 g/kg significantly increased the luteinizing hormone in the blood of Tibetan chickens. Although it was found that betaine could influence the reproductive hormone level of the Tibetan blood serum, the development of related organs had been completed in the 30-week-old Tibetan chickens, and it wasn\u0026rsquo;t easy to promote their growth by regulating the level of nutrition and hormones. Therefore, betaine may promote follicle development and growth by regulating of multiple reproductive hormones. Supplementation of 150 g/d (head/day) betaine during the perinatal period can significantly increase milk yield and the birth weight of calves (Du et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Therefore, animal species may also influence the action effects of betaine.\u003c/p\u003e \u003cp\u003eBetaine (trimethylglycine) is a stable compound that serves as a methyl donor for betaine-homocysteine S-methyltransferase. It regulates gene expression by altering the methylation status of target gene promoters (Figueroa-Soto et al. 2018). This study found that with betaine up-regulating the expression of the gonadotropin-releasing hormone (GnRH) gene, the gene expression of LHR in group 1 and FSHR in group 2 was significantly up-regulated. Therefore, the up-regulation of GnRH gene expression may increase the level of GnRH, thereby promoting the release of FSH and LH, and improving the expression level of FSHR and LHR genes in ovaries. However, the expression of FSHR and LHR genes did not change significantly in the low-dose group, which may be because the low-dose betaine has little effect on the reproductive performance of the body. At the same time, the pathway to promote GnRH on betaine may be related to its methyl supply. Betaine promotes the synthesis of methionine through transmethylation but also increases the content of SAM, which can increase the content of N-methyl-D-aspartate (NMDA) in vivo. It was found that GnRH and NMDA were affected by the content of receptors (Abbud R et al. 1995), so the increase of NMDA increased the expression of the NMDA receptor gene, thereby promoting the release of GnRH. At the same time, glycine was produced in the process of betaine transmethylation, and glycine also affected the activation of the NMDA receptor.\u003c/p\u003e \u003cp\u003eIn this study, we found that 3 g/kg betaine could significantly increase the gene expression of ESRβ in Tibetan chicken\u0026rsquo;s ovary. Some studies have shown that ESRβ can promote the release of follicles inside and outside the ovary and affect the development of follicle (Pepe G J et al. 2013). Therefore, under a high dose of betaine, Tibetan chickens may affect follicle development and ovulation by increasing the gene expression level of ESRβ in ovaries, thereby improving the laying rate and reproductive performance. Among the hormones related to the reproductive axis, prolactin (PRL) may reduce the secretion of LH in vivo and thus inhibit ovulation and follicle development (Wang et al. 2007). The down-regulation of prolactin receptor gene\u0026rsquo;s expression can reduce the nesting time of hens and thus increase the number of laying eggs (March J B et al. 1994). This study found that betaine had no significant effect on the PRLR gene expression of ovaries in Tibetan chickens. Therefore, the result showed that betaine promotes the reproductive performance of Tibetan chickens may not be related to PRLR gene expression.\u003c/p\u003e \u003cp\u003eSerum metabolites are an important index that reflects the physiological and metabolic status of animals. This study revealed that dietary betaine did not significantly alter total protein levels in Tibetan chickens, suggesting its minimal impact on protein absorption and metabolism. As an important substance for methionine synthesis in vivo, Betaine could increase the serum cholesterol content (Hirche et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). In this study, Tibetan chickens supplemented with 3 g/kg betaine significantly increased the birth weight, liver index and serum total cholesterol content of offspring. Similar to methionine, the increase of serum total cholesterol content of Tibetan chickens by betaine may be related to the activation of cholesterol synthase (Olthof et al. 2005).\u003c/p\u003e \u003cp\u003eAfter 6\u0026ndash;24 weeks of supplementation with 4 g/d betaine, adults exhibited elevated plasma T-CHO. In contrast, lipid parameters including LDL, HDL, and TG remained unaffected (Zawieja et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). These findings align with existing experimental data, corroborating reports that associate betaine supplementation with potential adverse effects on blood lipid profiles. Elevated serum cholesterol represents a well-characterized risk determinant for coronary heart disease, as extensively documented in epidemiological studies (Jeong et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). However, betaine supplementation did not affect on blood lipids, whereas a high-dose betaine in the diet decreased total cholesterol levels over time (Atkinson et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Fish fed diet supplemented with 1.4 g/kg betaine also significantly up-regulated gene expression of fat metabolism in fish liver compared to other groups (Shi et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Current evidence most strongly supports a mechanism of betaine-induced hepatic lipid export into circulation. The contents of triglyceride, LDL, and high-density lipoprotein in serum are closely related to fat metabolism. Studies document a positive correlation between betaine supplementation dosage and plasma triglyceride elevation in poultry (Ghasemi et al. 2019;Yusuf et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). At the same time, some studies found that 0.2% betaine significantly reduced the serum triglyceride content and significantly increased the serum high-density lipoprotein content (Ma et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Our findings demonstrate that maternal betaine intake did not significantly influence offspring lipid parameters (TG, LDL-C, HDL-C) in this avian species. It may be that different supplemental doses have other effects on serum triglycerides. On the other hand, the related indexes of fat metabolism in serum of hens may differ from that of their offspring. Interestingly, other studies have shown that betaine supplements can increase serum triglycerides in feed-deprived chicks, possibly due to increased lipid mobilization from both the liver and yolk sac in response to energy demand (Al-Sagan et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The mechanism by which dietary betaine supplementation does not alter triglycerides is unknown and requires further investigation.\u003c/p\u003e \u003cp\u003eSerum cholesterol levels remained unaltered in Hu sheep administered 1 g/d or 3 g/d betaine supplements (Cai et al. 2021). Dietary betaine at 250\u0026thinsp;~\u0026thinsp;1 000 mg/kg linearly decreased total cholesterol concentration in serum (Wen et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Notably, HDL concentrations exhibited significant reductions in both the 1 g/kg and 3 g/kg treatment groups. It may be due to the different dosages. The observed discrepancies could potentially stem from variations in metabolic states or dosage inaccuracies, potentially leading to impaired nutrient assimilation. Meanwhile, betaine demonstrates broad-spectrum anti-inflammatory properties against multiple pathologies. Further investigation is required to establish its optimal dosing regimen.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study demonstrates that betaine up-regulated the gene expression of hypothalamic GnRH and ovarian ESRβ/FSHR/LHR, thereby enhancing the ovulation. Meanwhile, it increased the large white follicle number and serum FSH/LH levels, futher improving the reproductive performance of Tibetan chicken. In terms of offspring, maternal betaine boosted the hatching weight and liver index, which indicating enhanced embryonic development. Additionally, betaine elevated serum total cholesterol in offspring, suggesting a regulatory role in lipid metabolism.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eJike Nawei:Methodology, Data curation, Writing \u0026ndash; Original Draft, Writing \u0026ndash; review and Editing, Visualization, Project administration. Hei Zhichao : Methodology, Data Curation, Writing \u0026ndash; Original Draft, Writing \u0026ndash; review and Editing, Visualization, Project administration. Ma Weimei : Methodology, Data Curation, Writing \u0026ndash; review and Editing. Chen Yuxing : Data Curation, Writing \u0026ndash; Original Draft. Zhang Yongliang : Writing Reviewing and Editing. Sun Yucai : Methodology, Writing Reviewing and Editing. Liu Tingting : Methodology, Writing Reviewing and Editing. Feng Weidong: Resources, Data Curation, Funding acquisition. Rao Kaiqing: Resources, Conceptualization, Funding acquisition.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003eThis study was supported by \u0026quot;the Fundamental Research Funds for the Central Universities\u0026quot;, Southwest Minzu University (ZYN2025096).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e Upon reasonable request, the datasets of this study can be available from the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u0026nbsp;\u003c/strong\u003eThe study was approved by the Academic Ethics and Integrity Committee of Southwest Minzu University(Permit number: SMU-202501218).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbbud R, Smith MS (1995) Do GnRH neurons express the gene for the NMDA receptor? Brain Research. 690(1):117\u0026ndash;120.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAtkinson W, Slow S, Elmslie J, Lever M, Chambers ST, George PM (2009) Dietary and supplementary betaine: Effects on betaine and homocysteine concentrations in males. Nutr Metab Cardiovasc Dis. 19(11):767\u0026ndash;773.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbobaker H, Hu Y, Hou Z, Sun Q, Idriss A A, Omer NA, Zong Y, Zhao R (2017) Dietary betaine supplementation increases adrenal expression of steroidogenic acute regulatory protein and yolk deposition of corticosterone in laying hens. Poultry Science.96(12).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlhotan RA, Sulaiman A, Alharthi AS, Abudabos AM (2021) Protective influence of betaine on intestinal health by regulating inflammation and improving barrier function in broilers under heat stress. Poultry Science. 100(9):101337.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAl-Sagan AA, Al-Abdullatif A, Hussein EOS, Saadeldin IM, Al-Mufarrej SI, Qaid M, Albaadani HH (2021) \u0026ldquo;Effects of Betaine Supplementation on Live Performance, Selected Blood Parameters, and Expression of Water Channel and Stress-Related mRNA Transcripts of Delayed Placement Broiler Chicks.\u0026rdquo; Frontiers in veterinary science. 7:632101.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAzad AK, Gao Q, Ma C, Wang K, Kong X (2022) Betaine hydrochloride addition in Bama mini-pig's diets during gestation and lactation enhances immunity and alters intestine microbiota of suckling piglets. Journal of the Science of Food and Agriculture.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBao WF, Gao SK, Fan ZY, Jiang ZR (1989) Isolation, identification and content determination of betaine in molasses. Journal of Shenyang Pharmaceutical College.01: 16\u0026ndash;19(in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen FF, Yang K, Zhao XGAZ, Ren B, Dong P (2009) Tibetan Eggs and the Nutritional Composition of Ordinary Eggs. Journal of Southwest University for Nationalities (Natural Science Edition). 35 (05): 1013\u0026ndash;1016(in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai DM (2015) Effects of Betaine on Liver Glucose and Lipid Metabolism in Newborn Piglets and Its Genetic Mechanisms. Nanjing:Nanjing Agricultural University (in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai D, Wang J, Jia Y, Liu H, Yuan M, Dong H, Zhao R (2016) Gestational dietary betaine supplementation suppresses hepatic expression of lipogenic genes in neonatal piglets through epigenetic and glucocorticoid receptor-dependent mechanisms. Biochim Biophys Acta. 1861(1):41\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen R, Zhuang S, Chen YP, Cheng YF, Wen C, Zhou YM (2018) Betaine improves the growth performance and muscle growth of partridge shank broiler chickens via altering myogenic gene expression and insulin-like growth factor-1 signaling pathway. Poultry Sci. 97(12):4297\u0026ndash;4305\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen YX, Zheng YC, Xu YO, Li ZX, Zhang DY, Xiang FC, Rao KQ (2018) Effects of Dietary Betaine on Laying Performance and Egg Quality of Tibetan Chicken. China Poultry. 40(23):23\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen R, Wen C, Gu Y, Wang C, Chen Y, Zhuang S (2020) Dietary betaine supplementation improves the meat quality of transported broilers by altering muscle anaerobic glycolysis and antioxidant capacity. J Sci Food Agric. 100(6):2656\u0026ndash;2663.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Q, Wang Y, Jiao F, Shi C, Pei M, Wang L, Gong Z (2020) Betaine inhibits Toll-like receptor 4 responses and restores intestinal microbiota in acute liver failure mice. Scientific Reports. 10(1):21850\u0026ndash;21853.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng QH, Jia G, Wang KN (2011) The effects of L-carnitine on sow reproductive performance and its mechanism. Chinese Journal of Animal Husbandry. 47(21): 64\u0026ndash;68(in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu C, Liang J, Wang YC, Hou MJ, Wu ZH, Bu DP, Zhang WJ (2021) Effects of supplementary feeding rumen bypass methionine, betaine and vitamin B complex on health and performance of perinatal dairy cows. Chinese Journal of Animal Nutrition.33(7):3885\u0026ndash;3895(in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDing Z, Kim IH (2025) Impact of Betaine Supplementation on Growth Performance, Nutrient Digestibility, Egg Quality, Gas Emissions, and Blood Profile in Laying Hens Under Heat Stress Conditions. Animals (Basel). 15(17):2565.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-Shater SN, Abo-El-Sooud K, Tolba A, Gamal M, Awad MA, Ibrahim M, Tayeh M, Swielim GA (2024) Effect of in-ovo inoculation of betaine on hatchability, serum antioxidant levels, muscle gene expression and intestinal development of broiler chicks. J Anim Physiol Anim Nutr (Berl). 108(4):883\u0026ndash;890.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFigueroa-Soto CG, Valenzuela-Soto EM (2018) Glycine betaine rather than acting only as an osmolyte also plays a role as regulator in cellular metabolism. Biochimie. 147:89\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao J (2008) Study on the programmed effect of glucocorticoid-induced metabolism in Broilers. Taian: Shandong Agricultural University (in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHirche F, Schr\u0026ouml;der A, Knoth B, Stangl GI, Eder K (2006) Effect of dietary methionine on plasma and liver cholesterol concentrations in rats and expression of hepatic genes involved in cholesterol metabolism. British Journal of Nutrition. 95(5):879\u0026ndash;888.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu Y, Sun QW, Li XL, Wang M, Cai D, Li X, Zhao R (2015) In ovo injection of betaine affects hepatic cholesterol metabolism through epigenetic gene regulation in newly hatched chicks. PloS one. 10(4):0122643.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu Y, Sun QW, Liu J, Jia YM, Cai D, Idriss AA, Omer NA, Zhao R (2017) In ovo injection of betaine alleviates corticosterone-induced fatty liver in chickens through epigenetic modifications. Sci Rep. 7:40251\u0026ndash;402516.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJia Y, Song H, Gao G, Cai D, Yang X, Zha R (2015) Maternal betaine supplementation during gestation enhances the expression of mtDNA-encoded genes through D-loop DNA hypomethylation in skeletal muscle of newborn piglets. Journal of Agricultural \u0026amp; Food Chemistry. 63(46):10152.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeong SM, Choi S, Kim K, Kim SM, Lee G, Park SJ, Kim YY, Son JS, Yun JM, Park SM (2018) Effect of change in total cholesterol levels on cardiovascular disease among young adults. J Am Heart Assoc. 7(12): 008819.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang YJ, Wu JG, Ding L, Shen YS, Mei WD, Wang KY (2020) Investigation and promotion strategy of laying industry in Zhejiang Province. Zhejiang Animal Husbandry and Veterinarian. 45(04):16\u0026ndash;20(in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJayang Deji (2021) Analysis of technical measures for improving egg production of Tibetan chickens. Livestock and Poultry Industry, 2021, 32(04):74\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeng Z, Fu Q, Yang X, Ding L, Wen C, Zhou Y (2016) Increased fatty acid oxidation as a possible mechanism for the fat-reducing effect of betaine in broilers. Animal Sci J. 87(8):1005\u0026ndash;1010.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarch JB, Sharp PJ, Wilson PW, Sang HM (1994) Effect of active immunization against recombinant-derived chicken prolactin fusion protein on the onset of broodiness and photoinduced egg-laying in bantam hens. Journal of Reproduction \u0026amp; Fertility 101(1):227\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa JS, Chang WH, Zhang S, Zheng AJ, Liu GH, Cai HY (2015) Effects of betaine on growth performance, lipid metabolism, and muscle flavor quality of broilers. Chinese Journal of animal nutrition. 27(1):185\u0026ndash;195(in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMendoza SM, Boyd RD, Ferket PR, Van HE (2017) Effects of dietary supplementation of the osmolyte betaine on growing pig performance and serological and hematological indices during thermos neutral and heat-stressed conditions. J Animal Sci. 95(11):5040\u0026ndash;5053.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMou DL (2017) Effects of methyl donor supplementation on reproductive performance and antioxidant capacity of sows during pregnancy. Chengdu:Sichuan Agricultural University(in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakev J, Popova T, Vasileva V (2009) Influence of dietary betaine supplementation on the growth performance and carcass characteristics in male and female growing-finishing pigs. Bulgarian Journal of Agricultural Science. 15(3):263\u0026ndash;268.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOlthof MR, Verhoef P (2005) Effects of betaine intake on plasma homocysteine concentrations and consequences for health. Current Drug Metabolism. 6(1):15\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePepe GJ, Billiar RB, Leavitt MG, Zachos NC, Gustafsson JA, Albrecht ED (2013) Expression of Estrogen Receptors α and β in the Baboon Fetal Ovary. Biology of Reproduction. 66(4):1054\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQian LC, Xu ZR (2000) Effects of Betaine on Reproductive Performance of Pregnant Sows. Pig Raising. 1:17\u0026ndash;17(in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamis G, Evangelista JN, Quereda JJ, Pallar\u0026eacute;s FJ, Munoz A (2011) Use of betaine in gilt and sows during lactation: Effects on milk quality, reproductive parameters, and piglet performance. J Swine Health Prod. 19 (4):226\u0026ndash;232.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRibo S, S\u0026aacute;nchez-Infantes D, Martinez-Guino L, Garc\u0026iacute;a-Mantrana I, Ramon-Krauel M, Tondo M, Arning E, Nofrar\u0026iacute;as M, Osorio-Conles \u0026Oacute;, Fern\u0026aacute;ndez-P\u0026eacute;rez A et al (2021) Increasing breast milk betaine modulates Akkermansia abundance in mammalian neonates and improves long-term metabolic health. Science Translational Medicine, 13(587): eabb0322.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun H, Yang WR, Yang ZB, Jiang SZ, Zhang GG, Liu L (2009) Effects of betaine substituting methionine on Broilers' growth performance and protein metabolism. Chinese Journal of Cereals and Oils. 24 (09): 90\u0026ndash;96(in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu Q, Leng ZX, Yang X, Bai JY, Wen C, Zhou YM (2015) Effects of betaine substituting methionine on growth, nutrient metabolism, and serum biochemical indexes of Broilers. Journal of Fujian Agricultural and Forestry University (Natural Science Edition). 44 (04): 396\u0026ndash;401(in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi L, Wei L, Zhai H, Ren T, Han Y (2021) An evaluation on betaine and trimethylammonium hydrochloride in the diet of Carassius auratus: Growth, immunity, and fat metabolism gene expression. Aquaculture Reports, 19:100627.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Wettere WHEJ, Smits RJ, Hughes PE (2013) Methyl donor supplementation of gestating sow diets improves pregnancy outcomes and litter size. Animal Production Science. 53(1):1\u0026ndash;7(in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang F (2007) Expression of PRL and PRLR genes in chickens and their relationship with reproductive performance. Nanjing: Nanjing Agricultural University (in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang DP, Wang YH, Xia ZY, Li HY (2009) Effects of betaine on laying performance and egg quality of laying hens in later laying period. Gansu Animal Husbandry and Veterinary Medicine. 39(01):6\u0026ndash;8(in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang H, Liu L, He X, Bian G (2025) Effect of betaine on growth performance, methionine metabolism, and methyl transfer in broilers aged 1 to 21 days and fed a low-methionine diet. J Poult Sci. 62:2025010.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWen C, Chen Y, Leng Z, Ding L, Wang T, Zhou Y (2019) Dietary betaine improves meat quality and oxidative status of broilers under heat stress. J Sci Food Agric. 99(2):620\u0026ndash;623.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWen C, Chen RY, Ding L, Wang T, Zhou Y (2021) Betaine improves growth performance, liver health, antioxidant status, breast meat yield, and quality in broilers fed a mold-contaminated corn-based diet. Anim Nutr. 7(5):661\u0026ndash;666.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao H, Zheng YC, Li ZX, Tan YP, Wang YH, Chen YX, Xu YO, Xiang FC, Rao KQ (2021) Effects of betaine on lipid metabolism and related gene expression in Tibetan chicken[J]. Animal Husbandry and Veterinary Medicine. 53(07):25\u0026ndash;31(in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin GP, Chen GH, Bian L, Silang QZ (2008) Current situation and development ideas of Tibetan chicken in Daocheng County [J]. Livestock and poultry industry. 10: 66\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYusuf, Mohamed S, Nabtiti Adel AEl, Hassan Marwa A, Mandour Mostafa A (2018) Supplementary outcomes of betaine on economic and productive performance, some biochemical parameters, and lipoprotein lipase gene expression in finishing male broilers. International Journal of Veterinary Science and Medicine. 6(2):213\u0026ndash;218.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZou XT (2001) The endocrine mechanism of betaine promoting laying hens. Chinese Veterinary Journal. 21(3): 300\u0026ndash;303(in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZawieja EE, Zawieja B, Chmurzynska A (2019) Betaine supplementation moderately increases total cholesterol levels: A Systematic review and meta-analysis. J Diet (Suppl). 18(1):107\u0026ndash;115.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"tropical-animal-health-and-production","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"trop","sideBox":"Learn more about [Tropical Animal Health and Production](https://www.springer.com/journal/11250)","snPcode":"11250","submissionUrl":"https://submission.nature.com/new-submission/11250/3","title":"Tropical Animal Health and Production","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Tibetan chicken, Betaine, Reproductive performance, Offspring development, Lipid metabolism","lastPublishedDoi":"10.21203/rs.3.rs-8212700/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8212700/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe purpose of this study was to investigate the effects of dietary betaine supplementation on reproductive axis-related hormones, relative gene expression levels, offspring growth performance and lipid metabolism in Tibetan chickens. A total of 180 30-week-old laying Tibetan chickens were randomly assigned to three dietary treatments with six replicates per treatment (10 hens per replicate). The control diet consisted of corn-soybean meal, whereas Experimental Groups 1 and 2 received diets containing 1 g/kg and 3 g/kg betaine supplementation, respectively. After one week of environmental adaptation, the formal experiment proceeded for seven consecutive weeks. The results showed that betaine significantly increased the number of large white follicles and total follicles of Tibetan chickens, and up-regulated the gonadotropin-releasing hormone mRNA expression in the hypothalamus of Tibetan chickens (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The content of follicle-stimulating hormone and luteinizing hormone in serum of 3 g/kg group was significantly improved by the betaine compared with other groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The relative expression of genes for estrogen receptor β, follicle-stimulating hormone receptor and luteinizing hormone receptor in the ovary was significantly up-regulated in the 3 g/kg group compared with the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Betaine significantly promoted hatching weight, liver index and the content of total cholesterol in the serum of the Tibetan chicken offspring (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In conclusion, the dietary supplement betaine can promote the reproductive performance of Tibetan chickens and regulate hepatic lipid metabolism in offspring of Tibetan chickens.\u003c/p\u003e","manuscriptTitle":"Effects of dietary betaine supplementation on reproductive performance of tibetan chickens and serum lipid metabolism-related indexes of its offspring","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-16 16:21:11","doi":"10.21203/rs.3.rs-8212700/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-12-11T11:39:50+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-11T11:32:06+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-11-28T00:22:42+00:00","index":"","fulltext":""},{"type":"submitted","content":"Tropical Animal Health and Production","date":"2025-11-26T07:04:33+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"tropical-animal-health-and-production","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"trop","sideBox":"Learn more about [Tropical Animal Health and Production](https://www.springer.com/journal/11250)","snPcode":"11250","submissionUrl":"https://submission.nature.com/new-submission/11250/3","title":"Tropical Animal Health and Production","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"67fa4524-77b9-46b2-9b05-c78bf295a96b","owner":[],"postedDate":"December 16th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-16T16:08:45+00:00","versionOfRecord":{"articleIdentity":"rs-8212700","link":"https://doi.org/10.1007/s11250-026-04938-6","journal":{"identity":"tropical-animal-health-and-production","isVorOnly":false,"title":"Tropical Animal Health and Production"},"publishedOn":"2026-03-12 16:00:22","publishedOnDateReadable":"March 12th, 2026"},"versionCreatedAt":"2025-12-16 16:21:11","video":"","vorDoi":"10.1007/s11250-026-04938-6","vorDoiUrl":"https://doi.org/10.1007/s11250-026-04938-6","workflowStages":[]},"version":"v1","identity":"rs-8212700","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8212700","identity":"rs-8212700","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00