Effects of Different Proportions of Concentrate Replaced by Fermented Mulberry Leaves on Growth Performance, Rumen Fermentation, Rumen Microbial and Fungal Community Structure of Heat-stressed Hu sheep

Effects of Different Proportions of Concentrate Replaced by Fermented Mulberry Leaves on Growth Performance, Rumen Fermentation, Rumen Microbial and Fungal Community Structure of Heat-stressed Hu sheep | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effects of Different Proportions of Concentrate Replaced by Fermented Mulberry Leaves on Growth Performance, Rumen Fermentation, Rumen Microbial and Fungal Community Structure of Heat-stressed Hu sheep Qiwen Fan, Fang Chen, Wenjing Tao, Encun Du, Na Zhao, Wanzheng Guo, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7903162/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 20 Apr, 2026 Read the published version in Applied Microbiology and Biotechnology → Version 1 posted You are reading this latest preprint version Abstract Heat stress is a major abiotic stress that limits growth performance, health, and physiological responses of sheep. Although Hu sheep possess innate mechanisms for managing heat stress, prolonged exposure impairs their performance and health. This study was conducted to explore the effects of different proportions of concentrate replaced with fermented mulberry leaves (FML) on rumen fermentation and rumen microbial and fungal community structures in Hu sheep. A total of 45 Hu sheep with similar body weight (26.42 ± 3.57 kg) were randomly divided into three group: the control group (CONT) was fed a basal diet, and the treatment groups (FML Treatment) FT1 and FT2 were fed experimental diets in which 10% and 20% concentrate, respectively, were replaced by FML. The pretest lasted for seven days, and the formal period lasted for 90 days. The average daily gain in the FT1 group increased at the first month of the formal period compared to the CONT group ( P < 0.05). Lower feed conversion ratio, feed weight gain cost ( P < 0.05), and higher apparent digestibility of acid detergent fiber and crude protein ( P < 0.05) were observed in the FT1 group. Moreover, the concentrations of acetate, propionate, valerate, and ammonia nitrogen in the FT1 group were significantly higher than those in the CONT group ( P < 0.05). Further analysis of the rumen microbiota indicated that the relative abundance of Succiniaclassicum and [Eubacterium]_ventriosum_group decreased, whereas that of Prevotellaceae_UCG_003 and unclassified_Selenomonadaceae increased in the FT1 group. Internal transcribed spacer sequencing indicated that FML significantly increased the relative abundance of beneficial fungi in the rumen of heat-stressed Hu sheep, including Aspergillus_alabamensis , Aspergillus_versicolor , Aspergillus_flavus , and Candida in the FT1 group. Correlation analysis suggested that the apparent digestibility of nutrients in fattening Hu sheep under heat stress was highly correlated with ruminal bacteria. Our findings indicate that the replacement of concentrate with FML can improve production performance, increase the apparent digestibility of nutrients, and enhance the rumen fermentation efficiency of fattening Hu sheep under heat stress. These changes are highly correlated with the changes in the composition and structure of bacteria and fungi in the rumen. fermented mulberry leaves Hu sheep rumen fermentation parameters microbial community structure Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Key points 10% FML Treatment enhanced feed conversion ratio and nutrient digestibility. 10% FML Treatment enhance the rumen fermentation efficiency 10% FML Treatment altered rumen bacteria and fungi populations 1. Introduction China is among the countries with the richest grassland areas, accounting for 40% of its national land area. Geographically, approximately 313 million hectare of grasslands in China occur in the northern zone, concentrated in the Xizang, Inner Mongolia, Xinjiang, Qinghai, Sichuan, and Gansu Provinces (Kang et al. 2007 ). However, grasslands are mostly scattered throughout southern China, making it difficult to meet the needs of sheep husbandry for forage under large-scale production conditions. Nutritional researchers are committed to seeking new green feed resources in China with strong ecological adaptability and high nutritional value, such as Jerusalem artichokes (Wang et al. 2020 ), mulberry leaves (ML) (Maqsood et al. 2022 ), paper mulberry (Wang et al. 2024 ), and rapeseed (Du et al. 2022 ), to increase forage supply. In addition, the summer climate in southern China is mainly humid and hot, and livestock are prone to heat stress (HS). HS has a significant negative effect on feed intake, body weight gain (Pragna and Sejian 2018 ; Zhang et al. 2021a ), and ewe fertility (Bouroutzika et al. 2022 ). Ruminants are more vulnerable to the negative effects of HS. Ruminal microorganisms have a symbiotic relationship with the host. However, HS could alter the ruminal temperatures, affect hormone secretion (Bagath et al. 2019 ; Lees et al. 2018 ). Thus, the microbial ecosystem would be disrupted under HS conditions. Many previous studies indicated that HS affected ruminal microbial compositions, impacted the production of short-chain fatty acids, and alter inflammatory signals (Eom et al. 2024 ; Yu et al. 2024 ). Hu sheep are descendants of Mongolian sheep that are widely cultivated in various provinces of southern China. Although Hu sheep inherit cold, heat, and drought resistance, heat stress remains a limiting factor in sheep production (Chen et al. 2024 ). Therefore, it is important to explore new feeds for mitigating heat stress. Mulberry belongs to the genus Morus and is a commercial tree that has been grown for thousands of years in China and spans Asia, Europe, Africa, and the United States (Dhanyalakshmi and Nataraja 2018 ; Xie et al. 2014 ). ML is a widely used protein feed with fiber and various active ingredients and is involved in the regulation of antioxidant, immune, glucose, and lipid metabolism (Cui et al. 2024 ; Cui et al. 2022 ; Hu et al. 2019 ). Recent studies have revealed that ML can be used as antidiabetic agents in animal models (Du et al. 2024 ; Zheng et al. 2023 ). Although dietary ML powder supplementation altered the apparent digestibility of nutrients, high content (20%-30%) ML powder supplementation interfered with the growth of Hu sheep (Ouyang et al. 2019 ). Another study indicated that 15% ML supplementation showed better effects in growth performance and promoting antioxidant (Luo et al. 2025 ). Thus, 10%-20% replacement rates might be more suitable for the Hu sheep. The tannins, phytic acid, and phytoactive components present in ML, serves as antinutritional factors, might affect the digestion and absorption of nutrients. The fermentation process can degrade these antinutritional factors by utilizing appropriate microorganisms and enzymes (Leeuwendaal et al. 2022 ). Additionally, the use of beneficial microorganisms during the fermentation process can also improve the rumen environment (Jung et al. 2025 ; Xue et al. 2022 ). Moreover, after fermentation, fresh mulberry leaves (ML) have a longer shelf life, making them easier to transport and suitable for economic activities. Compared to dried ML or ML powder, fermented mulberry leaves (FML) are more affordable and easier to obtain. However, the effect of FML on heat-stressed Hu sheep remains unclear. We hypothesized that FML will alter growth performance, rumen fermentation, and rumen microbial and fungal communities. Therefore, this study investigated the effects of different proportions of concentrate replaced by FML in heat-stressed Hu sheep on growth performance, ruminal nutrient degradability, VFA dynamics and rumen microbial and fungal communities. The study would provide workable solutions for ruminant production in hot and humid environments with high concentrate cost and heat stress. These results support the use of FML in ruminant feeding. 2. Materials and Methods 2.1 Fermented Mulberry Leaves FML were made from the fresh ML, bran and corn flour which were mixed in a ratio of 7:2:1 supplemented with 0.1% starter. The fresh ML were harvested from a farm in Jingmen city. The starter consists of fermentation strains ( Lactobacillus WYYL-RSJ-006, Saccharomycetes WYYL-JMJ-200 and Bacillus subtilis WYYL-KCYB-100 = 1:1:1, final concentration ≥ 1×10 7 cfu/g) were provided by Guangzhou Weiyuan Biotechnology Co., Ltd. (Guangzhou, China) and the enzymes (cellulase FDY-2263 and hemicellulose FDG-2255 = 10:3, final concentration ≥ 20 IU/g) were provided by Cangzhou Sunson Biotechnology Co., Ltd. (Cangzhou, China). FML was prepared by breathing bag for one week at 25 ℃. After laboratory testing, the routine nutrients of ML and FML were obtained and are shown in Table 1 . Table 1 Nutrient composition of ML and FML (DM basis) % Items ML FML CP 16.09 12.21 NDF 29.80 34.97 ADF 13.42 17.72 2.2 Experimental Design A total of 45 healthy 3-month-old fattening Hu sheep (weighing approximately 26.42 ± 3.57 kg) were marked with ear tags and randomly assigned into three groups with random numbers generated from Microsoft Excel (version 365). Each group contained 3 replicates and 5 lambs in each replicate. Each replicate was housed in an individual pen (3 m×3 m) in a room containing large fans for ventilation and cooling, and exposed to natural daylight, ambient temperature, and relative humidity during summer seasons in southern China. Each pen was equipped with an individual feeding trough. FML was used to replace 0, 10%, and 20% of the concentrate (named as CONT, FT1, and FT2 group, respectively) in Hu sheep diets as a total mixed ration (TMR). The basal diet (Table 2 ) consisted of a complete mixed diet with a concentrate to forage ratio of 6:4 designed to meet the Chinese Feeding Standard of Sheep (NY/T816-2004). The commercialized concentrated (named “Yang Guanjia Meat goat Concentrated Feed”) was purchased form Henan Haida Feed Co., Ltd. (YN903). Table 2 Composition and nutrient levels of experiment basal diets (air-dry basis, %) Ingredients CONT 1 FT1 FT2 Peanut straw 40.00 40.00 40.00 Corn 10.25 10.25 10.25 Concentrate 2 48.00 43.20 38.40 Fermented mulberry leaf 0 4.80 9.60 NaHCO 3 0.25 0.25 0.25 NaCl 0.50 0.50 0.50 Premix 3 1.00 1.00 1.00 Total 100.00 100.00 100.00 Nutrient levels DM 90.91 88.76 86.64 ME 4 , MJ/kg 10.84 10.73 10.62 CP 12.22 12.07 11.92 ADF 21.98 21.86 22.09 NDF 31.17 30.99 30.62 1 CONT = the control group, FT1 = 10% FML group, FT2 = 20% FML group 2 The concentrate is a commercialized concentrated material. 3 Per kg of the premix contained the following: Cu as copper sulfate, 250 mg; Fe as iron sulfate, 1,400 mg; Zn as zinc oxide, 1,200 mg; Mn as manganese oxide, 900 mg; vitamin D3, 27 000 IU; vitamin A, 100,000 IU; vitamin E, 800 IU. 4 ME was a calculated value, while the others were measured values. The experimental flow was shown in Fig. 1 . The pre-trail period was 7 days, followed by a 90 days trial period. All the Hu sheep were fed twice daily, at 6:30 AM and 4:00 PM, with free access to feed and water. Individual pen dry matter (DM) intake (DMI) was recorded, and the average DMI for Hu sheep was calculated (N = 3, each group). The start point was defined as Day 1. On Day 1, 30, 60, and 90 of the study, body weights measurements were recorded (N = 13, each group). Two fecal samples were collected from each pen at last 5 consecutive days (N = 6, each group). Two rumen fluid samples were collected from each pen on the morning at Day 90 (N = 6, each group). 2.3 Determination of Temperature and Humidity Index The temperature-humidity index (THI) is typically used to describe whether ruminants are in a state of HS and its degree during the breeding process. Temperature and humidity were recorded by the hygrothermograph (9010, Deli Inc., Hangzhou, China), and the THI was calculated according to the following formula: THI = (1.8 × T + 32) − (0.55–0.0055 × RH) × (1.8 × T − 26) Among, T represents the ambient temperature, RH stands for environmental humidity. 2.4 Growth Data Collection and Analysis All lambs were weighed for two consecutive days before morning feeding each month and at the last days using the Guangdong Senssun Weighing Apparatus in China. The feeding and residual amounts were recorded in each pen, and the DMI, average daily gain (ADG), and feed conversion ratio (FCR, DMI/ADG) were calculated. 2.5 Rumen Fermentation Characteristics Rumen fluid was collected using rumen tube, the pH was immediately measured after filtering through 4 layers of gauze, and then divided into 10 mL centrifuge tubes and stored at -20 ℃. The concentration of acetate, propionate, isobutyrate, butyrate, isovalerate, valerate, and total volatile fatty acid (TVFA) was analyzed by gas chromatography (GC-2014, Shimadzu, Tokyo, Japan) equipped with a capillary column (Stabilwax, Restek, Bellefonte, PA, United States). While ammonia nitrogen (NH 3 -N) concentration was determined according to the method of Broderica and Kang (Broderick and Kang 1980 ). 2.6 Determination of Apparent Nutrient Digestibility Feces were collected for five consecutive days at the end of the trial, and all feces of each replicate were evenly mixed and 10% hydrochloric acid was added to fix nitrogen. Fecal samples were stored at − 20 ° C for subsequent determination. DM and crude protein (CP) of the feed samples and fecal samples were determined according to the Association of Analytical Communities (AOAC, 2006). Neutral detergent fiber (NDF) and acid detergent fiber (ADF) were determined using an Hanon F2000 Fiber analyzer (HANON Technology Co., Shan Dong, China) according to Van Soest et al. (Van Soest et al. 1991 ). The content of hydrochloric acid insoluble ash (AIA) was determined according to Lee and Hristov (Lee and Hristov 2013 ) described, and AIA was used as a digestibility marker, and the apparent nutrient digestibility was calculated according to the following formula: Nutrient digestibility (%) = 100 - [(Nf / Nd) × (Ad / Af) × 100] Among, Nf represents the nutrient concentration in the feces, Nd represents the nutrient concentration in the diet, Ad stands for the AIA concentration in the diet, Af stands for the AIA concentration in the feces. 2.7 Rumen Bacterial DNA Extraction, Amplification, Sequencing and Analysis Total genomic DNA was extracted from 18 samples using the TGuide S96 Magnetic Soil/Stool DNA Kit (Tiangen Biotech (Beijing) Co., Ltd.) according to manufacturer’s instructions. The quality and concentration of DNA was determined on a Nanodrop spectrophotometer. The qualified DNA with more than 1.80 of OD260/280 was used for further PCR amplification. The primers F:5'-ACTCCTACGAGGCAGCAG-3' and R:5'-GGACTACHVGGGTWTCTAAT-3' were used to amplify the V3-V4 hypervariable region of the bacterial 16S rRNA gene, while the primers F:CTTGGTCATTTAGAGGAAGTAA和R:GCTGCGTTCTTCATCGATGC were used to amplify the ITS1 region of the fungal ITS gene in a 20 µL PCR reaction mixture. The PCR product was extracted from 2% agarose gel and purified using a PCR Clean-Up Kit (YuHua, Shanghai, China). After this, purified amplicons were pooled in equimolar amounts and paired-end sequenced on an Illumina PE300 platform (Illumina, San Diego, CA, USA) according to the standard protocols by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China). Bioinformatic analysis of the ruminal microbiota was conducted using the online platform BMKCloud “ https://www.biocloud.net ”. USEARCH (version 10.0) was used to assign qualified sequences with a similarity threshold exceeding 97% to one operational taxonomic unit (OTU). QIIME2 software (version 2020.6.0) was used to perform taxonomy annotation of the OTUs and alpha diversity of each sample. Beta diversity calculations were analyzed by principal coordinate analysis (PCoA) based on Bray–Curtis distances at the OTU level. Linear discriminant analysis (LDA) coupled with effect size (LEfSe) (version 1.1.1) was conducted to evaluate the biomarkers for each group. The phenotypic prediction of rumen microbiota was performed by BugBase (version 0.1.0) and Picrust2 (version 2.3.0), while rumen fungi was performed by FUNGuild (version 1.0). 2.8 Statistical Analysis Statistical analysis was carried out with GraphPad Prism software (6.0c) (GraphPad Software version 6.01). Homogeneity and normalcy were verified by SPSS Statistics software (SPSS Statistics version 17.0). Homogeneity of variance test was performed Levene test. The normalcy of data was checked by Shapiro-Wilk test. The one-way ANOVA was used for statistical analysis. Bonferroni test was used as post hoc test. Values with no letter or the same letter superscripts mean no significant difference (P > 0.05), while with different small letter superscripts mean significant difference (P < 0.05), and with different capital letter superscripts mean significant difference (P < 0.01). The effect size of eta-squared (η 2 ) was also performed by SPSS Statistics software (SPSS Statistics version 17.0). Spearman correlation coefficients were calculated by OriginPro 2021 software (version 9.8.0.200). These results could examine the correlations between rumen fermentation parameters and the relative abundance of bacteria and fungi at the genus level. The data were considered significantly different if P ≤ 0.05, and a tendency was suggested if 0.05 < P < 0.10. The values were presented as means ± SEM. 3. Results 3.1 Temperature and Humidity Index Values The Hu sheep suffered from heat stress during nearly the entire trial period, as shown in Fig. 2 . According to THI thresholds, the days that the Hu sheep spent during the trial period were in different heat stress states: light heat stress with 72 ≤ THI < 78 for 25 days, moderate heat stress with 78 ≤ THI < 90 for 55 days, and severe heat stress with THI ≥ 90 for 1 day. At the first month of the formal period, the THI value was significantly higher than the second and third month ( P < 0.01, Fig. 2 a). However, the ADG of Hu sheep in the FT1 group was significantly higher than that in the CONT group at the first month ( P < 0.05, Fig. 2 b). 3.2 Performance The performance of the fattening Hu sheep in each group is presented in Table 3 . There were no significant differences among the groups in terms of final body weight, ADG, or DMI ( P > 0.05). Compared to the CONT and FT2 groups, the FCR in FT1 was significantly lower ( P < 0.01, η 2 = 0.619). In addition, compared to the CONT group, the FT1 and FT2 groups had significantly reduced feed weight gain cost by 7.61 and 5.15 yuan/kg, respectively ( P < 0.01, η 2 = 0.719). Table 3 DMI and ADG of fattening Hu sheep fed with FML 1 CONT 2 FT1 FT2 P value Effect size η 2 Initial BW, kg 26.48 ± 1.05 26.15 ± 1.03 26.59 ± 1.08 0.837 0.003 Final BW, kg 38.19 ± 1.60 40.69 ± 0.91 39.67 ± 1.41 0.619 0.048 ADG, g 130.11 ± 10.48 161.56 ± 8.90 145.33 ± 8.24 0.296 0.162 DMI, kg 1.28 ± 0.01 1.28 ± 0.01 1.33 ± 0.02 0.499 0.071 FCR 9.91 ± 0.20 A 7.96 ± 0.14 B 9.18 ± 0.20 A < 0.001 0.619 Feed weight gain cost, yuan/kg 32.79 ± 0.63 A 25.18 ± 0.41 B 27.64 ± 0.58 B 0.05), while with different small letter superscripts mean significant difference ( P < 0.05), and with different capital letter superscripts mean significant difference ( P < 0.01). The same as below. 2 CONT = the control group, FT1 = 10% FML group, FT2 = 20% FML group, N = 13 except DMI N = 3. 3.3 Apparent Digestibility of Nutrients As shown in Table 4 , the apparent digestibility of DM in the CONT and FT1 groups was significantly higher than that in the FT2 group ( P < 0.01, η 2 = 0.570), the apparent digestibility of ADF in the FT1 group was significantly higher than that in the CONT and FT2 groups ( P < 0.05, η 2 = 0.564), and the apparent digestibility of CP in the FT1 group was also significantly higher than that in the CONT and FT2 groups ( P < 0.01, η 2 = 0.877). Table 4 Apparent digestibility of nutrients of fattening Hu sheep fed with FML % CONT 1 FT1 FT2 P value Effect size η 2 DM 87.44 ± 0.28 A 87.99 ± 0.43 A 85.85 ± 0.36 B 0.002 0.570 ADF 43.37 ± 1.03 b 51.24 ± 1.79 a 39.72 ± 2.49 b 0.033 0.564 NDF 41.54 ± 1.60 40.29 ± 1.46 42.73 ± 3.12 0.515 0.040 CP 53.20 ± 0.90 B 57.29 ± 0.61 A 47.22 ± 0.50 C 0.001 0.877 1 CONT = the control group, FT1 = 10% FML group, FT2 = 20% FML group, N = 6. 3.4 Rumen Fermentation Parameters The pH values and concentrations of isobutyrate, butyrate, and isovalerate were the same in all the groups (Table 5 ). The concentrations of acetate, propionate, and valerate in the FT1 group were significantly increased compared to CONT group ( P < 0.05, η 2 = 0.336, 0.353, and 0.347), and the concentration of NH 3 -N was significantly higher in the FT1 group than that in the CONT and FT2 groups ( P < 0.01, η 2 = 0.574). Table 5 Rumen fermentation parameters in ruminnal fluid of fattening Hu sheep fed with FML CONT 1 FT1 FT2 P value Effect size η 2 pH 6.61 ± 0.22 6.74 ± 0.13 6.53 ± 0.17 0.236 0.185 Acetate, mmol/L 44.00 ± 3.80 b 56.48 ± 2.43 a 52.80 ± 3.48 ab 0.046 0.336 Propionate, mmol/L 8.23 ± 1.05 b 11.96 ± 0.77 a 10.25 ± 0.93 ab 0.038 0.353 Isobutyrate, mmol/L 0.07 ± 0.01 0.18 ± 0.05 0.15 ± 0.05 0.181 0.204 Butyrate, mmol/L 10.41 ± 0.97 11.13 ± 0.44 9.92 ± 1.28 0.673 0.051 Isovalerate, mmol/L 0.17 ± 0.02 0.35 ± 0.09 0.28 ± 0.03 0.097 0.267 Valerate, mmol/L 0.35 ± 0.06 b 0.64 ± 0.05 a 0.49 ± 0.10 ab 0.041 0.347 NH 3 -N, mmol/L 3.48 ± 0.72 B 9.32 ± 1.17 A 4.39 ± 1.02 B 0.002 0.574 TVFA, mmol/L 63.23 ± 5.54 80.74 ± 3.54 73.88 ± 5.62 0.074 0.294 1 CONT = the control group, FT1 = 10% FML group, FT2 = 20% FML group, N = 6. 3.5 Diversity of Ruminal Microbiota The rumen is the core organ for predigestion in ruminants, and the composition and function of microorganisms are key factors (Keum et al. 2024 ). We have performed 16S rRNA sequencing on 18 rumen fluid samples and a total of 1,451,501 pairs of Reads were obtained. After quality control, a total of 1,446,250 Clean Reads were generated. Each sample generated at least 79,173 Clean Reads, with an average of 80,347 Clean Reads. As shown in Table 6 . The alpha diversity indexes were all shown no significantly difference among the groups ( P > 0.05). Whereas treatment affected by feature index (η 2 = 0.216), ACE index (η 2 = 0.213), Chao1 index (η 2 = 0.215), Simpson index (η 2 = 0.149), Shannon index (η 2 = 0.151) with large effect. Table 6 The alpha diversity indexes of ruminal microbiota CONT 1 FT1 FT2 P value Effect size η 2 Feature 1345.33 ± 128.47 1339.17 ± 63.67 1112.17 ± 72.63 0.162 0.216 ACE 1349.06 ± 128.04 1342.16 ± 62.74 1117.50 ± 72.73 0.166 0.213 Chao1 1346.26 ± 128.14 1339.50 ± 62.66 1113.75 ± 72.67 0.163 0.215 Simpson 0.99 ± 0.003 1.00 ± 0.001 0.99 ± 0.002 0.298 0.149 Shannon 8.96 ± 0.31 9.03 ± 0.12 8.52 ± 0.24 0.293 0.151 1 CONT = the control group, FT1 = 10% FML group, FT2 = 20% FML group, N = 6. 3.6 Composition and Structure of Ruminal Microbiota As shown in Fig. 3 , at the phylum level (Fig. 2 a), the relative abundance of Bacteroidetes and Verrucomicrobiota in the FT1 group were significantly increased compared to the CONT and FT2 groups (Fig. 2 b) ( P < 0.05), whereas the ratio of Firmicutes/Bacteroidetes (F/B) was significantly reduced in the FT1 group (Fig. 2 b) ( P < 0.05). The bar plots show that FML supplementation significantly altered the relative abundance of bacteria at the genus level (Fig. 3 c). Compared to the CONT and FT2 groups, the relative abundances of Succiniaclassicum and [Eubacterium]_ventriosum_group were significantly lower (Fig. 3 d, P < 0.05), whereas the relative abundances of Prevotellaceae_UCG_003 and unclassified_Selenomonadaceae were significantly higher (Fig. 3 d, P < 0.05) in the FT1 group. Moreover, the relative abundances of Saccharofermentans and Candidatus_Saccharimonas were lower (Fig. 3 d, P < 0.05), and the unclassified_Bacter-oidales_RF16_group was higher (Fig. 3 d, P < 0.05) in the FT1 group than in the FT2 group. The relative abundance of Ruminococcaceae_UCG_001 was significantly higher in the FT2 group than in the CONT and FT1 groups (Fig. 3 d, P < 0.05). 3.7 Ruminal Microbiota Function BugBase analysis was conducted to phenotype prediction (Fig. 4 a). Our results indicated that the relative abundance of Gram-negative bacteria was significantly decreased ( P < 0.05), whereas that of Gram-positive bacteria was significantly increased in the FT2 group ( P < 0.05). We also used PICRUSt2 analysis for microbiota function analysis. The significantly different Kyoto Encyclopedia of Genes and Genomes (KEGG) categories among all groups were mainly related to “Global and overview maps” (Fig. 4 b). Additionally, the results of the differential categories showed that four categories accounted for > 3% of the proportion of the rumen microbiota, including “Energy metabolism”, “Membrane transport”, “Biosynthesis of secondary metabolites”, “Biosynthesis of antibiotics” and “Biosynthesis of amino acids”. 3.8 Diversity of Ruminal Fungi The high efficiency of ruminants in digesting high-fiber feed and forage is primarily due to microbiome-mediated plant degradation and fermentation (Moraïs and Mizrahi 2019 ), in which fungi play key roles. After ITS sequencing, a total of 1,417,286 pairs of Reads were obtained. After quality control, a total of 1,412,685 Clean Reads were generated. Each sample generated at least 58,173 Clean Reads, with an average of 78,483 Clean Reads. As shown in Table 7 . The alpha diversity indexes were all shown no significantly difference among the groups ( P > 0.05). Table 7 The alpha diversity indexes of ruminal fungi CONT 1 FT1 FT2 P value Effect size η 2 Feature 794.67 ± 49.56 733.00 ± 35.46 793.17 ± 21.16 0.43 0.106 ACE 794.71 ± 49.56 733.07 ± 35.49 793.31 ± 21.13 0.43 0.106 Chao1 794.71 ± 49.56 733.07 ± 35.49 793.31 ± 21.13 0.43 0.106 Simpson 0.98 ± 0.003 0.98 ± 0.001 0.99 ± 0.001 0.61 0.064 Shannon 8.22 ± 0.17 7.93 ± 0.12 8.23 ± 0.03 0.197 0.194 1 CONT = the control group, FT1 = 10% FML group, FT2 = 20% FML group, N = 6. 3.9 Composition and Structure of Ruminal Fungi As shown in Fig. 5 , at the phylum level (Fig. 5 a), the relative abundance of Rozellomycota in the FT1 group was significantly downregulated compared to the CONT group (Fig. 5 b, P < 0.05), whereas the relative abundance of Olpidiomycota in the FT2 group was significantly upregulated compared to the FT1 group (Fig. 5 c, P < 0.05). Treatment with FML altered the relative abundance of various fungal microbiota at the genus level (Fig. 5 d). Compared to the CONT group, the relative abundances of unclassified_Thelephoraceae , Stachybotry were significantly lower in the FT1 group (Fig. 5 e, P 3.0 and P 3; P 3, P 3, P < 0.05). 3.10 Rumen Fungal Function The FUNGuild software was used to predict the effects of rumen fungal functions on hosts based on the measured fungal data. As shown in Fig. 6 , the relative abundance of the “Pathotroph” phenotype was increased compared to the FT1 group, whereas the “Saprotroph” phenotype was significantly decreased in the FT2 group ( P < 0.05), indicating that 20% FML may increase the risk of rumen fungal disease in fattening Hu sheep compared to FT1 group. 3.11 Correlation Analysis Correlation analyses of the indices of apparent digestibility, rumen fermentation parameters, differential rumen microbiota, and fungi are shown in Fig. 8 . Ruminal bacteria were highly correlated with apparent digestibility. The unclassified_Bacteroidales_RF16_group , unclassified_Selenomonadaceae , and Prevotellaceae_UCG_003 were positively correlated with the apparent digestibility of ADF, CP, and DM ( P < 0.05). Saccharofermentans, [Eubacterium]_ventriosum_group, Candidatus_Saccharimonas, Ruminococcaceae_UCG_001 , and Succiniclasticum were negatively correlated with the apparent digestibility of ADF and CP ( P < 0.05). Moreover, the concentration of fatty acids in the rumen is highly correlated with ruminal fungi. The concentrations of acetate, propionate, valerate, and NH 3 -N were negatively correlated with Trimorphomycetaceae and Saitozyma ( P < 0.05). Furthermore, valerate concentration was positively correlated with Diymellaceae , and Hannaellazeae was negatively correlated with NH 3 -N ( P < 0.05). 4. Discussion This study investigated the effects of replacing concentrate with FML on the growth performance, rumen fermentation, and rumen microbial and fungal community structures of fattening Hu sheep under heat stress conditions. To the best of our knowledge, no research experiments have been conducted on FML as a partial concentrate replacer in sheep under natural heat stress. The combined use of ITS and 16S sequencing further reveals the true state of ruminal fungi and bacteria. This study has advanced contemporary methodological depth. 4.1 Changes in Growth Performances ADG is a crucial metric in modern animal husbandry that directly reflects the economic value of farmed animals. Various substances have been studied to improve ADG, including organic acids, biological enzymes, and probiotics (Bello et al. 2025 ; Lai et al. 2025 ; Lu et al. 2023 ). These substances function by enhancing feed efficiency or animal health (Mehrban et al. 2021 ). The multifunctional properties of ML and their active ingredients are widely recognized (Cui et al. 2024 ; Cui et al. 2022 ; Hu et al. 2019 ). Regulation of antioxidant, immune, glucose, and lipid metabolism suggests that ML could serve as functional protein feed to improve animal health. However, some previous studies indicate that ML treatment did not impact ADG or final body weight (Ouyang et al. 2019 ; Sun et al. 2020 ; Wang and Luo 2021 ). Among these studies, the usage of ML in proportions ranging from 5% to 32%. These results suggested that ML may not be effective for promoting growth. FML are a stable microbial product containing biological enzymes, probiotics, active compounds from ML, and organic acids generated through fermentation. This makes it a versatile feed ingredient. Previous studies revealed the regulatory function of FML in lipid metabolism (Cui et al. 2024 ; Hou et al. 2024 ). Moreover, under conditions of excessive energy consumption, FML can decrease the loss of both backfat thickness and body weight (Zhang et al. 2021b ). FML exhibit beneficial protective effects on livestock. Thus, our results indicate that FML can lower FCR, which may be a combined result of its regulatory functions. Moreover, FML are more cost-effective than dried ML and mulberry leaf powder because they do not need prior processing like drying and fine grinding. Additionally, their price is lower than that of commercial concentrate. As shown in this study, using FML as a substitute for Concentrate could reduce breeding costs. On the other hand, FML have a shelf life of more than six months, making them suitable for commercial transportation as raw materials. They can also serve as reserve supplies to address varying climatic conditions or provide extra feed during extreme weather. 4.2 Changes in Apparent Digestibility The impact of ML on the apparent digestibility of ruminants has been extensively documented. A previous study revealed that mulberry leaf treatments increased the apparent digestibility of organic matter (OM) and NDF in fattening Hu sheep (Ouyang et al. 2019 ). Studies have shown that ML treatments did not affect ADG, FCR, or body weight, but increase the apparent digestibility of DM, OM, and ADF (Sun et al. 2020 ; Wang and Luo 2021 ). In this study, FML exhibits a regulatory effect on the apparent digestibility of nutrients, similar with that of ML. The regulatory effects of FML may be closely linked to their diverse active components. Supplementary ML flavonoids improved the apparent digestibility of CP and NDF (Ma et al. 2017 ). Moreover, it has been shown that 1-deoxynojirimycin isolated from ML decreases serum glucose and insulin levels (Hu et al. 2019 ). However, insulin inhibits food intake through the central nervous system (Kullmann et al. 2020 ; Schur and Tong 2022 ). Furthermore, dietary supplementation with mulberry leaf flavonoids improves the apparent digestibility of nitrogen and NDF (Ma et al. 2017 ). Thus, active ingredients originating from ML may at least partially improve digestion. 4.3 Changes in Ruminal Fermentation The rumen is a fermentation-like organ in ruminants. Temperature, feed composition, and microorganisms all affect fermentation efficiency. Organic acids or NH 3 -N are products absorbed by ruminal epithelial cells that provide the main energy substances for ruminant production (Li et al. 2016 ; Liu et al. 2018 ). Mulberry leaf supplementation influence the concentration of NH 3 -N, acetate, and butyrate in sheep (Ouyang et al. 2019 ; Sun et al. 2020 ). This study has reported that FML increase ruminal concentrations of NH 3 -N, acetate, propionate, and valerate in fattening Hu sheep. The consistent results in our study may be related to the presence of mulberry leaf fibers and active ingredients. Previous studies have shown that 1-deoxynojirimycin and flavonoids from ML also alter the concentration of volatile fatty acid (Hu et al. 2019 ; Ma et al. 2017 ). The inconsistent results of our study may be associated with the use of probiotics during fermentation. The addition of Saccharomyces cerevisiae leads to an increase in the concentrations of NH 3 -N, acetate, propionate, and valerate in dairy cows (Zhang et al. 2024 ). Marlida et al. ( 2023 ) reported probiotic ( Lactobacillus plantarum and S. cerevisiae ) supplementation significantly increased the content of NH 3 and total volatile fatty acid (TVFA) (Marlida et al. 2023 ). An in vitro experiment indicated that Bacillus subtilis improved ruminal NH 3 -N and propionate concentrations (Chang et al. 2021 ). Thus, the replacement of concentrate in Hu sheep with FML appeared to improve the fermentation efficiency. 4.4 Changes in Ruminal Microorganisms and Fungi The present study revealed that 10% concentrate replaced by FML resulted in an increased relative abundance of bacteria, such as Prevotellaceae and Selenomonadaceae. It has previously been reported that the levels of Prevotellaceae and Selenomonadaceae decreased following probiotic Lactobacillus supplementation in overweight individuals (Mo et al. 2022 ). This might demonstrate the regulatory effects in our treatment were similar to that of probiotics. A previous study showed that [Eubacterium]_ventriosum_group was enriched under severe heat stress condition in the rumen of lambs (Li et al. 2024 ). [Eubacterium]_ventriosum_group always shows the risk of a dangerous physiological state (Li and Lu 2023 ; Liu et al. 2022 ). We observed a decrease in the relative abundance of bacteria [Eubacterium]_ventriosum_group affected by the FML. Thus, FML improved their weak physiological state under heat stress conditions. Moreover, replacing 20% concentrate with FML resulted in a decrease in Gram-negative bacteria, whereas Gram-positive bacteria increased. These changes might indicate that ruminal acidosis results in increased lipopolysaccharide concentrations in the ruminal fluid (Monteiro and Faciola 2020 ). This may be the reason why the FT2 group had more FML but had no improvement effect. Candida has been used as a probiotics to improve the production efficiency and the health of cattle and goats (Kong et al. 2019 ; Lu et al. 2023 ). Aspergillus culture is a new feed additive that improves feed digestibility in Hu sheep (Guo et al. 2022 ). The enrichment of Candida and Aspergillus in the FT1 group might display a healthy state in Hu sheep. Consistent with these results, our predictive analysis of rumen fungal functions also revealed that the FT1 group possessed less “Pathotroph” phenotype and more “Saprotroph” phenotype than that in the FT2 group. The lack of research data related to fungi limits the further interpretation of our results. Study Limitations The experiment took place on the field in a high-THI summer instead of in a lab or climate chamber. This strengthens the external validity of results and practicality, while establishing a control group free from heat stress proved challenging. Therefore, it is unclear if the effects of FML would apply equally under normal conditions or if they are special to decrease heat stress. Studies with small sample sizes, compared to those required by a power analysis, may result in false negatives. Thus, six is the small sample size used in microbiological analysis. We chose to collect rumen fluid before feeding in the morning; however, the single sampling time point may be insufficient to capture the dynamic changes in the rumen environment and microbial community. Moreover, due to restrictions at the farm, the calculation of feed intake for this experiment was done on a pen-by-pen basis, which resulted in some individual differences being masked. Additionally, the microbial studies are correlated; no functional validation exists. Furthermore, this study does not assess the long-term effects of FML inclusion on carcass characteristics, immune health, reproductive performance, or health markers, which are crucial for practical application. Conclusion In mild heat stress, replacing 10% of concentrate with FML enhanced feed conversion ratio, nutrient digestibility, and rumen microbial populations, so presumably enhancing fermentation efficiency. FML may make Hu sheep more beneficial for Hu sheep as a partial concentrate replacement. Declarations Animal Ethics Declaration From June to September 2022, this study was conducted on a fattening sheep breeding farm in Zaoyang City, Hubei Province. The animal study was conducted in accordance with the ethical guidelines for animal research established and approved by the Institutional Animal Care and Use Committee at the Hubei Academy of Agricultural Sciences (HBAAS20220007). Authorship contribution Jintao Wei: Supervision, Resources, Conceptualization, Validation. Qiwen Fan: Writing – original draft, Investigation, Formal analysis, Data curation, Conceptualization. Fang Chen: Writing – original draft. Wenjing Tao: Writing – review & editing, Data curation. Encun Du: Supervision, Methodology. Na Zhao: Supervision, Writing – review & editing. Wanzheng Guo: Investigation, Formal analysis. Jing Huang and Feng Jin: Investigation. Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Funding Declaration This work was supported by Hubei Special Project for Technological Innovation [Grant Nos.2022BEC039], Hubei Innovation Center of Agricultural Science and Technology [Grant Nos. 2021-620-000-001-021], Hubei Technology Innovation Plan Project [Grant Nos.2024BBB112], and Youth Science Foundation of Hubei Academy of Agricultural Sciences [Grant Nos. 2024NKYJJ20]. Acknowledgments We also acknowledge other researchers and students for providing management and skills. References Bagath M, Krishnan G, Devaraj C, Rashamol VP, Pragna P, Lees AM, Sejian V (2019) The impact of heat stress on the immune system in dairy cattle: A review. Res Vet Sci 126:94-102 doi:10.1016/j.rvsc.2019.08.011 Bello A, Haldar S, Ghane AE, de Kreij A, Hardy R, Dersjant-Li Y (2025) Application of a minerals, digestible amino acids and energy matrix to a broiler diet supplemented with a bacterial 6-phytase maintained growth performance and reduced feed costs compared to a minerals matrix alone. Poult Sci 104(9):105407 doi:10.1016/j.psj.2025.105407 Bouroutzika EV, Theodosiadou EK, Barbagianni MS, Papadopoulos S, Katsogiannou EG, Kalogiannis D, Chadio S, Skaperda Z, Kouretas D, Valasi I (2022) Redox Status and Hematological Variables in Melatonin-Treated Ewes during Early Pregnancy under Heat Stress. Vet Sci 9(9):499 doi:10.3390/vetsci9090499 Broderick GA, Kang JH (1980) Automated simultaneous determination of ammonia and total amino acids in ruminal fluid and in vitro media. J Dairy Sci 63(1):64-75 doi:10.3168/jds.S0022-0302(80)82888-8 Chang M, Ma F, Wei J, Liu J, Nan X, Sun P (2021) Live Bacillus subtilis natto Promotes Rumen Fermentation by Modulating Rumen Microbiota In Vitro. Animals 11(6):1519 doi:10.3390/ani11061519 Chen Y, Meng F, Liu Y, Zhu C, Ling Y, Liu C, Li L, Liu Y, He X, Cao J, Zhang Y (2024) Effects of resveratrol on DLD and NDUFB9 decrease in frozen semen of Mongolian sheep. Cryobiology 114:104791 doi:10.1016/j.cryobiol.2023.104791 Cui X, Yang Y, Zhang M, Bao L, Jiao F, Liu S, Wang H, Wei X, Qian W, Shi X, Su C, Qian Y (2024) Mulberry leaves supplementation alters lipid metabolism and promotes fatty acid β oxidation in growing mutton sheep. J Anim Sci 102:skae076 doi:10.1093/jas/skae076 Cui X, Yang Y, Zhang M, Liu S, Wang H, Jiao F, Bao L, Lin Z, Wei X, Qian W, Shi X, Su C, Qian Y (2022) Transcriptomics and metabolomics analysis reveal the anti-oxidation and immune boosting effects of mulberry leaves in growing mutton sheep. Front Immunol 13:1088850 doi:10.3389/fimmu.2022.1088850 Dhanyalakshmi KH, Nataraja KN (2018) Mulberry (Morus spp.) has the features to treat as a potential perennial model system. Plant Signal Behav 13(8):e1491267 doi:10.1080/15592324.2018.1491267 Du E, Guo W, Zhao N, Chen F, Fan Q, Zhang W, Huang S, Zhou G, Fu T, Wei J (2022) Effects of diets with various levels of forage rape (Brassica napus) on growth performance, carcass traits, meat quality and rumen microbiota of Hu lambs. J Sci Food Agric 102(3):1281-1291 doi:10.1002/jsfa.11466 Du Y, Zhang R, Zheng XX, Zhao YL, Chen YL, Ji S, Guo MZ, Tang DQ (2024) Mulberry (Morus alba L.) leaf water extract attenuates type 2 diabetes mellitus by regulating gut microbiota dysbiosis, lipopolysaccharide elevation and endocannabinoid system disorder. J Ethnopharmacol 323:117681 doi:10.1016/j.jep.2023.117681 Eom JS, Choi Y, J. LS, S. KH, U. JS, D. B, H. LD, T. KE, B. KS, S. LS (2024) Integrated analysis of rumen metabolomics and metataxonomics to understand changes in metabolic and microbial community in Korean native goats under heat stress. Sci Rep 14(1):31416 doi:10.1038/s41598-024-83017-y Guo L, Zhang D, Du R, Li F, Li F, Ran T (2022) Supplementation of Aspergillus oryzae Culture Improved the Feed Dry Matter Digestibility and the Energy Supply of Total Volatile Fatty Acid Concentrations in the Rumen of Hu Sheep. Front Nutr 9:847156 doi:10.3389/fnut.2022.847156 Hou J, Ji X, Chu X, Shi Z, Wang B, Sun K, Wei H, Song Z, Wen F (2024) Comprehensive lipidomic analysis revealed the effects of fermented Morus alba L. intake on lipid profile in backfat and muscle tissue of Yuxi black pigs. J Anim Physiol Anim Nutr (Berl) 108(3):764-777 doi:10.1111/jpn.13932 Hu TG, Wen P, Shen WZ, Liu F, Li Q, Li EN, Liao ST, Wu H, Zou YX (2019) Effect of 1-Deoxynojirimycin Isolated from Mulberry Leaves on Glucose Metabolism and Gut Microbiota in a Streptozotocin-Induced Diabetic Mouse Model. J Nat Prod 82(8):2189-2200 doi:10.1021/acs.jnatprod.9b00205 Jung JS, Kim D, Singaravelu A, Soundharrajan I, Choi KC (2025) Dietary Fermentation with Lactobacillus sp. and Bacillus sp. Modulates Rumen Transcriptomic and Microbiota Profiles in Bos taurus. Int J Mol Sci 26(14):6816 doi:10.3390/ijms26146816 Kang L, Han X, Zhang Z, Sun OJ (2007) Grassland ecosystems in China: review of current knowledge and research advancement. Philos Trans R Soc Lond B Biol Sci 362(1482):997-1008 doi:10.1098/rstb.2007.2029 Keum GB, Pandey S, Kim ES, Doo H, Kwak J, Ryu S, Choi Y, Kang J, Kim S, Kim HB (2024) Understanding the Diversity and Roles of the Ruminal Microbiome. J Microbiol 62(3):217-230 doi:10.1007/s12275-024-00121-4 Kong L, Yang C, Dong L, Diao Q, Si B, Ma J, Tu Y (2019) Rumen Fermentation Characteristics in Pre- and Post-Weaning Calves upon Feeding with Mulberry Leaf Flavonoids and Candida tropicalis Individually or in Combination as a Supplement. Animals 9(11):990 doi:10.3390/ani9110990 Kullmann S, Kleinridders A, Small DM, Fritsche A, Häring HU, Preissl H, Heni M (2020) Central nervous pathways of insulin action in the control of metabolism and food intake. Lancet Diabetes Endocrinol 8(6):524-534 doi:10.1016/s2213-8587(20)30113-3 Lai Y, Liu L, Li Z, Li L, Wang R, Zhou F, Qu Z, Hu J, Guo S, Zhang B (2025) Dietary compounded traditional Chinese medicine residue meal improves laying performance, egg quality, and gut barrier integrity in late-phase laying hens. Poult Sci 104(9):105425 doi:10.1016/j.psj.2025.105425 Lee C, Hristov AN (2013) Short communication: Evaluation of acid-insoluble ash and indigestible neutral detergent fiber as total-tract digestibility markers in dairy cows fed corn silage-based diets. J Dairy Sci 96(8):5295-5299 doi:10.3168/jds.2012-6442 Lees AM, Lees JC, Lisle AT, Sullivan ML, Gaughan JB (2018) Effect of heat stress on rumen temperature of three breeds of cattle. Int J Biometeorol 62(2):207-215 doi:10.1007/s00484-017-1442-x Leeuwendaal NK, Stanton C, O'Toole PW, Beresford TP (2022) Fermented Foods, Health and the Gut Microbiome. Nutrients 14(7):1527 doi:10.3390/nu14071527 Li B, Wu K, Duan G, Yin W, Lei M, Yan Y, Ren Y, Zhang C (2024) Folic Acid and Taurine Alleviate the Impairment of Redox Status, Immunity, Rumen Microbial Composition and Fermentation of Lambs under Heat Stress. Animals 14(7):998 doi:10.3390/ani14070998 Li C, Lu P (2023) Association of Gut Microbiota with Age-Related Macular Degeneration and Glaucoma: A Bidirectional Mendelian Randomization Study. Nutrients 15(21):4646 doi:10.3390/nu15214646 Li D, Zhang Y, Cui Z, He L, Chen W, Meng Q, Ren L (2016) Effects of Phytoecdysteroids (PEDS) Extracted from Cyanotis arachnoidea on Rumen Fermentation, Enzyme Activity and Microbial Efficiency in a Continuous-Culture System. PloS One 11(4):e0153584 doi:10.1371/journal.pone.0153584 Liu B, Ye D, Yang H, Song J, Sun X, Mao Y, He Z (2022) Two-Sample Mendelian Randomization Analysis Investigates Causal Associations Between Gut Microbial Genera and Inflammatory Bowel Disease, and Specificity Causal Associations in Ulcerative Colitis or Crohn's Disease. Front Immunol 13:921546 doi:10.3389/fimmu.2022.921546 Liu Q, Wang C, Guo G, Huo WJ, Zhang YL, Pei CX, Zhang SL, Wang H (2018) Effects of isovalerate supplements on morphology and functional gene expression of rumen mucosa in pre- and post-weaning dairy calves. Animal 12(3):491-500 doi:10.1017/s175173111700194x Lu J, Chen Z, Chen P, Li Z, Wan Y, Song Y, Wang F, Zhang Y (2023) Dietary potential probiotics and enzymes complex modulates the performance and rumen microbiota in weaned goats. J Appl Microbiol 134(2) doi:10.1093/jambio/lxac079 Luo Y, Gao S, Sun A, Li J, Li H, Yi K, Hu R, Yang B (2025) Supplementation with mulberry leaves improves growth performance and meat quality of Xiangdong black goats. Anim Biosci 38(3):466-474 doi:10.5713/ab.24.0427 Ma T, Chen DD, Tu Y, Zhang NF, Si BW, Diao QY (2017) Dietary supplementation with mulberry leaf flavonoids inhibits methanogenesis in sheep. Anim Sci J 88(1):72-78 doi:10.1111/asj.12556 Maqsood M, Anam Saeed R, Sahar A, Khan MI (2022) Mulberry plant as a source of functional food with therapeutic and nutritional applications: A review. J Food Biochem 46(11):e14263 doi:10.1111/jfbc.14263 Marlida Y, Harnentis H, Nur YS, Ardani LR (2023) New probiotics (Lactobacillus plantarum and Saccharomyces cerevisiae) supplemented to fermented rice straw-based rations on digestibility and rumen characteristics in vitro. J Adv Vet Anim Res 10(1):96-102 doi:10.5455/javar.2023.j657 Mehrban H, Naserkheil M, Lee DH, Ibáñez-Escriche N (2021) Genetic parameters and correlations of related feed efficiency, growth, and carcass traits in Hanwoo beef cattle. Anim Biosci 34(5):824-832 doi:10.5713/ajas.20.0135 Mo SJ, Lee K, Hong HJ, Hong DK, Jung SH, Park SD, Shim JJ, Lee JL (2022) Effects of Lactobacillus curvatus HY7601 and Lactobacillus plantarum KY1032 on Overweight and the Gut Microbiota in Humans: Randomized, Double-Blinded, Placebo-Controlled Clinical Trial. Nutrients 14(12):2484 doi:10.3390/nu14122484 Monteiro HF, Faciola AP (2020) Ruminal acidosis, bacterial changes, and lipopolysaccharides. J Anim Sci 98(8): skaa248 doi:10.1093/jas/skaa248 Moraïs S, Mizrahi I (2019) Islands in the stream: from individual to communal fiber degradation in the rumen ecosystem. FEMS Microbiol Rev 43(4):362-379 doi:10.1093/femsre/fuz007 Ouyang J, Wang M, Hou Q, Feng D, Pi Y, Zhao W (2019) Effects of Dietary Mulberry Leaf Powder in Concentrate on the Rumen Fermentation and Ruminal Epithelium in Fattening Hu Sheep. Animals 9(5):218 doi:10.3390/ani9050218 Pragna P, Sejian V (2018) Comparative assessment of growth performance of three different indigenous goat breeds exposed to summer heat stress. 102(4):825-836 doi:10.1111/jpn.12892 Schur EA, Tong J (2022) Insulin Action to Inhibit Food Intake: Is It All in Your Head? J Clin Endocrinol Metab 107(2):e874-e876 doi:10.1210/clinem/dgab661 Sun H, Luo Y, Zhao F, Fan Y, Ma J, Jin Y, Hou Q, Ahmed G, Wang H (2020) The Effect of Replacing Wildrye Hay with Mulberry Leaves on the Growth Performance, Blood Metabolites, and Carcass Characteristics of Sheep. Animals 10(11):2018 doi:10.3390/ani10112018 Van Soest PJ, Robertson JB, Lewis BA (1991) Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 74(10):3583-3597 doi:10.3168/jds.S0022-0302(91)78551-2 Wang B, Luo H (2021) Effects of mulberry leaf silage on antioxidant and immunomodulatory activity and rumen bacterial community of lambs. BMC Microbiol 21(1):250 doi:10.1186/s12866-021-02311-1 Wang R, Wang X, Xiong Y (2024) Dietary Paper Mulberry Silage Supplementation Improves the Growth Performance, Carcass Characteristics, and Meat Quality of Yangzhou Goose. Animals 14(3):359 doi:10.3390/ani14030359 Wang Y, Zhao Y, Xue F, Nan X, Wang H, Hua D, Liu J, Yang L, Jiang L, Xiong B (2020) Nutritional value, bioactivity, and application potential of Jerusalem artichoke (Helianthus tuberosus L.) as a neotype feed resource. Anim Nutr 6(4):429-437 doi:10.1016/j.aninu.2020.09.001 Xie HH, Wei JG, Liu F, Pan XH, Yang XB (2014) First Report of Mulberry Root Rot Caused by Lasiodiplodia theobromae in China. Plant Dis 98(11):1581 doi:10.1094/pdis-03-14-0261-pdn Xue L, Zhou S, Wang D, Zhang F, Li J, Cai L (2022) The Low Dose of Saccharomyces cerevisiae Is Beneficial for Rumen Fermentation (Both In Vivo and In Vitro) and the Growth Performance of Heat-Stressed Goats. Microorganisms 10(10):1877 doi:10.3390/microorganisms10101877 Yu Z, Cantet JM, Paz HA, Kaufman JD, Orellano MS, Ipharraguerre IR, Ríus AG (2024) Heat stress-associated changes in the intestinal barrier, inflammatory signals, and microbiome communities in dairy calves. J Dairy Sci 107(2):1175-1196 doi:10.3168/jds.2023-23873 Zhang M, Warner RD, Dunshea FR, DiGiacomo K, Joy A, Abhijith A, Osei-Amponsah R, Hopkins DL, Ha M, Chauhan SS (2021a) Impact of heat stress on the growth performance and retail meat quality of 2nd cross (Poll Dorset × (Border Leicester × Merino)) and Dorper lambs. Meat Science 181:108581 doi:10.1016/j.meatsci.2021.108581 Zhang Q, Ma L, Zhang X, Jia H, Tana, Guo Y, Zhang J, Wang J (2024) Feeding live yeast (Saccharomyces cerevisiae) improved performance of mid-lactation dairy cows by altering ruminal bacterial communities and functions of serum antioxidation and immune responses. BMC Vet Res 20(1):245 doi:10.1186/s12917-024-04073-0 Zhang Y, Yin C, Schroyen M, Everaert N, Ma T, Zhang H (2021b) Effects of the Inclusion of Fermented Mulberry Leaves and Branches in the Gestational Diet on the Performance and Gut Microbiota of Sows and Their Offspring. Microorganisms 9(3):604 doi:10.3390/microorganisms9030604 Zheng XX, Li DX, Li YT, Chen YL, Zhao YL, Ji S, Guo MZ, Du Y, Tang DQ (2023) Mulberry leaf water extract alleviates type 2 diabetes in mice via modulating gut microbiota-host co-metabolism of branched-chain amino acid. Phytother Res 37(8):3195-3210 doi:10.1002/ptr.7822 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 20 Apr, 2026 Read the published version in Applied Microbiology and Biotechnology → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7903162","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":547734747,"identity":"42f5a4f3-0b86-4de8-bfad-e27671a292e8","order_by":0,"name":"Qiwen Fan","email":"","orcid":"","institution":"Hubei Academy of Agricultural Scienses","correspondingAuthor":false,"prefix":"","firstName":"Qiwen","middleName":"","lastName":"Fan","suffix":""},{"id":547734748,"identity":"a7afeb86-49db-4ede-b749-a4da75359252","order_by":1,"name":"Fang Chen","email":"","orcid":"","institution":"Hubei Academy of Agricultural Scienses","correspondingAuthor":false,"prefix":"","firstName":"Fang","middleName":"","lastName":"Chen","suffix":""},{"id":547734749,"identity":"2bfbca97-7cb3-4864-8470-e5225e952005","order_by":2,"name":"Wenjing Tao","email":"","orcid":"","institution":"Hubei Academy of Agricultural Scienses","correspondingAuthor":false,"prefix":"","firstName":"Wenjing","middleName":"","lastName":"Tao","suffix":""},{"id":547734750,"identity":"9a407020-4162-452b-9405-f9ab98c0013c","order_by":3,"name":"Encun Du","email":"","orcid":"","institution":"Hubei Academy of Agricultural Scienses","correspondingAuthor":false,"prefix":"","firstName":"Encun","middleName":"","lastName":"Du","suffix":""},{"id":547734751,"identity":"ed56b154-df46-4797-bd51-daf1f7c08fca","order_by":4,"name":"Na Zhao","email":"","orcid":"","institution":"Hubei Academy of Agricultural Scienses","correspondingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Zhao","suffix":""},{"id":547734752,"identity":"fcd57931-0883-457d-809d-0b6ae77f4964","order_by":5,"name":"Wanzheng Guo","email":"","orcid":"","institution":"Hubei Academy of Agricultural Scienses","correspondingAuthor":false,"prefix":"","firstName":"Wanzheng","middleName":"","lastName":"Guo","suffix":""},{"id":547734753,"identity":"327f5f6f-ff59-4b76-b18b-51577873ae24","order_by":6,"name":"Jing Huang","email":"","orcid":"","institution":"Hubei Academy of Agricultural Scienses","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Huang","suffix":""},{"id":547734754,"identity":"3b08c590-8881-4845-9a0f-d10b39f4d5c5","order_by":7,"name":"Feng Jin","email":"","orcid":"","institution":"Hubei Academy of Agricultural Scienses","correspondingAuthor":false,"prefix":"","firstName":"Feng","middleName":"","lastName":"Jin","suffix":""},{"id":547734755,"identity":"59352718-c245-4958-9d8e-e643c595589d","order_by":8,"name":"Jintao Wei","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwUlEQVRIiWNgGAWjYBACxmYwJcHDxt7Y+PADkVoYGxgYbOT4eA43G0sQaxFQS5qxnER6mwAPMeqZ23mPP/hRcTixTfJhG4MEg52cbgNBh/ElNvacAWqRTmx7UMCQbGx2gKAWHsMG3jawlnYDCYYDiduI0dL4F6RF8mCbBA+xWpp529KM2SQYSdAyW+aMjRwbTyIwkA2I8Ith/xmDj28qJHjk248/fPihwk6OsJYGFK4BAeUgIE+EmlEwCkbBKBjpAADU0T+sk1JMWAAAAABJRU5ErkJggg==","orcid":"","institution":"Hubei Academy of Agricultural Scienses","correspondingAuthor":true,"prefix":"","firstName":"Jintao","middleName":"","lastName":"Wei","suffix":""}],"badges":[],"createdAt":"2025-10-20 07:38:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7903162/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7903162/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00253-026-13819-9","type":"published","date":"2026-04-20T15:59:12+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":96817075,"identity":"7a627958-c7d7-473c-9e7f-f82447cf3e5a","added_by":"auto","created_at":"2025-11-26 11:23:02","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1072125,"visible":true,"origin":"","legend":"","description":"","filename":"revisedmanuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/9602646703338677a1d30413.docx"},{"id":96917892,"identity":"7599cce6-6b11-47c7-8896-1f81d8cba70c","added_by":"auto","created_at":"2025-11-27 14:10:41","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10750,"visible":true,"origin":"","legend":"","description":"","filename":"0df3ae94f70d4e8eb13a628d837941e2.json","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/c090e0eac0985ccc45179aeb.json"},{"id":96817051,"identity":"749a943c-cfd3-4df6-9bb9-abe8e4caffd8","added_by":"auto","created_at":"2025-11-26 11:22:56","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":183150,"visible":true,"origin":"","legend":"","description":"","filename":"0df3ae94f70d4e8eb13a628d837941e21enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/4d6a930474665f2d1a7df8cd.xml"},{"id":96918358,"identity":"370fced8-60b8-4c9d-873c-94ddf6b64e0f","added_by":"auto","created_at":"2025-11-27 14:11:49","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":21868,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/9e4d709fd2a724fd08d5ac34.png"},{"id":96917931,"identity":"93ec0bdf-dc46-4096-a95f-97e84a0d2c30","added_by":"auto","created_at":"2025-11-27 14:10:46","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":136061,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/d8ad1ab43270e16610b48660.png"},{"id":96817053,"identity":"a047f939-3d83-42bd-a345-3239c2855b59","added_by":"auto","created_at":"2025-11-26 11:22:56","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":165198,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/e75eeab41928e760670cfdc1.png"},{"id":96817063,"identity":"691929bd-5fef-41e5-aee3-4299b59e8532","added_by":"auto","created_at":"2025-11-26 11:22:56","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":85641,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/e76cb98b5f538906e5f55d99.png"},{"id":96817067,"identity":"359dd296-7d92-43c4-9f09-4f4b1f022b58","added_by":"auto","created_at":"2025-11-26 11:22:56","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":116782,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/b1d93f61df883951c81789b0.png"},{"id":96917309,"identity":"00560401-8f4d-42b6-85a4-9c26d4b85d4e","added_by":"auto","created_at":"2025-11-27 14:09:31","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":105232,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/a4ce37ad7debc1f0fb42c4e9.png"},{"id":96817069,"identity":"350ac05d-0e81-48a0-b38f-fe61b9880ebe","added_by":"auto","created_at":"2025-11-26 11:22:56","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":28055,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/07c05faa0411570f854c914c.png"},{"id":96817074,"identity":"b67cba18-077a-4239-adb8-31f3789be555","added_by":"auto","created_at":"2025-11-26 11:22:57","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":282686,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/d003e8f332c437d45c1f1921.jpeg"},{"id":96917299,"identity":"84a5be51-3652-4b87-86c9-6c8fd4459dac","added_by":"auto","created_at":"2025-11-27 14:09:31","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6014,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/138bea37460e6c3add62b43a.png"},{"id":96916306,"identity":"ee529119-fdaf-4dc3-8e08-5e0fbcdbd95d","added_by":"auto","created_at":"2025-11-27 14:08:27","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17246,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/e67424522d024b6ca9172fe9.png"},{"id":96817059,"identity":"1e3feec4-e501-4abe-87fa-2e578750c06c","added_by":"auto","created_at":"2025-11-26 11:22:56","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":33930,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/b24f2e52ed6742225283357d.png"},{"id":96916508,"identity":"40853223-dd5d-4c72-8c76-6b2f6cbfeec6","added_by":"auto","created_at":"2025-11-27 14:08:40","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14886,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/13e674e0e59cda11da71e6e6.png"},{"id":96817065,"identity":"412c807f-1da6-4bb6-9055-e5e5a45bc5d5","added_by":"auto","created_at":"2025-11-26 11:22:56","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":26512,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/50dbcb203e4c8da1418dabce.png"},{"id":96817068,"identity":"33992b52-05e4-473a-b3f5-4a881a8a6c53","added_by":"auto","created_at":"2025-11-26 11:22:56","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":21003,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/06be256713566cee9316ff5d.png"},{"id":96817070,"identity":"c1a06126-5540-4d37-9ab8-8f45fac51732","added_by":"auto","created_at":"2025-11-26 11:22:57","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6601,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/99f291d78dd6126e519efec3.png"},{"id":96817066,"identity":"09ca162c-5eea-4c67-8034-3e4e45f41f7c","added_by":"auto","created_at":"2025-11-26 11:22:56","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":41691,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/bddc742a01103b1cef0ca5bc.png"},{"id":96817071,"identity":"b5101f3f-0304-4db2-b15d-8afb01febe7a","added_by":"auto","created_at":"2025-11-26 11:22:57","extension":"xml","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":182984,"visible":true,"origin":"","legend":"","description":"","filename":"0df3ae94f70d4e8eb13a628d837941e21structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/3357be274e8a3dc170abb24c.xml"},{"id":96817073,"identity":"9509f4bb-ae55-4754-8ec3-394e4af10808","added_by":"auto","created_at":"2025-11-26 11:22:57","extension":"html","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":194151,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/10d1e5b1dc8f219b91508624.html"},{"id":96817046,"identity":"213bbd62-f15c-4fc7-9377-6e8ba07b2179","added_by":"auto","created_at":"2025-11-26 11:22:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":58155,"visible":true,"origin":"","legend":"\u003cp\u003eThe experimental flow\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/4ba1cdb8c6590942d8d20101.png"},{"id":96817047,"identity":"f6dac525-ceb0-4217-8d80-6ac01f051b9a","added_by":"auto","created_at":"2025-11-26 11:22:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":156380,"visible":true,"origin":"","legend":"\u003cp\u003eTHI and ADG during trial period. CONT = the control group, FT1 = 10% FML group, FT2 = 20% FML group; * \u003cem\u003eP\u003c/em\u003e≤ 0.05; N = 13\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/a48012f072fe947f344f9b32.png"},{"id":96917704,"identity":"0fc8f23b-ad2f-40fc-9f6f-1800a3969f25","added_by":"auto","created_at":"2025-11-27 14:10:26","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":216175,"visible":true,"origin":"","legend":"\u003cp\u003eConvention in counts of bacterial phylums and genera. a, The relative abundance of bacteria at phylum level in each group. b, the relative abundance of differential microbiota at the phylum level in each group. c, The relative abundance of bacteria at genus level in each group. d, the relative abundance of differential microbiota at the genus level in each group (relative abundance \u0026gt; 1%). CONT = the control group, FT1 = 10% FML group, FT2 = 20% FML group, N = 6. *, \u003cem\u003eP\u003c/em\u003e ≤ 0.05; **, \u003cem\u003eP\u003c/em\u003e ≤ 0.01.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/23bdff683ce609b765eaf2ad.png"},{"id":96918324,"identity":"70d27dcc-2cff-4d14-9af0-acd4278d92a9","added_by":"auto","created_at":"2025-11-27 14:11:44","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":131923,"visible":true,"origin":"","legend":"\u003cp\u003eBacterial functional potential prediction. a, BugBase analysis of microbiome phenotype prediction among all the groups. b, Picrust2 predictive analysis of the altered functional composition of rumen microbiota under CONT, FT1 and FT2 groups. CONT = the control group, FT1 = 10% FML group, FT2 = 20% FML group, N = 6. *, \u003cem\u003eP\u003c/em\u003e ≤ 0.05.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/722680dc55a8ec2ca9190c75.png"},{"id":96817050,"identity":"27f19001-0d85-47f6-acce-2b66b0f87777","added_by":"auto","created_at":"2025-11-26 11:22:56","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":137813,"visible":true,"origin":"","legend":"\u003cp\u003eFungal composition and functional projections. a, the fungal microbial content at the phylum level in each group of samples, b-c, the significant differences in fungal microorganisms at the phylum level in each group of samples; d, the composition of fungal content at the genus level in each group of samples; e, the significant differences in fungal microorganisms at the genus level in each group of samples (relative abundance \u0026gt; 0.3%). CONT = the control group, FT1 = 10% FML group, FT2 = 20% FML group, N = 6. *, \u003cem\u003eP\u003c/em\u003e ≤ 0.05; **, \u003cem\u003eP\u003c/em\u003e ≤ 0.01; ***, \u003cem\u003eP\u003c/em\u003e ≤ 0.001.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/40359ef26cdffa54280f83ca.png"},{"id":96919005,"identity":"c1b0e01c-237a-45c8-a1f0-0d4213052738","added_by":"auto","created_at":"2025-11-27 14:12:58","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":186410,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of fungal characteristics in rumen fluid. The histogram of taxonomic biomarkers identified in the rumen fungal data by LEfSe analysis. CONT = the control group, FT1 = 10% FML group, FT2 = 20% FML group, N = 6.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/ce647e5cbc1873e1f9e9ca61.png"},{"id":96817055,"identity":"b9a86350-9daa-40bf-bf09-747dfaa95f4e","added_by":"auto","created_at":"2025-11-26 11:22:56","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":62050,"visible":true,"origin":"","legend":"\u003cp\u003ePredictive analysis of rumen fungal function. a-b shows “Pathotroph” and “Saprotroph” phenotype of rumen fungal functions on hosts.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/e84e0b0dc68f58e73140b69c.png"},{"id":96917716,"identity":"df89616b-acdc-4ce5-bf05-78a62a638dec","added_by":"auto","created_at":"2025-11-27 14:10:26","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":274707,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation analysis among apparent digestibility, rumen fermentation parameters, differential rumen microbiota and fungi. N = 6 per group. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/b5c937117a580dddc9b198b8.png"},{"id":107928023,"identity":"ec412100-23fe-4c9c-95f3-ab6ca8e68d69","added_by":"auto","created_at":"2026-04-27 16:06:27","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1778340,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7903162/v1/0fe31fa7-30ad-4fb9-b1e9-06356133e4c8.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Effects of Different Proportions of Concentrate Replaced by Fermented Mulberry Leaves on Growth Performance, Rumen Fermentation, Rumen Microbial and Fungal Community Structure of Heat-stressed Hu sheep","fulltext":[{"header":"Key points","content":"\u003cul start=\"50\"\u003e\n \u003cli\u003e10% FML Treatment enhanced feed conversion ratio and nutrient digestibility.\u003c/li\u003e\n \u003cli\u003e10% FML Treatment enhance the rumen fermentation efficiency\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e10% FML Treatment altered rumen bacteria and fungi populations\u003c/li\u003e\n\u003c/ul\u003e"},{"header":"1. Introduction","content":"\u003cp\u003eChina is among the countries with the richest grassland areas, accounting for 40% of its national land area. Geographically, approximately 313\u0026nbsp;million hectare of grasslands in China occur in the northern zone, concentrated in the Xizang, Inner Mongolia, Xinjiang, Qinghai, Sichuan, and Gansu Provinces (Kang et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). However, grasslands are mostly scattered throughout southern China, making it difficult to meet the needs of sheep husbandry for forage under large-scale production conditions. Nutritional researchers are committed to seeking new green feed resources in China with strong ecological adaptability and high nutritional value, such as Jerusalem artichokes (Wang et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), mulberry leaves (ML) (Maqsood et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), paper mulberry (Wang et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), and rapeseed (Du et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), to increase forage supply.\u003c/p\u003e\u003cp\u003eIn addition, the summer climate in southern China is mainly humid and hot, and livestock are prone to heat stress (HS). HS has a significant negative effect on feed intake, body weight gain (Pragna and Sejian \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2021a\u003c/span\u003e), and ewe fertility (Bouroutzika et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Ruminants are more vulnerable to the negative effects of HS. Ruminal microorganisms have a symbiotic relationship with the host. However, HS could alter the ruminal temperatures, affect hormone secretion (Bagath et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Lees et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Thus, the microbial ecosystem would be disrupted under HS conditions. Many previous studies indicated that HS affected ruminal microbial compositions, impacted the production of short-chain fatty acids, and alter inflammatory signals (Eom et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Yu et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Hu sheep are descendants of Mongolian sheep that are widely cultivated in various provinces of southern China. Although Hu sheep inherit cold, heat, and drought resistance, heat stress remains a limiting factor in sheep production (Chen et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Therefore, it is important to explore new feeds for mitigating heat stress.\u003c/p\u003e\u003cp\u003eMulberry belongs to the genus \u003cem\u003eMorus\u003c/em\u003e and is a commercial tree that has been grown for thousands of years in China and spans Asia, Europe, Africa, and the United States (Dhanyalakshmi and Nataraja \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Xie et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). ML is a widely used protein feed with fiber and various active ingredients and is involved in the regulation of antioxidant, immune, glucose, and lipid metabolism (Cui et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Cui et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Hu et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Recent studies have revealed that ML can be used as antidiabetic agents in animal models (Du et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Zheng et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Although dietary ML powder supplementation altered the apparent digestibility of nutrients, high content (20%-30%) ML powder supplementation interfered with the growth of Hu sheep (Ouyang et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Another study indicated that 15% ML supplementation showed better effects in growth performance and promoting antioxidant (Luo et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Thus, 10%-20% replacement rates might be more suitable for the Hu sheep.\u003c/p\u003e\u003cp\u003eThe tannins, phytic acid, and phytoactive components present in ML, serves as antinutritional factors, might affect the digestion and absorption of nutrients. The fermentation process can degrade these antinutritional factors by utilizing appropriate microorganisms and enzymes (Leeuwendaal et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Additionally, the use of beneficial microorganisms during the fermentation process can also improve the rumen environment (Jung et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Xue et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Moreover, after fermentation, fresh mulberry leaves (ML) have a longer shelf life, making them easier to transport and suitable for economic activities. Compared to dried ML or ML powder, fermented mulberry leaves (FML) are more affordable and easier to obtain. However, the effect of FML on heat-stressed Hu sheep remains unclear.\u003c/p\u003e\u003cp\u003eWe hypothesized that FML will alter growth performance, rumen fermentation, and rumen microbial and fungal communities. Therefore, this study investigated the effects of different proportions of concentrate replaced by FML in heat-stressed Hu sheep on growth performance, ruminal nutrient degradability, VFA dynamics and rumen microbial and fungal communities. The study would provide workable solutions for ruminant production in hot and humid environments with high concentrate cost and heat stress. These results support the use of FML in ruminant feeding.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Fermented Mulberry Leaves\u003c/h2\u003e\u003cp\u003eFML were made from the fresh ML, bran and corn flour which were mixed in a ratio of 7:2:1 supplemented with 0.1% starter. The fresh ML were harvested from a farm in Jingmen city. The starter consists of fermentation strains (\u003cem\u003eLactobacillus\u003c/em\u003e WYYL-RSJ-006, \u003cem\u003eSaccharomycetes\u003c/em\u003e WYYL-JMJ-200 and \u003cem\u003eBacillus subtilis\u003c/em\u003e WYYL-KCYB-100\u0026thinsp;=\u0026thinsp;1:1:1, final concentration\u0026thinsp;\u0026ge;\u0026thinsp;1\u0026times;10\u003csup\u003e7\u003c/sup\u003e cfu/g) were provided by Guangzhou Weiyuan Biotechnology Co., Ltd. (Guangzhou, China) and the enzymes (cellulase FDY-2263 and hemicellulose FDG-2255\u0026thinsp;=\u0026thinsp;10:3, final concentration\u0026thinsp;\u0026ge;\u0026thinsp;20 IU/g) were provided by Cangzhou Sunson Biotechnology Co., Ltd. (Cangzhou, China). FML was prepared by breathing bag for one week at 25 ℃. After laboratory testing, the routine nutrients of ML and FML were obtained and are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eNutrient composition of ML and FML (DM basis) %\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eItems\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eML\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFML\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e16.09\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e12.21\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNDF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e29.80\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e34.97\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eADF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e13.42\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e17.72\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Experimental Design\u003c/h2\u003e\u003cp\u003eA total of 45 healthy 3-month-old fattening Hu sheep (weighing approximately 26.42\u0026thinsp;\u0026plusmn;\u0026thinsp;3.57 kg) were marked with ear tags and randomly assigned into three groups with random numbers generated from Microsoft Excel (version 365). Each group contained 3 replicates and 5 lambs in each replicate. Each replicate was housed in an individual pen (3 m\u0026times;3 m) in a room containing large fans for ventilation and cooling, and exposed to natural daylight, ambient temperature, and relative humidity during summer seasons in southern China. Each pen was equipped with an individual feeding trough. FML was used to replace 0, 10%, and 20% of the concentrate (named as CONT, FT1, and FT2 group, respectively) in Hu sheep diets as a total mixed ration (TMR). The basal diet (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) consisted of a complete mixed diet with a concentrate to forage ratio of 6:4 designed to meet the \u003cem\u003eChinese Feeding Standard of Sheep\u003c/em\u003e (NY/T816-2004). The commercialized concentrated (named \u0026ldquo;Yang Guanjia Meat goat Concentrated Feed\u0026rdquo;) was purchased form Henan Haida Feed Co., Ltd. (YN903).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eComposition and nutrient levels of experiment basal diets (air-dry basis, %)\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIngredients\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCONT\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFT1\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFT2\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePeanut straw\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e40.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e40.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e40.00\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCorn\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e10.25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e10.25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e10.25\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eConcentrate\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e48.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e43.20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e38.40\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFermented mulberry leaf\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e4.80\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e9.60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNaHCO\u003csub\u003e3\u003c/sub\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0.25\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNaCl\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.50\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.50\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0.50\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePremix\u003csup\u003e3\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1.00\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e100.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e100.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100.00\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNutrient levels\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e90.91\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e88.76\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e86.64\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eME\u003csup\u003e4\u003c/sup\u003e, MJ/kg\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e10.84\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e10.73\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e10.62\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e12.22\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e12.07\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e11.92\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eADF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e21.98\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e21.86\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e22.09\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNDF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e31.17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e30.99\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e30.62\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003csup\u003e1\u003c/sup\u003e CONT\u0026thinsp;=\u0026thinsp;the control group, FT1\u0026thinsp;=\u0026thinsp;10% FML group, FT2\u0026thinsp;=\u0026thinsp;20% FML group\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003csup\u003e2\u003c/sup\u003e The concentrate is a commercialized concentrated material.\u003c/p\u003e\u003cp\u003e\u003csup\u003e3\u003c/sup\u003e Per kg of the premix contained the following: Cu as copper sulfate, 250 mg; Fe as iron sulfate, 1,400 mg; Zn as zinc oxide, 1,200 mg; Mn as manganese oxide, 900 mg; vitamin D3, 27 000 IU; vitamin A, 100,000 IU; vitamin E, 800 IU.\u003c/p\u003e\u003cp\u003e\u003csup\u003e4\u003c/sup\u003e ME was a calculated value, while the others were measured values.\u003c/p\u003e\u003cp\u003eThe experimental flow was shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The pre-trail period was 7 days, followed by a 90 days trial period. All the Hu sheep were fed twice daily, at 6:30 AM and 4:00 PM, with free access to feed and water. Individual pen dry matter (DM) intake (DMI) was recorded, and the average DMI for Hu sheep was calculated (N\u0026thinsp;=\u0026thinsp;3, each group). The start point was defined as Day 1. On Day 1, 30, 60, and 90 of the study, body weights measurements were recorded (N\u0026thinsp;=\u0026thinsp;13, each group). Two fecal samples were collected from each pen at last 5 consecutive days (N\u0026thinsp;=\u0026thinsp;6, each group). Two rumen fluid samples were collected from each pen on the morning at Day 90 (N\u0026thinsp;=\u0026thinsp;6, each group).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 Determination of Temperature and Humidity Index\u003c/h2\u003e\u003cp\u003eThe temperature-humidity index (THI) is typically used to describe whether ruminants are in a state of HS and its degree during the breeding process. Temperature and humidity were recorded by the hygrothermograph (9010, Deli Inc., Hangzhou, China), and the THI was calculated according to the following formula:\u003c/p\u003e\u003cp\u003eTHI = (1.8 \u0026times; T\u0026thinsp;+\u0026thinsp;32) \u0026minus; (0.55\u0026ndash;0.0055 \u0026times; RH) \u0026times; (1.8 \u0026times; T\u0026thinsp;\u0026minus;\u0026thinsp;26)\u003c/p\u003e\u003cp\u003eAmong, T represents the ambient temperature, RH stands for environmental humidity.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 Growth Data Collection and Analysis\u003c/h2\u003e\u003cp\u003eAll lambs were weighed for two consecutive days before morning feeding each month and at the last days using the Guangdong Senssun Weighing Apparatus in China. The feeding and residual amounts were recorded in each pen, and the DMI, average daily gain (ADG), and feed conversion ratio (FCR, DMI/ADG) were calculated.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 Rumen Fermentation Characteristics\u003c/h2\u003e\u003cp\u003eRumen fluid was collected using rumen tube, the pH was immediately measured after filtering through 4 layers of gauze, and then divided into 10 mL centrifuge tubes and stored at -20 ℃. The concentration of acetate, propionate, isobutyrate, butyrate, isovalerate, valerate, and total volatile fatty acid (TVFA) was analyzed by gas chromatography (GC-2014, Shimadzu, Tokyo, Japan) equipped with a capillary column (Stabilwax, Restek, Bellefonte, PA, United States). While ammonia nitrogen (NH\u003csub\u003e3\u003c/sub\u003e-N) concentration was determined according to the method of Broderica and Kang (Broderick and Kang \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e1980\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6 Determination of Apparent Nutrient Digestibility\u003c/h2\u003e\u003cp\u003eFeces were collected for five consecutive days at the end of the trial, and all feces of each replicate were evenly mixed and 10% hydrochloric acid was added to fix nitrogen. Fecal samples were stored at \u0026minus;\u0026thinsp;20\u003csup\u003e\u0026deg;\u003c/sup\u003eC for subsequent determination.\u003c/p\u003e\u003cp\u003eDM and crude protein (CP) of the feed samples and fecal samples were determined according to the Association of Analytical Communities (AOAC, 2006). Neutral detergent fiber (NDF) and acid detergent fiber (ADF) were determined using an Hanon F2000 Fiber analyzer (HANON Technology Co., Shan Dong, China) according to Van Soest et al. (Van Soest et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e1991\u003c/span\u003e). The content of hydrochloric acid insoluble ash (AIA) was determined according to Lee and Hristov (Lee and Hristov \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) described, and AIA was used as a digestibility marker, and the apparent nutrient digestibility was calculated according to the following formula:\u003c/p\u003e\u003cp\u003eNutrient digestibility (%)\u0026thinsp;=\u0026thinsp;100 - [(Nf / Nd) \u0026times; (Ad / Af) \u0026times; 100]\u003c/p\u003e\u003cp\u003eAmong, Nf represents the nutrient concentration in the feces, Nd represents the nutrient concentration in the diet, Ad stands for the AIA concentration in the diet, Af stands for the AIA concentration in the feces.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7 Rumen Bacterial DNA Extraction, Amplification, Sequencing and Analysis\u003c/h2\u003e\u003cp\u003eTotal genomic DNA was extracted from 18 samples using the TGuide S96 Magnetic Soil/Stool DNA Kit (Tiangen Biotech (Beijing) Co., Ltd.) according to manufacturer\u0026rsquo;s instructions. The quality and concentration of DNA was determined on a Nanodrop spectrophotometer. The qualified DNA with more than 1.80 of OD260/280 was used for further PCR amplification. The primers F:5'-ACTCCTACGAGGCAGCAG-3' and R:5'-GGACTACHVGGGTWTCTAAT-3' were used to amplify the V3-V4 hypervariable region of the bacterial 16S rRNA gene, while the primers F:CTTGGTCATTTAGAGGAAGTAA和R:GCTGCGTTCTTCATCGATGC were used to amplify the ITS1 region of the fungal ITS gene in a 20 \u0026micro;L PCR reaction mixture. The PCR product was extracted from 2% agarose gel and purified using a PCR Clean-Up Kit (YuHua, Shanghai, China). After this, purified amplicons were pooled in equimolar amounts and paired-end sequenced on an Illumina PE300 platform (Illumina, San Diego, CA, USA) according to the standard protocols by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China).\u003c/p\u003e\u003cp\u003eBioinformatic analysis of the ruminal microbiota was conducted using the online platform BMKCloud \u0026ldquo;\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.biocloud.net\u003c/span\u003e\u003cspan address=\"https://www.biocloud.net\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u0026rdquo;. USEARCH (version 10.0) was used to assign qualified sequences with a similarity threshold exceeding 97% to one operational taxonomic unit (OTU). QIIME2 software (version 2020.6.0) was used to perform taxonomy annotation of the OTUs and alpha diversity of each sample. Beta diversity calculations were analyzed by principal coordinate analysis (PCoA) based on Bray\u0026ndash;Curtis distances at the OTU level. Linear discriminant analysis (LDA) coupled with effect size (LEfSe) (version 1.1.1) was conducted to evaluate the biomarkers for each group. The phenotypic prediction of rumen microbiota was performed by BugBase (version 0.1.0) and Picrust2 (version 2.3.0), while rumen fungi was performed by FUNGuild (version 1.0).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8 Statistical Analysis\u003c/h2\u003e\u003cp\u003eStatistical analysis was carried out with GraphPad Prism software (6.0c) (GraphPad Software version 6.01). Homogeneity and normalcy were verified by SPSS Statistics software (SPSS Statistics version 17.0). Homogeneity of variance test was performed Levene test. The normalcy of data was checked by Shapiro-Wilk test. The one-way ANOVA was used for statistical analysis. Bonferroni test was used as post hoc test. Values with no letter or the same letter superscripts mean no significant difference (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05), while with different small letter superscripts mean significant difference (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and with different capital letter superscripts mean significant difference (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The effect size of eta-squared (η\u003csup\u003e2\u003c/sup\u003e) was also performed by SPSS Statistics software (SPSS Statistics version 17.0). Spearman correlation coefficients were calculated by OriginPro 2021 software (version 9.8.0.200). These results could examine the correlations between rumen fermentation parameters and the relative abundance of bacteria and fungi at the genus level. The data were considered significantly different if \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05, and a tendency was suggested if 0.05\u0026thinsp;\u0026lt;\u0026thinsp;\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.10. The values were presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e3.1 Temperature and Humidity Index Values\u003c/h2\u003e\u003cp\u003eThe Hu sheep suffered from heat stress during nearly the entire trial period, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. According to THI thresholds, the days that the Hu sheep spent during the trial period were in different heat stress states: light heat stress with 72\u0026thinsp;\u0026le;\u0026thinsp;THI\u0026thinsp;\u003cem\u003e\u0026lt;\u003c/em\u003e\u0026thinsp;78 for 25 days, moderate heat stress with 78\u0026thinsp;\u0026le;\u0026thinsp;THI\u0026thinsp;\u0026lt;\u0026thinsp;90 for 55 days, and severe heat stress with THI\u0026thinsp;\u0026ge;\u0026thinsp;90 for 1 day.\u003c/p\u003e\u003cp\u003eAt the first month of the formal period, the THI value was significantly higher than the second and third month (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). However, the ADG of Hu sheep in the FT1 group was significantly higher than that in the CONT group at the first month (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e3.2 Performance\u003c/h2\u003e\u003cp\u003eThe performance of the fattening Hu sheep in each group is presented in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. There were no significant differences among the groups in terms of final body weight, ADG, or DMI (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Compared to the CONT and FT2 groups, the FCR in FT1 was significantly lower (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, η\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.619). In addition, compared to the CONT group, the FT1 and FT2 groups had significantly reduced feed weight gain cost by 7.61 and 5.15 yuan/kg, respectively (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, η\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.719).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eDMI and ADG of fattening Hu sheep fed with FML\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCONT\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFT1\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFT2\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eEffect size η\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eInitial BW, kg\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e26.48\u0026thinsp;\u0026plusmn;\u0026thinsp;1.05\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e26.15\u0026thinsp;\u0026plusmn;\u0026thinsp;1.03\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e26.59\u0026thinsp;\u0026plusmn;\u0026thinsp;1.08\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.837\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.003\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFinal BW, kg\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e38.19\u0026thinsp;\u0026plusmn;\u0026thinsp;1.60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e40.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.91\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e39.67\u0026thinsp;\u0026plusmn;\u0026thinsp;1.41\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.619\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.048\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eADG, g\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e130.11\u0026thinsp;\u0026plusmn;\u0026thinsp;10.48\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e161.56\u0026thinsp;\u0026plusmn;\u0026thinsp;8.90\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e145.33\u0026thinsp;\u0026plusmn;\u0026thinsp;8.24\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.296\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.162\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDMI, kg\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.499\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.071\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFCR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e9.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003csup\u003eA\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e7.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003csup\u003eB\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e9.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003csup\u003eA\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.619\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFeed weight gain cost, yuan/kg\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e32.79\u0026thinsp;\u0026plusmn;\u0026thinsp;0.63\u003csup\u003eA\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e25.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41\u003csup\u003eB\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e27.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003csup\u003eB\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.719\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003csup\u003e1\u003c/sup\u003e In the same row, values with no letter or the same letter superscripts mean no significant difference (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), while with different small letter superscripts mean significant difference (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and with different capital letter superscripts mean significant difference (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The same as below.\u003c/p\u003e\u003cp\u003e\u003csup\u003e2\u003c/sup\u003e CONT\u0026thinsp;=\u0026thinsp;the control group, FT1\u0026thinsp;=\u0026thinsp;10% FML group, FT2\u0026thinsp;=\u0026thinsp;20% FML group, N\u0026thinsp;=\u0026thinsp;13 except DMI N\u0026thinsp;=\u0026thinsp;3.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e3.3 Apparent Digestibility of Nutrients\u003c/h2\u003e\u003cp\u003eAs shown in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, the apparent digestibility of DM in the CONT and FT1 groups was significantly higher than that in the FT2 group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, η\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.570), the apparent digestibility of ADF in the FT1 group was significantly higher than that in the CONT and FT2 groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, η\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.564), and the apparent digestibility of CP in the FT1 group was also significantly higher than that in the CONT and FT2 groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, η\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.877).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eApparent digestibility of nutrients of fattening Hu sheep fed with FML %\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCONT\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFT1\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFT2\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eEffect size η\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e87.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28\u003csup\u003eA\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e87.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43\u003csup\u003eA\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e85.85\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003csup\u003eB\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.002\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.570\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eADF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e43.37\u0026thinsp;\u0026plusmn;\u0026thinsp;1.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e51.24\u0026thinsp;\u0026plusmn;\u0026thinsp;1.79\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e39.72\u0026thinsp;\u0026plusmn;\u0026thinsp;2.49\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.033\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.564\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNDF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e41.54\u0026thinsp;\u0026plusmn;\u0026thinsp;1.60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e40.29\u0026thinsp;\u0026plusmn;\u0026thinsp;1.46\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e42.73\u0026thinsp;\u0026plusmn;\u0026thinsp;3.12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.515\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.040\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e53.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.90\u003csup\u003eB\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e57.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.61\u003csup\u003eA\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e47.22\u0026thinsp;\u0026plusmn;\u0026thinsp;0.50\u003csup\u003eC\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.877\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003csup\u003e1\u003c/sup\u003e CONT\u0026thinsp;=\u0026thinsp;the control group, FT1\u0026thinsp;=\u0026thinsp;10% FML group, FT2\u0026thinsp;=\u0026thinsp;20% FML group, N\u0026thinsp;=\u0026thinsp;6.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e3.4 Rumen Fermentation Parameters\u003c/h2\u003e\u003cp\u003eThe pH values and concentrations of isobutyrate, butyrate, and isovalerate were the same in all the groups (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The concentrations of acetate, propionate, and valerate in the FT1 group were significantly increased compared to CONT group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, η\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.336, 0.353, and 0.347), and the concentration of NH\u003csub\u003e3\u003c/sub\u003e-N was significantly higher in the FT1 group than that in the CONT and FT2 groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, η\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.574).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eRumen fermentation parameters in ruminnal fluid of fattening Hu sheep fed with FML\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCONT\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFT1\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFT2\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eEffect size η\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e6.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e6.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e6.53\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.236\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.185\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAcetate, mmol/L\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e44.00\u0026thinsp;\u0026plusmn;\u0026thinsp;3.80\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e56.48\u0026thinsp;\u0026plusmn;\u0026thinsp;2.43\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e52.80\u0026thinsp;\u0026plusmn;\u0026thinsp;3.48\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.046\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.336\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePropionate, mmol/L\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e8.23\u0026thinsp;\u0026plusmn;\u0026thinsp;1.05\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e11.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.77\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e10.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.93\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.038\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.353\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIsobutyrate, mmol/L\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.181\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.204\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eButyrate, mmol/L\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e10.41\u0026thinsp;\u0026plusmn;\u0026thinsp;0.97\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e11.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.44\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e9.92\u0026thinsp;\u0026plusmn;\u0026thinsp;1.28\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.673\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.051\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIsovalerate, mmol/L\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.097\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.267\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eValerate, mmol/L\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.041\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.347\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNH\u003csub\u003e3\u003c/sub\u003e-N, mmol/L\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e3.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.72\u003csup\u003eB\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e9.32\u0026thinsp;\u0026plusmn;\u0026thinsp;1.17\u003csup\u003eA\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e4.39\u0026thinsp;\u0026plusmn;\u0026thinsp;1.02\u003csup\u003eB\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.002\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.574\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTVFA, mmol/L\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e63.23\u0026thinsp;\u0026plusmn;\u0026thinsp;5.54\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e80.74\u0026thinsp;\u0026plusmn;\u0026thinsp;3.54\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e73.88\u0026thinsp;\u0026plusmn;\u0026thinsp;5.62\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.074\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.294\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003csup\u003e1\u003c/sup\u003e CONT\u0026thinsp;=\u0026thinsp;the control group, FT1\u0026thinsp;=\u0026thinsp;10% FML group, FT2\u0026thinsp;=\u0026thinsp;20% FML group, N\u0026thinsp;=\u0026thinsp;6.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e3.5 Diversity of Ruminal Microbiota\u003c/h2\u003e\u003cp\u003eThe rumen is the core organ for predigestion in ruminants, and the composition and function of microorganisms are key factors (Keum et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). We have performed 16S rRNA sequencing on 18 rumen fluid samples and a total of 1,451,501 pairs of Reads were obtained. After quality control, a total of 1,446,250 Clean Reads were generated. Each sample generated at least 79,173 Clean Reads, with an average of 80,347 Clean Reads. As shown in Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. The alpha diversity indexes were all shown no significantly difference among the groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Whereas treatment affected by feature index (η\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.216), ACE index (η\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.213), Chao1 index (η\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.215), Simpson index (η\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.149), Shannon index (η\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.151) with large effect.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe alpha diversity indexes of ruminal microbiota\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCONT\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFT1\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFT2\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eEffect size η\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFeature\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e1345.33\u0026thinsp;\u0026plusmn;\u0026thinsp;128.47\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e1339.17\u0026thinsp;\u0026plusmn;\u0026thinsp;63.67\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e1112.17\u0026thinsp;\u0026plusmn;\u0026thinsp;72.63\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.162\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.216\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eACE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e1349.06\u0026thinsp;\u0026plusmn;\u0026thinsp;128.04\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e1342.16\u0026thinsp;\u0026plusmn;\u0026thinsp;62.74\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e1117.50\u0026thinsp;\u0026plusmn;\u0026thinsp;72.73\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.166\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.213\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eChao1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e1346.26\u0026thinsp;\u0026plusmn;\u0026thinsp;128.14\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e1339.50\u0026thinsp;\u0026plusmn;\u0026thinsp;62.66\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e1113.75\u0026thinsp;\u0026plusmn;\u0026thinsp;72.67\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.163\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.215\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSimpson\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e0.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.003\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e0.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.298\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.149\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eShannon\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e8.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e9.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e8.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.293\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.151\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003csup\u003e1\u003c/sup\u003e CONT\u0026thinsp;=\u0026thinsp;the control group, FT1\u0026thinsp;=\u0026thinsp;10% FML group, FT2\u0026thinsp;=\u0026thinsp;20% FML group, N\u0026thinsp;=\u0026thinsp;6.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e3.6 Composition and Structure of Ruminal Microbiota\u003c/h2\u003e\u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, at the phylum level (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea), the relative abundance of Bacteroidetes and Verrucomicrobiota in the FT1 group were significantly increased compared to the CONT and FT2 groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb) (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas the ratio of Firmicutes/Bacteroidetes (F/B) was significantly reduced in the FT1 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb) (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe bar plots show that FML supplementation significantly altered the relative abundance of bacteria at the genus level (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). Compared to the CONT and FT2 groups, the relative abundances of \u003cem\u003eSucciniaclassicum\u003c/em\u003e and \u003cem\u003e[Eubacterium]_ventriosum_group\u003c/em\u003e were significantly lower (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas the relative abundances of \u003cem\u003ePrevotellaceae_UCG_003\u003c/em\u003e and \u003cem\u003eunclassified_Selenomonadaceae\u003c/em\u003e were significantly higher (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in the FT1 group. Moreover, the relative abundances of \u003cem\u003eSaccharofermentans\u003c/em\u003e and \u003cem\u003eCandidatus_Saccharimonas\u003c/em\u003e were lower (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the \u003cem\u003eunclassified_Bacter-oidales_RF16_group\u003c/em\u003e was higher (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in the FT1 group than in the FT2 group. The relative abundance of \u003cem\u003eRuminococcaceae_UCG_001\u003c/em\u003e was significantly higher in the FT2 group than in the CONT and FT1 groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e3.7 Ruminal Microbiota Function\u003c/h2\u003e\u003cp\u003eBugBase analysis was conducted to phenotype prediction (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). Our results indicated that the relative abundance of Gram-negative bacteria was significantly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas that of Gram-positive bacteria was significantly increased in the FT2 group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWe also used PICRUSt2 analysis for microbiota function analysis. The significantly different Kyoto Encyclopedia of Genes and Genomes (KEGG) categories among all groups were mainly related to \u0026ldquo;Global and overview maps\u0026rdquo; (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). Additionally, the results of the differential categories showed that four categories accounted for \u0026gt;\u0026thinsp;3% of the proportion of the rumen microbiota, including \u0026ldquo;Energy metabolism\u0026rdquo;, \u0026ldquo;Membrane transport\u0026rdquo;, \u0026ldquo;Biosynthesis of secondary metabolites\u0026rdquo;, \u0026ldquo;Biosynthesis of antibiotics\u0026rdquo; and \u0026ldquo;Biosynthesis of amino acids\u0026rdquo;.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e3.8 Diversity of Ruminal Fungi\u003c/h2\u003e\u003cp\u003eThe high efficiency of ruminants in digesting high-fiber feed and forage is primarily due to microbiome-mediated plant degradation and fermentation (Mora\u0026iuml;s and Mizrahi \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), in which fungi play key roles. After ITS sequencing, a total of 1,417,286 pairs of Reads were obtained. After quality control, a total of 1,412,685 Clean Reads were generated. Each sample generated at least 58,173 Clean Reads, with an average of 78,483 Clean Reads. As shown in Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e. The alpha diversity indexes were all shown no significantly difference among the groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe alpha diversity indexes of ruminal fungi\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCONT\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFT1\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFT2\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eEffect size η\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFeature\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e794.67\u0026thinsp;\u0026plusmn;\u0026thinsp;49.56\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e733.00\u0026thinsp;\u0026plusmn;\u0026thinsp;35.46\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e793.17\u0026thinsp;\u0026plusmn;\u0026thinsp;21.16\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.43\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.106\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eACE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e794.71\u0026thinsp;\u0026plusmn;\u0026thinsp;49.56\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e733.07\u0026thinsp;\u0026plusmn;\u0026thinsp;35.49\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e793.31\u0026thinsp;\u0026plusmn;\u0026thinsp;21.13\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.43\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.106\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eChao1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e794.71\u0026thinsp;\u0026plusmn;\u0026thinsp;49.56\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e733.07\u0026thinsp;\u0026plusmn;\u0026thinsp;35.49\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e793.31\u0026thinsp;\u0026plusmn;\u0026thinsp;21.13\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.43\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.106\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSimpson\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e0.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.003\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e0.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e0.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.61\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.064\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eShannon\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e8.22\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e7.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e8.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.197\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.194\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003csup\u003e1\u003c/sup\u003e CONT\u0026thinsp;=\u0026thinsp;the control group, FT1\u0026thinsp;=\u0026thinsp;10% FML group, FT2\u0026thinsp;=\u0026thinsp;20% FML group, N\u0026thinsp;=\u0026thinsp;6.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e3.9 Composition and Structure of Ruminal Fungi\u003c/h2\u003e\u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, at the phylum level (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea), the relative abundance of Rozellomycota in the FT1 group was significantly downregulated compared to the CONT group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas the relative abundance of Olpidiomycota in the FT2 group was significantly upregulated compared to the FT1 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Treatment with FML altered the relative abundance of various fungal microbiota at the genus level (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed). Compared to the CONT group, the relative abundances of \u003cem\u003eunclassified_Thelephoraceae\u003c/em\u003e, \u003cem\u003eStachybotry\u003c/em\u003e were significantly lower in the FT1 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eLEfSe analysis revealed variations in the fungal taxon composition and specific microbiota with different abundances, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. We selected bacteria with LDA scores\u0026thinsp;\u0026gt;\u0026thinsp;3.0 and \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, as biomarkers in all the groups. In the CONT group, the predominant fungi belonged to \u003cem\u003eHumicola, Hirsutella, unclassified_Thelephoraceae, Hannaella_zeae\u003c/em\u003e, and \u003cem\u003eSaitozyma\u003c/em\u003e (LDA\u0026thinsp;\u0026gt;\u0026thinsp;3; \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). FML significantly increased the abundance of \u003cem\u003eAspergillus_alabamensis\u003c/em\u003e, \u003cem\u003eAspergillus_versicolor\u003c/em\u003e, \u003cem\u003eAspergillus_flavus\u003c/em\u003e, and \u003cem\u003eCandida\u003c/em\u003e in the FT1 group (LDA\u0026thinsp;\u0026gt;\u0026thinsp;3, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and \u003cem\u003eunclassified_Archaeorhizomyces\u003c/em\u003e and \u003cem\u003eWickerhamiella_azyma\u003c/em\u003e in the FT2 group. These results suggest that significant microbial variation existed between the CONT and FT groups (LDA\u0026thinsp;\u0026gt;\u0026thinsp;3, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003e3.10 Rumen Fungal Function\u003c/h2\u003e\u003cp\u003eThe FUNGuild software was used to predict the effects of rumen fungal functions on hosts based on the measured fungal data. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, the relative abundance of the \u0026ldquo;Pathotroph\u0026rdquo; phenotype was increased compared to the FT1 group, whereas the \u0026ldquo;Saprotroph\u0026rdquo; phenotype was significantly decreased in the FT2 group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), indicating that 20% FML may increase the risk of rumen fungal disease in fattening Hu sheep compared to FT1 group.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003e3.11 Correlation Analysis\u003c/h2\u003e\u003cp\u003eCorrelation analyses of the indices of apparent digestibility, rumen fermentation parameters, differential rumen microbiota, and fungi are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e. Ruminal bacteria were highly correlated with apparent digestibility. The \u003cem\u003eunclassified_Bacteroidales_RF16_group\u003c/em\u003e, \u003cem\u003eunclassified_Selenomonadaceae\u003c/em\u003e, and \u003cem\u003ePrevotellaceae_UCG_003\u003c/em\u003e were positively correlated with the apparent digestibility of ADF, CP, and DM (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). \u003cem\u003eSaccharofermentans, [Eubacterium]_ventriosum_group, Candidatus_Saccharimonas, Ruminococcaceae_UCG_001\u003c/em\u003e, and \u003cem\u003eSucciniclasticum\u003c/em\u003e were negatively correlated with the apparent digestibility of ADF and CP (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Moreover, the concentration of fatty acids in the rumen is highly correlated with ruminal fungi. The concentrations of acetate, propionate, valerate, and NH\u003csub\u003e3\u003c/sub\u003e-N were negatively correlated with \u003cem\u003eTrimorphomycetaceae\u003c/em\u003e and \u003cem\u003eSaitozyma\u003c/em\u003e (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Furthermore, valerate concentration was positively correlated with \u003cem\u003eDiymellaceae\u003c/em\u003e, and Hannaellazeae was negatively correlated with NH\u003csub\u003e3\u003c/sub\u003e-N (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThis study investigated the effects of replacing concentrate with FML on the growth performance, rumen fermentation, and rumen microbial and fungal community structures of fattening Hu sheep under heat stress conditions. To the best of our knowledge, no research experiments have been conducted on FML as a partial concentrate replacer in sheep under natural heat stress. The combined use of ITS and 16S sequencing further reveals the true state of ruminal fungi and bacteria. This study has advanced contemporary methodological depth.\u003c/p\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003e4.1 Changes in Growth Performances\u003c/h2\u003e\u003cp\u003eADG is a crucial metric in modern animal husbandry that directly reflects the economic value of farmed animals. Various substances have been studied to improve ADG, including organic acids, biological enzymes, and probiotics (Bello et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Lai et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Lu et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). These substances function by enhancing feed efficiency or animal health (Mehrban et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The multifunctional properties of ML and their active ingredients are widely recognized (Cui et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Cui et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Hu et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Regulation of antioxidant, immune, glucose, and lipid metabolism suggests that ML could serve as functional protein feed to improve animal health. However, some previous studies indicate that ML treatment did not impact ADG or final body weight (Ouyang et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Sun et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Wang and Luo \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Among these studies, the usage of ML in proportions ranging from 5% to 32%. These results suggested that ML may not be effective for promoting growth.\u003c/p\u003e\u003cp\u003eFML are a stable microbial product containing biological enzymes, probiotics, active compounds from ML, and organic acids generated through fermentation. This makes it a versatile feed ingredient. Previous studies revealed the regulatory function of FML in lipid metabolism (Cui et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Hou et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Moreover, under conditions of excessive energy consumption, FML can decrease the loss of both backfat thickness and body weight (Zhang et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2021b\u003c/span\u003e). FML exhibit beneficial protective effects on livestock. Thus, our results indicate that FML can lower FCR, which may be a combined result of its regulatory functions. Moreover, FML are more cost-effective than dried ML and mulberry leaf powder because they do not need prior processing like drying and fine grinding. Additionally, their price is lower than that of commercial concentrate. As shown in this study, using FML as a substitute for Concentrate could reduce breeding costs. On the other hand, FML have a shelf life of more than six months, making them suitable for commercial transportation as raw materials. They can also serve as reserve supplies to address varying climatic conditions or provide extra feed during extreme weather.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\u003ch2\u003e4.2 Changes in Apparent Digestibility\u003c/h2\u003e\u003cp\u003eThe impact of ML on the apparent digestibility of ruminants has been extensively documented. A previous study revealed that mulberry leaf treatments increased the apparent digestibility of organic matter (OM) and NDF in fattening Hu sheep (Ouyang et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Studies have shown that ML treatments did not affect ADG, FCR, or body weight, but increase the apparent digestibility of DM, OM, and ADF (Sun et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Wang and Luo \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In this study, FML exhibits a regulatory effect on the apparent digestibility of nutrients, similar with that of ML. The regulatory effects of FML may be closely linked to their diverse active components. Supplementary ML flavonoids improved the apparent digestibility of CP and NDF (Ma et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Moreover, it has been shown that 1-deoxynojirimycin isolated from ML decreases serum glucose and insulin levels (Hu et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, insulin inhibits food intake through the central nervous system (Kullmann et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Schur and Tong \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Furthermore, dietary supplementation with mulberry leaf flavonoids improves the apparent digestibility of nitrogen and NDF (Ma et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Thus, active ingredients originating from ML may at least partially improve digestion.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec26\" class=\"Section2\"\u003e\u003ch2\u003e4.3 Changes in Ruminal Fermentation\u003c/h2\u003e\u003cp\u003eThe rumen is a fermentation-like organ in ruminants. Temperature, feed composition, and microorganisms all affect fermentation efficiency. Organic acids or NH\u003csub\u003e3\u003c/sub\u003e-N are products absorbed by ruminal epithelial cells that provide the main energy substances for ruminant production (Li et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Mulberry leaf supplementation influence the concentration of NH\u003csub\u003e3\u003c/sub\u003e-N, acetate, and butyrate in sheep (Ouyang et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Sun et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). This study has reported that FML increase ruminal concentrations of NH\u003csub\u003e3\u003c/sub\u003e-N, acetate, propionate, and valerate in fattening Hu sheep. The consistent results in our study may be related to the presence of mulberry leaf fibers and active ingredients. Previous studies have shown that 1-deoxynojirimycin and flavonoids from ML also alter the concentration of volatile fatty acid (Hu et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ma et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The inconsistent results of our study may be associated with the use of probiotics during fermentation. The addition of \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e leads to an increase in the concentrations of NH\u003csub\u003e3\u003c/sub\u003e-N, acetate, propionate, and valerate in dairy cows (Zhang et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Marlida et al. (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) reported probiotic (\u003cem\u003eLactobacillus plantarum\u003c/em\u003e and \u003cem\u003eS. cerevisiae\u003c/em\u003e) supplementation significantly increased the content of NH\u003csub\u003e3\u003c/sub\u003e and total volatile fatty acid (TVFA) (Marlida et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). An \u003cem\u003ein vitro\u003c/em\u003e experiment indicated that \u003cem\u003eBacillus subtilis\u003c/em\u003e improved ruminal NH\u003csub\u003e3\u003c/sub\u003e-N and propionate concentrations (Chang et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Thus, the replacement of concentrate in Hu sheep with FML appeared to improve the fermentation efficiency.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec27\" class=\"Section2\"\u003e\u003ch2\u003e4.4 Changes in Ruminal Microorganisms and Fungi\u003c/h2\u003e\u003cp\u003eThe present study revealed that 10% concentrate replaced by FML resulted in an increased relative abundance of bacteria, such as \u003cem\u003ePrevotellaceae\u003c/em\u003e and \u003cem\u003eSelenomonadaceae.\u003c/em\u003e It has previously been reported that the levels of \u003cem\u003ePrevotellaceae\u003c/em\u003e and \u003cem\u003eSelenomonadaceae\u003c/em\u003e decreased following probiotic \u003cem\u003eLactobacillus\u003c/em\u003e supplementation in overweight individuals (Mo et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). This might demonstrate the regulatory effects in our treatment were similar to that of probiotics. A previous study showed that \u003cem\u003e[Eubacterium]_ventriosum_group\u003c/em\u003e was enriched under severe heat stress condition in the rumen of lambs (Li et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). \u003cem\u003e[Eubacterium]_ventriosum_group\u003c/em\u003e always shows the risk of a dangerous physiological state (Li and Lu \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). We observed a decrease in the relative abundance of bacteria \u003cem\u003e[Eubacterium]_ventriosum_group\u003c/em\u003e affected by the FML. Thus, FML improved their weak physiological state under heat stress conditions. Moreover, replacing 20% concentrate with FML resulted in a decrease in Gram-negative bacteria, whereas Gram-positive bacteria increased. These changes might indicate that ruminal acidosis results in increased lipopolysaccharide concentrations in the ruminal fluid (Monteiro and Faciola \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). This may be the reason why the FT2 group had more FML but had no improvement effect.\u003c/p\u003e\u003cp\u003e\u003cem\u003eCandida\u003c/em\u003e has been used as a probiotics to improve the production efficiency and the health of cattle and goats (Kong et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Lu et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). \u003cem\u003eAspergillus\u003c/em\u003e culture is a new feed additive that improves feed digestibility in Hu sheep (Guo et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The enrichment of \u003cem\u003eCandida\u003c/em\u003e and \u003cem\u003eAspergillus\u003c/em\u003e in the FT1 group might display a healthy state in Hu sheep. Consistent with these results, our predictive analysis of rumen fungal functions also revealed that the FT1 group possessed less \u0026ldquo;Pathotroph\u0026rdquo; phenotype and more \u0026ldquo;Saprotroph\u0026rdquo; phenotype than that in the FT2 group. The lack of research data related to fungi limits the further interpretation of our results.\u003c/p\u003e\u003cp\u003e\u003cb\u003eStudy Limitations\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe experiment took place on the field in a high-THI summer instead of in a lab or climate chamber. This strengthens the external validity of results and practicality, while establishing a control group free from heat stress proved challenging. Therefore, it is unclear if the effects of FML would apply equally under normal conditions or if they are special to decrease heat stress. Studies with small sample sizes, compared to those required by a power analysis, may result in false negatives. Thus, six is the small sample size used in microbiological analysis. We chose to collect rumen fluid before feeding in the morning; however, the single sampling time point may be insufficient to capture the dynamic changes in the rumen environment and microbial community. Moreover, due to restrictions at the farm, the calculation of feed intake for this experiment was done on a pen-by-pen basis, which resulted in some individual differences being masked. Additionally, the microbial studies are correlated; no functional validation exists. Furthermore, this study does not assess the long-term effects of FML inclusion on carcass characteristics, immune health, reproductive performance, or health markers, which are crucial for practical application.\u003c/p\u003e\u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn mild heat stress, replacing 10% of concentrate with FML enhanced feed conversion ratio, nutrient digestibility, and rumen microbial populations, so presumably enhancing fermentation efficiency. FML may make Hu sheep more beneficial for Hu sheep as a partial concentrate replacement.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAnimal Ethics Declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFrom June to September 2022, this study was conducted on a fattening sheep breeding farm in Zaoyang City, Hubei Province. The animal study was conducted in accordance with the ethical guidelines for animal research established and approved by the Institutional Animal Care and Use Committee at the Hubei Academy of Agricultural Sciences (HBAAS20220007).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthorship contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJintao Wei: Supervision, Resources, Conceptualization, Validation. Qiwen Fan: Writing \u0026ndash; original draft, Investigation, Formal analysis, Data curation, Conceptualization. Fang Chen: Writing \u0026ndash; original draft. Wenjing Tao: Writing \u0026ndash; review \u0026amp; editing, Data curation. Encun Du: Supervision, Methodology. Na Zhao: Supervision, Writing \u0026ndash; review \u0026amp; editing. Wanzheng Guo: Investigation, Formal analysis. Jing Huang and Feng Jin: Investigation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Competing Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Hubei Special Project for Technological Innovation [Grant Nos.2022BEC039], Hubei Innovation Center of Agricultural Science and Technology [Grant Nos.\u0026nbsp;2021-620-000-001-021], Hubei Technology Innovation Plan Project [Grant Nos.2024BBB112], and Youth Science Foundation of Hubei Academy of Agricultural Sciences [Grant Nos.\u0026nbsp;2024NKYJJ20].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe also acknowledge other researchers and students for providing management and skills.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBagath M, Krishnan G, Devaraj C, Rashamol VP, Pragna P, Lees AM, Sejian V (2019) The impact of heat stress on the immune system in dairy cattle: A review. Res Vet Sci 126:94-102 doi:10.1016/j.rvsc.2019.08.011\u003c/li\u003e\n\u003cli\u003eBello A, Haldar S, Ghane AE, de Kreij A, Hardy R, Dersjant-Li Y (2025) Application of a minerals, digestible amino acids and energy matrix to a broiler diet supplemented with a bacterial 6-phytase maintained growth performance and reduced feed costs compared to a minerals matrix alone. Poult Sci 104(9):105407 doi:10.1016/j.psj.2025.105407\u003c/li\u003e\n\u003cli\u003eBouroutzika EV, Theodosiadou EK, Barbagianni MS, Papadopoulos S, Katsogiannou EG, Kalogiannis D, Chadio S, Skaperda Z, Kouretas D, Valasi I (2022) Redox Status and Hematological Variables in Melatonin-Treated Ewes during Early Pregnancy under Heat Stress. Vet Sci 9(9):499 doi:10.3390/vetsci9090499\u003c/li\u003e\n\u003cli\u003eBroderick GA, Kang JH (1980) Automated simultaneous determination of ammonia and total amino acids in ruminal fluid and in vitro media. J Dairy Sci 63(1):64-75 doi:10.3168/jds.S0022-0302(80)82888-8\u003c/li\u003e\n\u003cli\u003eChang M, Ma F, Wei J, Liu J, Nan X, Sun P (2021) Live Bacillus subtilis natto Promotes Rumen Fermentation by Modulating Rumen Microbiota In Vitro. Animals 11(6):1519 doi:10.3390/ani11061519\u003c/li\u003e\n\u003cli\u003eChen Y, Meng F, Liu Y, Zhu C, Ling Y, Liu C, Li L, Liu Y, He X, Cao J, Zhang Y (2024) Effects of resveratrol on DLD and NDUFB9 decrease in frozen semen of Mongolian sheep. Cryobiology 114:104791 doi:10.1016/j.cryobiol.2023.104791\u003c/li\u003e\n\u003cli\u003eCui X, Yang Y, Zhang M, Bao L, Jiao F, Liu S, Wang H, Wei X, Qian W, Shi X, Su C, Qian Y (2024) Mulberry leaves supplementation alters lipid metabolism and promotes fatty acid \u0026beta; oxidation in growing mutton sheep. J Anim Sci 102:skae076 doi:10.1093/jas/skae076\u003c/li\u003e\n\u003cli\u003eCui X, Yang Y, Zhang M, Liu S, Wang H, Jiao F, Bao L, Lin Z, Wei X, Qian W, Shi X, Su C, Qian Y (2022) Transcriptomics and metabolomics analysis reveal the anti-oxidation and immune boosting effects of mulberry leaves in growing mutton sheep. Front Immunol 13:1088850 doi:10.3389/fimmu.2022.1088850\u003c/li\u003e\n\u003cli\u003eDhanyalakshmi KH, Nataraja KN (2018) Mulberry (Morus spp.) has the features to treat as a potential perennial model system. Plant Signal Behav 13(8):e1491267 doi:10.1080/15592324.2018.1491267\u003c/li\u003e\n\u003cli\u003eDu E, Guo W, Zhao N, Chen F, Fan Q, Zhang W, Huang S, Zhou G, Fu T, Wei J (2022) Effects of diets with various levels of forage rape (Brassica napus) on growth performance, carcass traits, meat quality and rumen microbiota of Hu lambs. J Sci Food Agric 102(3):1281-1291 doi:10.1002/jsfa.11466\u003c/li\u003e\n\u003cli\u003eDu Y, Zhang R, Zheng XX, Zhao YL, Chen YL, Ji S, Guo MZ, Tang DQ (2024) Mulberry (Morus alba L.) leaf water extract attenuates type 2 diabetes mellitus by regulating gut microbiota dysbiosis, lipopolysaccharide elevation and endocannabinoid system disorder. J Ethnopharmacol 323:117681 doi:10.1016/j.jep.2023.117681\u003c/li\u003e\n\u003cli\u003eEom JS, Choi Y, J. LS, S. KH, U. JS, D. B, H. LD, T. KE, B. KS, S. LS (2024) Integrated analysis of rumen metabolomics and metataxonomics to understand changes in metabolic and microbial community in Korean native goats under heat stress. Sci Rep 14(1):31416 doi:10.1038/s41598-024-83017-y\u003c/li\u003e\n\u003cli\u003eGuo L, Zhang D, Du R, Li F, Li F, Ran T (2022) Supplementation of Aspergillus oryzae Culture Improved the Feed Dry Matter Digestibility and the Energy Supply of Total Volatile Fatty Acid Concentrations in the Rumen of Hu Sheep. Front Nutr 9:847156 doi:10.3389/fnut.2022.847156\u003c/li\u003e\n\u003cli\u003eHou J, Ji X, Chu X, Shi Z, Wang B, Sun K, Wei H, Song Z, Wen F (2024) Comprehensive lipidomic analysis revealed the effects of fermented Morus alba L. intake on lipid profile in backfat and muscle tissue of Yuxi black pigs. J Anim Physiol Anim Nutr (Berl) 108(3):764-777 doi:10.1111/jpn.13932\u003c/li\u003e\n\u003cli\u003eHu TG, Wen P, Shen WZ, Liu F, Li Q, Li EN, Liao ST, Wu H, Zou YX (2019) Effect of 1-Deoxynojirimycin Isolated from Mulberry Leaves on Glucose Metabolism and Gut Microbiota in a Streptozotocin-Induced Diabetic Mouse Model. J Nat Prod 82(8):2189-2200 doi:10.1021/acs.jnatprod.9b00205\u003c/li\u003e\n\u003cli\u003eJung JS, Kim D, Singaravelu A, Soundharrajan I, Choi KC (2025) Dietary Fermentation with Lactobacillus sp. and Bacillus sp. Modulates Rumen Transcriptomic and Microbiota Profiles in Bos taurus. Int J Mol Sci 26(14):6816 doi:10.3390/ijms26146816\u003c/li\u003e\n\u003cli\u003eKang L, Han X, Zhang Z, Sun OJ (2007) Grassland ecosystems in China: review of current knowledge and research advancement. Philos Trans R Soc Lond B Biol Sci 362(1482):997-1008 doi:10.1098/rstb.2007.2029\u003c/li\u003e\n\u003cli\u003eKeum GB, Pandey S, Kim ES, Doo H, Kwak J, Ryu S, Choi Y, Kang J, Kim S, Kim HB (2024) Understanding the Diversity and Roles of the Ruminal Microbiome. J Microbiol 62(3):217-230 doi:10.1007/s12275-024-00121-4\u003c/li\u003e\n\u003cli\u003eKong L, Yang C, Dong L, Diao Q, Si B, Ma J, Tu Y (2019) Rumen Fermentation Characteristics in Pre- and Post-Weaning Calves upon Feeding with Mulberry Leaf Flavonoids and Candida tropicalis Individually or in Combination as a Supplement. Animals 9(11):990 doi:10.3390/ani9110990\u003c/li\u003e\n\u003cli\u003eKullmann S, Kleinridders A, Small DM, Fritsche A, H\u0026auml;ring HU, Preissl H, Heni M (2020) Central nervous pathways of insulin action in the control of metabolism and food intake. Lancet Diabetes Endocrinol 8(6):524-534 doi:10.1016/s2213-8587(20)30113-3\u003c/li\u003e\n\u003cli\u003eLai Y, Liu L, Li Z, Li L, Wang R, Zhou F, Qu Z, Hu J, Guo S, Zhang B (2025) Dietary compounded traditional Chinese medicine residue meal improves laying performance, egg quality, and gut barrier integrity in late-phase laying hens. Poult Sci 104(9):105425 doi:10.1016/j.psj.2025.105425\u003c/li\u003e\n\u003cli\u003eLee C, Hristov AN (2013) Short communication: Evaluation of acid-insoluble ash and indigestible neutral detergent fiber as total-tract digestibility markers in dairy cows fed corn silage-based diets. J Dairy Sci 96(8):5295-5299 doi:10.3168/jds.2012-6442\u003c/li\u003e\n\u003cli\u003eLees AM, Lees JC, Lisle AT, Sullivan ML, Gaughan JB (2018) Effect of heat stress on rumen temperature of three breeds of cattle. Int J Biometeorol 62(2):207-215 doi:10.1007/s00484-017-1442-x\u003c/li\u003e\n\u003cli\u003eLeeuwendaal NK, Stanton C, O\u0026apos;Toole PW, Beresford TP (2022) Fermented Foods, Health and the Gut Microbiome. Nutrients 14(7):1527 doi:10.3390/nu14071527\u003c/li\u003e\n\u003cli\u003eLi B, Wu K, Duan G, Yin W, Lei M, Yan Y, Ren Y, Zhang C (2024) Folic Acid and Taurine Alleviate the Impairment of Redox Status, Immunity, Rumen Microbial Composition and Fermentation of Lambs under Heat Stress. Animals 14(7):998 doi:10.3390/ani14070998\u003c/li\u003e\n\u003cli\u003eLi C, Lu P (2023) Association of Gut Microbiota with Age-Related Macular Degeneration and Glaucoma: A Bidirectional Mendelian Randomization Study. Nutrients 15(21):4646 doi:10.3390/nu15214646\u003c/li\u003e\n\u003cli\u003eLi D, Zhang Y, Cui Z, He L, Chen W, Meng Q, Ren L (2016) Effects of Phytoecdysteroids (PEDS) Extracted from Cyanotis arachnoidea on Rumen Fermentation, Enzyme Activity and Microbial Efficiency in a Continuous-Culture System. PloS One 11(4):e0153584 doi:10.1371/journal.pone.0153584\u003c/li\u003e\n\u003cli\u003eLiu B, Ye D, Yang H, Song J, Sun X, Mao Y, He Z (2022) Two-Sample Mendelian Randomization Analysis Investigates Causal Associations Between Gut Microbial Genera and Inflammatory Bowel Disease, and Specificity Causal Associations in Ulcerative Colitis or Crohn\u0026apos;s Disease. Front Immunol 13:921546 doi:10.3389/fimmu.2022.921546\u003c/li\u003e\n\u003cli\u003eLiu Q, Wang C, Guo G, Huo WJ, Zhang YL, Pei CX, Zhang SL, Wang H (2018) Effects of isovalerate supplements on morphology and functional gene expression of rumen mucosa in pre- and post-weaning dairy calves. Animal 12(3):491-500 doi:10.1017/s175173111700194x\u003c/li\u003e\n\u003cli\u003eLu J, Chen Z, Chen P, Li Z, Wan Y, Song Y, Wang F, Zhang Y (2023) Dietary potential probiotics and enzymes complex modulates the performance and rumen microbiota in weaned goats. J Appl Microbiol 134(2) doi:10.1093/jambio/lxac079\u003c/li\u003e\n\u003cli\u003eLuo Y, Gao S, Sun A, Li J, Li H, Yi K, Hu R, Yang B (2025) Supplementation with mulberry leaves improves growth performance and meat quality of Xiangdong black goats. Anim Biosci 38(3):466-474 doi:10.5713/ab.24.0427\u003c/li\u003e\n\u003cli\u003eMa T, Chen DD, Tu Y, Zhang NF, Si BW, Diao QY (2017) Dietary supplementation with mulberry leaf flavonoids inhibits methanogenesis in sheep. Anim Sci J 88(1):72-78 doi:10.1111/asj.12556\u003c/li\u003e\n\u003cli\u003eMaqsood M, Anam Saeed R, Sahar A, Khan MI (2022) Mulberry plant as a source of functional food with therapeutic and nutritional applications: A review. J Food Biochem 46(11):e14263 doi:10.1111/jfbc.14263\u003c/li\u003e\n\u003cli\u003eMarlida Y, Harnentis H, Nur YS, Ardani LR (2023) New probiotics (Lactobacillus plantarum and Saccharomyces cerevisiae) supplemented to fermented rice straw-based rations on digestibility and rumen characteristics in vitro. J Adv Vet Anim Res 10(1):96-102 doi:10.5455/javar.2023.j657\u003c/li\u003e\n\u003cli\u003eMehrban H, Naserkheil M, Lee DH, Ib\u0026aacute;\u0026ntilde;ez-Escriche N (2021) Genetic parameters and correlations of related feed efficiency, growth, and carcass traits in Hanwoo beef cattle. Anim Biosci 34(5):824-832 doi:10.5713/ajas.20.0135\u003c/li\u003e\n\u003cli\u003eMo SJ, Lee K, Hong HJ, Hong DK, Jung SH, Park SD, Shim JJ, Lee JL (2022) Effects of Lactobacillus curvatus HY7601 and Lactobacillus plantarum KY1032 on Overweight and the Gut Microbiota in Humans: Randomized, Double-Blinded, Placebo-Controlled Clinical Trial. Nutrients 14(12):2484 doi:10.3390/nu14122484\u003c/li\u003e\n\u003cli\u003eMonteiro HF, Faciola AP (2020) Ruminal acidosis, bacterial changes, and lipopolysaccharides. J Anim Sci 98(8): skaa248 doi:10.1093/jas/skaa248\u003c/li\u003e\n\u003cli\u003eMora\u0026iuml;s S, Mizrahi I (2019) Islands in the stream: from individual to communal fiber degradation in the rumen ecosystem. FEMS Microbiol Rev 43(4):362-379 doi:10.1093/femsre/fuz007\u003c/li\u003e\n\u003cli\u003eOuyang J, Wang M, Hou Q, Feng D, Pi Y, Zhao W (2019) Effects of Dietary Mulberry Leaf Powder in Concentrate on the Rumen Fermentation and Ruminal Epithelium in Fattening Hu Sheep. Animals 9(5):218 doi:10.3390/ani9050218\u003c/li\u003e\n\u003cli\u003ePragna P, Sejian V (2018) Comparative assessment of growth performance of three different indigenous goat breeds exposed to summer heat stress. 102(4):825-836 doi:10.1111/jpn.12892\u003c/li\u003e\n\u003cli\u003eSchur EA, Tong J (2022) Insulin Action to Inhibit Food Intake: Is It All in Your Head? J Clin Endocrinol Metab 107(2):e874-e876 doi:10.1210/clinem/dgab661\u003c/li\u003e\n\u003cli\u003eSun H, Luo Y, Zhao F, Fan Y, Ma J, Jin Y, Hou Q, Ahmed G, Wang H (2020) The Effect of Replacing Wildrye Hay with Mulberry Leaves on the Growth Performance, Blood Metabolites, and Carcass Characteristics of Sheep. Animals 10(11):2018 doi:10.3390/ani10112018\u003c/li\u003e\n\u003cli\u003eVan Soest PJ, Robertson JB, Lewis BA (1991) Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 74(10):3583-3597 doi:10.3168/jds.S0022-0302(91)78551-2\u003c/li\u003e\n\u003cli\u003eWang B, Luo H (2021) Effects of mulberry leaf silage on antioxidant and immunomodulatory activity and rumen bacterial community of lambs. BMC Microbiol 21(1):250 doi:10.1186/s12866-021-02311-1\u003c/li\u003e\n\u003cli\u003eWang R, Wang X, Xiong Y (2024) Dietary Paper Mulberry Silage Supplementation Improves the Growth Performance, Carcass Characteristics, and Meat Quality of Yangzhou Goose. Animals 14(3):359 doi:10.3390/ani14030359\u003c/li\u003e\n\u003cli\u003eWang Y, Zhao Y, Xue F, Nan X, Wang H, Hua D, Liu J, Yang L, Jiang L, Xiong B (2020) Nutritional value, bioactivity, and application potential of Jerusalem artichoke (Helianthus tuberosus L.) as a neotype feed resource. Anim Nutr 6(4):429-437 doi:10.1016/j.aninu.2020.09.001\u003c/li\u003e\n\u003cli\u003eXie HH, Wei JG, Liu F, Pan XH, Yang XB (2014) First Report of Mulberry Root Rot Caused by Lasiodiplodia theobromae in China. Plant Dis 98(11):1581 doi:10.1094/pdis-03-14-0261-pdn\u003c/li\u003e\n\u003cli\u003eXue L, Zhou S, Wang D, Zhang F, Li J, Cai L (2022) The Low Dose of Saccharomyces cerevisiae Is Beneficial for Rumen Fermentation (Both In Vivo and In Vitro) and the Growth Performance of Heat-Stressed Goats. Microorganisms 10(10):1877 doi:10.3390/microorganisms10101877\u003c/li\u003e\n\u003cli\u003eYu Z, Cantet JM, Paz HA, Kaufman JD, Orellano MS, Ipharraguerre IR, R\u0026iacute;us AG (2024) Heat stress-associated changes in the intestinal barrier, inflammatory signals, and microbiome communities in dairy calves. J Dairy Sci 107(2):1175-1196 doi:10.3168/jds.2023-23873\u003c/li\u003e\n\u003cli\u003eZhang M, Warner RD, Dunshea FR, DiGiacomo K, Joy A, Abhijith A, Osei-Amponsah R, Hopkins DL, Ha M, Chauhan SS (2021a) Impact of heat stress on the growth performance and retail meat quality of 2nd cross (Poll Dorset \u0026times; (Border Leicester \u0026times; Merino)) and Dorper lambs. Meat Science 181:108581 doi:10.1016/j.meatsci.2021.108581\u003c/li\u003e\n\u003cli\u003eZhang Q, Ma L, Zhang X, Jia H, Tana, Guo Y, Zhang J, Wang J (2024) Feeding live yeast (Saccharomyces cerevisiae) improved performance of mid-lactation dairy cows by altering ruminal bacterial communities and functions of serum antioxidation and immune responses. BMC Vet Res 20(1):245 doi:10.1186/s12917-024-04073-0\u003c/li\u003e\n\u003cli\u003eZhang Y, Yin C, Schroyen M, Everaert N, Ma T, Zhang H (2021b) Effects of the Inclusion of Fermented Mulberry Leaves and Branches in the Gestational Diet on the Performance and Gut Microbiota of Sows and Their Offspring. Microorganisms 9(3):604 doi:10.3390/microorganisms9030604\u003c/li\u003e\n\u003cli\u003eZheng XX, Li DX, Li YT, Chen YL, Zhao YL, Ji S, Guo MZ, Du Y, Tang DQ (2023) Mulberry leaf water extract alleviates type 2 diabetes in mice via modulating gut microbiota-host co-metabolism of branched-chain amino acid. Phytother Res 37(8):3195-3210 doi:10.1002/ptr.7822\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"fermented mulberry leaves, Hu sheep, rumen fermentation parameters, microbial community structure","lastPublishedDoi":"10.21203/rs.3.rs-7903162/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7903162/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHeat stress is a major abiotic stress that limits growth performance, health, and physiological responses of sheep. Although Hu sheep possess innate mechanisms for managing heat stress, prolonged exposure impairs their performance and health. This study was conducted to explore the effects of different proportions of concentrate replaced with fermented mulberry leaves (FML) on rumen fermentation and rumen microbial and fungal community structures in Hu sheep. A total of 45 Hu sheep with similar body weight (26.42\u0026thinsp;\u0026plusmn;\u0026thinsp;3.57 kg) were randomly divided into three group: the control group (CONT) was fed a basal diet, and the treatment groups (FML Treatment) FT1 and FT2 were fed experimental diets in which 10% and 20% concentrate, respectively, were replaced by FML. The pretest lasted for seven days, and the formal period lasted for 90 days. The average daily gain in the FT1 group increased at the first month of the formal period compared to the CONT group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Lower feed conversion ratio, feed weight gain cost (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and higher apparent digestibility of acid detergent fiber and crude protein (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) were observed in the FT1 group. Moreover, the concentrations of acetate, propionate, valerate, and ammonia nitrogen in the FT1 group were significantly higher than those in the CONT group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Further analysis of the rumen microbiota indicated that the relative abundance of \u003cem\u003eSucciniaclassicum\u003c/em\u003e and \u003cem\u003e[Eubacterium]_ventriosum_group\u003c/em\u003e decreased, whereas that of \u003cem\u003ePrevotellaceae_UCG_003\u003c/em\u003e and \u003cem\u003eunclassified_Selenomonadaceae\u003c/em\u003e increased in the FT1 group. Internal transcribed spacer sequencing indicated that FML significantly increased the relative abundance of beneficial fungi in the rumen of heat-stressed Hu sheep, including \u003cem\u003eAspergillus_alabamensis\u003c/em\u003e, \u003cem\u003eAspergillus_versicolor\u003c/em\u003e, \u003cem\u003eAspergillus_flavus\u003c/em\u003e, and \u003cem\u003eCandida\u003c/em\u003e in the FT1 group. Correlation analysis suggested that the apparent digestibility of nutrients in fattening Hu sheep under heat stress was highly correlated with ruminal bacteria. Our findings indicate that the replacement of concentrate with FML can improve production performance, increase the apparent digestibility of nutrients, and enhance the rumen fermentation efficiency of fattening Hu sheep under heat stress. These changes are highly correlated with the changes in the composition and structure of bacteria and fungi in the rumen.\u003c/p\u003e","manuscriptTitle":"Effects of Different Proportions of Concentrate Replaced by Fermented Mulberry Leaves on Growth Performance, Rumen Fermentation, Rumen Microbial and Fungal Community Structure of Heat-stressed Hu sheep","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-26 11:22:51","doi":"10.21203/rs.3.rs-7903162/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b6a7932a-8c69-4599-a9a8-8f52da8c8afa","owner":[],"postedDate":"November 26th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-04-27T16:04:13+00:00","versionOfRecord":{"articleIdentity":"rs-7903162","link":"https://doi.org/10.1007/s00253-026-13819-9","journal":{"identity":"applied-microbiology-and-biotechnology","isVorOnly":false,"title":"Applied Microbiology and Biotechnology"},"publishedOn":"2026-04-20 15:59:12","publishedOnDateReadable":"April 20th, 2026"},"versionCreatedAt":"2025-11-26 11:22:51","video":"","vorDoi":"10.1007/s00253-026-13819-9","vorDoiUrl":"https://doi.org/10.1007/s00253-026-13819-9","workflowStages":[]},"version":"v1","identity":"rs-7903162","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7903162","identity":"rs-7903162","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}