Role of drug induced nuclear CTSL (nCTSL) in DNA damage response in cancer- therapeutic implications

Role of drug induced nuclear CTSL (nCTSL) in DNA damage response in cancer- therapeutic implications | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Role of drug induced nuclear CTSL (nCTSL) in DNA damage response in cancer- therapeutic implications Prabhu Thirsangu , Ling Jin , Upasana Ray , Anya Zhao , Xinyan Wu , Xiaonan Hou , Jamison L VanBlaricom , Syed Mohamed Musheer Aalam , Ann Oberg , View ORCID Profile Nagarajan Kannan , John Weroha , Jeremy Chien , Scott H Kaufmann , Jamie N Bakkum-Gamez , Viji Shridhar doi: https://doi.org/10.1101/2025.01.09.632284 Prabhu Thirsangu 1 Department of Experimental Pathology and Medicine, Mayo Clinic , Rochester, MN, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Ling Jin 1 Department of Experimental Pathology and Medicine, Mayo Clinic , Rochester, MN, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Upasana Ray 1 Department of Experimental Pathology and Medicine, Mayo Clinic , Rochester, MN, USA 2 Division of Cancer Medicine, The University of Texas MD Anderson Cancer Center , Houston, TX Find this author on Google Scholar Find this author on PubMed Search for this author on this site Anya Zhao 1 Department of Experimental Pathology and Medicine, Mayo Clinic , Rochester, MN, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Xinyan Wu 1 Department of Experimental Pathology and Medicine, Mayo Clinic , Rochester, MN, USA 3 Department of Oncology, Mayo Clinic , Rochester, MN, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Xiaonan Hou 3 Department of Oncology, Mayo Clinic , Rochester, MN, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jamison L VanBlaricom 3 Department of Oncology, Mayo Clinic , Rochester, MN, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Syed Mohamed Musheer Aalam 1 Department of Experimental Pathology and Medicine, Mayo Clinic , Rochester, MN, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Ann Oberg 4 Department of Health Science Research, Mayo Clinic , Rochester, MN, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Nagarajan Kannan 1 Department of Experimental Pathology and Medicine, Mayo Clinic , Rochester, MN, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Nagarajan Kannan John Weroha 3 Department of Oncology, Mayo Clinic , Rochester, MN, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jeremy Chien 5 Department of Biochemistry and Molecular Medicine, University of California Davis Medical Center , Sacramento, CA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Scott H Kaufmann 3 Department of Oncology, Mayo Clinic , Rochester, MN, USA 6 Department of Molecular Pharmacology and Experimental Therapeutics, Mayo Clinic , Rochester, MN, 55905, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jamie N Bakkum-Gamez 7 Department of Obstetrics and Gynecology, Mayo Clinic , Rochester, MN, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Viji Shridhar 1 Department of Experimental Pathology and Medicine, Mayo Clinic , Rochester, MN, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: Shridhar.Vijayalakshmi{at}mayo.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF ABSTRACT In our efforts to enhance sensitivity to PARP inhibitors, we identified clofarabine (CLF) as a potential therapy for drug-resistant ovarian cancer and nuclear trafficking of Cathepsin L (CTSL) as a treatment- responsive biomarker. Using PARP inhibitor-sensitive and -resistant OC cell lines, ex vivo cultures of patient-derived ovarian ascites (OVA), primary ovarian tumors, and xenografts (PDX), we found that CLF monotherapy induces nuclear CTSL (nCTSL) in CLF-responsive cells (CLF-r) and sensitizes them to PARP inhibitors olaparib and rucaparib. In CLF non-responsive cells (CLF-nr), a combination of CLF with olaparib is necessary for nCTSL trafficking and synergy. CLF+olaparib synergy was observed in 47% of CLF-r and 24% of CLF-nr OVA samples. Drug-induced nCTSL is crucial for DNA damage response, including cell cycle arrest and apoptosis. Knockdown of CTSL in both CLF-r and CLF-nr cells conferred resistance to the CLF+olaparib combination, emphasizing nCTSL’s role in the DNA damage response pathway (DDR). Mechanistically, CLF facilitates CTSL nuclear import via KPNB1 in CLF-r cells. In CLF-nr cells, both olaparib and CLF are needed to facilitate CTSL nuclear import. Additionally, CLF downregulates the nuclear export protein CRM1 (XPO1) in both cohorts. Interestingly, CLF does not downregulate CRM1 in a subset of OVAs (29%), and they were classified as CLF-resistant (CLF- Res). In these samples, inhibiting CRM1 with KPT8602 restored synergy between CLF and PARP inhibitors. In vivo, CLF-r and CLF-nr PDX models exhibited enhanced DDR, reduced tumor burden, and prolonged survival with the CLF+olaparib combination. These findings suggest the CLF+olaparib combination is a promising therapeutic strategy for drug-resistant OC by inducing DDR through CTSL nuclear localization. INTRODUCTION Despite advances in treatment, ovarian cancer remains the most lethal gynecological malignancy, with a mortality rate of approximately 70%. High-grade serous ovarian cancer (HGSOC), the most common and deadliest subtype of ovarian cancer, initially responds to platinum-containing chemotherapy but eventually acquires platinum resistance. This resistance, which occurs in all women who die of ovarian cancer, reduces median survival to 12 months, underscoring the urgent need for improved therapies ( 1 ). While poly(ADP-ribose) polymerase (PARP) inhibitors improve relapse-free survival when used as maintenance therapy for women whose ovarian cancer has responded to adjuvant or neoadjuvant platinum therapy, they do not improve overall survival ( 2 ). This highlights the need to identify promising therapeutic combinations with predictive markers of response that target tumors independent of BRCA mutational status. We have uncovered a unique role of nuclear cathepsin L (nCTSL) in the new combination of clofarabine (CLF) and olaparib for ovarian cancer, and it can offer a personalized approach to therapy. Clofarabine (2-chloro-9-[2′-deoxy-2′-fluoro-β-D-arabinofuranosyl]-9H-purine-6-amine; CLF-ara-A; CAFdA) (CLOLAR®), a next-generation nucleoside analog, has shown remarkable efficacy in recurrent hematological malignancies, including both pediatric and adult acute lymphoblastic leukemia ( 3 , 4 ), acute myeloid leukemia (AML) ( 5 ), and myelodysplastic syndrome ( ClinicalTrials.gov Identifier: NCT0070001). In various Phase II studies, CLF as a single agent has shown an overall response rate of 46-55% and a complete response rate of approximately 40% in AML ( 5 , 6 ). CLF has also shown therapeutic efficacy alone and in combination with other drugs in a wide range of solid tumor cell lines and patient-derived xenografts (PDXs) ( 7 – 13 ), but it has not been tested in ovarian cancer nor with PARP inhibitors. Based on Phase I clinical studies in adult patients with solid tumors administered weekly for 3 weeks (days 1, 8, and 15) every 28 days, CLF was well tolerated and showed clinical activity with the maximum tolerated dose estimated to be 128 mg/m² (Cmax 720 nM) ( 14 ). The reported anticancer activity of CLF involves inhibition of DNA synthesis, direct induction of apoptosis, and inhibition of ribonucleotide reductase activity, resulting in DNA damage and potential replication stalling ( 15 ). There are currently no studies that reported the action of CLF in inducing DNA damage through nCTSL and promoting synergy with PARP inhibitors in blood cancers or solid tumors. Goulet et al. ( 16 ) were the first to reveal that CTSL can traffic to the nucleus through increased translation initiation at downstream AUG sites, bypassing the signal peptide. The functions of the nCTSL isoform in regulating DNA repair ( 17 ), acting as a transcriptional regulator ( 18 ), and serving as a chromatin modifier ( 19 ) are well documented. The pleotropic effects highlight the complexity of CTSL’s function in cancer biology, suggesting its effects are highly context-dependent and influenced by factors such as the type of cancer, the cellular microenvironment ( 20 ), and the presence of specific regulatory molecules or response to specific drugs, as shown in this study. While upregulated nCTSL was observed in Lamin A knockout and growth-arrested MCF7 cells, the underlying mechanism remained unclear ( 17 ). The presence of nCTSL in colon cancer was associated with poor prognosis ( 21 ). In contrast to these reports, our data supports drug-induced nCTSL as a mediator of cell death in cancers. Supporting this role, Li et al. ( 22 ) demonstrated a correlation between 6-hydroxydopamine-induced nCTSL and aberrant expression of certain cell cycle regulators, leading to neuronal cell death in dopaminergic neurons. Other studies by Dennemärker et al ( 23 ), utilizing mice with constitutive CTSL deficiency, uncovered that the absence of CTSL heightened tumor progression and metastasis. Knockdown of CTSL reduced rotenone-induced cell cycle arrest and cell death in PC-12 neuronal cells ( 24 ). Interestingly, CTSL has been shown to generate the angiogenesis inhibitor endostatin from collagen XVIII ( 25 ). Understanding these dynamics is crucial for developing targeted therapies that can either inhibit CTSL’s oncogenic activities or enhance its tumor-suppressing functions. Our study shows that clofarabine (CLF), unlike cytarabine hydrochloride, fludarabine, or gemcitabine hydrochloride, promotes nCTSL, induces DNA damage response, and enhances sensitivity to PARP inhibitors, particularly olaparib in ovarian cancer. RESULTS CLF induces nCTSL in some OC cells In our ongoing efforts to define the role of nCTSL, where it plays a role in the DNA damage response by degrading 53BP1, we conducted a drug repurposing screen with 179 FDA-approved drugs ( https://dtp.cancer.gov/dtpstandard/ChemData/index.jsp ) by immunofluorescence (IF) analysis of nCTSL in BRCA2-mutant PEO1 and its isogenic olaparib resistant PEO1/OLTRC4 cells (selected with continuous exposure to olaparib; a gift from Dr. Xinyan Wu). We identified the anti-leukemic drug clofarabine to promote the trafficking of CTSL to the nucleus in PEO1 cells, but not in PEO1/OLTRC4 cells ( Figure 1A and B ) respectively. For ease of presentation, we refer to cells in which CLF induces nCTSL as CLF- responsive (CLF-r) and those without nCTSL following CLF treatment as CLF-nonresponsive (CLF-nr). Download figure Open in new tab Figure 1: CLF induces differential nuclear trafficking of CTSL in CLF-R vs. CLF-NR ovarian cancer cells. (A) Representative immunofluorescence images of CTSL (green) and CRM1 (red) in PEO1 cells and (B) PEO1/OLTRC4 cells following 24-hour treatment with the indicated inhibitors are shown (40X magnification, scale bar: 5 μm). DAPI was used to stain the nucleus. (C) Similar immunofluorescence images were captured for PEO1 and (D) PEO1/OLTRC4 cells treated with CLF, either alone or in combination with the PARP1 inhibitors olaparib and rucaparib, at the indicated concentrations for 24 hours (40X magnification, scale bar: 5 μm). Representative images include DAPI nuclear staining. (E) Western blot analysis of cytoplasmic and nuclear fractions from PEO1 cells and (F) PEO1/OLTRC4 cells was performed under similar treatment conditions. Tubulin was used as the cytosolic endogenous control, and Histone H3 served as the nuclear control. Normalized fold changes relative to control were calculated using ImageJ software, and displayed beneath each panel. (G-H) Comparable immunoblot analysis of cytoplasmic and nuclear fractions was carried out on ex vivo patient-derived xenograft (PDX) cultures PH610 and PH747 under identical treatment conditions. CLF promoted the nuclear trafficking of CTSL (Green foci in the nucleus) in PEO1 cells (CLF-r), both alone and in combination with olaparib or rucaparib ( Figure 1C , top panel, CTSL: green, DAPI: blue). However, in the PEO1/OLTRC4 cells (CLF-nr), only the combination of CLF and olaparib, ( Figure 1D , bottom panel) but not CLF and rucaparib alone or in combination promoted the nuclear trafficking of CTSL. Using the western blot analysis of fractionated cell lysates, we confirmed that CLF aids in the nuclear trafficking of CTSL in the PARP inhibitor sensitive PEO1 cells alone and in combination with olaparib or rucaparib ( Figure 1E , red box). However, in the PEO1/OLTRC4 cells, only the combination of CLF and olaparib, but not rucaparib, resulted in the trafficking of CTSL to the nucleus ( Figure 1F , red box). Additionally, CLF induces nCTSL in PH610 cells ( ex vivo culture of a patient-derived xenograft) ( Figure 1G , red boxes) whereas it was not sufficient to induce nCTSL in PH747 cells ( Figure 1H , red box). Similarly, CLF alone aided in nCTSL trafficking in OVCAR5 and HeyA8 (all BRCA WT), categorizing them as CLF-r. In contrast, CLF alone was not sufficient to induce nCTSL in OVCAR8 and HeyA8-MDR (with cross-resistance to cisplatin, adriamycin, and vincristine) ( 26 ), thus classifying them as CLF-nr. These data suggest that the trafficking of nCTSL is not restricted to PARP inhibitor-resistant cells but also extends to cells resistant to paclitaxel, cisplatin, and other drugs ( Table 1 ). View this table: View inline View popup Download powerpoint Table 1: List of ovarian cancer cells categorized based on drug induced (CLF and/or olaparib) nCTSL trafficking as CLF-R, CLF-NR and CLF- Resistant. (CLF-R: Responsive to CLF, CLF-NR; Responsive to CLF/Olaparib combination, CLF Resistant; Resistant to CLF/olaparib combination. It is important to note that in addition to rucaparib neither niraparib nor veliparib, alone or in combination with CLF did not aid in the translocation of CTSL to the nucleus in CLF-nr PH747 cells (Figure S1A-C). We also observed that CLF induces nCTSL in ex vivo cultures of patient-derived ascites OVA2 but not in OVA12 (Figures S1 D and E), and in ex vivo cultures of patient primary tumor OV-1182 but not in OV- 1183 (Figures S1 F and G). CLF and olaparib differentially regulate the trafficking of Importin B1 (KPNB1) to the nucleus in the CLF-r vs. CLF-nr OC cells respectively to promote the nuclear import of CTSL . Considering that nuclear proteins are imported by KPNB1 and exported by Exportin 1 (also known as CRM1), we assessed the extent to which CLF and PARP inhibitors affected the expression of these proteins. In CLF-r PEO1 cells, CLF downregulates CRM1 and upregulates KPNB1 ( Figure 1E ). In CLF- nr PEO1/OLTRC4 cells, CLF downregulates CRM1 but fails to upregulate KPNB1 ( Figure 1F ). These results suggest KPNB1 upregulation determines nuclear import of CTSL. These results are consistent with prior studies indicating that KPNB1 knockdown (KD) resulted in the absence of nCTSL in the nucleus of MDA 468 cells ( 27 ). In PEO1 and PH610 cells, CLF (but not olaparib) promoted the trafficking of KPNB1 into the nucleus ( Figure 1E and G , blue boxes) as seen as increased levels of KPNB1 in the nuclear compartment. In contrast, in the CLF-nr PEO1/OLTRC4 and PDX PH747 cells, olaparib (but not rucaparib or CLF) regulated KPNB1 trafficking to the nucleus ( Figure 1F and H , blue boxes). This is in comparison to rucaparib-treated lysates in CLF-nr cells ( Figure 1F and H , last two lanes). CLF downregulated olaparib- induced CRM1 ( Figure 1F and H , green boxes), leading to the retention of CTSL in the nuclear compartment. Furthermore, it is important to note that rucaparib (as well as niraparib and veliparib, data not shown) alone or in combination with CLF do not promote KPNB1 import into the nuclear compartment in CLF-nr cells ( Figure 1F and H , last two lanes). Importazole specifically blocks CLF alone and CLF+olaparib-induced KPNB1 import into the nucleus Our data indicated that in CLF-r cells, CLF facilitates the nuclear translocation of KPNB1-bound CTSL, while in CLF-nr cells, olaparib aids this process. To determine if KPNB1 is involved in the nuclear translocation of CTSL, we treated CLF-r PH610 and CLF-nr PH747 cells with the indicated doses of CLF or olaparib, alone and in combination ( Figure 2A and B ). Fractionated cell lysates were analyzed by western blot with the indicated antibodies. Download figure Open in new tab Figure 2: Importazole specifically blocks CLF alone and CLF+olaparib-induced KPNB1 import into the nucleus. (A-B) Western blot analysis of CTSL and KPNB1 levels was performed on cytoplasmic and nuclear fractionated extracts from PH610 and PH747 cultures treated with the indicated drugs with or without importazole for 24 hours. Normalized fold changes relative to control were calculated using ImageJ software, normalized, and presented below each panel. (C) Cell extracts from empty vector and Flag-tagged CTSL overexpressing cells were immunoprecipitated with an anti-Flag antibody. Co-precipitated KPNB1 was detected via immunoblot analysis, and the reverse co-immunoprecipitation was also performed. KPNA1 was included as a negative control. (D) A CETSA (cellular thermal shift assay) was conducted to evaluate the thermal stability of KPNB1 protein upon binding to clofarabine (CLF) and olaparib, respectively, in PEO1 cells, followed by analysis via western blot. (E-F) Densitometric analysis of the CETSA blot was performed using ImageJ, and the results were plotted using GraphPad Prism. (G) A similar CETSA was conducted in PEO1/OLTRC4 cells. (H-I) Densitometric analysis and data plotting of the CETSA blot were performed as described. In PH610 cells, CLF treatment alone induced nuclear CTSL (nCTSL) ( Figure 2A ). This corresponds with the increased levels of KPNB1 in the nuclear compartment ( Figure 2A ). In cells treated with importazole, a small molecule inhibitor which specifically blocks KPNB1-mediated nuclear import without disrupting CRM1-mediated nuclear export ( 28 ), the levels of KPNB1 were negligible ( Figure 2A ), coinciding with the absence of nCTSL ( Figure 2A ). Similar results were observed in CLF-nr PH747 cells treated with the combination of CLF and olaparib ( Figure 2B ) that generated nCTSL translocation. Under these conditions, the addition of importazole resulted in negligible levels of KPNB1 Figure 2B ), corresponding with the absence of CTSL in the nucleus ( Figure 2B ). Collectively, these results support the role of KPNB1 as the importer involved in the translocation of nCTSL. To determine the interaction between KPNB1 and CTSL, we transfected a Flag-tagged full length CTSL construct into HEK293 cells and performed coimmunoprecipitation using anti-KPNB1 or anti-Flag antibodies. These studies showed that KPNB1 but not KPNA1 immunoprecipitated CTSL and vice versa ( Figure 2C ). Cellular thermal shift assay shows olaparib stabilizes KPNB1 bound CTSL To better understand the differential role of CLF versus olaparib in the import of CTSL-bound KPNB1, we performed a cellular thermal shift assay (CETSA) as described in the methods section ( 29 , 30 ). The interaction of CLF and olaparib with endogenous KPNB1, assessed by CETSA, showed that direct binding of these drugs to KPNB1 results in enhanced stability, requiring increased temperature for denaturation. In CLF-r PEO1 cells, KPNB1 is stabilized by CLF, as evidenced by its increased stability and higher denaturation temperature compared to the unbound protein, ( Figure 2D , middle panel compared to control DMSO-treated cells panel 1). There is a significant increase in the stability of KPNB1 bound to CLF but not to olaparib in these cells, as shown by the melting curves with relative band intensities in Figures 2E and 2F (compare the red and blue lines). Conversely, in PEO1/OLTRC4 cells, KPNB1 is stabilized by olaparib but not by CLF, and remains in solution at higher temperatures ( Figure 2G , panel 3 compared to control DMSO-treated cells in panel 1). A thermal shift is observed with olaparib but not CLF in these cells, as depicted by the melting curves in Figures 2H and 2I (compare the red and blue lines). These data support the differential stability of CTSL-bound KPNB1 translocated to the nucleus by clofarabine in CLF-R PEO1 cells and by olaparib in CLF-NR PEO1/OLTRC4 cells, respectively. Drug-induced nCTSL is a common event in cancers of different origins Reports indicate the presence of nuclear CTSL in tumors of triple-negative breast cancer (TNBC) ( 17 ), as well as in colon cancers ( 21 , 31 , 32 ). Previous studies revealed that LMNA knockout (KO) cells and MCF7 cells, which bypassed BRCA1 loss-induced growth arrest, exhibited upregulated nCTSL, although the underlying mechanism remained unclear. To explore this phenomenon, we assessed the effects of CLF alone and in combination with olaparib in TNBC cell lines: BRCA wild-type (WT) MDA-MB-231 and BRCA1 mutant lines HCC1395 (BRCA1 HD and BRCA2 mut E1593*), MDA-MB-436, and HCC1937. In all TNBC cell lines tested, CLF alone facilitated nuclear CTSL trafficking, classifying them as CLF-r cells. Conversely, in the luminal BRCA WT MCF7 cells, CLF alone did not promote nCTSL trafficking, categorizing them as CLF-nr cells. In these cells, both CLF and Olaparib were needed to facilitate nCTSL trafficking. Similarly, the OV2008 cervical cell line (a derivative of ME180) was CLF-r, while its isogenic cisplatin-resistant C13 cells were CLF-nr, mirroring the behavior of ovarian cell lines HeyA8 and HeyA8 MDR cells. The endometrial cancer cell lines KLE and ARK1 were CLF-nr. The uterine carcinosarcoma cell line SNU539 was CLF-r, while SNU1077 was categorized as CLF-nr. Non-small cell lung cancer cell lines H460 and A549 also belonged to the CLF-nr category ( Table 2 ). In CLF-nr cohort, the combination of CLF and Olaparib facilitated nCTSL trafficking and cytotoxicity. Collectively, the data suggest that this novel combination therapy shows potential applicability across various tumor types. View this table: View inline View popup Download powerpoint Table 2: List of other cancer types categorized based on drug induced (CLF and/or olaparib) nCTSL trafficking as CLF-R, CLF-NR and CLF- Resistant. (CLF-R: Responsive to CLF, CLF-NR; Responsive to CLF/Olaparib combination, CLF Resistant; Resistant to CLF/olaparib combination. Specificity of nCTSL in targeting 53BP1 and RAD51 to inhibit homologous recombination repair Based on reports that nCTSL degrades 53BP1 in breast cancer ( 17 ), we evaluated the ability of drug- induced nCTSL to target the two major repair proteins, 53BP1 and RAD51. In PEO1 and PEO1/OLTRC4 cells (and in PH610 and PH747, data not shown), the presence of drug-induced nCTSL ( Figure 3A and B , Row 1 - green boxes) is associated with reduced levels of 53BP1 and RAD51 in both CLF-r and CLF-nr cells ( Figure 3A and B , respectively). Consistent with these findings, IF analysis revealed that CLF downregulated 53BP1 and RAD51 in PEO1 non-targeted control (NTC) cells, but not in CTSL- knockdown (KD) sh2 and sh3 cells ( Figure 3C ), indicating that nCTSL plays a role in degrading these specific proteins. Figures 3D-F show the quantification of the number of 53BP1 and RAD51 foci in PEO1 NTC and CTSL-KD sh2 and sh3 cells, respectively. Data using recombinant CTSL (rCTSL) incubated with lysates from OVA-12 cells confirmed that, in addition to 53BP1, CTSL also degraded RAD51 ( Figure 3G ) but not PARP1. Treatment with the CTSL-specific inhibitor z-fy(tbu)-dmk restored 53BP1 and RAD51 levels ( Figure 3G ) without affecting PARP1, suggesting that CTSL selectively degrades certain DNA repair proteins. Download figure Open in new tab Figure 3: nCTSL targets 53BP1 and RAD51 to inhibit the homologous recombination repair. (A-B) Immunoblot analysis was performed to evaluate CTSL, 53BP1, and RAD51 levels in cytoplasmic and nuclear fractions of PEO1 and PEO1/OLTRC4 cells treated with the indicated drugs for 24 hours. Tubulin was used as the cytosolic control, and Histone H3 as the nuclear control. Fold changes were calculated using ImageJ software, normalized, and displayed below each panel. (C) Immunoblot analysis confirmed efficient knockdown (KD) of CTSL in PEO1 cells. (D) Representative immunofluorescence images show 53BP1 (red) and RAD51 (green) foci in PEO1 non-targeting control (NTC), CTSL KD sh2, and sh3 cells following 24-hour CLF treatment. DAPI was used to stain nuclei. (E-F) Quantification of the number of foci per cell was performed in 25 cells, and data were plotted as mean ± SEM (***p < 0.001 vs. control). (G) Immunoblot analysis of RAD51, 53BP1, and PARP1 levels was conducted on OVA12 ascites cell lysates treated with recombinant CTSL protein alone or in combination with the z-t(bu)-dmk inhibitor for 24 hours. (H) Representative flow cytometric analysis images show the percentage of GFP-positive cells as a measure of double-strand break (DSB) repair following treatment with the indicated concentrations of CLF and olaparib, either alone or in combination, in PEO1 cells for 24 hours. Quantification of GFP- positive cells is presented as mean ± SD (*p < 0.05, **p < 0.01, ***p < 0.001 vs. control). To determine the effect of CLF and olaparib alone or in combination on homologous recombination repair (HRR), we used the DR-GFP reporter assay ( 33 ). Following the induction of DNA double-strand breaks with I-SceI, in PEO1 -CLF-r cells expressing DR-GFP substrate, we observed significantly less GFP+ cells in CLF alone and in CLF+olaparib treated cells which also facilitates the translocation of CTSL to the nucleus compared and olaparib alone untreated cells ( Figures 3H-I ) indicating inhibition of HR repair. Together, these results suggest that the CLF+olaparib combination attenuates DNA repair by downregulating two key DNA repair proteins, 53BP1 and RAD51. Presence of nCTSL is associated with DNA damage in PDX and OVA cells Consistent with the induction of nCTSL in PH610 and OVA-2 cells, COMET assays demonstrated that CLF alone or in combination with olaparib induced substantial DNA damage in these cells ( Figures 4A and E ). In contrast, olaparib alone induced negligible DNA damage ( Figures 4A and E ). In OVA-2 cells, the combination of CLF and rucaparib also induced some level of DNA damage ( Figure 4E ). However, CLF or olaparib alone produced negligible DNA damage in PH747 and OVA-12 cells ( Figures 4C and F ). The combination of CLF and olaparib, on the other hand, induced significant DNA damage in these cells ( Figures 4C and F ). More strikingly, rucaparib treatment alone or in combination with CLF did not induce any DNA damage in the CLF-nr OVA-12 cells. Quantification of tail moments for all events is shown next to their respective COMET images ( Figure 4B , D, G and H). Importantly, in CTSL KD sh2 cells, CLF alone or in combination with olaparib did not induce DNA damage ( Figure 4J ) compared to PEO1 cells transduced with non-targeted control (NTC). Western blot analysis in Figure 4I shows the efficient KD of CTSL. Collectively, these results show that DNA damage induced by these drugs rely on the presence of CTSL in the nucleus. Download figure Open in new tab Figure 4: nCTSL induces DNA damage in the PDX and ovarian ascites cells. (A-B) Representative images from the alkaline COMET assay are shown for PDX PH610 (CLF- responsive) and PH747 (CLF-non-responsive) cells treated with CLF (200 nM) and olaparib (2 µM), either alone or in combination, for 24 hours. (C-D) A similar COMET assay was performed in ovarian ascites cell lines OVA-2 and OVA-12 treated with CLF (100 nM), olaparib (2 µM), and rucaparib (2 µM), either alone or in combination with CLF, for 24 hours. (E) The alkaline COMET assay was also conducted in CTSL knockdown (KD) PEO1 cells and non-targeting control (NTC) cells following treatment with the indicated concentrations of CLF and olaparib, either alone or in combination, for 24 hours. For all cases, quantification of the tail moment is shown (**p < 0.01, ***p < 0.001 vs. control). (F) Western blot analysis of CTSL levels was performed in NTC control and CTSL KD PEO1 cells, with tubulin used as the endogenous control. CLF+olaparib combination induces G2M arrest and apoptosis in CLF-nr cells To better understand the effect of DNA damage induced by CLF alone or in combination with olaparib or rucaparib, PH610 and PH747 cells were treated with 20 nM CLF alone or in combination with 2.0 µM olaparib or rucaparib for 24 hours. Cell cycle analysis revealed that treatment of PH610 cells with CLF alone or in combination with PARP inhibitors led to cell cycle arrest in the G2/M phase ( Figure 5A and C ). However, in PH747 cells, only the combination of CLF and olaparib resulted in G2/M arrest, while the combination of CLF and rucaparib did not exhibit the same effect ( Figure 5B and D ). Consistent with the cell cycle analysis, the apoptotic effects of CLF were examined in both the CLF-r PEO1 and CLF-nr PEO1/OLTRC4 models using flow cytometry with Annexin V (Pacific Blue) and propidium iodide labeling with and without caspase inhibitor. In PEO1 cells, CLF alone induced 21.4% cell death, and this was enhanced 4.4 fold when combined with Olaparib, with minimal attenuation by the caspase inhibitor ( Figure 5E and G ). This data suggests that the caspase-independent cell death as a mechanism in these cells. Similarly, in CLF-nr cells, CLF+ olaparib induced significant cell death (86.2%), which was minimally reduced to 84.7% in the presence of Z-DEVD-FMK (84.7%), implicating the caspase- independent mechanism in nCTSL-mediated cell death (Figure 5Fand H). Rucaparib alone or in combination with CLF were not effective in the CLF-nr PEO1/OLTRC4 cells. Collectively, these data indicate that CLF and olaparib combination promotes nCTSL translocation and induces caspase- independent cell death in both CLF-r and CLF-nr cells, thus providing evidence for the role of nCTSL in the DNA damage response (DDR) and cell death. Download figure Open in new tab Figure 5: Combination of CLF with olaparib treatment induces G2M arrest and apoptosis in CLF- NR cells. (A) Cell cycle analysis was conducted in PDX PH610 cells using PI staining and flow cytometry after treatment with the indicated concentrations of CLF, olaparib, and rucaparib, either alone or in combination, for 24 hours. The percentage of cells in each cell cycle phase was quantified and plotted. (B) A similar cell cycle analysis was performed on PH747 PDX cells, and the results are represented accordingly. (C-D) Flow cytometric analysis of Annexin V+ cells was conducted in PEO1 (C) and PEO1/OLTRC4 (D) cells following treatment with the indicated concentrations of CLF, either alone or in combination with olaparib and rucaparib, with or without the pan-caspase inhibitor Z-DEVD-FMK, for 24 hours. (G and H)The percentage of Annexin V+ cells was quantified and plotted. Quantification of annexin-v positive cells is presented as mean ± SD (*p < 0.05, **p < 0.01, ***p < 0.001 vs. control). CLF synergizes with olaparib and rucaparib in CLF-r cells and only with olaparib in CLF-nr cells Due to the differential effect of CLF in inducing nCTSL in the CLF-r vs. CLF-nr cohorts, we next investigated whether nCTSL presence was essential for CLF to sensitize cells to PARP inhibitors. Clonogenic assays of PEO1 and its isogenic olaparib-resistant PEO1/OLTRC4 cells showed that PEO1 cells were more sensitive to olaparib compared to PEO1/OLTRC4 cells ( Figure 6A and B ). The IC50 for olaparib improved by 10-fold from 1.8 µM to 0.18 µM in PEO1 cells when 5.0 nM CLF was included ( Figure 6C ). Approximately 4-fold improvement in IC50 (from 0.4 µM to 0.1 µM) was observed with rucaparib in these cells when 5.0 nM CLF was included ( Figure 6D ). The IC50 for olaparib also improved from 11.76 µM to 3.5 µM in PEO1/OLTRC4 cells when 5.0 nM CLF was included ( Figure 6E ). A smaller improvement in IC50s for rucaparib in combination with CLF was observed in PEO1/OLTRC4 cells ( Figure 6F , blue line). Download figure Open in new tab Figure 6: CLF-R cells show synergy on combination treatment of CLF with olaparib and rucaparib, while CLF-NR cells show similar effect with CLF + olaparib only. (A)Representative images of the colony formation assay are shown in PEO1 and PEO1/OLTRC4 cells with increasing dose of olaparib as indicated. (B) Quantification was performed using image J software and plotted. (C-D) Quantification of the clonogenic assay was represented as colonies (% of the control) in the PEO1 cells upon continuous exposure to increasing concentrations of olaparib and rucaparib respectively (±) 2.5 and 5.0 nM CLF. (E-F) Similar assay was performed and plotted in the PEO1/OLTRC4 cells. (G-H) Similar assay was performed with the indicated drug concentrations in the PDX PH610 and (I-J) PH747 cells respectively. (K-L) Quantification of the clonogenic assay was represented as colonies (% of the control) in the PEO1/OLTRC4 NTC and CTSL-KD cells upon continuous exposure to increasing concentrations of olaparib with 5 nM of Clofarabine (In inset, western blot shows shCTSL1 and shCTSL3 knockdown compared to NTC). For all the cases, IC50 value was calculated and presented (error bars, ±SEM, n=3). Consistent with the cell line model data, clonogenic assays of ex vivo cultures of PDX models showed that CLF sensitized the CLF-r PDX PH610 to both olaparib and rucaparib ( Figure 6G and H ). In contrast, CLF sensitized the CLF-nr PDX PH747 cells to olaparib but not to rucaparib treatment ( Figure 6I and J ). To demonstrate that nCTSL is necessary for sensitization, knockdown (KD) of CTSL (shCTSL- 1 and -3) in PEO1/OLTRC4 cells showed resistance to olaparib alone or combination with CLF compared to control cells transduced with NTC ( Figure 6K and L ). Western blot analysis confirmed efficient CTSL KD in these cells ( Figure 6K , inset). Specific role of nCTSL in DDR The 5′ portion of the human cathepsin L cDNA contains 7 AUG codons, corresponding to methionine 1, 35, 42 56, 58, 75, 77, 83, and 92. hCTSL mutants were generated with the following substitutions: AUG codons (Met 1, 35, 42 and 56). We have generated several C9-tagged CTSL constructs including with substitutions in the first initiation codon (ATG > TTG, converting Methionine to Leucine-referred to as M1L mutant). In the context of M1L mutant we generated additional constructs where M35, M42 and M56 were mutated to M35L, M42L and M56L ( Figure 7A ) ( 34 ). M1L-Mut prevents the generation of the secreted form of CTSL ( 16 ). To validate the specific role of nCTSL in DDR, we transfected WT, M1L and M56L ( 16 ) in CTSL knockdown PEO1/OLTRC4 sh2CTSL cells. IF analysis confirms the presence of nCTSL-C9 in cells transfected with M1L but not with the M56L ( Figure 7B ). Western blot analysis of fractionated cell lysates further corroborated these results ( Figure 7C ). The presence of nCTSL generated by M1L enhances DNA damage as assessed by increase in γH2AX levels ( Figure 7C ), downregulated 53BP1 and RAD51 levels. Expression of the M35L and M42L mutant constructs in the M1L-Mut background, the two other in-frame start codons in the human CTSL localized to the nucleus (data not shown), implicating codon 56 (M56-Mut) as the preferred first in frame ATG to generate the nCTSL isoform. Download figure Open in new tab Figure 7: nCTSL is specifically involved in the DNA damage response. (A) Schematic representation of the C9-tagged CTSL construct, highlighting the alternative start codons, nuclear localization signal (NLS), and nuclear export sequence (NES) motifs. (B) Immunofluorescence analysis of C9-tagged M1 and M56 mutant constructs in PEO1/OLTRC4sh2 CTSL cells, detected with an anti-C9 antibody. (C) Western blot analysis of cytoplasmic and nuclear fractions was performed in PEO1/OLTRC4sh2 CTSL cells transfected with the M1 WT, M1-Mut, and M56-Mut nCTSL isoform constructs. Blots were probed with the indicated antibodies, with tubulin and Histone H3 used as endogenous controls for the cytoplasmic and nuclear fractions, respectively. Evaluation of synergy between CLF with olaparib and rucaparib in patient derived ascites and primary patient tumors ex vivo . To assess the potential efficacy of the CLF and PARPi combination in primary OC samples, we examined 14 patient-derived ascites samples ( Table 3 ). OC cells were enriched based on epithelial marker PAX8 expression, with almost no fibroblast activated protein (FAP) expression, as validated through western blot analysis of the ascites samples (Supplementary figure 2A). To evaluate the effect of CLF alone or in combination with olaparib or rucaparib, spheroids were generated (Supplementary figure 2B) with OVA- 11 and OVA-12 ascites using 12.5% ascitic supernatant from the same patient. Supplementary figure 2C shows the efficacy of the drugs expressed as spheroid area compared to untreated control. View this table: View inline View popup Download powerpoint Table 3: List of patients derived ovarian ascitic cancers categorized based on drug induced (CLF and/or olaparib) nCTSL trafficking as CLF-R, CLF-NR and CLF- Resistant. (CLF-R: Responsive to CLF, CLF-NR; Responsive to CLF/Olaparib combination, CLF Resistant; Resistant to CLF/olaparib combination. as an effective cancer and the BRCA and p53 mutational status, when available are shown in the Supplementary table 3. The calculated Combination Index (CI) values for the individual drug combinations across three categories (CLF-r, CLF-nr and CLF-res as defined in this study) of 14 ascites samples are shown in Tables 2 - 1 , 2-2 and 2-3 respectively. Six CLF-r ascites samples (OVA -1, -2, -10, - 11, -22, and -33) and four CLF-nr ascites samples (OVA -12, -15, -28 and -34), collectively representing ∼72% (10/14) of the ascites, displayed synergism with the CLF+olaparib combination, with CI values ranging between 0.4 and 0.7 ( Figures 8A-B and Table 3 ). In the CLF-r OVA samples, CLF also synergized with rucaparib, with CI values ranging from 0.38 to 0.7 ( Figure 8C and D ). As expected, in the CLF-nr OVAs, the CLF+rucaparib combination was antagonistic ( Table 3 ). In the other 28% (4/14) of the ascites samples (OVA-9, -16, -29, and -30), the CLF+olaparib combination was antagonistic, categorizing them as CLF-Res cells ( Figures 8E and F , Table 3 ). Download figure Open in new tab Figure 8: Evaluation of synergy upon treatment of CLF with olaparib and rucaparib respectively in the patient derived ascites cells ex vivo (A)Dual drug response assays for CLF + olaparib and CLF + rucaparib were performed in CLF-R OVAs (OVA-1, 2, 10, 11, 22, and 3) and in (C) CLF-NR OVAs (OVA-12, 15, 28, and 34), and (E) in CLF-Res resistant OVAs (OVA-9, 16, 29, and 30). Each assay included three technical replicates, repeated independently three times (N=3), and was analyzed using the Loewe synergy and antagonism matrix model with Combenefit software. (G) Additional drug response assays for CLF + KPT8602 and olaparib + KPT8602 were conducted in CLF-Res-resistant OVAs (OVA- 9, 16, 29, and 30), analyzed, and represented similarly. The larger numeral in each box of the synergy matrix represents the synergy score, with negative values indicating antagonism. Green boxes indicate non-significant synergy scores, while colored boxes correspond to statistically significant results based on the synergism/antagonism scale, determined using a one-sample t-test. (B, C, F, I and J) Combination index (CI) values across treatment panels were analyzed and presented in a table format. An average CI of 1 indicates an additive effect, CI 1 indicates antagonism. In CLF resistant (CLF-Res) cells, CLF does not downregulate CRM1 levels . Since CLF downregulated CRM1 levels in both CLF-r and -nr cells ( Figure 1E & 1F), we surmised that CLF-resistant cells might have lost the ability to downregulate CRM1, resulting in a failure to retain CTSL in the nucleus. However, these cells might still traffic KPNB1-bound CTSL to the nucleus. Based on this premise, we predicted that these cells would respond to a combination therapy including a CRM1 inhibitor. Retesting the four CLF-Res samples, which previously showed antagonism with the CLF+olaparib combination, with the CRM1 inhibitor KPT8602 in combination with CLF or olaparib, revealed synergistic effects. Specifically, synergy was observed in OVA-9 and -16 with KPT8602+CLF combination and in OVA-29 and -30 with the KPT8602+olaparib combination, with CI values ranging from 0.4 to 0.7 ( Figure 8G -J). In our ongoing investigations, we discovered that certain cell lines, such as small cell lung carcinoma lines H1048 and H1882 and the endometrial cancer lines HEC1A, HEC1B, and RL95-2, were resistant to CLF- induced nCTSL, both alone and in combination with olaparib ( Table 2 ). Consistent with our hypothesis, treating RL95-2 cells with KPT8602 in combination with CLF or olaparib resulted in the trafficking of nCTSL with KPT8602+CLF combination but not with KPT8602+olaparib combination. This outcome suggested that in this sample CLF (but not olaparib) retained the ability to import CTSL bound KPNB1 to the nucleus ( Figure 9A ). This finding suggests additional therapeutic options for sensitizing CLF- resistant cells using CRM1 inhibitors. Supporting this observation, clonogenic assays using RL-95-2 cells and showed that KPT8602 synergized with CLF ( Figure 9B-E ). These results provide further evidence that drug-induced nCTSL can sensitize cells to different combinations of the tested drugs . Download figure Open in new tab Figure 9: KPT8602 sensitizes CLF resistant OVAs to CLF treatment by downregulating CRM1 (A) Western blot analysis of cytoplasmic and nuclear fractions from CLF-resistant RL-95-2 cells was performed to assess CTSL, CRM1, KPNB1, and the nuclear control Histone H3 levels following treatment with the indicated drugs for 24 hours. Fold changes were calculated using ImageJ software, normalized, and displayed below each panel. (B and D) A clonogenic assay was conducted in RL-95-2 cells treated with the indicated concentrations of CLF alone or in combination with olaparib and KPT8602. (C and E) Quantification of the clonogenic assay was represented as colonies (% of the control) in the RL95-2 cells. Error bars represent ± SEM from triplicates of a single assay (n=3). Collectively, these results indicate CLF enhances sensitivity to both olaparib and rucaparib in CLF-r cells and exclusively to olaparib in CLF-nr cells. In CLF-Res cells, a combination of the CRM1 inhibitor KPT8602 with either CLF or olaparib resulted in the CTSL import and retention in the nucleus ( Figure 3 ), correlating with KPT8602-induced synergy with these agents. This highlights the therapeutic importance of drug-induced nCTSL in the DNA damage response (DDR) pathway in ovarian and other cancers. CLF acts synergistically with both olaparib and rucaparib to inhibit tumorigenesis in ex vivo cultures of CLF-r PH610 but only with olaparib in CLF-nr PH747 in vivo NSG mice (NOD/SCID/gamma c null) were injected intraperitoneally with 4×10 6 PH610 and PH747 cells and randomized into six groups (n= 7 and 6 respectively). Treatment regimens are shown in Figures 10A and. CLF (5 mg/kg) was administered intraperitoneally every other day and combined with olaparib (50 mg/kg/day) or rucaparib (50 mg/kg/day) given by oral gavage for four weeks. Mice were sacrificed when the tumor burden exceeded 10% of body weight. The combination of CLF and olaparib or rucaparib significantly reduced tumor burden and ascites in PH610 (CLF-r) mice ( Figure 10B and C ), while only the CLF+olaparib combination was effective in PH747 (CLF-nr) mice ( Figure 10G and H ). Survival increased to 61 days in CLF-r and 56 days in CLF-nr mice with the CLF+olaparib treatment, compared to ∼40 days in the single-agent or CLF+rucaparib groups and controls ( Figures 10D and I ). Single-agent treatments in CLF-r mice also resulted in longer survival than untreated controls. There was no significant body weight loss in any group. Densitometric analysis of western blots from nuclear lysates of representative xenografts (n=3) showed the presence of nCTSL, an increase in γH2AX, a decrease in CRM1 with an increase in KPNB1 nuclear translocation in the CLF+olaparib and CLF+rucaparib groups in CLF-r PH610 ( Figure 10E ). In CLF-nr PH747 xenografts, only the CLF+olaparib combination induced these changes ( Figure 10J ). Decreased 53BP1 and RAD51 expression were observed with nCTSL under treated conditions ( Figure 10E and J ). Download figure Open in new tab Figure 10: Evaluation of synergy upon treatment of CLF with the PARPis olaparib and rucaparib to inhibit tumorigenesis in the in vivo xenograft model of PH610 and 747. (A) Schematic representation of the drug treatment regimen in the in vivo xenograft models of PH610 and (F) PH747. (B) Graph showing the excised tumor weight for the control vs treated mice cohorts in the PH610 and (G) PH747 models, respectively. (C) Graph showing the volume of ascites collected for the control vs treated mice cohorts in the PH610 and (H) PH747 models, respectively. (D) Overall survival plots comparing the control vs treated mice cohorts in the PH610 and (I) PH747 models, respectively. Ki-67 staining of representative xenografts and their quantification for each treatment group. (E) Immunoblot analysis of nuclear fractionated lysates displaying levels of nCTSL, KPNB1, CRM1, and γH2AX in PH610 and (J) PH747 xenografts, with Histone H3 as an endogenous nuclear control for both models. Fold changes were calculated using ImageJ software, normalized, and are shown beneath each panel. CLF synergizes with olaparib in FT33 cells transformed with TAg-Myc or shP53/CDK4 R24C To determine if the combination of CLF+olaparib is toxic to normal cells, we performed clonogenic assay in FT33 cells that are derived from non-diseased human fallopian tube secretory epithelial cells (FTSEC) immortalized with human telomerase reverse transcriptase (hTERT) plus SV40 large T antigens (FT33TAg) and compared it to their counterparts further transformed with c-Myc or with sh-p53 and mutant CDK4 (CDK4 R24C ) ( 35 ). Colony formation assays showed that FT33, FT33-shP53/CDK4 R24C and shPP2A-B56γ and FT33 c-Myc/TAg cells were resistant to CLF monotherapy up to 20nM (Supplementary figure 3A). Clonogenic survival assays showed that FT33 cells treated with increasing concentration of olaparib + 5 nM CLF were resistant to this combination (Supplementary figure 3B). In contrast, under similar conditions, FT33-shP53-R24C that is transformed but not tumorigenic and FT33-TAg-Myc cells that are transformed and tumorigenic in nude mice showed 5.0 nM CLF treatment sensitized these cells to olaparib treatment (Supplementary figure 3C&D) respectively. Significantly, these results indicate CLF synergizes with olaparib in FT33 Tag-Myc and FT33 shP53/CDK4 R24C transformed FTSEC( 35 ) cells but are resistant to FT33 cell immortalized with hTERT and T antigen. ( 35 ). Likewise, IF analysis showed that CLF and olaparib alone or in combination did not aid in nuclear translocation of CTSL in FT33 cells. However, CLF+olaparib combination promoted nCTSL in FT33TAg/Myc cells. Collectively, these data are consistent with the drug-induced nCTSL as a predictive biomarker of response in transformed tumor cells and not in immortalized but nontransformed FTE cells. These results demonstrate that the CLF+olaparib combination facilitates nCTSL translocation, enhancing antitumor activity and modulating DDR in both CLF-r and CLF-nr preclinical OC models. Discussion While PARP inhibitors (PARPis) have provided significant benefits for women with high-grade serous ovarian cancer (HGSOC), selecting the right patients for this treatment remains a challenge. PARPis are not effective for all patients, and even those who initially respond may not sustain their response, resulting in eventual resistance. Current efforts are directed toward improving the overall effectiveness of PARPis such as combining them with other therapies. Despite decades of research, very few predictive biomarkers of response to specific drugs been translated into clinical use. Biomarkers that predict responses to refractory disease could facilitate a precision oncology approach and provide a means to select patients for clinical trials to identify and implement effective therapies. In our efforts to improve response to PARPis, we uncovered that nucleoside analog CLF, by promoting the translocation of cathepsin L to the nucleus, conferred PARP inhibitor sensitivity and cell death. Our data support the role of cathepsin L, a lysosomal cysteine protease that has roles beyond its conventional function in protein degradation in the cytoplasm. Cathepsin L has demonstrated contradictory roles as both an oncogene and a tumor suppressor, depending on the context and cellular environment. While the secreted CTSL isoform promotes migration and invasion ( 36 , 37 ), regulated release of the cytoplasmic form from the lysosomes is involved in the crosstalk between lysosomal membrane permeabilization and mitochondrial membrane permeabilization and cell death ( 38 – 40 ). The presence of the nuclear isoform of CTSL reported in the literature provided the support for the oncogenic role of nCTSL in Ras induced transformation ( 41 ), resistance to DNA damage inducing agents ( 42 ) and typically as a marker associated with bad prognosis ( 21 ). In contrast to these reports, our data indicates the drug-induced nCTSL promotes DNA damage, cell cycle arrest, cell death, and sensitivity to PARP inhibitors in the in vitro cell line models, in ex vivo cultures of patient derived ascites, and in PDX models, clearly providing support for a tumor suppressing role for the drug-induced nCTSL ( Figure 3 - 6 and 10 ). Based on the report that CTSL, CUX1 and Snail all utilize importin β1 for nuclear import ( 27 ), we decided to examine the role of KPNB1 in drug-induced nuclear import of CTSL. Our data showed that one of the key molecular events for retaining CTSL in the nucleus involves the import of KPNB1-bound CTSL by CLF in CLF-r cells and by olaparib in CLF-nr cells. In support of a non-canonical role of olaparib, reports indicate that the PARP inhibitor olaparib, but not talazoparib, acts as a mitochondrial Complex I inhibitor, enhancing its anticancer effects ( 43 ). This suggests that combining DNA repair inhibition with the disruption of cancer cell respiration is a strategy employed by some cancer cells as a strategy for effective therapy. Another critical alteration is CLF-induced downregulation of CRM1 expression, which aids in the nuclear retention of CTSL in both CLF-r and CLF-nr cells ( Figure 1E-H ). However, our data also revealed resistance to CLF-induced CRM1 downregulation in a subset of samples termed CLF-resistant cells (CLF-Res), resulting in the non-retention of CTSL in the nucleus ( Table 2 ). Interestingly, treating CLF-Res cells with a CRM1 inhibitor, KPT8602, in combination with CLF or olaparib, resulted in the nuclear retention of CTSL, restored synergy to these combinations, and induced DNA damage and cell death. Collectively, these findings suggest that CLF promotes the import of KPNB1-bound cargo into the nucleus in CLF-r cells. However, in CLF-nr cells, olaparib effectively traffics KPNB1-bound CTSL to the nucleus when combined with KPT8602 ( Figure 9 ). It is important to note that in CLF-r cells, CLF has dual function: 1) importing CTSL-bound KPNB1 into the nucleus and 2) attenuating CRM1 levels to retain CTSL in the nucleus. This dual function allows CLF to synergize with both olaparib and rucaparib (potentially with other PARP inhibitors) in CLF-r cells. In contrast, in CLF-nr cells, while CLF downregulates CRM1 expression, olaparib—but not rucaparib— facilitates the import of CTSL-bound KPNB1 into the nucleus ( Figure 1C-H , Figure 2A-B ). We confirmed the differential binding of CLF and olaparib to their target KPNB1 using the CETSA assay in CLF-r versus CLF-nr cells, providing evidence for the differential drug response in the import of KPNB1-bound CTSL to the nucleus ( Figure 2C-I ). Consequently, these results present a promising opportunity for using a CRM1 inhibitor with CLF or olaparib as a novel combination therapy for these highly resistant cells. This provides a mechanistic explanation for the differential response to CLF+olaparib versus CLF+rucaparib in nCTSL-induced DDR in CLF-r versus CLF-nr cells. Importantly, these studies have identified novel non-canonical roles of CLF and olaparib in cancer through the nuclear import/export machinery. However, how CLF attenuates CRM1 expression is not currently understood. In our ongoing studies, we will determine if CLF is degrading CRM1 through proteasomal degradation or through autophagy mediated cell death. It is also unknown why in CLF-Res cells, CLF has lost the ability to downregulate CRM1 levels. Available data on the action of CLF in breast cancer suggests that CLF can act as a demethylating agent ( 8 , 10 ). It is possible that CLF by demethylating CRM1 promoter may lead to upregulated CRM1 levels in this category of cells. Studies by Yamanashi et al. suggest that histone H3 and H4 acetylation were significantly decreased in CLF resistant cells, and melatonin induced increase in acetylation may overcome CLF resistance in leukemia cell lines ( 44 ). As a novel therapeutic combination, our further studies showed that the CLF+olaparib combination promoted nCTSL in both CLF-r and CLF-nr cells and drug synergism in 72% of the samples. Similarly, in CLF-Res samples, KPT8602 in combination with CLF or olaparib promoted nCTSL and showed drug synergism in 33% of the samples ( Figure 8 ). This unique observation, that all OVA samples (n=15), drug resistant cell lines (HeyA8MDR, PEO1/OLTRC4, C13, OVCAR 8), and ex vivo cultures of PDXs (PH610, PH747) show synergy when nCTSL was promoted, attest to the drug-induced nCTSL as a predictive marker of response which can be evaluated in ex vivo cultures of patient-derived tumor samples could facilitate a precision oncology approach and provide a means to select patients for clinical trials to identify and implement effective therapies. Sensitivity to combination always correlated with the presence of CTSL in the nucleus. Unlike the clearly defined role of drug-induced nCTSL in this study, the role of nCTSL in breast cancer remains highly controversial. Initially, Gortsky et al. ( 17 ) reported that growth arrested cells transcriptionally downregulated BRCA1 (not BRCA2) and activated nCTSL-mediated degradation of 53BP1, facilitating homologous recombination repair (HRR) ( 42 ). Thus, the presence of nCTSL, in the absence of BRCA1, enabled these cells to survive. This scenario was observed only in triple-negative breast cancers ( 45 ), typically associated with aggressiveness, growth, and survival. In a follow-up study, Croke et al. ( 46 ) demonstrated that in non-cycling cells, nCTSL-mediated degradation of 53BP1 is a natural regulatory mechanism that balances non-homologous end joining (NHEJ) versus HRR repair. Upon re-entering the cell cycle, BRCA1 expression is upregulated, and CTSL is downregulated, restoring the levels of 53BP1 and leading to increased genomic instability, particularly in response to radiation and PARP inhibitors. In contrast to the aforementioned studies, our data show that in addition to targeting 53BP1 for degradation, the drug-induced nCTSL also downregulates RAD51, thus promoting inhibition of HRR. Additionally, the drug-induced nCTSL reported in this study is independent of BRCA1 status. Collectively, these data indicate that the role of nCTSL is highly context-dependent, influenced by the cell cycle status (cycling versus non-cycling) and specific cellular environments. The drug-induced nCTSL in the triple-negative breast cancer cell lines we analyzed ( Table 2 ) is independent of BRCA1 status and exhibits similar roles and behaviors in DNA damage response (DDR) as observed in ovarian cancer. In summary ( Figure 11 ), our drug screening revealed synthetic lethality in cells harboring nCTSL when treated with the FDA-approved nucleoside analogue CLF alone or in combination with olaparib. Therefore, our study suggests that the use of drug-induced nCTSL as a predictive marker of response to treat OC patients with CLF alone or in combination with olaparib irrespective of their BRCA or p53 mutational status. Our results could offer new opportunities for the identification of new druggable targets and/or predictive markers to improve current treatments. Additionally, the tumor suppressive nature of nCTSL was further corroborated by in vivo evidence in mice, independent of BRCA mutational status. This in vivo model also corroborated our in vitro observation that nCTSL induces 53BP1 and RAD51 downregulation and DNA damage (γH2AX staining). These findings suggest that the CLF+olaparib combination is a promising therapeutic strategy for drug-resistant OC by inducing DDR through CTSL localization to the nucleus. Download figure Open in new tab Figure 11: A summarized illustration ( BioRender, https://biorender.com ) showing the role of clofarabine induced nuclear CTSL in DNA damage response in ovarian cancers. Abbreviations; CLF-- clofarabine, R-responsive, NR- Nonresponsive, CTSL- cathepsin L, CRM1-chromosomal region maintenance 1, KPNB1-karyopherin β1, 53BP1-p53-binding protein 1, RAD51-RAD51 recombinase, ϒH2AX- gamma H2A histone family member X, Olaparib- PARP inhibitor, Importazole- KPNB1 inhibitor, KPT8602- CRM1 inhibitor. Materials and methods Materials All anti-cancer drugs, inhibitors, reagents and antibodies are listed in the supplementary table 1. Cell culture and treatments Details of cell lines and culture media used in the study are listed in supplementary Table 2. Cell lines were cultivated in respective culture media with 10% FBS, and 1% penicillin streptomycin in humidified incubators at 37 °C, 5% CO2 atmosphere. Current FDA-approved anticancer drugs were obtained from NCI-DCTD. The current set consists of 179 agents (10 mM) and details can be found here ( https://dtp.cancer.gov/organization/dscb/obtaining/available_plates.htm ). PEO1/PEO-OLTRC4 cells were treated at 10µM concentration for 24 h and stained with Magic Red® Cathepsin L for observing CTSL activity. Further, based on our observation, nucleoside analogs including CLF, fludarabine, gemcitabine and cytarabine were used to treat PEO1 and PEO1-OLTRC4 cells for 24 h and then fixed it and stained with CTSL/CRM1 antibody to detect CTSL localization by confocal imaging. For clonogenic assays, 300 cells per well were seeded in 24-well plates and treated as indicated for up to 10 days till colonies became visible. The colonies were stained with crystal violet dye and quantified using the ImageJ software ( 47 ). Clinical samples from chemo-naive patients were obtained at Mayo Clinic (IRB-approved protocol; 1288- 03) and in association with the University of Minnesota Cancer Center Tissue Procurement Facility (IRB approval; 0702E01841). The patient ascites samples were centrifuged, and trypsinized for 10 min. Following further centrifugation, the cell pellet was treated with 0.4% sterile ammonium chloride, 5 min to eliminate the red blood cells and centrifuged. The pellets were then washed twice with sterile PBS and plated using the specialized DMEM/F12 medium supplemented with 15% FBS on low attachment plates. Clinical characteristics of the patients are provided in the supplementary Table S3. Briefly 400 cells per well were plated in 96-well low attachment plates and treated with the mentioned drug concentrations for up to 3 days, and cell viability measured using CellTiter-Glo® following the manufacturer protocol. Our institutional standard of care includes germline genetic testing and/or somatic testing (like FoundationOne CDx or Myriad myChoice CDx) for all the newly diagnosed advanced stage and recurrent ovarian cancer patients. Subcellular fractionation studies The cells treated with indicated doses of vehicle or CLF with/without PARP inhibitors under in vitro and in ex vivo conditions were fractionated into the cytosol and nuclear portions using a NE-PER Kit (Thermo Fisher Scientific, USA) according to the manufacturer’s protocol. Briefly, the cells/tumor tissues were washed, incubated in cytoplasmic extraction solution and subsequently centrifuged. The supernatant served as the cytoplasmic fractions. The residual pellet was resuspended in nuclear extraction buffer, centrifuged for nuclear fractions separation. Generation of knockdown and overexpressed cells PEO1 and PEO1-OLTRC4 (Gift from Dr. Xinyan Wu, Mayo Clinic) cell lines were stably knocked down for CTSL using specific targeted shRNA from Sigma-Aldrich, following supplier’s protocol. CTSL-sh1 (TGCCTCAGCTACTCTAACAT) CTSL-sh2 (TGCCTCAGCTACTCTAACATT) and with nontargeted control shRNA as control with Lipofectamine 2000 (Invitrogen, Carlsbad, CA) as per manufacturer protocol in the indicated cell lines. Puromycin was used to select stable clones as reported earlier ( 48 ). Flag-tag insert p3xFlag-CMV-14 was purchased from Sigma and human wildtype CTSL-C9 plasmid was purchased from addgene (Addgene #11250). CTSL-wildtype construct was inserted into p3xFlag-CMV-14 to generate flag-tagged hCTSL by using hCTSL-wildtype primers -CMV-14 Forward (Hind III) 5’ – AAT TAA GCT TAT GAA TCC TAC ACT CAT CCT TGC T-Reverse (Xba I)5’ – AAT TTC TAG ACA CAG TGG GGT AGC TGG CTG C -3’. CTSL mutants were generated in human wildtype CTSL-C9 plasmid with the following replacements: AUG codons (Met 1, 35, 42 and 56) mutated to UUG (Leu) to generate C9-tagged hCTSL- M1L, M35L, M42L and M56L by site-directed mutagenesis (Agilent) kit using primers hCTSL-M1L Fw- 5’ C GGG CCC TCT AGA TTC AAT CCT ACA CTC ATC C 3’, R-5’ G GAT GAG TGT AGG ATT GAA TCT AGA GGG CCC G 3’; hCTSL M35L FW-5’ GG ACC AAG TGG AAG GCG TTG CAC AAC AGA TTA TAC GG 3’, RW-5’ CC GTA TAA TCT GTT GTG GAA CGC CTT CCA CTT GGT CC 3’; hCTSL M42L FW-5’C AAC AGA TTA TAC GGC TTG AAT GAA GAA GGA TGG AGG 3’ RW-5’ CCT CCA TCC TTC TTC ATT GAA GCC GTA TAA TCT GTT G 3’ hCTSL-M56L F- 5’ GTG TGG GAG AAG AAC TTG AAG ATG ATT GAA CTG C 3’, R-5’ GCA GTT CAA TCA TCT TCA AGT TCT TCT CCC ACA C 5’; The M1L and M56L mutant constructs were overexpressed in the PEO1/OLTRC4 cells to generate nCTSL and stained with anti-flag antibody and confirmed by immunoblots. Degradation of Cellular RAD51/53BP1 by rCTSL Analysis To assess whether RAD51 and 53BP1 were directly degraded by CTSL, 50 µg of whole cell lysates from OVA-12 cells were incubated with recombinant human CTSL (rCTSL) protein (0.5 µg/sample for 1 h) at room temperature in assay buffer (50 mM MES, 5 mM DTT, 1 mM EDTA, 0.005% (w/v) Brij35, pH 6.0). Samples were resolved on a 4-15% SDS-PAGE gel, followed by immunoblotting with the RAD51, 53BP1, PARP1 and tubulin antibodies ( 40 ). Cellular thermal shift assay (CETSA) PEO1 and PEO1/OLTRC4 cells were treated with indicated concentrations of DMSO, CLF and olaparib alone and whole cell lysates containing 0.1% Triton 100 were diluted to 1.5 μg/μl and the cell lysates were incubated for 30 min at room temperature. Proteins were denatured using Bio-Rad 96-well Thermal Cycler for 3 min at different temperatures ranging from 46 °C to 67 °C and centrifuged at 16000 X g for 30 min at 4 °C ( 29 , 30 ). The supernatants were immunoblotted and probed with anti-KPNB1 antibody and shown here. Single cell electrophoresis (COMET assay) Alkaline comet assays were performed with the mentioned treatments using an established protocol ( 49 ). 1×10 5 cells were plated in 12 well plate and treated with CLF alone or in combination with olaparib or rucaparib for 24 h. The cells were washed in 2 x PBS and resuspended in 100 µl of a low melting point agarose, smeared on glass slides. After gelling, slides immersed in pre-chilled alkaline lysis buffer (1.2 M NaCl, 100 mM Na2EDTA, 0.1% sodium lauryl sarcosinate, 0.26 M NaOH (pH > 13)) for 1 h. Slides were electrophoresed in alkaline electrophoresis buffer (0.03 M NaOH, 2 mM Na2EDTA (pH ∼12.3)) for 15 min at 30 V. Slides were washed, stained with ethidium bromide (2.5 µg/ml) and observed using a fluorescence microscope (Olympus). Tail moments were quantified using CaspLab version 2.2 software and plotted. Homologous Recombination (HR) assay PEO1 cells were stably transfected with the HR substrate pDR-GFP ( 50 ) and transfected with pCβASceI plasmid for 24 h, and treated with indicated concentrations of CLF, olaparib alone and in combination for another 24 h, and evaluated for the percent GFP positive fluorescence using flow cytometry. Immunoprecipitation assay For detection of the protein complex, the cell lysates containing 400 μg of protein were incubated with the anti-Flag-CTSL antibody (1:100) overnight at 4 °C, and then 10 μl of 50% protein A-agarose beads were added and thoroughly mixed at 4 °C for 6 h. The immunoprecipitates were washed thrice with PBS, and precipitated beads were loaded into the sample buffer, subjected to electrophoresis on 4–15% SDS–PAGE and blotted using an anti-Flag, -KPNB1 or KPNA1 antibodies Immunofluorescence assay Indicated cells were grown on multi-chambered slides overnight and then cells were fixed, permeabilized and stained with anti- RAD51, -γH2AX, -CRM1 and -CTSL (1:100) overnight at 4 °C. The cells were then stained using rabbit anti-mouse IgG Alexa Fluor® 594 or rabbit anti-mouse IgG-FITC (Molecular Probes) Slides were mounted with Antifade reagent (Invitrogen, Carlsbad, CA), visualized using a Zeiss-LSM780 confocal microscope and corrected total cell fluorescence (CTCF) was obtained by ImageJ-Fiji software. Immunoblot assay Cytosolic and nuclear fractions or whole cell lysates were isolated and subjected to SDS-PAGE followed by immunoblot ( 51 ) using antibodies listed in Table S1. Secondary staining was achieved with secondary anti-mouse and rabbit with-680 or 800 IR dyes and scanned under the Odyssey Fc Imaging system (Bio-Rad, Hercules, CA). The normalized relative expression folds were calculated using ImageJ software. Annexin V/PI staining Percent cell apoptosis was assessed as described before ( 40 ) and the cells after indicated treatments were fixed, stained with annexin V-pacific blue and propidium iodide (PI), then sorted using a flow cytometer (BD FACS Canto II) and analyzed using FlowJo 10.1 software Cell cycle analysis Briefly cells were treated with the indicated concentrations of the mentioned drugs for 0-24 h and the cells were collected, washed with ice-cold PBS, and fixed using 70% chilled alcohol and stained with propidium iodide in presence of RNase A (Invitrogen Life Technologies) at 37 °C for 20 min prior to analysis. Cell cycle was evaluated using FlowJo 10.1 software Synergy assessment Synergy was measured with the Combenefit software ( http://sourceforge.net/projects/ combenefit/ ), and the synergism-antagonism distributions were shown. Drug assays of CLF with rucaparib and olaparib (N = 3) were analyzed by the Loewe additivity model and colored when significant. The Combenefit software compare the experimental drug response surface to the reference surface and prepare a percentage score to each cell in the matrix. Statistical significance was determined by applying the one- sample t test. The combination index (CI) values were calculated using Calcusyn software ( https://www.combosyn.com ) applying a non-constant ratio approach, according to Chou and Talalay ( 33 ). Patient derived xenograft (PDX) models Female NSG mice (NOD-SCID) were injected intraperitoneally (i.p.) with ex-vivo cultures of PH610 and PH747 cells (4×10 6 cells/mouse) and maintained for 15 days. The mice were then randomized into six groups (n=7, PH610) (n=6, PH747) and treated as; group 1: vehicle control; group 2: CLF (5 mg/kg every other day i.p.) ; group 3: olaparib (50 mg/kg/day by oral gavage); group 4: rucaparib (50 mg/kg/day by oral gavage); group 5: combination of CLF and olaparib; group 6: combination of CLF and rucaparib. Mice were treated for 4 weeks and then followed for 2 weeks and sacrificed when tumor burden exceeded 10% of body weight in the control group. At end of the study, tumor volume, ascites volume and survival of animals were assessed Animal experiments were carried out under the approved protocols and guidelines of the Mayo Clinic Animal Care and Use Committee (IACUC number#A00006931) Statistical analysis All experiments were performed in triplicates in each of 3 independent experiments unless indicated. The results were expressed as mean ± standard deviation. Statistical significance (*p < 0.05; **p < 0.01; ***p <0.001) was determined using Student’s test unless otherwise noted. Final approval of manuscript All authors Conflict of interest Authors declare no conflict of interest. Acknowledgements This work was supported in part by Department of Defense grant award #HT9425 241-0357 (OC230398) to VS and an Ovarian SPORE (P50 CA136393) developmental research grant to VS. We would also like to acknowledge the Mayo Ovarian Spore for collection of the ovarian ascites samples from patients. We would also like to thank Dr. Larry Karnitz (Mayo Clinic Rochester, MN) for OVCAR8 DR-GFP cells, Drs. Amy Skubitz and Kristin Boylan for cryopreserved patient-derived ascites samples from the University of Minnesota under an IRB-approved protocol, and Dr. Ronny Drapkin, University of Pennsylvania, Perelman School of Medicine for the FT33(hTERT/TAg), FT33-shP53/CDK4 R24C and shPP2A-B56γ and FT33 c-Myc/TAg cells. We gratefully acknowledge contributions of the Mayo Clinic Cancer Center (P50 CA015803)-supported Pathology Research Core laboratory, Microscopy & Cell Analysis Core, and the Flow Cytometry Facility. References 1. ↵ Andrei Havasi SSC , Ana Teodora Havasi , and Calin Cainap . Ovarian Cancer—Insights into Platinum Resistance and Overcoming It . Medicina (Kaunas ) 2023 2. ↵ Caruso G , Tomao F , Parma G , Lapresa M , Multinu F , Palaia I , et al. Poly (ADP-ribose) polymerase inhibitors (PARPi) in ovarian cancer: lessons learned and future directions . Int J Gynecol Cancer 2023 ; 33 : 431 – 43 OpenUrl Abstract / FREE Full Text 3. ↵ Gandhi V , Plunkett W , Bonate PL , Du M , Nowak B , Lerner S , et al. Clinical and pharmacokinetic study of clofarabine in chronic lymphocytic leukemia: strategy for treatment . Clin Cancer Res 2006 ; 12 : 4011 – 7 OpenUrl Abstract / FREE Full Text 4. ↵ Jeha S , Gaynon PS , Razzouk BI , Franklin J , Kadota R , Shen V , et al. Phase II study of clofarabine in pediatric patients with refractory or relapsed acute lymphoblastic leukemia . J Clin Oncol 2006 ; 24 : 1917 – 23 OpenUrl Abstract / FREE Full Text 5. ↵ Larson ML , Venugopal P . Clofarabine: a new treatment option for patients with acute myeloid leukemia . Expert Opinion on Pharmacotherapy 2009 ; 10 : 1353 – 7 OpenUrl CrossRef PubMed 6. ↵ Faderl S , Gandhi V , Keating MJ , Jeha S , Plunkett W , Kantarjian HM . The role of clofarabine in hematologic and solid malignancies--development of a next-generation nucleoside analog . Cancer 2005 ; 103 : 1985 – 95 OpenUrl CrossRef PubMed 7. ↵ Rahmati-Yamchi M , Zarghami N , Nozad Charoudeh H , Ahmadi Y , Baradaran B , Khalaj-Kondori M , et al. Clofarabine Has Apoptotic Effect on T47D Breast Cancer Cell Line via P53R2 Gene Expression . Adv Pharm Bull 2015 ; 5 : 471 – 6 OpenUrl CrossRef PubMed 8. ↵ Lubecka-Pietruszewska K , Kaufman-Szymczyk A , Stefanska B , Cebula-Obrzut B , Smolewski P , Fabianowska- Majewska K . Clofarabine, a novel adenosine analogue, reactivates DNA methylation-silenced tumour suppressor genes and inhibits cell growth in breast cancer cells . Eur J Pharmacol 2014 ; 723 : 276 – 87 OpenUrl CrossRef PubMed 9. de Wolf C , Jansen R , Yamaguchi H , de Haas M , van de Wetering K , Wijnholds J , et al. Contribution of the drug transporter ABCG2 (breast cancer resistance protein) to resistance against anticancer nucleosides . Mol Cancer Ther 2008 ; 7 : 3092 – 102 OpenUrl Abstract / FREE Full Text 10. ↵ Lubecka K , Kaufman-Szymczyk A , Fabianowska-Majewska K . Inhibition of breast cancer cell growth by the combination of clofarabine and sulforaphane involves epigenetically mediated CDKN2A upregulation . Nucleosides Nucleotides Nucleic Acids 2018 ; 37 : 280 – 9 OpenUrl CrossRef PubMed 11. Khalafi S , Zhu S , Khurana R , Lohse I , Giordano S , Corso S , et al. A novel strategy for combination of clofarabine and pictilisib is synergistic in gastric cancer . Transl Oncol 2022 ; 15 : 101260 OpenUrl CrossRef PubMed 12. Lee YJ , Lee YJ , Lee SH . Resveratrol and clofarabine induces a preferential apoptosis-activating effect on malignant mesothelioma cells by Mcl-1 down-regulation and caspase-3 activation . BMB Rep 2015 ; 48 : 166 – 71 OpenUrl CrossRef PubMed 13. ↵ O’Connor CM , Taylor SE , Miller KM , Hurst L , Haanen TJ , Suhan TK , et al. Targeting Ribonucleotide Reductase Induces Synthetic Lethality in PP2A-Deficient Uterine Serous Carcinoma . Cancer Res 2022 ; 82 : 721 – 33 OpenUrl PubMed 14. ↵ Cunningham CC , Nemunaitis J , Senzer N , Vukelja S , Richards D , Vukovic V , et al. Clofarabine administration weekly to adult patients with advanced solid tumors in a phase I dose-finding study . Journal of Clinical Oncology 2005 ; 23 : 7109 - OpenUrl CrossRef 15. ↵ Zhenchuk A , Lotfi K , Juliusson G , Albertioni F . Mechanisms of anti-cancer action and pharmacology of clofarabine . Biochem Pharmacol 2009 ; 78 : 1351 – 9 OpenUrl CrossRef PubMed Web of Science 16. ↵ Goulet B , Baruch A , Moon NS , Poirier M , Sansregret LL , Erickson A , et al. A cathepsin L isoform that is devoid of a signal peptide localizes to the nucleus in S phase and processes the CDP/Cux transcription factor . Mol Cell 2004 ; 14 : 207 – 19 OpenUrl CrossRef PubMed Web of Science 17. ↵ Grotsky DA , Gonzalez-Suarez I , Novell A , Neumann MA , Yaddanapudi SC , Croke M , et al. BRCA1 loss activates cathepsin L-mediated degradation of 53BP1 in breast cancer cells . J Cell Biol 2013 ; 200 : 187 – 202 OpenUrl Abstract / FREE Full Text 18. ↵ Chapman HA . Cathepsins as transcriptional activators? Dev Cell 2004 ; 6 : 610 – 1 OpenUrl CrossRef PubMed 19. ↵ Bulynko YA , Hsing LC , Mason RW , Tremethick DJ , Grigoryev SA . Cathepsin L stabilizes the histone modification landscape on the Y chromosome and pericentromeric heterochromatin . Mol Cell Biol 2006 ; 26 : 4172 – 84 OpenUrl Abstract / FREE Full Text 20. ↵ Holzen L , Parigiani MA , Reinheckel T . Tumor cell- and microenvironment-specific roles of cysteine cathepsins in mouse models of human cancers . Biochim Biophys Acta Proteins Proteom 2020 ; 1868 : 140423 OpenUrl CrossRef PubMed 21. ↵ Sullivan S , Tosetto M , Kevans D , Coss A , Wang L , O’Donoghue D , et al. Localization of nuclear cathepsin L and its association with disease progression and poor outcome in colorectal cancer . Int J Cancer 2009 ; 125 : 54 – 61 OpenUrl CrossRef PubMed Web of Science 22. ↵ Li L , Gao L , Song Y , Qin ZH , Liang Z . Activated cathepsin L is associated with the switch from autophagy to apoptotic death of SH-SY5Y cells exposed to 6-hydroxydopamine . Biochem Biophys Res Commun 2016 ; 470 : 579 – 85 OpenUrl CrossRef PubMed 23. ↵ Dennemarker J , Lohmuller T , Mayerle J , Tacke M , Lerch MM , Coussens LM , et al. Deficiency for the cysteine protease cathepsin L promotes tumor progression in mouse epidermis . Oncogene 2010 ; 29 : 1611 – 21 OpenUrl CrossRef PubMed 24. ↵ Shen X , Zhao YF , Xu SQ , Wang L , Cao HM , Cao Y , et al. Cathepsin L induced PC-12 cell apoptosis via activation of B-Myb and regulation of cell cycle proteins . Acta Pharmacol Sin 2019 ; 40 : 1394 – 403 OpenUrl CrossRef PubMed 25. ↵ Veillard F , Saidi A , Burden RE , Scott CJ , Gillet L , Lecaille F , et al. Cysteine cathepsins S and L modulate anti- angiogenic activities of human endostatin . J Biol Chem 2011 ; 286 : 37158 – 67 OpenUrl Abstract / FREE Full Text 26. ↵ Han LY , Landen CN , Trevino JG , Halder J , Lin YG , Kamat AA , et al. Antiangiogenic and antitumor effects of SRC inhibition in ovarian carcinoma . Cancer Res 2006 ; 66 : 8633 – 9 OpenUrl Abstract / FREE Full Text 27. ↵ Burton LJ , Henderson V , Liburd L , Odero-Marah VA . Snail transcription factor NLS and importin β1 regulate the subcellular localization of Cathepsin L and Cux1 . Biochem Biophys Res Commun 2017 ; 491 : 59 – 64 OpenUrl CrossRef PubMed 28. ↵ Soderholm JF , Bird SL , Kalab P , Sampathkumar Y , Hasegawa K , Uehara-Bingen M , et al. Importazole, a small molecule inhibitor of the transport receptor importin-β . ACS Chem Biol 2011 ; 6 : 700 – 8 OpenUrl CrossRef PubMed Web of Science 29. ↵ Jafari R , Almqvist H , Axelsson H , Ignatushchenko M , Lundbäck T , Nordlund P , et al. The cellular thermal shift assay for evaluating drug target interactions in cells . Nature Protocols 2014 ; 9 : 2100 – 22 OpenUrl CrossRef PubMed 30. ↵ Sevim H , Çelik H , Düsünceli L , Ceyhan CS , Molotkova A , Nakazawa K , et al. Clofarabine induces ERK/MSK/CREB activation through inhibiting CD99 on Ewing sarcoma cells . Plos One 2021 ; 16 31. ↵ Tamhane T , Lllukkumbura R , Lu S , Maelandsmo GM , Haugen MH , Brix K . Nuclear cathepsin L activity is required for cell cycle progression of colorectal carcinoma cells . Biochimie 2016 ; 122 : 208 – 18 OpenUrl CrossRef PubMed 32. ↵ ’Leary PCO, Chen HD, Doruk YU, Williamson T, Polacco B, McNeal AS, et al. Resistance to ATR Inhibitors Is Mediated by Loss of the Nonsense-Mediated Decay Factor UPF2 . Cancer Research 2022 ; 82 : 3950 – 61 OpenUrl CrossRef PubMed 33. ↵ Ray U , Thirusangu P , Jin L , Xiao Y , Pathoulas CL , Staub J , et al. PG545 sensitizes ovarian cancer cells to PARP inhibitors through modulation of RAD51-DEK interaction . Oncogene 2023 ; 42 : 2725 – 36 OpenUrl CrossRef PubMed 34. ↵ Liu P , Khurana A , Rattan R , He X , Kalloger S , Dowdy S , et al. Regulation of HSulf-1 expression by variant hepatic nuclear factor 1 in ovarian cancer . Cancer Res 2009 ; 69 : 4843 – 50 OpenUrl Abstract / FREE Full Text 35. ↵ Karst AM , Levanon K , Drapkin R . Modeling high-grade serous ovarian carcinogenesis from the fallopian tube . Proc Natl Acad Sci U S A 2011 ; 108 : 7547 – 52 OpenUrl Abstract / FREE Full Text 36. ↵ Fei Y , Xiong Y , Shen X , Zhao Y , Zhu Y , Wang L , et al. Cathepsin L promotes ionizing radiation-induced U251 glioma cell migration and invasion through regulating the GSK-3β/CUX1 pathway . Cell Signal 2018 ; 44 : 62 – 71 OpenUrl CrossRef PubMed 37. ↵ Sudhan DR , Siemann DW . Cathepsin L targeting in cancer treatment . Pharmacol Ther 2015 ; 155 : 105 – 16 OpenUrl CrossRef PubMed 38. ↵ Boya P , Kroemer G . Lysosomal membrane permeabilization in cell death . Oncogene 2008 ; 27 : 6434 – 51 OpenUrl CrossRef PubMed Web of Science 39. Stoka V , Turk B , Schendel SL , Kim TH , Cirman T , Snipas SJ , et al. Lysosomal protease pathways to apoptosis. Cleavage of bid, not pro-caspases, is the most likely route . J Biol Chem 2001 ; 276 : 3149 – 57 OpenUrl Abstract / FREE Full Text 40. ↵ Thirusangu P , Pathoulas CL , Ray U , Xiao Y , Staub J , Jin L , et al. Quinacrine-Induced Autophagy in Ovarian Cancer Triggers Cathepsin-L Mediated Lysosomal/Mitochondrial Membrane Permeabilization and Cell Death . Cancers (Basel ) 2021 ; 13 41. ↵ Goulet B , Sansregret L , Leduy L , Bogyo M , Weber E , Chauhan SS , et al. Increased expression and activity of nuclear cathepsin L in cancer cells suggests a novel mechanism of cell transformation . Mol Cancer Res 2007 ; 5 : 899 – 907 OpenUrl Abstract / FREE Full Text 42. ↵ Gonzalez-Suarez I , Redwood AB , Grotsky DA , Neumann MA , Cheng EH , Stewart CL , et al. A new pathway that regulates 53BP1 stability implicates cathepsin L and vitamin D in DNA repair . Embo j 2011 ; 30 : 3383 – 96 OpenUrl Abstract / FREE Full Text 43. ↵ Zampieri LX , Sboarina M , Cacace A , Grasso D , Thabault L , Hamelin L , et al. Olaparib Is a Mitochondrial Complex I Inhibitor That Kills Temozolomide-Resistant Human Glioblastoma Cells . International Journal of Molecular Sciences 2021 ; 22 : 11938 OpenUrl CrossRef PubMed 44. ↵ Yamanishi M , Narazaki H , Asano T . Melatonin overcomes resistance to clofarabine in two leukemic cell lines by increased expression of deoxycytidine kinase . Exp Hematol 2015 ; 43 : 207 – 14 OpenUrl CrossRef PubMed 45. ↵ Bouwman P , Aly A , Escandell JM , Pieterse M , Bartkova J , van der Gulden H , et al. 53BP1 loss rescues BRCA1 deficiency and is associated with triple-negative and BRCA-mutated breast cancers . Nature Structural & Molecular Biology 2010 ; 17 : 688 – 95 OpenUrl CrossRef PubMed 46. ↵ Croke M , Neumann MA , Grotsky DA , Kreienkamp R , Yaddanapudi SC , Gonzalo S . Differences in 53BP1 and BRCA1 regulation between cycling and non-cycling cells . Cell Cycle 2013 ; 12 : 3629 – 39 OpenUrl CrossRef PubMed 47. ↵ Xiao Y , Jin L , Deng C , Guan Y , Kalogera E , Ray U , et al. Inhibition of PFKFB3 induces cell death and synergistically enhances chemosensitivity in endometrial cancer . Oncogene 2021 ; 40 : 1409 – 24 OpenUrl CrossRef PubMed 48. ↵ Jung D , Khurana A , Roy D , Kalogera E , Bakkum-Gamez J , Chien J , et al. Quinacrine upregulates p21/p27 independent of p53 through autophagy-mediated downregulation of p62-Skp2 axis in ovarian cancer . Sci Rep 2018 ; 8 : 2487 49. ↵ Olive PL , Banath JP . The comet assay: a method to measure DNA damage in individual cells . Nat Protoc 2006 ; 1 : 23 – 9 OpenUrl CrossRef PubMed Web of Science 50. ↵ Kanakkanthara A , Huntoon CJ , Hou X , Zhang M , Heinzen EP , O’Brien DR , et al. ZC3H18 specifically binds and activates the BRCA1 promoter to facilitate homologous recombination in ovarian cancer . Nat Commun 2019 ; 10 : 4632 51. ↵ Khurana A , Liu P , Mellone P , Lorenzon L , Vincenzi B , Datta K , et al. HSulf-1 Modulates FGF2-and Hypoxia- Mediated Migration and Invasion of Breast Cancer Cells . Cancer Research 2011 ; 71 : 2152 – 61 OpenUrl Abstract / FREE Full Text View the discussion thread. Back to top Previous Next Posted January 14, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Role of drug induced nuclear CTSL (nCTSL) in DNA damage response in cancer- therapeutic implications Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Role of drug induced nuclear CTSL (nCTSL) in DNA damage response in cancer- therapeutic implications Prabhu Thirsangu , Ling Jin , Upasana Ray , Anya Zhao , Xinyan Wu , Xiaonan Hou , Jamison L VanBlaricom , Syed Mohamed Musheer Aalam , Ann Oberg , Nagarajan Kannan , John Weroha , Jeremy Chien , Scott H Kaufmann , Jamie N Bakkum-Gamez , Viji Shridhar bioRxiv 2025.01.09.632284; doi: https://doi.org/10.1101/2025.01.09.632284 Share This Article: Copy Citation Tools Role of drug induced nuclear CTSL (nCTSL) in DNA damage response in cancer- therapeutic implications Prabhu Thirsangu , Ling Jin , Upasana Ray , Anya Zhao , Xinyan Wu , Xiaonan Hou , Jamison L VanBlaricom , Syed Mohamed Musheer Aalam , Ann Oberg , Nagarajan Kannan , John Weroha , Jeremy Chien , Scott H Kaufmann , Jamie N Bakkum-Gamez , Viji Shridhar bioRxiv 2025.01.09.632284; doi: https://doi.org/10.1101/2025.01.09.632284 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Cancer Biology Subject Areas All Articles Animal Behavior and Cognition (7626) Biochemistry (17653) Bioengineering (13876) Bioinformatics (41893) Biophysics (21430) Cancer Biology (18568) Cell Biology (25469) Clinical Trials (138) Developmental Biology (13366) Ecology (19875) Epidemiology (2067) Evolutionary Biology (24294) Genetics (15591) Genomics (22478) Immunology (17717) Microbiology (40331) Molecular Biology (17154) Neuroscience (88497) Paleontology (666) Pathology (2829) Pharmacology and Toxicology (4817) Physiology (7635) Plant Biology (15116) Scientific Communication and Education (2044) Synthetic Biology (4286) Systems Biology (9817) Zoology (2268)