Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium

preprint OA: closed
Full text JSON View at publisher

Abstract

Background: Anabolic-androgenic steroids (AAS), such as methandienone, are synthetic testosterone derivatives that are widely used for the enhancement of physical performance and the growth of muscles. This study looked at the effect of methandienone on ovarian CYP19A1 gene expression and oxidative status in rabbits. The work also examined whether supplementation with selenium could reduce the adverse effects caused by methandienone. Methods Twenty healthy adult female rabbits were randomly assigned to four groups and maintained under uniform management for 30 days. The groups included a control, a methandienone-treated group (T1), a selenium group (T2), and a combined methandienone plus selenium group (T3). Serum oestrogens concentrations were measured using standard biochemical techniques. CYP19A1 mRNA expression in ovarian tissue and markers were quantified by established molecular and biochemical protocols. Results Rabbits receiving methandienone alone (T1) showed a significant decline (P≤0.05) in CYP19A1 mRNA expression and serum oestrogens when compared with the control and other treatment groups. Selenium supplementation (T2) produced marked increases in both parameters relative to G1 and G3, indicating a robust corrective effect. Oxidative stress analysis revealed elevated levels of malondialdehyde (MDA) and protein carbonyl content (PCC) in the T1 group, consistent with increased oxidative stress. Intermediate oxidative stress values were observed in the T3 group, exceeding those in the T1 group but remaining below those in the T2 group. Conclusion Methandienone appears to impair ovarian function by suppressing CYP19A1gene expression and promoting oxidative stress, leading to reduced steroidogenic activity. Selenium administration mitigates these disturbances by enhancing antioxidant defense and partially restoring gene expression and oestrogens levels. These findings highlight the potential of selenium as a supportive intervention against methandienone -induced oxidative and hormonal disruptions in rabbits.
Full text 161,299 characters · extracted from preprint-html · click to expand
Effects of Methandienone on the ovaries of... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/15-115" }, "headline": "Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative...", "datePublished": "2026-01-24T06:55:21", "dateModified": "2026-03-05T12:30:21", "author": [ { "@type": "Person", "name": "Mohammed Ali Shahooth" }, { "@type": "Person", "name": "Maysam Abdulrahman Ghazi" }, { "@type": "Person", "name": "Sabea Khamees Abed" }, { "@type": "Person", "name": "Ahmed Emad Abood" }, { "@type": "Person", "name": "Mustafa A. Saud" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": " Background Anabolic-androgenic steroids (AAS), such as methandienone, are synthetic testosterone derivatives that are widely used for the enhancement of physical performance and the growth of muscles. This study looked at the effect of methandienone on ovarian CYP19A1 gene expression and oxidative status in rabbits. The work also examined whether supplementation with selenium could reduce the adverse effects caused by methandienone. Methods Twenty healthy adult female rabbits were randomly assigned to four groups and maintained under uniform management for 30 days. The groups included a control, a methandienone-treated group (T1), a selenium group (T2), and a combined methandienone plus selenium group (T3). Serum oestrogens concentrations were measured using standard biochemical techniques. CYP19A1 mRNA expression in ovarian tissue and markers were quantified by established molecular and biochemical protocols. Results Rabbits receiving methandienone alone (T1) showed a significant decline (P≤0.05) in CYP19A1 mRNA expression and serum oestrogens when compared with the control and other treatment groups. Selenium supplementation (T2) produced marked increases in both parameters relative to G1 and G3, indicating a robust corrective effect. Oxidative stress analysis revealed elevated levels of malondialdehyde (MDA) and protein carbonyl content (PCC) in the T1 group, consistent with increased oxidative stress. Intermediate oxidative stress values were observed in the T3 group, exceeding those in the T1 group but remaining below those in the T2 group. Conclusion Methandienone appears to impair ovarian function by suppressing CYP19A1gene expression and promoting oxidative stress, leading to reduced steroidogenic activity. Selenium administration mitigates these disturbances by enhancing antioxidant defense and partially restoring gene expression and oestrogens levels. These findings highlight the potential of selenium as a supportive intervention against methandienone -induced oxidative and hormonal disruptions in rabbits. " } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/15-115", "name": "Effects of Methandienone on the ovaries of rabbits in relation to..." } } ] } Home Browse Effects of Methandienone on the ovaries of rabbits in relation to... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Shahooth MA, Abdulrahman Ghazi M, Khamees Abed S et al. Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2026, 15 :115 ( https://doi.org/10.12688/f1000research.174480.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article Revised Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] Mohammed Ali Shahooth 1 , Maysam Abdulrahman Ghazi https://orcid.org/0000-0002-8534-726X 2 , Sabea Khamees Abed https://orcid.org/0009-0005-6639-0384 2 , Ahmed Emad Abood 2 , Mustafa A. Saud 2 Mohammed Ali Shahooth 1 , Maysam Abdulrahman Ghazi https://orcid.org/0000-0002-8534-726X 2 , [...] Sabea Khamees Abed https://orcid.org/0009-0005-6639-0384 2 , Ahmed Emad Abood 2 , Mustafa A. Saud 2 PUBLISHED 05 Mar 2026 Author details Author details 1 University of Anbar, Ramadi, Al Anbar Governorate, Iraq 2 University of Fallujah, Al-Fallujah, Al Anbar Governorate, Iraq Mohammed Ali Shahooth Roles: Conceptualization, Investigation, Methodology, Project Administration, Writing – Review & Editing Maysam Abdulrahman Ghazi Roles: Data Curation, Formal Analysis, Investigation, Visualization, Writing – Review & Editing Sabea Khamees Abed Roles: Data Curation, Investigation, Resources, Validation, Writing – Review & Editing Ahmed Emad Abood Roles: Formal Analysis, Software, Validation, Visualization, Writing – Original Draft Preparation Mustafa A. Saud Roles: Resources, Supervision, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the Fallujah Multidisciplinary Science and Innovation gateway. Abstract Background Anabolic-androgenic steroids (AAS), such as methandienone, are synthetic testosterone derivatives that are widely used for the enhancement of physical performance and the growth of muscles. This study looked at the effect of methandienone on ovarian CYP19A1 gene expression and oxidative status in rabbits. The work also examined whether supplementation with selenium could reduce the adverse effects caused by methandienone. Methods Twenty healthy adult female rabbits were randomly assigned to four groups and maintained under uniform management for 30 days. The groups included a control, a methandienone-treated group (T1), a selenium group (T2), and a combined methandienone plus selenium group (T3). Serum oestrogens concentrations were measured using standard biochemical techniques. CYP19A1 mRNA expression in ovarian tissue and markers were quantified by established molecular and biochemical protocols. Results Rabbits receiving methandienone alone (T1) showed a significant decline (P≤0.05) in CYP19A1 mRNA expression and serum oestrogens when compared with the control and other treatment groups. Selenium supplementation (T2) produced marked increases in both parameters relative to G1 and G3, indicating a robust corrective effect. Oxidative stress analysis revealed elevated levels of malondialdehyde (MDA) and protein carbonyl content (PCC) in the T1 group, consistent with increased oxidative stress. Intermediate oxidative stress values were observed in the T3 group, exceeding those in the T1 group but remaining below those in the T2 group. Conclusion Methandienone appears to impair ovarian function by suppressing CYP19A1gene expression and promoting oxidative stress, leading to reduced steroidogenic activity. Selenium administration mitigates these disturbances by enhancing antioxidant defense and partially restoring gene expression and oestrogens levels. These findings highlight the potential of selenium as a supportive intervention against methandienone -induced oxidative and hormonal disruptions in rabbits. READ ALL READ LESS Keywords Methandienone, Selenium, CYP19A1 gene Corresponding Author(s) Maysam Abdulrahman Ghazi ( [email protected] ) Sabea Khamees Abed ( [email protected] ) Close Corresponding authors: Maysam Abdulrahman Ghazi, Sabea Khamees Abed Competing interests: No competing interests were disclosed. Grant information: The author(s) declared that no grants were involved in supporting this work. Copyright: © 2026 Shahooth MA et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Shahooth MA, Abdulrahman Ghazi M, Khamees Abed S et al. Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2026, 15 :115 ( https://doi.org/10.12688/f1000research.174480.2 ) First published: 24 Jan 2026, 15 :115 ( https://doi.org/10.12688/f1000research.174480.1 ) Latest published: 05 Mar 2026, 15 :115 ( https://doi.org/10.12688/f1000research.174480.2 ) Revised Amendments from Version 1 In this revised version, the manuscript has been carefully updated in response to reviewers’ comments to improve clarity, methodological transparency, and statistical rigor. Although the main findings and conclusions remain unchanged, several important refinements have been made throughout the text. The Introduction has been revised to better define the research gap and strengthen the scientific rationale of the study. Relevant background information has been clarified, terminology has been standardized (including consistent use of “AAS”), and redundant phrasing has been removed. Additional references were incorporated where appropriate to support key statements. The Methods section has been expanded to provide clearer details regarding animal selection, randomization procedures, experimental design, and compound verification. The study is now explicitly described as a randomized controlled post-test experimental model, and additional methodological clarifications have been added to enhance transparency and reproducibility. In the Results section, Fisher’s LSD test was replaced with Tukey’s post hoc test to provide a more conservative statistical assessment. The data were reanalyzed, and the findings remained consistent. Exact p-values (p ≤ 0.05) are now reported to improve clarity and interpretation. The Discussion has been refined to adopt more cautious language and to better explain the relevance of the Nrf2 pathway in relation to oxidative stress. Overall, these revisions strengthen the scientific quality and readability of the manuscript without altering its primary outcomes. In this revised version, the manuscript has been carefully updated in response to reviewers’ comments to improve clarity, methodological transparency, and statistical rigor. Although the main findings and conclusions remain unchanged, several important refinements have been made throughout the text. The Introduction has been revised to better define the research gap and strengthen the scientific rationale of the study. Relevant background information has been clarified, terminology has been standardized (including consistent use of “AAS”), and redundant phrasing has been removed. Additional references were incorporated where appropriate to support key statements. The Methods section has been expanded to provide clearer details regarding animal selection, randomization procedures, experimental design, and compound verification. The study is now explicitly described as a randomized controlled post-test experimental model, and additional methodological clarifications have been added to enhance transparency and reproducibility. In the Results section, Fisher’s LSD test was replaced with Tukey’s post hoc test to provide a more conservative statistical assessment. The data were reanalyzed, and the findings remained consistent. Exact p-values (p ≤ 0.05) are now reported to improve clarity and interpretation. The Discussion has been refined to adopt more cautious language and to better explain the relevance of the Nrf2 pathway in relation to oxidative stress. Overall, these revisions strengthen the scientific quality and readability of the manuscript without altering its primary outcomes. See the authors' detailed response to the review by Luke M Pelton READ REVIEWER RESPONSES Introduction Anabolic-androgenic steroids (AAS), such as methandienone, are synthetic derivatives of testosterone which are widely used to enhance physical performance and muscle growth ( Vazhat et al., 2024 ). AAS have potent anabolic properties and utilized to treat senile osteoporosis and various kinds of anemia, as well as their masculinizing effects ( Barbonetti et al., 2020 ), prolonged or excessive use is associated with a number of adverse psychological and biochemical reactions, including cardiovascular dysfunction, hepatotoxicity, endocrine imbalances and reproductive disorders ( Albano et al., 2021 ). The female reproductive system, especially the ovaries, is particularly sensitive to hormonal disturbances and oxidative damage as a result of exposure to exogenous steroids ( Matyja et al., 2023 ). Within the ovary, aromatase, which is encoded by CYP19A1, is the key enzyme in steroidogenesis, which catalyzes the conversion of androgens to oestrogens by removing Carbon-19 atom from testosterone. This aromatic process is essential for follicular development, ovulation and maintenance of normal ovarian circulation ( Magnani et al., 2017 ). Alterations in the expression of CYP19A1 gene or in its enzyme activity may alter the physiological balance of accumulation of androgens and reduce oestrogens synthesis, potentially leading to affects follicular development and oocyte maturation and infertility ( El Fouikar et al., 2024 ). Elevated androgen levels are also strongly associated with follicular cysts in animals ( Kalhori et al., 2018 ) and polycystic ovarian syndrome (PCOS), a hormonal disorder characterized by masculinity, anovulation, menstrual irregularities and multiple ovarian cysts, which often leads to infertility and widespread metabolic disorders ( Morales-Ledesma et al., 2017 ). The AAS methandienone has been shown to induce oxidative stress by inducing over production of reactive oxygen species (ROS) and reducing the activity of antioxidant enzymes, mitochondrial dysfunctions ( Abed, 2020 ) and stimulating pro-inflammatory cytokines (TNF-α, IL-6) ( Petrovic et al., 2022 ). This oxidative imbalance is a key pathogenic pathway mediating cytotoxicity and multiple organ apoptotic effects of anabolic-androgenic steroids ( Abed, 2020 ). In ovarian tissue, increased levels of ROS impair mitochondrial integrity, increase lipid peroxidation and induce apoptosis of granulocytes, thereby reducing both follicular development and steroidogenic synthesis ( Dutta et al., 2024 ). A compound which plays a central role in maintaining the balance of redox and preserving mitochondrial integrity in the body is selenium (Se), a basic micronutrient a basic micronutrient and a critical component of several selenoproteins such as glutathione peroxidase (GPx) and thioredoxin reductase (ThiR) and Selenoprotein P (SelP). Experimental data suggest that selenium supplementation reduces oxidative damage by activating the Nuclear factor erythroid 2-related factor 2 (Nrf2) pathway, regulates steroidogenic enzyme expression and improves mammalian reproduction ( Rabah et al., 2023 ). Selenium is also essential in a number of biological processes, including electron transport, regulates immune cell proliferation, hydroxylation and oxidative metabolism of aromatic compounds in the metabolism of animals ( Stolwijk et al., 2020 ). Previous studies have shown that methandienone may modify gene expression and oxidative status in brain tissues ( Abed and Al-Azawi, 2020 ), with a focus on potential systemic effects. However, the effect on ovarian function and on reproductive tissues is to date largely unknown. Understanding these effects is essential, given the role of CYP19A1 in steroidogenesis and the potential for ovarian dysfunction due to oxidative stress so that the aim of this study was to identify these effects and to try to reduce them by supplementing selenium, which compensates for these disturbances by strengthening antioxidant protection and promoting normal steroidogenic function. Exploring these interactions in the rabbit model may provide valuable insights into the contribution of anabolic and androgenic steroids to ovarian dysfunction and may inform strategies for reducing their reproductive adverse effect. Materials and methods In this study, we used twenty young adult female rabbits, aged between 8 and 14 weeks, weighing roughly 850 to 1,200 grams. All the rabbits had the same breed and genetic background and had been taken from Baghdad Cancer Research Center. The animals were matched in age and weight and randomly assigned to the experimental groups. The study was conducted by randomised, controlled, post-test design, and a control group was included for comparison. These rabbits were kept in the Physiology Laboratory at the Veterinary Medicine College in Fallujah University, randomly divided them into four groups, with five rabbits in each. for the T1 group gave a dose of methandienone (Black dragon pharma, Thailand) orally, which was 0.35 mg/kg body weight Selenium yeast supplied by (21st Century ® (USA)) and administered to T2 group at a dose of 3 μg/kg body weight ( Abed and Al-Azawi, 2020 ). Methandienone and selenium were administered orally (T3) to a combined group of rabbits (0.35 mg per kg bodyweight, 3 μg per kg bodyweight). All animals received oral administration every day for 30 days. After 30 days of the experiment, blood samples were taken from each rabbit by cardiac puncture for estrogen evaluation, and at the end of the study, Animal sacrifice was carried out in accordance with approved ethical standards. and ovary were isolated for gene expression evaluation. All animal experimental procedures, including anesthesia administration and blood sampling, were performed in accordance with American Veterinary Medical Association (AVMA) guidelines ( Underwood and Raymond, 2013 ). The estradiol test is a one-step immunoassay used to evaluate the value estradiol in serum of mammals using a universal assay protocol called chemiflex ( Fu et al., 2020 ). Malondialdehyde (MDA) assay was determined by colorimetric method ( Yalçin et al., 2010 ), using malondialdehyde colorimetric assay kit (Elabscience china) and assay, protein carbonyl content was determined by colorimetric method ( Reznick and Packer, 1994 ) using protein carbonyl colorimetric assay kit (Elabscience, china). The total RNA was extracted with a magnatronic nanosorbent kit as specified by the manufacturer (RealBest Extraction 100, Russia). The RNA integrity and purity were verified by nanodrop spectrophotometry. We used a reverse transcriptase (M-MLV) template from the Synthol (Russia) and appropriate primers to reverse transcript the RNA to cDNA for a real-time PCR (RT). Table 1 shows the primer sequences purchased all from Bioneer (Korea). We examined the expression of these genes (the genes of interest) using GAPDH as a control gene. Start ExicyclerTM 96 real-time PCR-based thermal block device and load as follows: The PCR method was used for one hour of reverse transcriptase at 50°C, five minutes at 95°C, and 47 cycles at 96°C, 46 seconds at 62°C, all repeated 45 times. Delta-delta CT has previously been reported to be used to assess the relative amount of expression of a specific gene ( Livak and Schmittgen, 2001 ). Statistical analysis was performed with version 21.0 of SPSS software. Data were expressed as mean ± standard error of the mean (SE) and compared to groups using (One-way) analysis of variance (ANOVA) with a P ≤ 0.05 ( Larsen et al., 1973 ) and then tested using by Tukey's HDS test. All experimental procedures have been carried out in accordance with institutional guidelines on the care and use of laboratory animals. Table 1. The table shows the identifies of the primers and their sequence. Primer Sequence CYP19A1 (Aromatase enzyme) F GGAAGAATGCATCGACTTGAGTT R GGGCCCAAAACCAAATGGT GAPDH (glyceraldehyde-3-phosphate dehydrogenase) F ATGCCCCCATGTTTGTGATG R AGGATGCGTTGCTGACAATC Results 1-The effect of methandienone, selenium and both on the aromatase gene expression and serum estrogen concentration There was a statistically significant difference ( Table 2 ) in the levels of mRNA CYP19A1 in ovarian tissues and serum oestrogen concentrations in rabbits treated with anabolic androgenic steroids (T1) (down regulation) compared to controls and non-treated animals (T2, T3). The selenium (T2) group showed a significant (P ≤ 0.05) increase in gene expression and oestrogen concentrations compared to T1 and T3. Table 2. The effect of methandienone, selenium and both on CYP19A1 gene expression analysis (Aromatase gene) in ovary and serum estrogen concentration of different groups (T1, T2, and T3) in female rabbits. Groups/Parameter Control Methandienone (T1) Selenium (T2) Metha. + Se-organic (T3) P-value CYP19A1 gene (Fold change (2^-∆∆CT)) 1.20 ± 0.03 D 3.20 ± 0.12 C 6.11 ± 0.14 A 4.54 ± 0.85 B 0.00 Estrogen (pg/ml) 37.3 ± 0.3 B 18.6 ± 0.55 D 41.8 ± 0.5 A 24.3 ± 0.54 C 0.00 2-The effect of methandienone, selenium and both on malondialdehyde and protein carbonyl content in the ovarian tissue A significant (P < 0.05) increases in oxidative markers (MDA and protein carbonyl content) were observed in the T1 group compared to all other groups ( Table 3 ). The protection group (T3) also had higher values than the control group (T2) and selenium group (T1), but lower values than T1. Table 3. The effect of methandienone, selenium and both of malondialdehyde (MDA) and protein carbonyl content (PCC) levels in the ovarian tissue of different groups (T1, T2, and T3) in female rabbits. Groups/Parameter Control Methandienone (T1) Selenium (T2) Metha. + Se-organic (T3) P-value MDA (micro mole/L) 2.34 ± 0.83 C 5.42 ± 0.71 A 2.21 ± 0.54 C 3.92 ± 0.65 B 0.00 PCC (nmol/mgprot) 3.5 ± 0.9 C 6.45 ± 1.2 A 4.02 ± 0.72 C 5.11 ± 1.1 B 0.0007 Discussion This study showed that administration of methandienone resulted in a marked decrease in mRNA expression of CYP19A1 in ovarian tissues ( Table 2 ) and a concurrent decrease in serum oestrogen concentrations in treated rabbits (T1 group) compared to control groups. These findings may indicate that methandienone has a suppression effect on aromatase activity, resulting in a decrease in the conversion of androgens to oestrogens. The inhibition of aromatase expression observed in this study is consistent with previous studies suggesting that AAS exposure influences the hypothalamic-pituitary-gonadal (HPG) axis and ovarian steroidogenesis through the suppression of CYP19A1 transcription ( Barros-Oliveira et al., 2021 ; El Fouikar et al., 2024 ). Notably, supplementation with selenium (T2 group) significantly restored CYP19A1 expression and serum oestrogen concentrations compared with the methandienone-treated group. This improvement highlights the modulatory role of selenium in maintaining steroidogenic enzyme function and its influence on Nrf2, a key regulator of cellular antioxidant protection and a key driver of oxidative stress reduction. Its activation helps to maintain the redox balance and mitochondrial integrity, which is of particular importance to the understanding of the potential effects of selenium in this study ( Abed, 2020 ) and its ability to counter the oxidative stress induced by AAS. Selenium is known to increase the activity of selenoproteins, including glutathione peroxidase and thioredoxin reductase, thereby reducing the accumulation of reactive oxygen species (ROS) and protecting the cellular macromolecules from oxidative damage ( Zhang et al., 2023 ). Thus, the observed upregulation of CYP19A1 following selenium supplementation may reflect the preservation of mitochondrial, endoplasmic reticulum function and transcription of antioxidant enzymes, both of which are essential for steroid hormone synthesis. These findings are consistent with Rabah et al., (2023) , who demonstrated that selenium supplementation enhances ovarian function and steroidogenesis under conditions of oxidative stress. The significant increase in oxidative markers, including malondialdehyde (MDA) and protein carbonyl (PC) levels in methandienone (T1) ( Table 3 ) further highlights the role of oxidative stress in ovarian dysfunction. Increased lipid peroxidation and protein oxidation, associated with decreased antioxidant protection, and when oestrogen levels fall in this group, loss of oestrogenic antioxidant protection ( Ruiz-Romero et al., 2025 ), reflect a disruption in the balance between reactive species generation and the body’s scavenging capacity. These oxidative insults may result in apoptosis of granulosa cells, mitochondrial dysfunction and reduced follicular viability ( Daraghmeh et al., 2025 ). Furthermore, testosterone and its derivatives are considered to be pro-oxidants which may have adverse effects on primary biomolecules ( Andrés Juan et al., 2021 ). Since testosterone increases metabolic activity to promote protein synthesis, it may increase mitochondrial respiration and ATP production, thereby increasing the production of reactive oxygen species (ROS) and contributing to oxidative stress ( Stallone and Oloyo, 2023 ). Partial normalization of these oxidative markers in the group of selenium-protected (T3) supports the hypothesis that selenium provides cytoprotection by stabilizing the redox homeostasis and increasing the activity of antioxidant enzymes. Although the oxidative indices in the protection group were still higher than in the controls, their decrease compared to T1 indicates that oxidative damage caused by AAS is attenuated rather than reversed. Conclussion These findings together highlight a dual pathogenic mechanism of methandienone toxicity: (1) direct endocrine disruption through aromatase inhibition and CYP19A1 downregulation; and (2) indirect oxidative damage by oxidative over production and oxidative depletion of antioxidant defences. The ability of selenium to inhibit both pathways reflects its integral role in maintaining cellular homeostasis, modulating redox signaling and stabilizing steroidogenic gene transcription. Ethical considerations This study was conducted in full compliance with the ethical guidelines approved by the Scientific Committee on Research Ethics of the University of Fallujah Faculty of Veterinary Medicine (Approval No: 7; 13/10 2025) ( Shahooth et al., 2025 ). Data availability Underlying data Zenodo: Data are available under the terms of the Creative Commons Zero “No rights reserved” data waiver (CC0 1.0 Public domain dedication) . The data raw of study of Methandienone and Selenium in rabbits. https://doi.org/10.5281/zenodo.17897289 ( Shahooth et al., 2025 ). Arrive checklist https://doi.org/10.5281/zenodo.17897289 ( Shahooth et al., 2025 ). Acknowledgments The authors thank the study staff as well as the study participants. References Abed SK: The protective effects of the organic selenium (high-selenium yeast) on the oxidative stress caused by methanedienone on the brain of male rabbits.2020. Abed SK, Al-Azawi TSS: Selenium Enriched Yeast Modifies the Effects of Methandienone in Male Rabbits on the HPA Axis and Adrenal Gland Oxidative Stress. Al-Anbar Journal of Veterinary Sciences. 2020; 13 (2). Albano GD, Amico F, Cocimano G, et al. : Adverse effects of anabolic-androgenic steroids: a literature review. Healthcare. 2021; 9 (1): 97. Andrés Juan C, Pérez de Lastra JM, Plou Gasca FJ, et al. : The chemistry of Reactive oxygen Species (ROS) revisited: Outlining their role in biological macromolecules (DNA, lipids and proteins) and induced pathologies.2021. Barbonetti A, D’Andrea S, Francavilla S: Testosterone replacement therapy. Andrology. 2020; 8 (6): 1551–1566. PubMed Abstract | Publisher Full Text Barros-Oliveira M d C, Costa-Silva DR, Dos Santos AR, et al. : Influence of CYP19A1 gene expression levels in women with breast cancer: A systematic review of the literature. Clinics. 2021; 76 : e2846. Daraghmeh DN, Salameh S, Zahdeh M, et al. : Exploring the Effects of Oxidative Stress on Female Reproductive Function: The Role of Antioxidant Supplementation. Curr. Drug Metab. 2025. Dutta S, Sengupta P, Izuka E, et al. : Oxidative and nitrosative stress and female reproduction: Roles of oxidants and antioxidants. Journal of Integrated Science and Technology. 2024; 12 (3): 754. El Fouikar S, Van Acker N, Héliès V, et al. : Folliculogenesis and steroidogenesis alterations after chronic exposure to a human-relevant mixture of environmental toxicants spare the ovarian reserve in the rabbit model. J. Ovarian Res. 2024; 17 (1): 134. PubMed Abstract | Publisher Full Text Fu P, Devare S, Liu J, et al. : Evaluate performance of the Abbott chemiluminescent microparticle immunoassay assay for detection of syphilis infection in Chinese blood donors. J. Clin. Lab. Anal. 2020; 34 (1): e23033. PubMed Abstract | Publisher Full Text Kalhori Z, Mehranjani MS, Azadbakht M, et al. : Ovary stereological features and serum biochemical factors following induction of polycystic ovary syndrome with testosterone enanthate in mice: An experimental study. International Journal of Reproductive BioMedicine. 2018; 16 (4): 267–274. PubMed Abstract Larsen IL, Hartmann NA, Wagner JJ: Estimating precision for the method of standard additions. Anal. Chem. 1973; 45 (8): 1511–1513. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods. 2001; 25 (4): 402–408. PubMed Abstract Magnani L, Frige G, Gadaleta RM, et al. : Acquired CYP19A1 amplification is an early specific mechanism of aromatase inhibitor resistance in ERα metastatic breast cancer. Nat. Genet. 2017; 49 (3): 444–450. PubMed Abstract | Publisher Full Text Matyja D, Abod L, Ilnicka N, et al. : Anabolic-androgenic steroids. Mechanism of action and clinical effects. Journal of Education, Health and Sport. 2023; 15 (1): 122–133. Morales-Ledesma L, Díaz Ramos JA, Trujillo Hernández A: Polycystic ovary syndrome induced by exposure to testosterone propionate and effects of sympathectomy on the persistence of the syndrome. Reprod. Biol. Endocrinol. 2017; 15 (1): 50. PubMed Abstract | Publisher Full Text Petrovic A, Vukadin S, Sikora R, et al. : Anabolic androgenic steroid-induced liver injury: An update. World J. Gastroenterol. 2022; 28 (26): 3071–3080. PubMed Abstract | Publisher Full Text Rabah HM, Mohamed DA, Mariah RA, et al. : Novel insights into the synergistic effects of selenium nanoparticles and metformin treatment of letrozole-induced polycystic ovarian syndrome: targeting PI3K/Akt signalling pathway, redox status and mitochondrial dysfunction in ovarian tissue. Redox Rep. 2023; 28 (1): 2160569. PubMed Abstract | Publisher Full Text Reznick AZ, Packer L: [38] Oxidative damage to proteins: spectrophotometric method for carbonyl assay. Methods in enzymology. Elsevier; 1994; Vol. 233 . ; pp. 357–363. Ruiz-Romero GA, Bernáldez-Sarabia J, Orozco-Valdivia M, et al. : Antioxidant, Bioenergetic, and Metabolic Effects of Novel Mitochondria-Targeted Estrogens. J. Mol. Endocrinol. 2025; 1 (aop). Shahooth MA, Ghazi MA, Abed SK, et al. : The data raw of study of Methandienone and Selenium in rabbits. Zenodo. 2025. Publisher Full Text Stallone JN, Oloyo AK: Cardiovascular and metabolic actions of the androgens: Is testosterone a Janus-faced molecule? Biochem. Pharmacol. 2023; 208 : 115347. Stolwijk JM, Garje R, Sieren JC, et al. : Understanding the redox biology of selenium in the search of targeted cancer therapies. Antioxidants. 2020; 9 (5): 420. Underwood W, Raymond A: American Veterinary Medical Association AVMA Guidelines for the Euthanasia of Animals: 2020 Edition.2013. Vazhat R. A., Farook N. M., Nalakath J., Komathu P. O.: Exploring methandienone metabolites generated via homogenized camel liver: Advancements for anti‐doping applications through High Resolution‐Liquid Chromatography Mass Spectrometry analysis. Rapid Communications in Mass Spectrometry 2024; 38 (22). Yalçin AS, Kilinç A, Cöbek B: Evaluation of a simple colorimetric analysis for urinary malondialdehyde determination. Pathology and Laboratory Medicine International. 2010; 23–26. Zhang F, Li X, Wei Y: Selenium and selenoproteins in health. Biomolecules. 2023; 13 (5): 799. Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 24 Jan 2026 ADD YOUR COMMENT Comment Author details Author details 1 University of Anbar, Ramadi, Al Anbar Governorate, Iraq 2 University of Fallujah, Al-Fallujah, Al Anbar Governorate, Iraq Mohammed Ali Shahooth Roles: Conceptualization, Investigation, Methodology, Project Administration, Writing – Review & Editing Maysam Abdulrahman Ghazi Roles: Data Curation, Formal Analysis, Investigation, Visualization, Writing – Review & Editing Sabea Khamees Abed Roles: Data Curation, Investigation, Resources, Validation, Writing – Review & Editing Ahmed Emad Abood Roles: Formal Analysis, Software, Validation, Visualization, Writing – Original Draft Preparation Mustafa A. Saud Roles: Resources, Supervision, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information The author(s) declared that no grants were involved in supporting this work. Article Versions (2) version 2 Revised Published: 05 Mar 2026, 15:115 https://doi.org/10.12688/f1000research.174480.2 version 1 Published: 24 Jan 2026, 15:115 https://doi.org/10.12688/f1000research.174480.1 Copyright © 2026 Shahooth MA et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Shahooth MA, Abdulrahman Ghazi M, Khamees Abed S et al. Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2026, 15 :115 ( https://doi.org/10.12688/f1000research.174480.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 2 VERSION 2 PUBLISHED 05 Mar 2026 Revised Views 0 Cite How to cite this report: Pelton LM. Reviewer Report For: Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2026, 15 :115 ( https://doi.org/10.5256/f1000research.197154.r464958 ) The direct URL for this report is: https://f1000research.com/articles/15-115/v2#referee-response-464958 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 01 Apr 2026 Luke M Pelton , Springfield College, Springfield, Massachusetts, USA Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.197154.r464958 I thank the authors for their diligence in responding to my previous feedback. While I feel the quality of the manuscript as a whole has dramatically improved, there are a few minor points that I would like to see addressed; ... Continue reading READ ALL I thank the authors for their diligence in responding to my previous feedback. While I feel the quality of the manuscript as a whole has dramatically improved, there are a few minor points that I would like to see addressed; however, they are relatively simple fixes and I do not feel that they prohibit the manuscript from being acceptable. Intro : For Sentence 3, I apologize; I see now that my previous feedback was poorly stated on my part. The sentence should read “ AAS have potent anabolic properties and are often utilized to treat geriatric osteoporosis and various kinds of anemia. However, in addition to their masculinizing effects (Barbonetti et al., 2020), prolonged or excessive use is associated with a number of adverse psychological and biochemical reactions, including cardiovascular dysfunction, hepatotoxicity, endocrine imbalances and reproductive disorders (Albano et al., 2021) .” Methods : Knowing that the rabbits were of identical breed, we should definitely have that exact breed named clearly; this is important for two reasons. First, any future researchers looking to replicate this study will need to use identical subjects. Second, it allows you to make a stronger argument for why a posttest-only model was chosen (i.e., clarify the logic of the homogeneous rabbit breed circumventing the need for a pretest, as all could be assumed to be similar at baseline, etc.). In terms of the methandienone sourcing: I think it is prudent to clarify the specific source through which the drug was purchased by name. Again, this helps bolster the internal validity of your investigation, and would assist future researchers in replicating your methodology. Additionally, include that the compound was analyzed for purity in the Department of Analytics at the Veterinary Directorate, and that all experimental groups received the same verified preparation under controlled conditions. This should be a simple fix. Results : I am glad to see that the analysis yielded consistent findings, and I appreciate the authors’ reformatting and presentation of the findings. However: for p values reading “0.00,” we should change these to read “< 0.001” as the probability can never truly be 0. Again, this should be a very simple change. Discussion : I would actually suggest beginning the discussion by 1) restating the purpose of the investigation along with the hypothesis. This reminds the reader of the background as they then read the main findings. Conclusion : Kindly fix the spelling of the word “Conclusion” Competing Interests: No competing interests were disclosed. Reviewer Expertise: Exercise physiology, reproductive endocrinology, anabolic-androgenic steroids I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Pelton LM. Reviewer Report For: Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2026, 15 :115 ( https://doi.org/10.5256/f1000research.197154.r464958 ) The direct URL for this report is: https://f1000research.com/articles/15-115/v2#referee-response-464958 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Asker M. Reviewer Report For: Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2026, 15 :115 ( https://doi.org/10.5256/f1000research.197154.r465201 ) The direct URL for this report is: https://f1000research.com/articles/15-115/v2#referee-response-465201 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 12 Mar 2026 Mohammed Asker , Mustansiriyah University, Baghdad, Iraq Approved VIEWS 0 https://doi.org/10.5256/f1000research.197154.r465201 The manuscript entitled “Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1), oxidative markers and the possible protective role of selenium” presents an interesting and scientifically relevant investigation. Overall, the ... Continue reading READ ALL The manuscript entitled “Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1), oxidative markers and the possible protective role of selenium” presents an interesting and scientifically relevant investigation. Overall, the study is clearly written and well organized. The authors have presented the objectives, methodology, results, and discussion in a logical and coherent manner. The experimental design appears appropriate for addressing the research question, and the methods are described with sufficient clarity to allow understanding of the procedures used. The manuscript is written in a clear and precise scientific style, and the literature cited is relevant and supports the background of the study. In addition, the results are presented clearly and the conclusions are generally supported by the data provided. The work contributes useful information regarding the effects of Methandienone on ovarian function and oxidative stress markers, as well as the potential protective role of selenium. Overall, the manuscript represents a valuable contribution to the field. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Asker M. Reviewer Report For: Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2026, 15 :115 ( https://doi.org/10.5256/f1000research.197154.r465201 ) The direct URL for this report is: https://f1000research.com/articles/15-115/v2#referee-response-465201 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Version 1 VERSION 1 PUBLISHED 24 Jan 2026 Views 0 Cite How to cite this report: Pelton LM. Reviewer Report For: Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2026, 15 :115 ( https://doi.org/10.5256/f1000research.192385.r453351 ) The direct URL for this report is: https://f1000research.com/articles/15-115/v1#referee-response-453351 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 16 Feb 2026 Luke M Pelton , Springfield College, Springfield, Massachusetts, USA Not Approved VIEWS 0 https://doi.org/10.5256/f1000research.192385.r453351 I had the privilege of being asked to provide an open review of the recently published “Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of ... Continue reading READ ALL I had the privilege of being asked to provide an open review of the recently published “Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium.” While I am greatly intrigued by the premise and purpose, I believe there are several crucial points that must be addressed before it is truly ready to add its findings to this area of research. In the Introduction, there is a noticeable jump from the background information of the Intro to the hypothesis. WHY is this investigation being conducted? Is there some crucial gap that exists in this previous area of research? Has anything similar been conducted previously? It seems as though your research group has actually conducted similar investigations in the brain (Abed et al. 2020). Why not present that as a recent relevant finding, and use that to pose the following: Although previous research has been conducted in brain tissues (Abed et al. 2020), there have been no such investigations in the subspinal reproductive centers. Therefore, the purpose of this study is to…” In the Methods: there are several elements which gravely threaten the internal validity of this investigation. Firstly, it should be indicated whether all rabbits were the same breed/genetic strain. I am assuming this is the case, but requires clarification as any preexisting between-group differences at baseline must be accounted for. To that point: I am not seeing any indication that baseline data was gathered before the supplementation protocol. If this data was not gathered, it is a fatal threat to internal validity, as there is no accounting for whether the between-groups differences were actually a result of the protocol, or due to the aforementioned preexisting group differences. Finally, the use of Black Dragon Pharma: based on the name and a Google search, this seems like a UG lab (i.e. a black market trader of non-regulated AAS and PEDs) and not a reputable pharmaceutical provider. Was there any 3rd party testing conducted on this to even determine if the dosing of the compound was accurate? This is also a potentially fatal threat to the internal validity of this investigation, as it severely limits whether we can claim that the changes in groups are due to the protocol. Additionally, for the benefit of the authors, I have provided minor feedback which pertains mostly to writing style, organization, etc., and should be relatively simple for the authors to address. Intro: I would like to see a supporting citation for sentence 1 After introducing the acronymic abbreviation AAS< use that for all instances going forward (i.e. sentence 2) “Senile osteoporosis”: is this meant to be “geriatric”? Senile implies psychological/cognitive status Sentence 3: this structure needs revision; the second phrase could better read “...as well as their masculinizing effects…” “Anabolic properties” and “anabolic impacts" are redundant and repetitive. Should be written “...number of adverse psychological and biochemical reactions…” Second paragraph: clarify what C19 is or the read (and then use C19 throughout) “Elevated androgen levels are also strongly associated with follicular cystic…” What is meant by “follicular cystic”? Should this be “follicular cysts”? Third paragraph: should start by saying “The AAS methandienone…” Fourth paragraph: to facilitate a better transition to this point from the previous topic, I would revise this opening point sentence: “A compound which plays a central role in maintaining the balance of redox and preserving mitochondrial integrity in the body is selenium (Se), a basic micronutrient…” Results: LSD: If this is Fisher’s LSD as used as a post hoc analysis following the ANOVA, I would urge caution in its use and extrapolation. Fisher’s LSD is often likely to return a false positive via hyperinflation of alpha in its multiple comparisons. I would suggest using Tukey’s post hoc, as it is a more conservative measure (particularly given the lack of robust supporting research provided in the introduction as to provide rationale for the expected direction of change/difference; this, compounded with the previously mentioned concerns regarding the AAS dosing, present an additional threat to internal validity). I ran the analysis on my own with the raw data set you kindly provided, and found that your findings would be maintained with the use of Tukey’s post hoc. When stating statistically significant findings: there must be some indication of the exact p value. Saying “p < 0.05” is not enough, firstly as the threshold is “p ≤ 0.05,” and secondly as it is not indicated on the table anywhere. To that point, the use of capital letters to indicate significant differences is unwieldy and confusing. Please consider using this entire point of feedback to present the group differences in a way that both clarifies your presentation of the data and makes it more easily understood by the reader. Discussion Throughout the discussion: be careful when using words like “indicates,” as they carry with them a weight of finality. Simply including the phrase “may indicate” presents your findings in a more conservative manner appropriate for conveying the findings of a single investigation. Paragraph 2: this is the first introduction of the Nrf2 pathway. I recommend clarifying what that is for the reader, and how it relates to the current investigation. Paragraph 3: the final sentence of this paragraph is an incomplete thought. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? No Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Partly Competing Interests: No competing interests were disclosed. Reviewer Expertise: Exercise physiology, reproductive endocrinology, anabolic-androgenic steroids I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Pelton LM. Reviewer Report For: Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2026, 15 :115 ( https://doi.org/10.5256/f1000research.192385.r453351 ) The direct URL for this report is: https://f1000research.com/articles/15-115/v1#referee-response-453351 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 05 Mar 2026 Sabea Abed , University of Fallujah, Al-Fallujah, Iraq 05 Mar 2026 Author Response Dear Reviewers, We sincerely thank the reviewers for their valuable time, effort, and insightful comments on our manuscript titled: “Effects of Methandienone on the ovaries of rabbits in relation ... Continue reading Dear Reviewers, We sincerely thank the reviewers for their valuable time, effort, and insightful comments on our manuscript titled: “Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium.” In response, we have carefully revised the manuscript and addressed all points raised: Paragraph 1 : In response, we revised the Introduction to incorporate our previous findings in brain tissues (Abed et al., 2020) and clarified that no similar investigations have been conducted in the subspinal reproductive centers. This revision clearly defines the research gap and the objective of the present study. Paragraph 2: All rabbits used in this study were of the same breed and genetic background and were obtained from the Cancer Research Center, Baghdad. The animals were age- and weight-matched prior to the start of the experiment. In addition, rabbits were randomly assigned to the experimental groups to minimize potential preexisting differences between groups. The study was designed as a randomized controlled post-test experimental model; therefore, baseline measurements were not collected prior to the supplementation protocol. The inclusion of a control group together with random allocation ensures group comparability at the beginning of the experiment and allows the observed differences to be attributed to the intervention. These methodological clarifications have now been added to the Methods section Paragraph 3: The methandienone used in this study was obtained from a commercial supplement provider (Gym Center Supplements) as part of the doctoral research project. To ensure accuracy and consistency, the compound was analyzed for purity in the Department of Analytics at the Veterinary Directorate. All experimental groups received the same verified preparation under controlled conditions. Introduction Added a supporting citation for the first sentence. Introduced the acronym “AAS” and used it consistently throughout the text. Replaced “senile osteoporosis” with “geriatric osteoporosis” for accuracy. Revised sentence 3 to read “…as well as their masculinizing effects…” and removed redundant references to “anabolic properties.” Corrected phrasing to “…number of adverse psychological and biochemical reactions…” Clarified the meaning of C19 and used it consistently throughout the paragraph. Replaced “follicular cystic” with “follicular cysts” for precision. Revised the third paragraph to begin with “The AAS methandienone…” Improved the opening sentence of the fourth paragraph to enhance transition, now reading: “A compound which plays a central role in maintaining the balance of redox and preserving mitochondrial integrity in the body is selenium (Se), a basic micronutrient…” Results: 1- Following the reviewer’s suggestion, we have replaced Fisher’s LSD post hoc analysis with Tukey’s post hoc test to provide a more conservative assessment of group differences and reduce the risk of false positives. Re-analysis confirmed that the original findings are maintained with Tukey’s test. This change has been updated in both the Results section and corresponding tables. 2- We have revised the presentation of statistically significant findings to include exact p-values for all comparisons (p ≤ 0.05), replacing the use of capital letters in the tables. Group differences are now presented in a clearer and more reader-friendly format, enhancing transparency and interpretability. Discussion 1- We have revised the language throughout the Discussion to use more conservative phrasing, replacing terms such as “indicates” with “may indicate” to appropriately reflect the findings of a single investigation. 2- The Nrf2 pathway is now clearly introduced and explained in paragraph 2, including its relevance to oxidative stress and the current study’s objectives. 3- The final sentence of paragraph 3 has been corrected to complete the thought and improve clarity. Finally , we sincerely thank the reviewer for their time, effort, and valuable feedback on our manuscript. Your thorough evaluation and constructive suggestions have significantly enhanced the clarity, rigor, and overall quality of our work. We have learned a great deal from your comments, which have not only improved this study but also enriched our expertise in best practices for scientific writing and research presentation. Thank you for your consideration. Sincerely Sabea Khamees Abed Dear Reviewers, We sincerely thank the reviewers for their valuable time, effort, and insightful comments on our manuscript titled: “Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium.” In response, we have carefully revised the manuscript and addressed all points raised: Paragraph 1 : In response, we revised the Introduction to incorporate our previous findings in brain tissues (Abed et al., 2020) and clarified that no similar investigations have been conducted in the subspinal reproductive centers. This revision clearly defines the research gap and the objective of the present study. Paragraph 2: All rabbits used in this study were of the same breed and genetic background and were obtained from the Cancer Research Center, Baghdad. The animals were age- and weight-matched prior to the start of the experiment. In addition, rabbits were randomly assigned to the experimental groups to minimize potential preexisting differences between groups. The study was designed as a randomized controlled post-test experimental model; therefore, baseline measurements were not collected prior to the supplementation protocol. The inclusion of a control group together with random allocation ensures group comparability at the beginning of the experiment and allows the observed differences to be attributed to the intervention. These methodological clarifications have now been added to the Methods section Paragraph 3: The methandienone used in this study was obtained from a commercial supplement provider (Gym Center Supplements) as part of the doctoral research project. To ensure accuracy and consistency, the compound was analyzed for purity in the Department of Analytics at the Veterinary Directorate. All experimental groups received the same verified preparation under controlled conditions. Introduction Added a supporting citation for the first sentence. Introduced the acronym “AAS” and used it consistently throughout the text. Replaced “senile osteoporosis” with “geriatric osteoporosis” for accuracy. Revised sentence 3 to read “…as well as their masculinizing effects…” and removed redundant references to “anabolic properties.” Corrected phrasing to “…number of adverse psychological and biochemical reactions…” Clarified the meaning of C19 and used it consistently throughout the paragraph. Replaced “follicular cystic” with “follicular cysts” for precision. Revised the third paragraph to begin with “The AAS methandienone…” Improved the opening sentence of the fourth paragraph to enhance transition, now reading: “A compound which plays a central role in maintaining the balance of redox and preserving mitochondrial integrity in the body is selenium (Se), a basic micronutrient…” Results: 1- Following the reviewer’s suggestion, we have replaced Fisher’s LSD post hoc analysis with Tukey’s post hoc test to provide a more conservative assessment of group differences and reduce the risk of false positives. Re-analysis confirmed that the original findings are maintained with Tukey’s test. This change has been updated in both the Results section and corresponding tables. 2- We have revised the presentation of statistically significant findings to include exact p-values for all comparisons (p ≤ 0.05), replacing the use of capital letters in the tables. Group differences are now presented in a clearer and more reader-friendly format, enhancing transparency and interpretability. Discussion 1- We have revised the language throughout the Discussion to use more conservative phrasing, replacing terms such as “indicates” with “may indicate” to appropriately reflect the findings of a single investigation. 2- The Nrf2 pathway is now clearly introduced and explained in paragraph 2, including its relevance to oxidative stress and the current study’s objectives. 3- The final sentence of paragraph 3 has been corrected to complete the thought and improve clarity. Finally , we sincerely thank the reviewer for their time, effort, and valuable feedback on our manuscript. Your thorough evaluation and constructive suggestions have significantly enhanced the clarity, rigor, and overall quality of our work. We have learned a great deal from your comments, which have not only improved this study but also enriched our expertise in best practices for scientific writing and research presentation. Thank you for your consideration. Sincerely Sabea Khamees Abed Competing Interests: The authors declare that they have no competing interests. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 05 Mar 2026 Sabea Abed , University of Fallujah, Al-Fallujah, Iraq 05 Mar 2026 Author Response Dear Reviewers, We sincerely thank the reviewers for their valuable time, effort, and insightful comments on our manuscript titled: “Effects of Methandienone on the ovaries of rabbits in relation ... Continue reading Dear Reviewers, We sincerely thank the reviewers for their valuable time, effort, and insightful comments on our manuscript titled: “Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium.” In response, we have carefully revised the manuscript and addressed all points raised: Paragraph 1 : In response, we revised the Introduction to incorporate our previous findings in brain tissues (Abed et al., 2020) and clarified that no similar investigations have been conducted in the subspinal reproductive centers. This revision clearly defines the research gap and the objective of the present study. Paragraph 2: All rabbits used in this study were of the same breed and genetic background and were obtained from the Cancer Research Center, Baghdad. The animals were age- and weight-matched prior to the start of the experiment. In addition, rabbits were randomly assigned to the experimental groups to minimize potential preexisting differences between groups. The study was designed as a randomized controlled post-test experimental model; therefore, baseline measurements were not collected prior to the supplementation protocol. The inclusion of a control group together with random allocation ensures group comparability at the beginning of the experiment and allows the observed differences to be attributed to the intervention. These methodological clarifications have now been added to the Methods section Paragraph 3: The methandienone used in this study was obtained from a commercial supplement provider (Gym Center Supplements) as part of the doctoral research project. To ensure accuracy and consistency, the compound was analyzed for purity in the Department of Analytics at the Veterinary Directorate. All experimental groups received the same verified preparation under controlled conditions. Introduction Added a supporting citation for the first sentence. Introduced the acronym “AAS” and used it consistently throughout the text. Replaced “senile osteoporosis” with “geriatric osteoporosis” for accuracy. Revised sentence 3 to read “…as well as their masculinizing effects…” and removed redundant references to “anabolic properties.” Corrected phrasing to “…number of adverse psychological and biochemical reactions…” Clarified the meaning of C19 and used it consistently throughout the paragraph. Replaced “follicular cystic” with “follicular cysts” for precision. Revised the third paragraph to begin with “The AAS methandienone…” Improved the opening sentence of the fourth paragraph to enhance transition, now reading: “A compound which plays a central role in maintaining the balance of redox and preserving mitochondrial integrity in the body is selenium (Se), a basic micronutrient…” Results: 1- Following the reviewer’s suggestion, we have replaced Fisher’s LSD post hoc analysis with Tukey’s post hoc test to provide a more conservative assessment of group differences and reduce the risk of false positives. Re-analysis confirmed that the original findings are maintained with Tukey’s test. This change has been updated in both the Results section and corresponding tables. 2- We have revised the presentation of statistically significant findings to include exact p-values for all comparisons (p ≤ 0.05), replacing the use of capital letters in the tables. Group differences are now presented in a clearer and more reader-friendly format, enhancing transparency and interpretability. Discussion 1- We have revised the language throughout the Discussion to use more conservative phrasing, replacing terms such as “indicates” with “may indicate” to appropriately reflect the findings of a single investigation. 2- The Nrf2 pathway is now clearly introduced and explained in paragraph 2, including its relevance to oxidative stress and the current study’s objectives. 3- The final sentence of paragraph 3 has been corrected to complete the thought and improve clarity. Finally , we sincerely thank the reviewer for their time, effort, and valuable feedback on our manuscript. Your thorough evaluation and constructive suggestions have significantly enhanced the clarity, rigor, and overall quality of our work. We have learned a great deal from your comments, which have not only improved this study but also enriched our expertise in best practices for scientific writing and research presentation. Thank you for your consideration. Sincerely Sabea Khamees Abed Dear Reviewers, We sincerely thank the reviewers for their valuable time, effort, and insightful comments on our manuscript titled: “Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium.” In response, we have carefully revised the manuscript and addressed all points raised: Paragraph 1 : In response, we revised the Introduction to incorporate our previous findings in brain tissues (Abed et al., 2020) and clarified that no similar investigations have been conducted in the subspinal reproductive centers. This revision clearly defines the research gap and the objective of the present study. Paragraph 2: All rabbits used in this study were of the same breed and genetic background and were obtained from the Cancer Research Center, Baghdad. The animals were age- and weight-matched prior to the start of the experiment. In addition, rabbits were randomly assigned to the experimental groups to minimize potential preexisting differences between groups. The study was designed as a randomized controlled post-test experimental model; therefore, baseline measurements were not collected prior to the supplementation protocol. The inclusion of a control group together with random allocation ensures group comparability at the beginning of the experiment and allows the observed differences to be attributed to the intervention. These methodological clarifications have now been added to the Methods section Paragraph 3: The methandienone used in this study was obtained from a commercial supplement provider (Gym Center Supplements) as part of the doctoral research project. To ensure accuracy and consistency, the compound was analyzed for purity in the Department of Analytics at the Veterinary Directorate. All experimental groups received the same verified preparation under controlled conditions. Introduction Added a supporting citation for the first sentence. Introduced the acronym “AAS” and used it consistently throughout the text. Replaced “senile osteoporosis” with “geriatric osteoporosis” for accuracy. Revised sentence 3 to read “…as well as their masculinizing effects…” and removed redundant references to “anabolic properties.” Corrected phrasing to “…number of adverse psychological and biochemical reactions…” Clarified the meaning of C19 and used it consistently throughout the paragraph. Replaced “follicular cystic” with “follicular cysts” for precision. Revised the third paragraph to begin with “The AAS methandienone…” Improved the opening sentence of the fourth paragraph to enhance transition, now reading: “A compound which plays a central role in maintaining the balance of redox and preserving mitochondrial integrity in the body is selenium (Se), a basic micronutrient…” Results: 1- Following the reviewer’s suggestion, we have replaced Fisher’s LSD post hoc analysis with Tukey’s post hoc test to provide a more conservative assessment of group differences and reduce the risk of false positives. Re-analysis confirmed that the original findings are maintained with Tukey’s test. This change has been updated in both the Results section and corresponding tables. 2- We have revised the presentation of statistically significant findings to include exact p-values for all comparisons (p ≤ 0.05), replacing the use of capital letters in the tables. Group differences are now presented in a clearer and more reader-friendly format, enhancing transparency and interpretability. Discussion 1- We have revised the language throughout the Discussion to use more conservative phrasing, replacing terms such as “indicates” with “may indicate” to appropriately reflect the findings of a single investigation. 2- The Nrf2 pathway is now clearly introduced and explained in paragraph 2, including its relevance to oxidative stress and the current study’s objectives. 3- The final sentence of paragraph 3 has been corrected to complete the thought and improve clarity. Finally , we sincerely thank the reviewer for their time, effort, and valuable feedback on our manuscript. Your thorough evaluation and constructive suggestions have significantly enhanced the clarity, rigor, and overall quality of our work. We have learned a great deal from your comments, which have not only improved this study but also enriched our expertise in best practices for scientific writing and research presentation. Thank you for your consideration. Sincerely Sabea Khamees Abed Competing Interests: The authors declare that they have no competing interests. Close Report a concern COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Al-Ghareebawi AMA. Reviewer Report For: Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2026, 15 :115 ( https://doi.org/10.5256/f1000research.192385.r453353 ) The direct URL for this report is: https://f1000research.com/articles/15-115/v1#referee-response-453353 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 02 Feb 2026 Aamir Maqtoof Abed Al-Ghareebawi , University of Al-Shatrah, Thi-Qar, Iraq Approved VIEWS 0 https://doi.org/10.5256/f1000research.192385.r453353 Thank you for the opportunity to review this submission. A paper submitted to the Journal is reviewed to determine whether the paper is suitable for indexing. In the review process, the originality, technical quality, and impact of the research work ... Continue reading READ ALL Thank you for the opportunity to review this submission. A paper submitted to the Journal is reviewed to determine whether the paper is suitable for indexing. In the review process, the originality, technical quality, and impact of the research work are critically evaluated. According to above, the article is suitable to indexing. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Animal Physiology I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Al-Ghareebawi AMA. Reviewer Report For: Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2026, 15 :115 ( https://doi.org/10.5256/f1000research.192385.r453353 ) The direct URL for this report is: https://f1000research.com/articles/15-115/v1#referee-response-453353 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 24 Jan 2026 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 3 Version 2 (revision) 05 Mar 26 read read Version 1 24 Jan 26 read read Aamir Maqtoof Abed Al-Ghareebawi , University of Al-Shatrah, Thi-Qar, Iraq Luke M Pelton , Springfield College, Springfield, USA Mohammed Asker , Mustansiriyah University, Baghdad, Iraq Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Pelton L. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 01 Apr 2026 | for Version 2 Luke M Pelton , Springfield College, Springfield, Massachusetts, USA 0 Views copyright © 2026 Pelton L. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions I thank the authors for their diligence in responding to my previous feedback. While I feel the quality of the manuscript as a whole has dramatically improved, there are a few minor points that I would like to see addressed; however, they are relatively simple fixes and I do not feel that they prohibit the manuscript from being acceptable. Intro : For Sentence 3, I apologize; I see now that my previous feedback was poorly stated on my part. The sentence should read “ AAS have potent anabolic properties and are often utilized to treat geriatric osteoporosis and various kinds of anemia. However, in addition to their masculinizing effects (Barbonetti et al., 2020), prolonged or excessive use is associated with a number of adverse psychological and biochemical reactions, including cardiovascular dysfunction, hepatotoxicity, endocrine imbalances and reproductive disorders (Albano et al., 2021) .” Methods : Knowing that the rabbits were of identical breed, we should definitely have that exact breed named clearly; this is important for two reasons. First, any future researchers looking to replicate this study will need to use identical subjects. Second, it allows you to make a stronger argument for why a posttest-only model was chosen (i.e., clarify the logic of the homogeneous rabbit breed circumventing the need for a pretest, as all could be assumed to be similar at baseline, etc.). In terms of the methandienone sourcing: I think it is prudent to clarify the specific source through which the drug was purchased by name. Again, this helps bolster the internal validity of your investigation, and would assist future researchers in replicating your methodology. Additionally, include that the compound was analyzed for purity in the Department of Analytics at the Veterinary Directorate, and that all experimental groups received the same verified preparation under controlled conditions. This should be a simple fix. Results : I am glad to see that the analysis yielded consistent findings, and I appreciate the authors’ reformatting and presentation of the findings. However: for p values reading “0.00,” we should change these to read “< 0.001” as the probability can never truly be 0. Again, this should be a very simple change. Discussion : I would actually suggest beginning the discussion by 1) restating the purpose of the investigation along with the hypothesis. This reminds the reader of the background as they then read the main findings. Conclusion : Kindly fix the spelling of the word “Conclusion” Competing Interests No competing interests were disclosed. Reviewer Expertise Exercise physiology, reproductive endocrinology, anabolic-androgenic steroids I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Pelton LM. Peer Review Report For: Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2026, 15 :115 ( https://doi.org/10.5256/f1000research.197154.r464958) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/15-115/v2#referee-response-464958 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Asker M. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 12 Mar 2026 | for Version 2 Mohammed Asker , Mustansiriyah University, Baghdad, Iraq 0 Views copyright © 2026 Asker M. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The manuscript entitled “Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1), oxidative markers and the possible protective role of selenium” presents an interesting and scientifically relevant investigation. Overall, the study is clearly written and well organized. The authors have presented the objectives, methodology, results, and discussion in a logical and coherent manner. The experimental design appears appropriate for addressing the research question, and the methods are described with sufficient clarity to allow understanding of the procedures used. The manuscript is written in a clear and precise scientific style, and the literature cited is relevant and supports the background of the study. In addition, the results are presented clearly and the conclusions are generally supported by the data provided. The work contributes useful information regarding the effects of Methandienone on ovarian function and oxidative stress markers, as well as the potential protective role of selenium. Overall, the manuscript represents a valuable contribution to the field. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Asker M. Peer Review Report For: Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2026, 15 :115 ( https://doi.org/10.5256/f1000research.197154.r465201) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/15-115/v2#referee-response-465201 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Pelton L. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 16 Feb 2026 | for Version 1 Luke M Pelton , Springfield College, Springfield, Massachusetts, USA 0 Views copyright © 2026 Pelton L. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Not Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions I had the privilege of being asked to provide an open review of the recently published “Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium.” While I am greatly intrigued by the premise and purpose, I believe there are several crucial points that must be addressed before it is truly ready to add its findings to this area of research. In the Introduction, there is a noticeable jump from the background information of the Intro to the hypothesis. WHY is this investigation being conducted? Is there some crucial gap that exists in this previous area of research? Has anything similar been conducted previously? It seems as though your research group has actually conducted similar investigations in the brain (Abed et al. 2020). Why not present that as a recent relevant finding, and use that to pose the following: Although previous research has been conducted in brain tissues (Abed et al. 2020), there have been no such investigations in the subspinal reproductive centers. Therefore, the purpose of this study is to…” In the Methods: there are several elements which gravely threaten the internal validity of this investigation. Firstly, it should be indicated whether all rabbits were the same breed/genetic strain. I am assuming this is the case, but requires clarification as any preexisting between-group differences at baseline must be accounted for. To that point: I am not seeing any indication that baseline data was gathered before the supplementation protocol. If this data was not gathered, it is a fatal threat to internal validity, as there is no accounting for whether the between-groups differences were actually a result of the protocol, or due to the aforementioned preexisting group differences. Finally, the use of Black Dragon Pharma: based on the name and a Google search, this seems like a UG lab (i.e. a black market trader of non-regulated AAS and PEDs) and not a reputable pharmaceutical provider. Was there any 3rd party testing conducted on this to even determine if the dosing of the compound was accurate? This is also a potentially fatal threat to the internal validity of this investigation, as it severely limits whether we can claim that the changes in groups are due to the protocol. Additionally, for the benefit of the authors, I have provided minor feedback which pertains mostly to writing style, organization, etc., and should be relatively simple for the authors to address. Intro: I would like to see a supporting citation for sentence 1 After introducing the acronymic abbreviation AAS< use that for all instances going forward (i.e. sentence 2) “Senile osteoporosis”: is this meant to be “geriatric”? Senile implies psychological/cognitive status Sentence 3: this structure needs revision; the second phrase could better read “...as well as their masculinizing effects…” “Anabolic properties” and “anabolic impacts" are redundant and repetitive. Should be written “...number of adverse psychological and biochemical reactions…” Second paragraph: clarify what C19 is or the read (and then use C19 throughout) “Elevated androgen levels are also strongly associated with follicular cystic…” What is meant by “follicular cystic”? Should this be “follicular cysts”? Third paragraph: should start by saying “The AAS methandienone…” Fourth paragraph: to facilitate a better transition to this point from the previous topic, I would revise this opening point sentence: “A compound which plays a central role in maintaining the balance of redox and preserving mitochondrial integrity in the body is selenium (Se), a basic micronutrient…” Results: LSD: If this is Fisher’s LSD as used as a post hoc analysis following the ANOVA, I would urge caution in its use and extrapolation. Fisher’s LSD is often likely to return a false positive via hyperinflation of alpha in its multiple comparisons. I would suggest using Tukey’s post hoc, as it is a more conservative measure (particularly given the lack of robust supporting research provided in the introduction as to provide rationale for the expected direction of change/difference; this, compounded with the previously mentioned concerns regarding the AAS dosing, present an additional threat to internal validity). I ran the analysis on my own with the raw data set you kindly provided, and found that your findings would be maintained with the use of Tukey’s post hoc. When stating statistically significant findings: there must be some indication of the exact p value. Saying “p < 0.05” is not enough, firstly as the threshold is “p ≤ 0.05,” and secondly as it is not indicated on the table anywhere. To that point, the use of capital letters to indicate significant differences is unwieldy and confusing. Please consider using this entire point of feedback to present the group differences in a way that both clarifies your presentation of the data and makes it more easily understood by the reader. Discussion Throughout the discussion: be careful when using words like “indicates,” as they carry with them a weight of finality. Simply including the phrase “may indicate” presents your findings in a more conservative manner appropriate for conveying the findings of a single investigation. Paragraph 2: this is the first introduction of the Nrf2 pathway. I recommend clarifying what that is for the reader, and how it relates to the current investigation. Paragraph 3: the final sentence of this paragraph is an incomplete thought. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? No Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Partly Competing Interests No competing interests were disclosed. Reviewer Expertise Exercise physiology, reproductive endocrinology, anabolic-androgenic steroids I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. reply Respond to this report Responses (1) Author Response 05 Mar 2026 Sabea Abed, University of Fallujah, Al-Fallujah, Iraq Dear Reviewers, We sincerely thank the reviewers for their valuable time, effort, and insightful comments on our manuscript titled: “Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium.” In response, we have carefully revised the manuscript and addressed all points raised: Paragraph 1 : In response, we revised the Introduction to incorporate our previous findings in brain tissues (Abed et al., 2020) and clarified that no similar investigations have been conducted in the subspinal reproductive centers. This revision clearly defines the research gap and the objective of the present study. Paragraph 2: All rabbits used in this study were of the same breed and genetic background and were obtained from the Cancer Research Center, Baghdad. The animals were age- and weight-matched prior to the start of the experiment. In addition, rabbits were randomly assigned to the experimental groups to minimize potential preexisting differences between groups. The study was designed as a randomized controlled post-test experimental model; therefore, baseline measurements were not collected prior to the supplementation protocol. The inclusion of a control group together with random allocation ensures group comparability at the beginning of the experiment and allows the observed differences to be attributed to the intervention. These methodological clarifications have now been added to the Methods section Paragraph 3: The methandienone used in this study was obtained from a commercial supplement provider (Gym Center Supplements) as part of the doctoral research project. To ensure accuracy and consistency, the compound was analyzed for purity in the Department of Analytics at the Veterinary Directorate. All experimental groups received the same verified preparation under controlled conditions. Introduction Added a supporting citation for the first sentence. Introduced the acronym “AAS” and used it consistently throughout the text. Replaced “senile osteoporosis” with “geriatric osteoporosis” for accuracy. Revised sentence 3 to read “…as well as their masculinizing effects…” and removed redundant references to “anabolic properties.” Corrected phrasing to “…number of adverse psychological and biochemical reactions…” Clarified the meaning of C19 and used it consistently throughout the paragraph. Replaced “follicular cystic” with “follicular cysts” for precision. Revised the third paragraph to begin with “The AAS methandienone…” Improved the opening sentence of the fourth paragraph to enhance transition, now reading: “A compound which plays a central role in maintaining the balance of redox and preserving mitochondrial integrity in the body is selenium (Se), a basic micronutrient…” Results: 1- Following the reviewer’s suggestion, we have replaced Fisher’s LSD post hoc analysis with Tukey’s post hoc test to provide a more conservative assessment of group differences and reduce the risk of false positives. Re-analysis confirmed that the original findings are maintained with Tukey’s test. This change has been updated in both the Results section and corresponding tables. 2- We have revised the presentation of statistically significant findings to include exact p-values for all comparisons (p ≤ 0.05), replacing the use of capital letters in the tables. Group differences are now presented in a clearer and more reader-friendly format, enhancing transparency and interpretability. Discussion 1- We have revised the language throughout the Discussion to use more conservative phrasing, replacing terms such as “indicates” with “may indicate” to appropriately reflect the findings of a single investigation. 2- The Nrf2 pathway is now clearly introduced and explained in paragraph 2, including its relevance to oxidative stress and the current study’s objectives. 3- The final sentence of paragraph 3 has been corrected to complete the thought and improve clarity. Finally , we sincerely thank the reviewer for their time, effort, and valuable feedback on our manuscript. Your thorough evaluation and constructive suggestions have significantly enhanced the clarity, rigor, and overall quality of our work. We have learned a great deal from your comments, which have not only improved this study but also enriched our expertise in best practices for scientific writing and research presentation. Thank you for your consideration. Sincerely Sabea Khamees Abed View more View less Competing Interests The authors declare that they have no competing interests. reply Respond Report a concern Pelton LM. Peer Review Report For: Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2026, 15 :115 ( https://doi.org/10.5256/f1000research.192385.r453351) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/15-115/v1#referee-response-453351 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Al-Ghareebawi A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 02 Feb 2026 | for Version 1 Aamir Maqtoof Abed Al-Ghareebawi , University of Al-Shatrah, Thi-Qar, Iraq 0 Views copyright © 2026 Al-Ghareebawi A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Thank you for the opportunity to review this submission. A paper submitted to the Journal is reviewed to determine whether the paper is suitable for indexing. In the review process, the originality, technical quality, and impact of the research work are critically evaluated. According to above, the article is suitable to indexing. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Animal Physiology I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Al-Ghareebawi AMA. Peer Review Report For: Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2026, 15 :115 ( https://doi.org/10.5256/f1000research.192385.r453353) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/15-115/v1#referee-response-453353 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "Effects of Methandienone on the ovaries of...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/15-115/v2" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/15-115/v2&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/15-115/v2" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Shahooth MA et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/15-115/v2/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/15-115", templates : { twitter : "Effects of Methandienone on the ovaries of rabbits in relation.... Shahooth MA et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/15-115/v2" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/174480/197154") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "197154"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "453351": 10, "453358": 0, "465199": 0, "453359": 0, "465198": 0, "453356": 0, "465197": 0, "453357": 0, "465196": 0, "453354": 0, "465195": 0, "453355": 0, "465194": 0, "453352": 0, "465193": 0, "453353": 10, "465202": 0, "453360": 0, "465201": 10, "465200": 0, "464959": 0, "464958": 4, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "a7bbba9c-0342-479a-a7fe-314ea12506fb"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "[email protected]", infoEmail: "[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00