Repurposing Disulfiram: A Promising Antifibrotic Strategy Against Paraquat-Induced Pulmonary Fibrosis

Repurposing Disulfiram: A Promising Antifibrotic Strategy Against Paraquat-Induced Pulmonary Fibrosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Repurposing Disulfiram: A Promising Antifibrotic Strategy Against Paraquat-Induced Pulmonary Fibrosis Fatemeh Karimzadeh, Zahra Babazadeh, Abdolreza Daraei, Ebrahim Zabihi-Neyshaburi, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7218465/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 18 Sep, 2025 Read the published version in Journal of Molecular Histology → Version 1 posted 9 You are reading this latest preprint version Abstract Pulmonary fibrosis is a fatal condition marked by excessive extracellular matrix deposition and myofibroblast activation, with paraquat (PQ) being a potent inducer via oxidative stress and profibrotic signaling. This study evaluated the antifibrotic effects of disulfiram (DSF), an FDA-approved medication, in rats with PQ-induced pulmonary fibrosis. Forty male Wistar rats were divided into eight groups receiving PQ (40 mg/kg) and DSF (1, 10, 100 mg/kg) for 21 days. Lung tissues were analyzed histopathologically (H&E, Mallory’s trichrome) for inflammation, alveolar septal thickening, vascular congestion, and fibrosis, while ZEB1 gene expression was assessed by real-time PCR. PQ exposure led to severe lung injury, collagen deposition, and significant upregulation of ZEB1 (p=0.0022). DSF at 10 mg/kg provided the most effective protection, significantly reducing histopathological damage and ZEB1 expression (p < 0.001). The 1 mg/kg dose showed moderate efficacy, and the 100 mg/kg dose had limited benefits, suggesting a dose-dependent toxicity. These findings indicate that DSF at 10 mg/kg attenuates PQ-induced pulmonary fibrosis by reducing inflammation, collagen accumulation, and ZEB1-mediated profibrotic signaling, supporting DSF as a potential repurposed antifibrotic therapy for PQ-induced and possibly idiopathic pulmonary fibrosis. Disulfiram Paraquat Pulmonary fibrosis ZEB1 Antifibrotic therapy Histopathology Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Pulmonary fibrosis (PF) is a chronic, fatal condition characterized by progressive lung tissue destruction through persistent inflammation, fibroblast proliferation, excessive extracellular matrix (ECM) deposition, and architectural remodeling (Mei, Liu, Zuo, Yang, & Qu, 2022 ). Despite current therapeutic options, patient prognosis remains poor, with a median survival of 3–5 years due to treatment limitations (Glass et al., 2022 ). The complex pathogenesis of PF involves interconnected pathways, including ion dysregulation, immune cell activation, epigenetic modifications, and aberrant cytokine signaling (Ebrahimi Naghani, Javadi, Rashidinooshabadi, Godarzi, & Houshmand, 2016 ; King, Pardo, & Selman, 2011 ). Paraquat (PQ), a bipyridyl herbicide banned in many industrialized countries yet still used in developing regions, is utilized to model PF due to its well-characterized mechanisms of ROS-mediated lipid peroxidation, mitochondrial dysfunction, and apoptosis (J. Liu, Lv, Ma, Yang, & Zhang, 2023 ; Yamada, Aki, Unuma, Funakoshi, & Uemura, 2015 ). PQ selectively accumulates in type II pneumocytes via the polyamine transport system, reaching concentrations up to tenfold higher than systemic levels and inducing endoplasmic reticulum (ER) stress-mediated apoptosis, which impairs epithelial regeneration and triggers fibroblast activation and ECM deposition. Notably, effective antidotes against PQ-induced fibrosis remain unavailable despite emerging immunosuppressive strategies (Chen et al., 2013 ; Khazraei, Marashi, & Sanaei-Zadeh, 2019 ; L. Li, Lv, Li, & Liu, 2022 ; Palipoch et al., 2022 ; Salton, Volpe, & Confalonieri, 2019 ) A key driver of fibrogenesis is epithelial-to-mesenchymal transition (EMT), a biological process wherein epithelial cells lose polarity and intercellular adhesion, acquiring mesenchymal traits that promote migration, invasion, and resistance to apoptosis. EMT is orchestrated by transcription factors, including zinc finger E-box-binding homeobox 1 (ZEB1), which suppress epithelial markers like E-cadherin while upregulating mesenchymal genes such as N-cadherin and vimentin (Saitoh, 2023 ). ZEB1 is highly expressed in alveolar epithelium near fibrotic lesions, suggesting its critical involvement in early fibrogenesis and its potential as a therapeutic target in PF (Z. Huang, Zhang, Zhou, Liu, & Huang, 2022 ; Runyan & Savagner, 2018 ). Disulfiram (DSF), an FDA-approved medication traditionally used for alcohol dependence (Mutschler, Grosshans, Soyka, & Rösner, 2016 ), has recently gained attention for its antifibrotic properties across various organ systems. DSF is known to inhibit enzymes, induce apoptosis in cancer cells via DNA methyltransferase inhibition, and modulate epigenetic and signaling pathways (Conticello et al., 2012 ; Zhang et al., 2022 ). Recent studies indicate that DSF can suppress EMT and myofibroblast activation by targeting TGF-β/ERK/NF-κB/Snail pathways, thereby reducing excessive collagen deposition and ECM remodeling during fibrosis progression (Han et al., 2015 ; Suthakaran, Singh, Deshmukh, & Das, 2022 ). In preclinical models of PF, DSF has been shown to improve lung compliance and reduce collagen deposition in bleomycin-induced fibrosis through inhibition of macrophage migration by blocking FROUNT, a mediator of CCR2/CCR5 signaling (Okabe et al., 2023 ; Sato et al., 2024 ). Additionally, DSF suppresses hepatic stellate cell activation in liver fibrosis and influences prostaglandin E2 biosynthesis, highlighting its broad antifibrotic potential (C. Li, Pei, Zheng, Cao, & Ren, 2021 ; X.-M. Yang et al., 2022 ). Given that PQ-induced PF is driven by ROS-mediated injury and EMT activation, and considering DSF's antioxidant, anti-inflammatory, and EMT-inhibitory effects, evaluating DSF in this model is particularly relevant. Despite promising antifibrotic effects in other models, the role of DSF in PQ-induced pulmonary fibrosis, a clinically and mechanistically significant model of lung fibrosis, remains unexplored. Therefore, this study aimed to investigate the protective and antifibrotic effects of disulfiram against paraquat-induced pulmonary fibrosis, providing insights into its potential as a repurposed therapeutic agent for fibrotic lung diseases. Materials and Methods Animal Care This study was conducted on 40 male Wistar rats weighing 180–220 g, housed in the Animal House of Babol University of Medical Sciences for 21 days. Animals were maintained under standard laboratory conditions (23 ± 3°C, 50–60% humidity, 12-hour light/dark cycle) with proper ventilation and ad libitum access to food and water. All experimental procedures were performed in compliance with institutional and national guidelines for the care and use of laboratory animals under the supervision of the Research Ethics Committee of Babol University of Medical Sciences (Approval Code: IR.MUBABOL.HRI.REC.1398.247). Study Design and Experimental Groups Pulmonary fibrosis was induced by a single oral gavage of paraquat (PQ) at 40 mg/kg dissolved in 800 µL sterile saline on day 1 (Guo et al., 2015 ). Disulfiram (DSF) was prepared in sesame oil and administered intraperitoneally in varying doses (1, 10, and 100 mg/kg) at a volume of 400 µL daily for 21 days based on body weight (Hamidi et al., 2023 ). The animals were randomly divided into eight groups (n = 5 per group) as follows: Control: 800 µL sterile saline via gavage (day 1) Vehicle Control: 400 µL sesame oil (IP) for 21 days PQ: PQ 40 mg/kg in 800 µL saline via gavage (day 1) DSF: DSF 100 mg/kg in 400 µL sesame oil (IP) for 21 days PQ + Vehicle: PQ via gavage (day 1) + sesame oil (IP) for 21 days PQ + DSF 1: PQ via gavage (day 1) + DSF 1 mg/kg (IP) for 21 days PQ + DSF 10: PQ via gavage (day 1) + DSF 10 mg/kg (IP) for 21 days PQ + DSF 100: PQ via gavage (day 1) + DSF 100 mg/kg (IP) for 21 days Following the treatment period, animals were sacrificed, and their lungs were harvested for further analysis. Sample Collection A small section of the apical region of the right lung was separated and immediately stored at − 80°C for gene expression analysis using real-time PCR. The remaining parts of the lungs were divided into apical, middle, and basal sections and fixed in 10% neutral buffered formalin for 72 hours for histopathological examination. Histopathological Analysis Formalin-fixed lung tissues were processed using graded alcohols and xylene, embedded in paraffin, and sectioned at 5 µm thickness. Sections were stained with hematoxylin and eosin (H&E) to assess general histopathological changes and with Mallory’s trichrome staining to evaluate collagen deposition and fibrosis. Histopathological parameters, including inflammation (perivascular, peribronchial, and interstitial), alveolar wall thickening, hemorrhage, and vascular congestion, were evaluated using H&E staining. The severity of lesions was graded as: 0–10% (Grade 0) 10–25% (Grade 1) 25–50% (Grade 2) 50–75% (Grade 3) 75–100% (Grade 4) (Park et al., 2013 ). Fibrosis was graded using the Ashcroft scoring system based on Mallory’s trichrome staining (Ashcroft, Simpson, & Timbrell, 1988 ). All slides were evaluated under a light microscope by three independent blinded observers, and inter-observer discrepancies were resolved through discussion. Gene Expression Analysis (ZEB1) Total RNA was extracted from the apical portion of the right lung using a Total RNA Extraction Kit (Pars Tous, Iran) following the manufacturer’s instructions. RNA concentration and purity were assessed using a NanoDrop spectrophotometer. Complementary DNA (cDNA) was synthesized using a cDNA synthesis kit (Yekta Tajhiz Azma, Iran). Real-time PCR was performed using SYBR Green Master Mix (Biofact, Korea) in a StepOnePlus Real-Time PCR System (Applied Biosystems, USA). The thermal cycling conditions included initial denaturation at 95°C for 10 min, followed by 40 cycles of Denaturation: 95°C for 15 s, Annealing: 60°C for 30s, and Extension: 30s. Each reaction (20 µL) contained 10 µL SYBR Green mix, 0.5 µL of each primer (10 µM), 2 µL cDNA, and 7 µL nuclease-free water. All reactions were performed in triplicate. Relative gene expression levels of ZEB1 were calculated using the 2^(-ΔΔCt) method with GAPDH as the internal reference. Primer sequences are listed in Table 1 . Table 1 Primer Sequences Used for Real time PCR Gene Primer Sequence (5'→3') ZEB1-F TGGCATATACATACTCCGCTAC ZEB1-R CTCCTTCTGAGCTAGTGTCTTG GAPDH-F CCTTCCGTGTTCCTACCCC GAPDH-R GCCCAGGATGCCCTTTAGTG Statistical Analysis Statistical analyses were conducted using GraphPad Prism 9.0.0. One-way analysis of variance (ANOVA) was used for gene expression data, and the Kruskal-Wallis test was applied for histopathological scores. A p-value ≤ 0.05 was considered statistically significant. Results Histopathological Alterations Induced by PQ PQ administration induced significant histopathological damage, including marked inflammatory cell infiltration, severe vascular congestion + Hemorrhage, alveolar septal thickening, and extensive fibrotic deposition (p 0.9999), confirming the vehicle’s neutrality (Fig. 1 ). Therapeutic Efficacy of Disulfiram Treatment with disulfiram demonstrated dose-dependent mitigation of PQ-induced lung injury: Inflammatory Response : PQ + D1 (2.53 ± 0.18) and PQ + D10 (1.20 ± 0.16) significantly reduced inflammation compared to PQ (p = 0.0116 and p < 0.0001, respectively). Vascular Congestion and Hemorrhage : PQ + D1 (2.33 ± 0.14) and PQ + D10 (0.73 ± 0.08) reduced congestion (p = 0.0010 and p < 0.0001, respectively). Alveolar Wall Thickening : PQ + D1 (2.20 ± 0.19) and PQ + D10 (1.33 ± 0.16) significantly attenuated septal thickening (both p < 0.0001). Fibrosis : All treatment groups showed antifibrotic activity, following: PQ + D10 (1.40 ± 0.14; p PQ + D1 (4.07 ± 0.26; p PQ + D100 (5.67 ± 0.26; p = 0.0362) vs. PQ. Notably, high-dose PQ + D100 exhibited limited protective effects across parameters, with non-significant differences in inflammation (p > 0.9999), congestion (p = 0.1948), and alveolar thickness (p = 0.5896) versus PQ, indicating potential dose-related toxicity. Inter-group comparisons revealed : PQ + D10 was superior to PQ + D100 (p < 0.0001). PQ + D10 exhibited lower inflammatory infiltration (p = 0.0448) and vascular congestion (p = 0.0062) than PQ + D1, while alveolar thickness was comparable (p = 0.7253). (Fig. 1 a-d) Histopathological evaluation (H&E and Mallory’s trichrome staining) corroborated these findings, illustrating marked attenuation of PQ-induced alveolar thickening, inflammation, and fibrosis in the PQ + D10 group (Figs. 2 and 3 ). Notably, PQ + D10 demonstrated near-complete restoration of alveolar architecture with minimal fibrosis, while PQ + D100 paradoxically exacerbated fibrotic remodeling, suggesting a narrow therapeutic window for disulfiram. (Figs. 2 and 3 ) Regional Distribution of Protective Effects Regional histopathological assessment demonstrated consistent therapeutic efficacy of PQ + D10 across all lung regions (apex, middle, base), with significant improvement over PQ (p < 0.0001) and other treatment regimens (p 0.05), a trend toward enhanced efficacy was observed in the basal region, indicating potential region-specific treatment responsiveness warranting further investigation (Table 2 , Tables S2–S4). Table 2 Comparative Therapeutic Efficacy Across Lung Regions (Apex, Middle, and Base) Parameter Region PQ (Mean ± SE) PQ + D10 (Mean ± SE) IQR Range (PQ vs Treatment) MR (PQ vs Treatment) Regional Difference Inflammation Apex 3.867 ± 0.09085 1.533 ± 0.2153 (4, 4) vs (1, 2) 302.1 vs 137.0 Base < Apex = middle Middle 3.933 ± 0.06667 1.533 ± 0.2153 (4, 4) vs (1, 2) 307.6 vs 137.0 Base 3.733 ± 0.1182 0.8667 ± 0.2153 (3, 4) vs (0, 2) 291.3 vs 98.37 Congestion Apex 3.900 ± 0.1000 0.7000 ± 0.1528 (4, 4) vs (0, 1) 205.8 vs 65.45 Apex = Middle < Base Middle 3.900 ± 0.1000 0.7000 ± 0.1528 (4, 4) vs (0, 1) 205.8 vs 65.45 Base 3.800 ± 0.1333 0.8000 ± 0.1333 (3.75, 4) vs (0.75, 1) 200.5 vs 70.30 Alveolar Wall Apex 4.000 ± 0.0000 1.800 ± 0.2000 (4, 4) vs (1.5, 2) 107.0 vs 50.30 Base < Middle < Apex Middle 4.000 ± 0.0000 1.200 ± 0.4899 (4, 4) vs (0, 2) 107.0 vs 39.00 Base 4.000 ± 0.0000 1.000 ± 0.4472 (4, 4) vs (0, 2) 107.0 vs 36.30 Fibrosis Apex 7.800 ± 0.2000 1.800 ± 0.1633 (7.5, 8) vs (1.6, 2) 117.7 vs 45.50 Base < Middle < Apex Middle 8.000 ± 0.0000 1.400 ± 0.4000 (8, 8) vs (0.5, 2) 121.0 vs 40.40 Base 7.800 ± 0.2000 1.067 ± 0.3712 (7.5, 8) vs (0, 2) 117.7 vs 35.33 There is no significant regional. Modulation of ZEB1 Gene Expression Real-time PCR analysis revealed marked dysregulation of ZEB1 across experimental groups (Fig. 4 ). PQ exposure significantly upregulated ZEB1 expression (6.88 ± 0.78) versus control (1.22 ± 0.46; p = 0.0022) and oil groups (2.31 ± 1.07; p = 0.0213), indicating robust fibrotic signaling activation. Disulfiram treatments significantly attenuated PQ-induced ZEB1 upregulation: PQ + D1: 2.19 ± 0.81 (p = 0.0169 vs. PQ) PQ + D10: 0.88 ± 0.37 (p = 0.0011 vs. PQ) PQ + D100: 2.55 ± 0.49 (p = 0.0343 vs. PQ) D100 monotherapy (0.45 ± 0.07) showed no difference from controls (p = 0.9986), while PQ + Oil remained comparable to PQ alone (p = 0.9071). Although inter-dose comparisons among disulfiram treatments were not statistically significant (p > 0.88), a consistent efficacy gradient emerged (D10 > D1 > D100), suggesting dose-dependent modulation of ZEB1-mediated fibrotic signaling. (Fig. 4 ) Collectively, these histopathological and molecular findings demonstrate that disulfiram, particularly at 10 mg/kg, effectively mitigates PQ-induced pulmonary fibrosis through anti-inflammatory, antifibrotic, and EMT-modulating mechanisms. The observed dose-dependent profile highlights the therapeutic potential of disulfiram while emphasizing the importance of optimal dosing to avoid potential toxicity at higher concentrations. Discussion Fibrotic disorders, characterized by dysregulated extracellular matrix (ECM) deposition and persistent myofibroblast activation, are a global health concern (Dees, Chakraborty, & Distler, 2021 ). Environmental toxins like paraquat, noted for environmental persistence and fibrogenic potential, remain key contributors to pulmonary fibrosis (Y. Huang, Zhan, Bhatt, & Chen, 2019 ; Subbiah & Tiwari, 2021 ). Acute paraquat poisoning typically follows a biphasic course, with initial symptom resolution followed by delayed pulmonary fibrosis and fatal respiratory failure (Khazraei et al., 2019 ). We employed a single oral paraquat dose (40 mg/kg) to induce fibrosis within 21 days, consistent with prior studies reporting fibrosis within 14–28 days: Silva et al. (i.p. 10 mg/kg; 14 days) (Rodrigues da Silva et al., 2018 ), Yang et al. (i.p. 30 mg/kg; 14/21 days) (Zhizhou Yang et al., 2015 ), Shao et al. (i.p. 10 mg/kg; 14/28 days) (Shao et al., 2015 ), and Khodayar et al. (oral 20 mg/kg; 21 days) (Khodayar et al., 2014 ). These findings align with Afzali et al.’s observation of delayed fibrogenesis within 2–10 weeks (Afzali & Gholyaf, 2008 ). Unlike previous intraperitoneal models, we used oral gavage to clinically simulate secondary fibrosis after paraquat ingestion, reflecting human cases where patients initially recover post-ingestion but later develop fatal fibrosis. This clinically relevant model allows the investigation of antifibrotic therapies under conditions that closely mimic human paraquat poisoning, enhancing translational relevance while addressing the need for effective interventions in toxin-induced pulmonary fibrosis. Our histopathological findings demonstrated that paraquat exposure led to severe inflammation, vascular congestion, and pronounced fibrosis, with significant alveolar wall thickening across all lung regions, consistent with previous reports by Palipoch et al., reflecting paraquat’s ability to generate reactive oxygen species (ROS), disrupt epithelial-endothelial barriers, and trigger inflammatory cascades, including IL-6, TNF-α, and IL-1β, leading to leukocyte infiltration, edema, and hemorrhage (Palipoch et al., 2022 ; Rodrigues da Silva et al., 2018 ). These pathological events contribute to progressive fibrotic remodeling, aligning with the established biphasic trajectory of paraquat-induced lung injury. Critically, our study revealed significant upregulation of ZEB1 gene expression in paraquat-exposed rats, supporting its pivotal role in fibrogenesis. ZEB1 facilitates fibroblast activation and fibroblast-to-myofibroblast transition (FMyT), fundamental to fibrosis progression across multiple organs, including the lung, kidney, and liver. In renal models, ZEB1 knockdown attenuates TGF-β-induced myofibroblast activation and fibrosis, highlighting its therapeutic potential (Hu et al., 2024 ; Zhao et al., 2023 ). In pulmonary fibrosis, ZEB1 stabilization by GTSE1 promotes epithelial-to-mesenchymal transition (EMT), while lncRNAs such as FEZF1-AS1 modulate ZEB1 via miR-200c-3p, further driving fibrogenesis (M. Liu, Song, Lai, Gao, & Man, 2024 ). These mechanisms collectively contribute to excessive collagen deposition and ECM remodeling during fibrosis. Importantly, targeting ZEB1 directly or its upstream modulators through strategies such as shRNA silencing, lncRNA interference, or small-molecule inhibitors has shown efficacy in reducing fibrosis severity in various preclinical models (M. Liu et al., 2024 ; Menche et al., 2024 ; Zhao et al., 2023 ). Our findings thus corroborate the central role of ZEB1 in PQ-induced pulmonary fibrosis, suggesting that ZEB1 may serve as a valuable therapeutic target for mitigating fibrotic progression. In this study, we employed an oral paraquat-induced pulmonary fibrosis model to evaluate the antifibrotic potential of disulfiram (DSF), with a specific focus on ZEB1 gene expression as a fibrogenic marker. Our findings demonstrate that DSF effectively reduced ZEB1 gene expression and fibrotic pattern across all tested doses (1, 10, and 100 mg/kg), indicating its capacity to modulate key profibrotic signaling pathways at the molecular level and fibrotic pattern. Notably, significant improvements in histopathological parameters—including inflammatory infiltration, vascular congestion, hemorrhage, and alveolar septal thickening—were observed at the 1 and 10 mg/kg doses compared to paraquat-only and paraquat + oil groups, suggesting that gene expression modulation may precede and contribute to subsequent histopathological recovery. However, the 100 mg/kg dose did not yield significant histopathological improvements despite reducing ZEB1 expression and fibrotic pattern, implying potential dose-limiting toxicity or suboptimal efficacy at this higher concentration. These findings highlight the importance of dose optimization in leveraging DSF's antifibrotic effects while minimizing potential adverse outcomes, underscoring the need for further studies to define the therapeutic window of DSF in paraquat-induced and idiopathic pulmonary fibrosis models. Among the tested doses, 10 mg/kg of DSF demonstrated the most robust and pan-regional efficacy across all lung fields (Tables S2–S4), markedly improving histopathological parameters throughout the apex, middle, and basal regions. In contrast, 1 mg/kg only reduced alveolar thickness in the apical region. The magnitude of improvement exhibited spatial variation, with optimal anti-fibrotic and anti-inflammatory effects in the basal region and superior reduction of vascular congestion in the apex/middle regions, consistent with ventilation-perfusion gradients (Koeppen & Stanton, 2017 ). Comparative analyses further identified 10 mg/kg as the optimal therapeutic dose, significantly outperforming both 1 mg/kg and 100 mg/kg (p < 0.05), and achieving near-complete restoration of lung architecture (p = 0.6265 vs. healthy controls). In contrast, the 100 mg/kg dose exhibited attenuated efficacy, potentially due to dose-dependent toxicity that may counteract its therapeutic benefits. Collectively, these findings emphasize that intermediate dosing of DSF maximizes antifibrotic outcomes while avoiding the limitations associated with subtherapeutic or excessively high doses, informing future translational efforts for effective antifibrotic interventions. (Tables S2–S4) Supporting our findings, previous studies reported DSF-mediated suppression of proinflammatory cytokines and epigenetic dysregulation in paraquat models, with 10 mg/kg demonstrating optimal efficacy in reducing fibrosis and inflammatory markers while restoring gene expression patterns (Hamidi et al., 2023 ). Mechanistically, DSF’s antifibrotic effects are mediated by ALDH inhibition leading to cytotoxic aldehyde accumulation, oxidative stress, and apoptosis in activated fibroblasts (Zhi Yang, Guo, Albers, Sehouli, & Kaufmann, 2019 ). This disrupts EMT and fibroblast-to-myofibroblast differentiation pathways, reducing collagen deposition and fibrosis progression (Wu et al., 2025 ). Our trichrome staining results confirm DSF's efficacy in reducing collagen deposition across lung regions, corroborating these mechanistic insights. Disulfiram (DSF) has shown consistent antifibrotic efficacy across different organ systems, including the lungs, kidneys, liver, and orbital tissues, suggesting a shared mechanism that involves modulation of inflammatory and fibrotic pathways (C. Li et al., 2021 ; Patil, Patil, Patel, & Kumar, 2025 ; Wang, Ye, et al., 2022 ; X.-M. Yang et al., 2022 ). In pulmonary fibrosis models, DSF has been reported to enhance PGE2 reactivation via COX-2 pathways, contributing to its antifibrotic effects (C. Li et al., 2021 ). Additionally, its benefits in conditions such as Graves’ orbitopathy further support its potential as a versatile antifibrotic agent (Wang, Yang, et al., 2022 ; Wang, Ye, et al., 2022 ). Collectively, these findings align with our results, underscoring the potential for repurposing DSF as a therapeutic option in managing paraquat-induced and idiopathic pulmonary fibrosis. Despite these promising therapeutic effects, DSF’s adverse event profile—encompassing hepatotoxicity, neurological complications, and hypersensitivity reactions—remains a critical barrier for its chronic use as an antifibrotic agent, requiring careful safety monitoring and individualized risk-benefit analysis for clinical application (Lanz et al., 2023 ; Stokes, Patel, & Abdijadid, 2024 ). These concerns underscore the necessity to determine not only the most effective dose but also the optimal treatment duration of DSF to balance maximal antifibrotic efficacy with minimal toxicity, thereby ensuring safe clinical translation. Emerging evidence indicates that both dosing and treatment duration significantly influence antifibrotic therapy outcomes in pulmonary fibrosis, affecting the resolution of inflammation, reversal of fibrotic remodeling, and the incidence of adverse events (Chan et al., 2017 ). Therefore, future translational research, including well-structured clinical trials, is essential to validate the long-term safety, ideal dosing strategies, and therapeutic potential of DSF in managing paraquat-induced and idiopathic pulmonary fibrosis. Strengths and Limitations This study highlights the potential of disulfiram as a repurposed antifibrotic agent in paraquat-induced pulmonary fibrosis, demonstrating dose-dependent efficacy, mechanistic modulation of ZEB1 expression, and histopathological improvements across various lung regions. The study’s methodological strengths, including dose stratification, comprehensive blinded histopathological analysis, and mechanistic gene expression evaluation, enhance the reliability of the findings. However, this study has some limitations that should be acknowledged. First, while we assessed ZEB1 mRNA expression using Real-time PCR in paraquat-induced pulmonary fibrosis, we did not perform protein-level validation using Western blot or immunohistochemistry (IHC) due to budgetary and technical limitations at the end of the project. Protein-level evaluation would have strengthened the mechanistic interpretation of ZEB1’s role in fibrosis progression and therapeutic modulation by disulfiram. Additionally, although our histopathological evaluation was comprehensive and region-specific, the absence of additional fibrotic markers such as α-SMA or collagen I/III protein expression limits a deeper molecular characterization of fibrotic remodeling. Future studies will address these limitations by incorporating protein-level analyses and mechanistic pathway evaluations to further validate the antifibrotic effects of disulfiram and clarify its precise mode of action in paraquat-induced pulmonary fibrosis. Despite these limitations, the current findings provide robust and regionally consistent evidence supporting disulfiram’s antifibrotic efficacy and establish a strong foundation for subsequent molecular investigations. Conclusion In conclusion, our study demonstrates that disulfiram, particularly at a dose of 10 mg/kg, effectively mitigates PQ-induced pulmonary fibrosis by reducing inflammation, attenuating ZEB1-mediated fibrogenic signaling, and preserving lung architecture. These findings position DSF as a promising candidate for repurposing as an antifibrotic agent, offering a potential therapeutic strategy for managing PQ-induced and other forms of pulmonary fibrosis. However, translating these findings into clinical practice will require further research to establish the safety, efficacy, and optimal dosing strategies of DSF in human subjects, paving the way for the development of effective antifibrotic therapies aimed at improving patient outcomes in fibrotic lung diseases. Declarations Acknowledgments The authors gratefully acknowledge the support of Babol University of Medical Sciences and express their appreciation to all individuals who contributed to the successful completion of this research. Funding This study was financially supported by the Vice-Chancellery for Research and Technology of Babol University of Medical Sciences. Competing Interests The authors declare that they have no competing interests. Ethics Approval and Consent to Participate The study protocol was reviewed and approved by the Ethics Committee of Babol University of Medical Sciences (Approval Code: IR.MUBABOL.HRI.REC.1398.247). Use of AI-Assisted Tools Portions of this manuscript were prepared using AI-assisted tools (ChatGPT Plus) to refine academic language and improve structural clarity. All AI-generated content was thoroughly reviewed and edited by the authors. No AI tools were used for data analysis or result generation. The authors assume full responsibility for the accuracy and integrity of the manuscript. References Afzali, S., & Gholyaf, M. (2008). The effectiveness of combined treatment with methylprednisolone and cyclophosphamide in oral paraquat poisoning. Ashcroft, T., Simpson, J. M., & Timbrell, V. (1988). Simple method of estimating severity of pulmonary fibrosis on a numerical scale. Journal of clinical pathology, 41 (4), 467-470. Chan, P., Bax, L., Chen, C., Zhang, N., Huang, S. P., Soares, H., . . . AbuTarif, M. (2017). Model‐based meta‐analysis on the efficacy of pharmacological treatments for idiopathic pulmonary fibrosis. CPT: pharmacometrics & systems pharmacology, 6 (10), 695-704. Chen, Y., Nie, Y.-c., Luo, Y.-l., Lin, F., Zheng, Y.-f., Cheng, G.-h., . . . Shen, J.-g. (2013). Protective effects of naringin against paraquat-induced acute lung injury and pulmonary fibrosis in mice. Food and Chemical Toxicology, 58 , 133-140. Conticello, C., Martinetti, D., Adamo, L., Buccheri, S., Giuffrida, R., Parrinello, N., . . . Cavalli, M. (2012). Disulfiram, an old drug with new potential therapeutic uses for human hematological malignancies. International journal of cancer, 131 (9), 2197-2203. Dees, C., Chakraborty, D., & Distler, J. H. (2021). Cellular and molecular mechanisms in fibrosis. Experimental Dermatology, 30 (1), 121-131. Ebrahimi Naghani, E., Javadi, I., Rashidinooshabadi, M., Godarzi, M., & Houshmand, G. (2016). Protective effects of hydroalcoholic extract of Hypericum perforatum against bleomycin-induced pulmonary fibrosis in rats. Journal of Babol University of Medical Sciences, 18 (1), 44-51. Glass, D. S., Grossfeld, D., Renna, H. A., Agarwala, P., Spiegler, P., DeLeon, J., & Reiss, A. B. (2022). Idiopathic pulmonary fibrosis: Current and future treatment. The clinical respiratory journal, 16 (2), 84-96. Guo, F., Sun, Y., Su, L., Li, S., Liu, Z., Li, J., . . . Li, J. (2015). Losartan attenuates paraquat-induced pulmonary fibrosis in rats. Human & Experimental Toxicology, 34 (5), 497-505. Hamidi, N., Feizi, F., Azadmehr, A., Zabihi, E., Khafri, S., Zarei-Behjani, Z., & Babazadeh, Z. (2023). Disulfiram ameliorates bleomycin induced pulmonary inflammation and fibrosis in rats. Biotechnic & Histochemistry, 98 (8), 584-592. Han, D., Wu, G., Chang, C., Zhu, F., Xiao, Y., Li, Q., . . . Zhang, L. (2015). Disulfiram inhibits TGF-β-induced epithelial-mesenchymal transition and stem-like features in breast cancer via ERK/NF-κB/Snail pathway. Oncotarget, 6 (38), 40907. Hu, J.-Q., Zheng, D.-C., Huang, L., Yang, X., Ning, C.-Q., Zhou, J., . . . Xie, Y. (2024). Suppression of ZEB1 by Ethyl caffeate attenuates renal fibrosis via switching glycolytic reprogramming. Pharmacological Research, 209 , 107407. Huang, Y., Zhan, H., Bhatt, P., & Chen, S. (2019). Paraquat degradation from contaminated environments: current achievements and perspectives. Frontiers in Microbiology, 10 , 1754. Huang, Z., Zhang, Z., Zhou, C., Liu, L., & Huang, C. (2022). Epithelial–mesenchymal transition: The history, regulatory mechanism, and cancer therapeutic opportunities. MedComm, 3 (2), e144. Khazraei, S., Marashi, S. M., & Sanaei-Zadeh, H. (2019). Ventilator settings and outcome of respiratory failure in paraquat-induced pulmonary injury. Scientific Reports, 9 (1), 16541. Khodayar, M. J., Kiani, M., Hemmati, A. A., Rezaie, A., Zerafatfard, M. R., Nooshabadi, M. R. R., & Goudarzi, M. (2014). The preventive effect of atorvastatin on paraquat-induced pulmonary fibrosis in the rats. Advanced pharmaceutical bulletin, 4 (4), 345. King, T. E., Pardo, A., & Selman, M. (2011). Idiopathic pulmonary fibrosis. The Lancet, 378 (9807), 1949-1961. Koeppen, B. M., & Stanton, B. A. (2017). Berne & Levy Physiology: First South Asia Edition-E-book : Elsevier Health Sciences. Lanz, J., Biniaz-Harris, N., Kuvaldina, M., Jain, S., Lewis, K., & Fallon, B. A. (2023). Disulfiram: mechanisms, applications, and challenges. Antibiotics, 12 (3), 524. Li, C., Pei, X., Zheng, F., Cao, K., & Ren, D. (2021). Disulfiram Regulates Epithelial-Mesenchymal Transition by Activating PGE2 Biosynthesis to Improve Idiopathic Pulmonary Fibrosis TP116. TP116 PRECLINICAL THERAPEUTIC MODELS OF FIBROSIS (pp. A4439-A4439): American Thoracic Society. Li, L., Lv, S., Li, X., & Liu, J. (2022). Wnt-induced secreted proteins-1 play an important role in paraquat-induced pulmonary fibrosis. BMC Pharmacology and Toxicology, 23 (1), 21. Liu, J., Lv, S., Ma, W., Yang, D., & Zhang, X. (2023). Effect of WISP1 on paraquat-induced EMT. Toxicology in Vitro, 93 , 105693. Liu, M., Song, L., Lai, Y., Gao, F., & Man, J. (2024). LncRNA FEZF1-AS1 promotes pulmonary fibrosis via up-regulating EZH2 and targeting miR-200c-3p to regulate the ZEB1 pathway. Scientific Reports, 14 (1), 26044. Mei, Q., Liu, Z., Zuo, H., Yang, Z., & Qu, J. (2022). Idiopathic pulmonary fibrosis: an update on pathogenesis. Frontiers in Pharmacology, 12 , 797292. Menche, C., Schuhwerk, H., Armstark, I., Gupta, P., Fuchs, K., van Roey, R., . . . Clavel Ezquerra, A. (2024). ZEB1-mediated fibroblast polarization controls inflammation and sensitivity to immunotherapy in colorectal cancer. EMBO reports, 25 (8), 3406-3431. Mutschler, J., Grosshans, M., Soyka, M., & Rösner, S. (2016). Current findings and mechanisms of action of disulfiram in the treatment of alcohol dependence. Pharmacopsychiatry, 49 (04), 137-141. Okabe, Y., Toda, E., Urushiyama, H., Terashima, Y., Kunugi, S., Kajimoto, Y., . . . Yamauchi, Y. (2023). Antifibrotic effect of disulfiram on bleomycin-induced lung fibrosis in mice. Palipoch, S., Punsawad, C., Koomhin, P., Na-Ek, P., Poonsawat, W., Kimseng, R., . . . Suwannalert, P. (2022). Aqueous Thunbergia laurifolia leaf extract alleviates paraquat-induced lung injury in rats by inhibiting oxidative stress and inflammation. BMC complementary medicine and therapies, 22 (1), 83. Park, Y. S., Park, C. M., Lee, H. J., Goo, J. M., Chung, D. H., Lee, S.-M., . . . Yoo, C.-G. (2013). Clinical implication of protease-activated receptor-2 in idiopathic pulmonary fibrosis. Respiratory medicine, 107 (2), 256-262. Patil, V. S., Patil, C. R., Patel, H. M., & Kumar, A. (2025). Exploring disulfiram mechanisms in renal fibrosis: insights from biological data and computational approaches. Frontiers in Pharmacology, 16 , 1480732. Rodrigues da Silva, M., Schapochnik, A., Peres Leal, M., Esteves, J., Bichels Hebeda, C., Sandri, S., . . . Lino-dos-Santos-Franco, A. (2018). Beneficial effects of ascorbic acid to treat lung fibrosis induced by paraquat. PLoS One, 13 (11), e0205535. Runyan, R. B., & Savagner, P. (2018). Epithelial-mesenchymal transition and plasticity in the developmental basis of cancer and fibrosis. Dev Dyn, 247 (3), 330-331. Saitoh, M. (2023). Transcriptional regulation of EMT transcription factors in cancer. Paper presented at the Seminars in cancer biology. Salton, F., Volpe, M. C., & Confalonieri, M. (2019). Epithelial–mesenchymal transition in the pathogenesis of idiopathic pulmonary fibrosis. Medicina, 55 (4), 83. Sato, M., Urushiyama, H., Toda, E., Takumida, H., Enokido, T., Saito, A., . . . Kage, H. (2024). Exploring Combined Therapy: Disulfiram and Antifibrotic Agents in Attenuating Pulmonary Fibrosis in Bleomycin-Induced Mouse Model: European Respiratory Society. Shao, X., Li, M., Luo, C., Wang, Y.-y., Lu, Y.-y., Feng, S., . . . Lin, C. (2015). Effects of rapamycin against paraquat-induced pulmonary fibrosis in mice. Journal of Zhejiang University-SCIENCE B, 16 (1), 52-61. Stokes, M., Patel, P., & Abdijadid, S. (2024). Disulfiram StatPearls [Internet] : StatPearls Publishing. Subbiah, R., & Tiwari, R. R. (2021). The herbicide paraquat-induced molecular mechanisms in the development of acute lung injury and lung fibrosis. Critical reviews in Toxicology, 51 (1), 36-64. Suthakaran, S., Singh, D., Deshmukh, R. K., & Das, A. (2022). Targeting Epithelial-to-Mesenchymal Transition for Breast Cancer Stem Cells Therapeutics Handbook of Oxidative Stress in Cancer: Therapeutic Aspects (pp. 2539-2563): Springer. Wang, X., Yang, S., Ye, H., Chen, J., Shi, L., Feng, L., . . . Xiao, W. (2022). Disulfiram exerts antiadipogenic, anti-inflammatory, and antifibrotic therapeutic effects in an in vitro model of Graves' orbitopathy. Thyroid, 32 (3), 294-305. Wang, X., Ye, H., Yang, S., Sha, X., Wang, X., Zhang, T., . . . Yang, H. (2022). Disulfiram exerts antifibrotic and anti-inflammatory therapeutic effects on perimysial orbital fibroblasts in Graves’ orbitopathy. International Journal of Molecular Sciences, 23 (9), 5261. Wu, X., Xu, H., Zhang, Z., Ma, Z., Zhang, L., Wang, C., . . . Chen, M. (2025). Disulfiram alleviates MTX-induced pulmonary fibrosis by inhibiting EMT in Type 2 alveolar epithelial cells. Lung, 203 (1), 4. Yamada, A., Aki, T., Unuma, K., Funakoshi, T., & Uemura, K. (2015). Paraquat induces epithelial-mesenchymal transition-like cellular response resulting in fibrogenesis and the prevention of apoptosis in human pulmonary epithelial cells. PLoS One, 10 (3), e0120192. Yang, X.-M., Wu, Z., Wang, X., Zhou, Y., Zhu, L., Li, D., . . . Ma, X. (2022). Disulfiram inhibits liver fibrosis in rats by suppressing hepatic stellate cell activation and viability. BMC Pharmacology and Toxicology, 23 (1), 54. Yang, Z., Guo, F., Albers, A. E., Sehouli, J., & Kaufmann, A. M. (2019). Disulfiram modulates ROS accumulation and overcomes synergistically cisplatin resistance in breast cancer cell lines. Biomedicine & Pharmacotherapy, 113 , 108727. Yang, Z., Sun, Z., Liu, H., Ren, Y., Shao, D., Zhang, W., . . . Nie, S. (2015). Connective tissue growth factor stimulates the proliferation, migration and differentiation of lung fibroblasts during paraquat‑induced pulmonary fibrosis. Molecular medicine reports, 12 (1), 1091-1097. Zhang, Z., Wang, G., Li, Y., Lei, D., Xiang, J., Ouyang, L., . . . Yang, J. (2022). Recent progress in DNA methyltransferase inhibitors as anticancer agents. Frontiers in Pharmacology, 13 , 1072651. Zhao, Q., Shao, T., Zhu, Y., Zong, G., Zhang, J., Tang, S., . . . Xu, Y. (2023). An MRTF-A–ZEB1–IRF9 axis contributes to fibroblast–myofibroblast transition and renal fibrosis. Experimental & molecular medicine, 55 (5), 987-998. Additional Declarations No competing interests reported. Supplementary Files Graphicalabstract.docx Cite Share Download PDF Status: Published Journal Publication published 18 Sep, 2025 Read the published version in Journal of Molecular Histology → Version 1 posted Editorial decision: Revision requested 08 Aug, 2025 Reviews received at journal 08 Aug, 2025 Reviews received at journal 04 Aug, 2025 Reviewers agreed at journal 29 Jul, 2025 Reviewers agreed at journal 28 Jul, 2025 Reviewers invited by journal 28 Jul, 2025 Editor assigned by journal 28 Jul, 2025 Submission checks completed at journal 28 Jul, 2025 First submitted to journal 26 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7218465","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":492625910,"identity":"0667c0cc-9f4c-4ac3-9d1d-60997e428dce","order_by":0,"name":"Fatemeh Karimzadeh","email":"","orcid":"","institution":"Babol University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Fatemeh","middleName":"","lastName":"Karimzadeh","suffix":""},{"id":492625911,"identity":"c3989f11-2454-4f6a-b745-1c880244dcd2","order_by":1,"name":"Zahra Babazadeh","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCElEQVRIiWNgGAWjYDACCQY2EMXYIMHYYJBgYANiNx4gUgtzQ8GHijQwm1gt7A0fZ5w5DBbEq0V+dvOzBz/+2Mn2Szc2buZtO2+3tv0w0JYam2hcWhjnHDM37OFJNp4552CzMW/b7eRtZxKBWo6l5Tbg0MIskWAmwSPBnLjhRmIbWIvZAaAWxobDOLWwSaR/k/xjUJ+4/0Zi+2/etnPJZucf4tfCI5FjJs2TcDhxg0Rig+GMMwfszG4QsEVC5ky5scyB48YzgCoNPlQkJ5jdANqSgMcv8rPbtz1886datn9G+gNgVNrZm51Pf/jgQ40NTi0YIBGsMoFY5SBgT4riUTAKRsEoGBkAAC45afoW5XUOAAAAAElFTkSuQmCC","orcid":"","institution":"Babol University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Zahra","middleName":"","lastName":"Babazadeh","suffix":""},{"id":492625912,"identity":"75039023-0edb-49e1-a305-e5efe8084f8c","order_by":2,"name":"Abdolreza Daraei","email":"","orcid":"","institution":"Babol University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Abdolreza","middleName":"","lastName":"Daraei","suffix":""},{"id":492625913,"identity":"42d5951f-a406-49c2-a6e8-35a026116f1a","order_by":3,"name":"Ebrahim Zabihi-Neyshaburi","email":"","orcid":"","institution":"Babol University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Ebrahim","middleName":"","lastName":"Zabihi-Neyshaburi","suffix":""},{"id":492625914,"identity":"72c4bea9-f5cd-40bb-be52-03aac86b6483","order_by":4,"name":"Farideh Feizi","email":"","orcid":"","institution":"Babol University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Farideh","middleName":"","lastName":"Feizi","suffix":""},{"id":492625915,"identity":"e95034f8-5c79-48ee-8e8d-4d0fb159131f","order_by":5,"name":"Mohammad Ranaee","email":"","orcid":"","institution":"Babol University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"","lastName":"Ranaee","suffix":""},{"id":492625918,"identity":"b496278d-d74b-4c73-91a0-d2af64f5934a","order_by":6,"name":"Soraya Khafri","email":"","orcid":"","institution":"Babol University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Soraya","middleName":"","lastName":"Khafri","suffix":""},{"id":492625919,"identity":"61e6844d-0fb8-4050-bc7d-a1fe45b71f7b","order_by":7,"name":"Zohre Esmaeili","email":"","orcid":"","institution":"Babol University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Zohre","middleName":"","lastName":"Esmaeili","suffix":""}],"badges":[],"createdAt":"2025-07-26 04:53:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7218465/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7218465/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10735-025-10613-1","type":"published","date":"2025-09-18T15:57:10+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":87940840,"identity":"6d97519b-2438-498e-a0cf-d49f07b8ca33","added_by":"auto","created_at":"2025-07-30 15:15:54","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":100487,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of the mean (±SEM) severity of inflammation, congestion, interstitial hemorrhage, alveolar thickness, and fibrosis in different groups of lungs.\u003c/p\u003e\n\u003cp\u003e*, # (P ≤ 0.05); **, ## (P ≤ 0.001); ***, ### (P ≤ 0.0005); and ****, #### (P ≤ 0.0001)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7218465/v1/65fb265d2d447b7dc50ed520.png"},{"id":87942118,"identity":"828e0e73-2104-4e0e-8be6-9891ec4cb927","added_by":"auto","created_at":"2025-07-30 15:31:54","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":911393,"visible":true,"origin":"","legend":"\u003cp\u003eHematoxylin and eosin (H\u0026amp;E) stained lung sections demonstrating histopathological changes across treatment groups. a1-a2: Control group showing normal pulmonary architecture. b1-b2: Oil-treated group maintaining intact alveolar structure. c1-c2: Paraquat (PQ)-treated group exhibiting severe pathological alterations. d1-d2: D100-treated group showing intermediate pathology. e1-e2: PQ+Oil-treated group displaying similar damage to PQ alone. f1-f2: PQ+D1-treated group demonstrating partial protection. g1-g2: PQ+D10-treated group revealing optimal therapeutic effects. h1-h2: PQ+D100-treated group showing limited improvement.\u003c/p\u003e\n\u003cp\u003eYellow arrows: Alveolar walls (noticeably thickened in PQ group, normalized in PQ+D10 group). Blue arrows: Vascular congestion and hemorrhage. Yellow stars: Inflammatory cell infiltrates. Magnification: a1-h1 (10×), a2-h2 (40×). Scale bar = 50 µm.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7218465/v1/e267a74a768d374f920ac67b.png"},{"id":87940841,"identity":"92b6a23e-dd08-4357-91c8-a7d9ebef53a1","added_by":"auto","created_at":"2025-07-30 15:15:54","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":953352,"visible":true,"origin":"","legend":"\u003cp\u003eMallory's trichrome-stained lung sections illustrating fibrotic progression across treatment groups.\u003c/p\u003e\n\u003cp\u003ea1-a2: Control group showing normal lung architecture with thin alveolar septa. b1-b2: Oil-treated control maintaining physiological tissue organization. c1-c2: Paraquat (PQ)-treated group exhibiting extensive fibrotic remodeling with thickened septa. d1-d2: D100-treated group displaying focal fibrotic lesions (arrows). e1-e2: PQ+Oil-treated group demonstrating comparable fibrosis to PQ alone. f1-f2: PQ+D1-treated group showing partial attenuation of fibrotic changes. g1-g2: PQ+D10-treated group revealing near-complete prevention of fibrotic deposition. h1-h2: PQ+D100-treated group exhibiting persistent fibrotic pathology.\u003c/p\u003e\n\u003cp\u003eRed arrows: Mark areas of collagen fibers in fibrotic alveolar wall thickening (prominent in PQ group, minimal in PQ+D10 group). All images acquired at two magnifications: a1-h1 (10× overview), a2-h2 (40× detail). Scale bar = 50 µm.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7218465/v1/e110f9d3653885075549b61e.png"},{"id":87941764,"identity":"c4055ed1-8e61-4765-b5b9-aabfb81862c5","added_by":"auto","created_at":"2025-07-30 15:23:54","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":15430,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of the mean ± SEM of gene expression (ZEB1) levels in studied groups relative to the PQ-received group\u003c/p\u003e\n\u003cp\u003e* (P ≤ 0.05); ** (P ≤ 0.005); and ***(P ≤ 0.001).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7218465/v1/5070089aa46124c4d30c81a1.png"},{"id":91889778,"identity":"d174e70c-1497-48c8-8e3f-ca9439a8da7b","added_by":"auto","created_at":"2025-09-22 16:01:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2890455,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7218465/v1/85a83769-ddc5-4b42-93c2-7d4f564459d2.pdf"},{"id":87941766,"identity":"abd1e2bb-82e2-46ff-a464-1d84ecbed740","added_by":"auto","created_at":"2025-07-30 15:23:54","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":576662,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicalabstract.docx","url":"https://assets-eu.researchsquare.com/files/rs-7218465/v1/2e1842e5595ad2e9d97be7d1.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Repurposing Disulfiram: A Promising Antifibrotic Strategy Against Paraquat-Induced Pulmonary Fibrosis","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePulmonary fibrosis (PF) is a chronic, fatal condition characterized by progressive lung tissue destruction through persistent inflammation, fibroblast proliferation, excessive extracellular matrix (ECM) deposition, and architectural remodeling (Mei, Liu, Zuo, Yang, \u0026amp; Qu, \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). Despite current therapeutic options, patient prognosis remains poor, with a median survival of 3\u0026ndash;5 years due to treatment limitations (Glass et al., \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). The complex pathogenesis of PF involves interconnected pathways, including ion dysregulation, immune cell activation, epigenetic modifications, and aberrant cytokine signaling (Ebrahimi Naghani, Javadi, Rashidinooshabadi, Godarzi, \u0026amp; Houshmand, \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e; King, Pardo, \u0026amp; Selman, \u003cspan class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eParaquat (PQ), a bipyridyl herbicide banned in many industrialized countries yet still used in developing regions, is utilized to model PF due to its well-characterized mechanisms of ROS-mediated lipid peroxidation, mitochondrial dysfunction, and apoptosis (J. Liu, Lv, Ma, Yang, \u0026amp; Zhang, \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e; Yamada, Aki, Unuma, Funakoshi, \u0026amp; Uemura, \u003cspan class=\"CitationRef\"\u003e2015\u003c/span\u003e). PQ selectively accumulates in type II pneumocytes via the polyamine transport system, reaching concentrations up to tenfold higher than systemic levels and inducing endoplasmic reticulum (ER) stress-mediated apoptosis, which impairs epithelial regeneration and triggers fibroblast activation and ECM deposition. Notably, effective antidotes against PQ-induced fibrosis remain unavailable despite emerging immunosuppressive strategies (Chen et al., \u003cspan class=\"CitationRef\"\u003e2013\u003c/span\u003e; Khazraei, Marashi, \u0026amp; Sanaei-Zadeh, \u003cspan class=\"CitationRef\"\u003e2019\u003c/span\u003e; L. Li, Lv, Li, \u0026amp; Liu, \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e; Palipoch et al., \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e; Salton, Volpe, \u0026amp; Confalonieri, \u003cspan class=\"CitationRef\"\u003e2019\u003c/span\u003e)\u003c/p\u003e\n\u003cp\u003eA key driver of fibrogenesis is epithelial-to-mesenchymal transition (EMT), a biological process wherein epithelial cells lose polarity and intercellular adhesion, acquiring mesenchymal traits that promote migration, invasion, and resistance to apoptosis. EMT is orchestrated by transcription factors, including zinc finger E-box-binding homeobox 1 (ZEB1), which suppress epithelial markers like E-cadherin while upregulating mesenchymal genes such as N-cadherin and vimentin (Saitoh, \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e). ZEB1 is highly expressed in alveolar epithelium near fibrotic lesions, suggesting its critical involvement in early fibrogenesis and its potential as a therapeutic target in PF (Z. Huang, Zhang, Zhou, Liu, \u0026amp; Huang, \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e; Runyan \u0026amp; Savagner, \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eDisulfiram (DSF), an FDA-approved medication traditionally used for alcohol dependence (Mutschler, Grosshans, Soyka, \u0026amp; R\u0026ouml;sner, \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e), has recently gained attention for its antifibrotic properties across various organ systems. DSF is known to inhibit enzymes, induce apoptosis in cancer cells via DNA methyltransferase inhibition, and modulate epigenetic and signaling pathways (Conticello et al., \u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e; Zhang et al., \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). Recent studies indicate that DSF can suppress EMT and myofibroblast activation by targeting TGF-\u0026beta;/ERK/NF-\u0026kappa;B/Snail pathways, thereby reducing excessive collagen deposition and ECM remodeling during fibrosis progression (Han et al., \u003cspan class=\"CitationRef\"\u003e2015\u003c/span\u003e; Suthakaran, Singh, Deshmukh, \u0026amp; Das, \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). In preclinical models of PF, DSF has been shown to improve lung compliance and reduce collagen deposition in bleomycin-induced fibrosis through inhibition of macrophage migration by blocking FROUNT, a mediator of CCR2/CCR5 signaling (Okabe et al., \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e; Sato et al., \u003cspan class=\"CitationRef\"\u003e2024\u003c/span\u003e). Additionally, DSF suppresses hepatic stellate cell activation in liver fibrosis and influences prostaglandin E2 biosynthesis, highlighting its broad antifibrotic potential (C. Li, Pei, Zheng, Cao, \u0026amp; Ren, \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e; X.-M. Yang et al., \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eGiven that PQ-induced PF is driven by ROS-mediated injury and EMT activation, and considering DSF\u0026apos;s antioxidant, anti-inflammatory, and EMT-inhibitory effects, evaluating DSF in this model is particularly relevant. Despite promising antifibrotic effects in other models, the role of DSF in PQ-induced pulmonary fibrosis, a clinically and mechanistically significant model of lung fibrosis, remains unexplored.\u003c/p\u003e\n\u003cp\u003eTherefore, this study aimed to investigate the protective and antifibrotic effects of disulfiram against paraquat-induced pulmonary fibrosis, providing insights into its potential as a repurposed therapeutic agent for fibrotic lung diseases.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cb\u003eAnimal Care\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThis study was conducted on 40 male Wistar rats weighing 180–220 g, housed in the Animal House of Babol University of Medical Sciences for 21 days. Animals were maintained under standard laboratory conditions (23 ± 3°C, 50–60% humidity, 12-hour light/dark cycle) with proper ventilation and ad libitum access to food and water. All experimental procedures were performed in compliance with institutional and national guidelines for the care and use of laboratory animals under the supervision of the Research Ethics Committee of Babol University of Medical Sciences (Approval Code: IR.MUBABOL.HRI.REC.1398.247).\u003c/p\u003e\u003cp\u003e\u003cb\u003eStudy Design and Experimental Groups\u003c/b\u003e\u003c/p\u003e\u003cp\u003ePulmonary fibrosis was induced by a single oral gavage of paraquat (PQ) at 40 mg/kg dissolved in 800 µL sterile saline on day 1 (Guo et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Disulfiram (DSF) was prepared in sesame oil and administered intraperitoneally in varying doses (1, 10, and 100 mg/kg) at a volume of 400 µL daily for 21 days based on body weight (Hamidi et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe animals were randomly divided into \u003cb\u003eeight groups (n = 5 per group)\u003c/b\u003e as follows:\u003c/p\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003eControl: 800 µL sterile saline via gavage (day 1)\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003eVehicle Control: 400 µL sesame oil (IP) for 21 days\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003ePQ: PQ 40 mg/kg in 800 µL saline via gavage (day 1)\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003eDSF: DSF 100 mg/kg in 400 µL sesame oil (IP) for 21 days\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003ePQ + Vehicle: PQ via gavage (day 1) + sesame oil (IP) for 21 days\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003ePQ + DSF 1: PQ via gavage (day 1) + DSF 1 mg/kg (IP) for 21 days\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003ePQ + DSF 10: PQ via gavage (day 1) + DSF 10 mg/kg (IP) for 21 days\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003ePQ + DSF 100: PQ via gavage (day 1) + DSF 100 mg/kg (IP) for 21 days\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003cp\u003eFollowing the treatment period, animals were sacrificed, and their lungs were harvested for further analysis.\u003c/p\u003e\u003cp\u003e\u003cb\u003eSample Collection\u003c/b\u003e\u003c/p\u003e\u003cp\u003eA small section of the apical region of the right lung was separated and immediately stored at − 80°C for gene expression analysis using real-time PCR. The remaining parts of the lungs were divided into apical, middle, and basal sections and fixed in 10% neutral buffered formalin for 72 hours for histopathological examination.\u003c/p\u003e\u003cp\u003e\u003cb\u003eHistopathological Analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFormalin-fixed lung tissues were processed using graded alcohols and xylene, embedded in paraffin, and sectioned at 5 µm thickness. Sections were stained with hematoxylin and eosin (H\u0026amp;E) to assess general histopathological changes and with Mallory’s trichrome staining to evaluate collagen deposition and fibrosis.\u003c/p\u003e\u003cp\u003eHistopathological parameters, including inflammation (perivascular, peribronchial, and interstitial), alveolar wall thickening, hemorrhage, and vascular congestion, were evaluated using H\u0026amp;E staining. The severity of lesions was graded as:\u003c/p\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003e0–10% (Grade 0)\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003e10–25% (Grade 1)\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003e25–50% (Grade 2)\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003e50–75% (Grade 3)\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003e75–100% (Grade 4) (Park et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003cp\u003eFibrosis was graded using the Ashcroft scoring system based on Mallory’s trichrome staining (Ashcroft, Simpson, \u0026amp; Timbrell, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1988\u003c/span\u003e). All slides were evaluated under a light microscope by three independent blinded observers, and inter-observer discrepancies were resolved through discussion.\u003c/p\u003e\u003cp\u003e\u003cb\u003eGene Expression Analysis (ZEB1)\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTotal RNA was extracted from the apical portion of the right lung using a Total RNA Extraction Kit (Pars Tous, Iran) following the manufacturer’s instructions. RNA concentration and purity were assessed using a NanoDrop spectrophotometer. Complementary DNA (cDNA) was synthesized using a cDNA synthesis kit (Yekta Tajhiz Azma, Iran).\u003c/p\u003e\u003cp\u003eReal-time PCR was performed using SYBR Green Master Mix (Biofact, Korea) in a StepOnePlus Real-Time PCR System (Applied Biosystems, USA). The thermal cycling conditions included initial denaturation at 95°C for 10 min, followed by 40 cycles of Denaturation: 95°C for 15 s, Annealing: 60°C for 30s, and Extension: 30s. Each reaction (20 µL) contained 10 µL SYBR Green mix, 0.5 µL of each primer (10 µM), 2 µL cDNA, and 7 µL nuclease-free water. All reactions were performed in triplicate.\u003c/p\u003e\u003cp\u003eRelative gene expression levels of \u003cb\u003eZEB1\u003c/b\u003e were calculated using the 2^(-ΔΔCt) method with \u003cb\u003eGAPDH\u003c/b\u003e as the internal reference. Primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer Sequences Used for Real time PCR\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer Sequence (5'→3')\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eZEB1-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGGCATATACATACTCCGCTAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eZEB1-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTCCTTCTGAGCTAGTGTCTTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCTTCCGTGTTCCTACCCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCCCAGGATGCCCTTTAGTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eStatistical analyses were conducted using GraphPad Prism 9.0.0. One-way analysis of variance (ANOVA) was used for gene expression data, and the Kruskal-Wallis test was applied for histopathological scores. A p-value ≤ 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eHistopathological Alterations Induced by PQ\u003c/b\u003e\u003c/p\u003e\u003cp\u003ePQ administration induced significant histopathological damage, including marked inflammatory cell infiltration, severe vascular congestion\u0026thinsp;+\u0026thinsp;Hemorrhage, alveolar septal thickening, and extensive fibrotic deposition (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 for all parameters vs. controls). The PQ\u0026thinsp;+\u0026thinsp;Oil group exhibited similar damage to the PQ group (p\u0026thinsp;\u0026gt;\u0026thinsp;0.9999), confirming the vehicle\u0026rsquo;s neutrality (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTherapeutic Efficacy of Disulfiram\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTreatment with disulfiram demonstrated dose-dependent mitigation of PQ-induced lung injury:\u003c/p\u003e\u003cp\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003e\u003cb\u003eInflammatory Response\u003c/b\u003e: PQ\u0026thinsp;+\u0026thinsp;D1 (2.53\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18) and PQ\u0026thinsp;+\u0026thinsp;D10 (1.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16) significantly reduced inflammation compared to PQ (p\u0026thinsp;=\u0026thinsp;0.0116 and p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, respectively).\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003e\u003cb\u003eVascular Congestion and Hemorrhage\u003c/b\u003e: PQ\u0026thinsp;+\u0026thinsp;D1 (2.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14) and PQ\u0026thinsp;+\u0026thinsp;D10 (0.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08) reduced congestion (p\u0026thinsp;=\u0026thinsp;0.0010 and p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, respectively).\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003e\u003cb\u003eAlveolar Wall Thickening\u003c/b\u003e: PQ\u0026thinsp;+\u0026thinsp;D1 (2.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19) and PQ\u0026thinsp;+\u0026thinsp;D10 (1.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16) significantly attenuated septal thickening (both p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001).\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003e\u003cb\u003eFibrosis\u003c/b\u003e: All treatment groups showed antifibrotic activity, following:\u003c/p\u003e\u003cp\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003ePQ\u0026thinsp;+\u0026thinsp;D10 (1.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001)\u0026thinsp;\u0026gt;\u0026thinsp;PQ\u0026thinsp;+\u0026thinsp;D1 (4.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001)\u0026thinsp;\u0026gt;\u0026thinsp;PQ\u0026thinsp;+\u0026thinsp;D100 (5.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26; p\u0026thinsp;=\u0026thinsp;0.0362) vs. PQ.\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e\u003cp\u003eNotably, high-dose PQ\u0026thinsp;+\u0026thinsp;D100 exhibited limited protective effects across parameters, with non-significant differences in inflammation (p\u0026thinsp;\u0026gt;\u0026thinsp;0.9999), congestion (p\u0026thinsp;=\u0026thinsp;0.1948), and alveolar thickness (p\u0026thinsp;=\u0026thinsp;0.5896) versus PQ, indicating potential dose-related toxicity.\u003c/p\u003e\u003cp\u003e\u003cb\u003eInter-group comparisons revealed\u003c/b\u003e:\u003c/p\u003e\u003cp\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003ePQ\u0026thinsp;+\u0026thinsp;D10 was superior to PQ\u0026thinsp;+\u0026thinsp;D100 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001).\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003ePQ\u0026thinsp;+\u0026thinsp;D10 exhibited lower inflammatory infiltration (p\u0026thinsp;=\u0026thinsp;0.0448) and vascular congestion (p\u0026thinsp;=\u0026thinsp;0.0062) than PQ\u0026thinsp;+\u0026thinsp;D1, while alveolar thickness was comparable (p\u0026thinsp;=\u0026thinsp;0.7253). (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea-d)\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e\u003cp\u003eHistopathological evaluation (H\u0026amp;E and Mallory\u0026rsquo;s trichrome staining) corroborated these findings, illustrating marked attenuation of PQ-induced alveolar thickening, inflammation, and fibrosis in the PQ\u0026thinsp;+\u0026thinsp;D10 group (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Notably, PQ\u0026thinsp;+\u0026thinsp;D10 demonstrated near-complete restoration of alveolar architecture with minimal fibrosis, while PQ\u0026thinsp;+\u0026thinsp;D100 paradoxically exacerbated fibrotic remodeling, suggesting a narrow therapeutic window for disulfiram. (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e)\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eRegional Distribution of Protective Effects\u003c/b\u003e\u003c/p\u003e\u003cp\u003eRegional histopathological assessment demonstrated consistent therapeutic efficacy of PQ\u0026thinsp;+\u0026thinsp;D10 across all lung regions (apex, middle, base), with significant improvement over PQ (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and other treatment regimens (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). While protection did not significantly differ between lung regions (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), a trend toward enhanced efficacy was observed in the basal region, indicating potential region-specific treatment responsiveness warranting further investigation (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Tables S2\u0026ndash;S4).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eComparative Therapeutic Efficacy Across Lung Regions (Apex, Middle, and Base)\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"7\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eParameter\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRegion\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePQ (Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePQ\u0026thinsp;+\u0026thinsp;D10 (Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eIQR Range (PQ vs Treatment)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eMR (PQ vs Treatment)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eRegional Difference\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003e\u003cb\u003eInflammation\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eApex\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e3.867\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09085\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e1.533\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2153\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e(4, 4) vs (1, 2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e302.1 vs 137.0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eBase\u0026thinsp;\u0026lt;\u0026thinsp;Apex\u0026thinsp;=\u0026thinsp;middle\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMiddle\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e3.933\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06667\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e1.533\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2153\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e(4, 4) vs (1, 2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e307.6 vs 137.0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eBase\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e3.733\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1182\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e0.8667\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2153\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e(3, 4) vs (0, 2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e291.3 vs 98.37\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003e\u003cb\u003eCongestion\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eApex\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e3.900\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e0.7000\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1528\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e(4, 4) vs (0, 1)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e205.8 vs 65.45\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eApex\u0026thinsp;=\u0026thinsp;Middle\u0026thinsp;\u0026lt;\u0026thinsp;Base\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMiddle\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e3.900\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e0.7000\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1528\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e(4, 4) vs (0, 1)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e205.8 vs 65.45\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eBase\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e3.800\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1333\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e0.8000\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1333\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e(3.75, 4) vs (0.75, 1)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e200.5 vs 70.30\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003e\u003cb\u003eAlveolar Wall\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eApex\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e4.000\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e1.800\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e(4, 4) vs (1.5, 2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e107.0 vs 50.30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eBase\u0026thinsp;\u0026lt;\u0026thinsp;Middle\u0026thinsp;\u0026lt;\u0026thinsp;Apex\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMiddle\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e4.000\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e1.200\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4899\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e(4, 4) vs (0, 2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e107.0 vs 39.00\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eBase\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e4.000\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e1.000\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4472\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e(4, 4) vs (0, 2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e107.0 vs 36.30\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003e\u003cb\u003eFibrosis\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eApex\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e7.800\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e1.800\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1633\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e(7.5, 8) vs\u003c/p\u003e\u003cp\u003e(1.6, 2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e117.7 vs 45.50\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eBase\u0026thinsp;\u0026lt;\u0026thinsp;Middle\u0026thinsp;\u0026lt;\u0026thinsp;Apex\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMiddle\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e8.000\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e1.400\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e(8, 8) vs (0.5, 2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e121.0 vs 40.40\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eBase\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e7.800\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e1.067\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3712\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e(7.5, 8) vs (0, 2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e117.7 vs 35.33\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"7\"\u003eThere is no significant regional.\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eModulation of ZEB1 Gene Expression\u003c/b\u003e\u003c/p\u003e\u003cp\u003eReal-time PCR analysis revealed marked dysregulation of ZEB1 across experimental groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). PQ exposure significantly upregulated ZEB1 expression (6.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.78) versus control (1.22\u0026thinsp;\u0026plusmn;\u0026thinsp;0.46; p\u0026thinsp;=\u0026thinsp;0.0022) and oil groups (2.31\u0026thinsp;\u0026plusmn;\u0026thinsp;1.07; p\u0026thinsp;=\u0026thinsp;0.0213), indicating robust fibrotic signaling activation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eDisulfiram treatments significantly attenuated PQ-induced ZEB1 upregulation:\u003c/p\u003e\u003cp\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003ePQ\u0026thinsp;+\u0026thinsp;D1: 2.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.81 (p\u0026thinsp;=\u0026thinsp;0.0169 vs. PQ)\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003ePQ\u0026thinsp;+\u0026thinsp;D10: 0.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.37 (p\u0026thinsp;=\u0026thinsp;0.0011 vs. PQ)\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003ePQ\u0026thinsp;+\u0026thinsp;D100: 2.55\u0026thinsp;\u0026plusmn;\u0026thinsp;0.49 (p\u0026thinsp;=\u0026thinsp;0.0343 vs. PQ)\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e\u003cp\u003eD100 monotherapy (0.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07) showed no difference from controls (p\u0026thinsp;=\u0026thinsp;0.9986), while PQ\u0026thinsp;+\u0026thinsp;Oil remained comparable to PQ alone (p\u0026thinsp;=\u0026thinsp;0.9071).\u003c/p\u003e\u003cp\u003eAlthough inter-dose comparisons among disulfiram treatments were not statistically significant (p\u0026thinsp;\u0026gt;\u0026thinsp;0.88), a consistent efficacy gradient emerged (D10\u0026thinsp;\u0026gt;\u0026thinsp;D1\u0026thinsp;\u0026gt;\u0026thinsp;D100), suggesting dose-dependent modulation of ZEB1-mediated fibrotic signaling. (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e)\u003c/p\u003e\u003cp\u003eCollectively, these histopathological and molecular findings demonstrate that disulfiram, particularly at 10 mg/kg, effectively mitigates PQ-induced pulmonary fibrosis through anti-inflammatory, antifibrotic, and EMT-modulating mechanisms. The observed dose-dependent profile highlights the therapeutic potential of disulfiram while emphasizing the importance of optimal dosing to avoid potential toxicity at higher concentrations.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eFibrotic disorders, characterized by dysregulated extracellular matrix (ECM) deposition and persistent myofibroblast activation, are a global health concern (Dees, Chakraborty, \u0026amp; Distler, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Environmental toxins like paraquat, noted for environmental persistence and fibrogenic potential, remain key contributors to pulmonary fibrosis (Y. Huang, Zhan, Bhatt, \u0026amp; Chen, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Subbiah \u0026amp; Tiwari, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Acute paraquat poisoning typically follows a biphasic course, with initial symptom resolution followed by delayed pulmonary fibrosis and fatal respiratory failure (Khazraei et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eWe employed a single oral paraquat dose (40 mg/kg) to induce fibrosis within 21 days, consistent with prior studies reporting fibrosis within 14\u0026ndash;28 days: Silva et al. (i.p. 10 mg/kg; 14 days) (Rodrigues da Silva et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), Yang et al. (i.p. 30 mg/kg; 14/21 days) (Zhizhou Yang et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), Shao et al. (i.p. 10 mg/kg; 14/28 days) (Shao et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), and Khodayar et al. (oral 20 mg/kg; 21 days) (Khodayar et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). These findings align with Afzali et al.\u0026rsquo;s observation of delayed fibrogenesis within 2\u0026ndash;10 weeks (Afzali \u0026amp; Gholyaf, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2008\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eUnlike previous intraperitoneal models, we used oral gavage to clinically simulate secondary fibrosis after paraquat ingestion, reflecting human cases where patients initially recover post-ingestion but later develop fatal fibrosis. This clinically relevant model allows the investigation of antifibrotic therapies under conditions that closely mimic human paraquat poisoning, enhancing translational relevance while addressing the need for effective interventions in toxin-induced pulmonary fibrosis.\u003c/p\u003e\u003cp\u003eOur histopathological findings demonstrated that paraquat exposure led to severe inflammation, vascular congestion, and pronounced fibrosis, with significant alveolar wall thickening across all lung regions, consistent with previous reports by Palipoch et al., reflecting paraquat\u0026rsquo;s ability to generate reactive oxygen species (ROS), disrupt epithelial-endothelial barriers, and trigger inflammatory cascades, including IL-6, TNF-α, and IL-1β, leading to leukocyte infiltration, edema, and hemorrhage (Palipoch et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Rodrigues da Silva et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). These pathological events contribute to progressive fibrotic remodeling, aligning with the established biphasic trajectory of paraquat-induced lung injury.\u003c/p\u003e\u003cp\u003eCritically, our study revealed significant upregulation of ZEB1 gene expression in paraquat-exposed rats, supporting its pivotal role in fibrogenesis. ZEB1 facilitates fibroblast activation and fibroblast-to-myofibroblast transition (FMyT), fundamental to fibrosis progression across multiple organs, including the lung, kidney, and liver. In renal models, ZEB1 knockdown attenuates TGF-β-induced myofibroblast activation and fibrosis, highlighting its therapeutic potential (Hu et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Zhao et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In pulmonary fibrosis, ZEB1 stabilization by GTSE1 promotes epithelial-to-mesenchymal transition (EMT), while lncRNAs such as FEZF1-AS1 modulate ZEB1 via miR-200c-3p, further driving fibrogenesis (M. Liu, Song, Lai, Gao, \u0026amp; Man, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). These mechanisms collectively contribute to excessive collagen deposition and ECM remodeling during fibrosis. Importantly, targeting ZEB1 directly or its upstream modulators through strategies such as shRNA silencing, lncRNA interference, or small-molecule inhibitors has shown efficacy in reducing fibrosis severity in various preclinical models (M. Liu et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Menche et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Zhao et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Our findings thus corroborate the central role of ZEB1 in PQ-induced pulmonary fibrosis, suggesting that ZEB1 may serve as a valuable therapeutic target for mitigating fibrotic progression.\u003c/p\u003e\u003cp\u003eIn this study, we employed an oral paraquat-induced pulmonary fibrosis model to evaluate the antifibrotic potential of disulfiram (DSF), with a specific focus on ZEB1 gene expression as a fibrogenic marker. Our findings demonstrate that DSF effectively reduced ZEB1 gene expression and fibrotic pattern across all tested doses (1, 10, and 100 mg/kg), indicating its capacity to modulate key profibrotic signaling pathways at the molecular level and fibrotic pattern. Notably, significant improvements in histopathological parameters\u0026mdash;including inflammatory infiltration, vascular congestion, hemorrhage, and alveolar septal thickening\u0026mdash;were observed at the 1 and 10 mg/kg doses compared to paraquat-only and paraquat\u0026thinsp;+\u0026thinsp;oil groups, suggesting that gene expression modulation may precede and contribute to subsequent histopathological recovery.\u003c/p\u003e\u003cp\u003eHowever, the 100 mg/kg dose did not yield significant histopathological improvements despite reducing ZEB1 expression and fibrotic pattern, implying potential dose-limiting toxicity or suboptimal efficacy at this higher concentration. These findings highlight the importance of dose optimization in leveraging DSF's antifibrotic effects while minimizing potential adverse outcomes, underscoring the need for further studies to define the therapeutic window of DSF in paraquat-induced and idiopathic pulmonary fibrosis models.\u003c/p\u003e\u003cp\u003e Among the tested doses, 10 mg/kg of DSF demonstrated the most robust and pan-regional efficacy across all lung fields (Tables S2\u0026ndash;S4), markedly improving histopathological parameters throughout the apex, middle, and basal regions. In contrast, 1 mg/kg only reduced alveolar thickness in the apical region. The magnitude of improvement exhibited spatial variation, with optimal anti-fibrotic and anti-inflammatory effects in the basal region and superior reduction of vascular congestion in the apex/middle regions, consistent with ventilation-perfusion gradients (Koeppen \u0026amp; Stanton, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Comparative analyses further identified 10 mg/kg as the optimal therapeutic dose, significantly outperforming both 1 mg/kg and 100 mg/kg (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and achieving near-complete restoration of lung architecture (p\u0026thinsp;=\u0026thinsp;0.6265 vs. healthy controls). In contrast, the 100 mg/kg dose exhibited attenuated efficacy, potentially due to dose-dependent toxicity that may counteract its therapeutic benefits. Collectively, these findings emphasize that intermediate dosing of DSF maximizes antifibrotic outcomes while avoiding the limitations associated with subtherapeutic or excessively high doses, informing future translational efforts for effective antifibrotic interventions. (Tables S2\u0026ndash;S4)\u003c/p\u003e\u003cp\u003eSupporting our findings, previous studies reported DSF-mediated suppression of proinflammatory cytokines and epigenetic dysregulation in paraquat models, with 10 mg/kg demonstrating optimal efficacy in reducing fibrosis and inflammatory markers while restoring gene expression patterns (Hamidi et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eMechanistically, DSF\u0026rsquo;s antifibrotic effects are mediated by ALDH inhibition leading to cytotoxic aldehyde accumulation, oxidative stress, and apoptosis in activated fibroblasts (Zhi Yang, Guo, Albers, Sehouli, \u0026amp; Kaufmann, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). This disrupts EMT and fibroblast-to-myofibroblast differentiation pathways, reducing collagen deposition and fibrosis progression (Wu et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Our trichrome staining results confirm DSF's efficacy in reducing collagen deposition across lung regions, corroborating these mechanistic insights.\u003c/p\u003e\u003cp\u003eDisulfiram (DSF) has shown consistent antifibrotic efficacy across different organ systems, including the lungs, kidneys, liver, and orbital tissues, suggesting a shared mechanism that involves modulation of inflammatory and fibrotic pathways (C. Li et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Patil, Patil, Patel, \u0026amp; Kumar, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Wang, Ye, et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; X.-M. Yang et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In pulmonary fibrosis models, DSF has been reported to enhance PGE2 reactivation via COX-2 pathways, contributing to its antifibrotic effects (C. Li et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Additionally, its benefits in conditions such as Graves\u0026rsquo; orbitopathy further support its potential as a versatile antifibrotic agent (Wang, Yang, et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Wang, Ye, et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Collectively, these findings align with our results, underscoring the potential for repurposing DSF as a therapeutic option in managing paraquat-induced and idiopathic pulmonary fibrosis.\u003c/p\u003e\u003cp\u003eDespite these promising therapeutic effects, DSF\u0026rsquo;s adverse event profile\u0026mdash;encompassing hepatotoxicity, neurological complications, and hypersensitivity reactions\u0026mdash;remains a critical barrier for its chronic use as an antifibrotic agent, requiring careful safety monitoring and individualized risk-benefit analysis for clinical application (Lanz et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Stokes, Patel, \u0026amp; Abdijadid, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). These concerns underscore the necessity to determine not only the most effective dose but also the optimal treatment duration of DSF to balance maximal antifibrotic efficacy with minimal toxicity, thereby ensuring safe clinical translation. Emerging evidence indicates that both dosing and treatment duration significantly influence antifibrotic therapy outcomes in pulmonary fibrosis, affecting the resolution of inflammation, reversal of fibrotic remodeling, and the incidence of adverse events (Chan et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Therefore, future translational research, including well-structured clinical trials, is essential to validate the long-term safety, ideal dosing strategies, and therapeutic potential of DSF in managing paraquat-induced and idiopathic pulmonary fibrosis.\u003c/p\u003e\u003cp\u003e\u003cb\u003eStrengths and Limitations\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThis study highlights the potential of disulfiram as a repurposed antifibrotic agent in paraquat-induced pulmonary fibrosis, demonstrating dose-dependent efficacy, mechanistic modulation of ZEB1 expression, and histopathological improvements across various lung regions. The study\u0026rsquo;s methodological strengths, including dose stratification, comprehensive blinded histopathological analysis, and mechanistic gene expression evaluation, enhance the reliability of the findings. However, this study has some limitations that should be acknowledged. First, while we assessed ZEB1 mRNA expression using Real-time PCR in paraquat-induced pulmonary fibrosis, we did not perform protein-level validation using Western blot or immunohistochemistry (IHC) due to budgetary and technical limitations at the end of the project. Protein-level evaluation would have strengthened the mechanistic interpretation of ZEB1\u0026rsquo;s role in fibrosis progression and therapeutic modulation by disulfiram.\u003c/p\u003e\u003cp\u003eAdditionally, although our histopathological evaluation was comprehensive and region-specific, the absence of additional fibrotic markers such as α-SMA or collagen I/III protein expression limits a deeper molecular characterization of fibrotic remodeling. Future studies will address these limitations by incorporating protein-level analyses and mechanistic pathway evaluations to further validate the antifibrotic effects of disulfiram and clarify its precise mode of action in paraquat-induced pulmonary fibrosis.\u003c/p\u003e\u003cp\u003eDespite these limitations, the current findings provide robust and regionally consistent evidence supporting disulfiram\u0026rsquo;s antifibrotic efficacy and establish a strong foundation for subsequent molecular investigations.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, our study demonstrates that disulfiram, particularly at a dose of 10 mg/kg, effectively mitigates PQ-induced pulmonary fibrosis by reducing inflammation, attenuating ZEB1-mediated fibrogenic signaling, and preserving lung architecture. These findings position DSF as a promising candidate for repurposing as an antifibrotic agent, offering a potential therapeutic strategy for managing PQ-induced and other forms of pulmonary fibrosis. However, translating these findings into clinical practice will require further research to establish the safety, efficacy, and optimal dosing strategies of DSF in human subjects, paving the way for the development of effective antifibrotic therapies aimed at improving patient outcomes in fibrotic lung diseases.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors gratefully acknowledge the support of Babol University of Medical Sciences and express their appreciation to all individuals who contributed to the successful completion of this research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was financially supported by the Vice-Chancellery for Research and Technology of Babol University of Medical Sciences.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval and Consent to Participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study protocol was reviewed and approved by the Ethics Committee of Babol University of Medical Sciences (Approval Code: IR.MUBABOL.HRI.REC.1398.247).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eUse of AI-Assisted Tools\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePortions of this manuscript were prepared using AI-assisted tools (ChatGPT Plus) to refine academic language and improve structural clarity. All AI-generated content was thoroughly reviewed and edited by the authors. No AI tools were used for data analysis or result generation. The authors assume full responsibility for the accuracy and integrity of the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAfzali, S., \u0026amp; Gholyaf, M. (2008). The effectiveness of combined treatment with methylprednisolone and cyclophosphamide in oral paraquat poisoning.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eAshcroft, T., Simpson, J. M., \u0026amp; Timbrell, V. (1988). Simple method of estimating severity of pulmonary fibrosis on a numerical scale. \u003cem\u003eJournal of clinical pathology, 41\u003c/em\u003e(4), 467-470.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eChan, P., Bax, L., Chen, C., Zhang, N., Huang, S. P., Soares, H., . . . AbuTarif, M. (2017). Model‐based meta‐analysis on the efficacy of pharmacological treatments for idiopathic pulmonary fibrosis. \u003cem\u003eCPT: pharmacometrics \u0026amp; systems pharmacology, 6\u003c/em\u003e(10), 695-704.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eChen, Y., Nie, Y.-c., Luo, Y.-l., Lin, F., Zheng, Y.-f., Cheng, G.-h., . . . Shen, J.-g. (2013). Protective effects of naringin against paraquat-induced acute lung injury and pulmonary fibrosis in mice. \u003cem\u003eFood and Chemical Toxicology, 58\u003c/em\u003e, 133-140.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eConticello, C., Martinetti, D., Adamo, L., Buccheri, S., Giuffrida, R., Parrinello, N., . . . Cavalli, M. (2012). Disulfiram, an old drug with new potential therapeutic uses for human hematological malignancies. \u003cem\u003eInternational journal of cancer, 131\u003c/em\u003e(9), 2197-2203.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eDees, C., Chakraborty, D., \u0026amp; Distler, J. H. (2021). Cellular and molecular mechanisms in fibrosis. \u003cem\u003eExperimental Dermatology, 30\u003c/em\u003e(1), 121-131.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eEbrahimi Naghani, E., Javadi, I., Rashidinooshabadi, M., Godarzi, M., \u0026amp; Houshmand, G. (2016). Protective effects of hydroalcoholic extract of Hypericum perforatum against bleomycin-induced pulmonary fibrosis in rats. \u003cem\u003eJournal of Babol University of Medical Sciences, 18\u003c/em\u003e(1), 44-51.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eGlass, D. S., Grossfeld, D., Renna, H. A., Agarwala, P., Spiegler, P., DeLeon, J., \u0026amp; Reiss, A. B. (2022). Idiopathic pulmonary fibrosis: Current and future treatment. \u003cem\u003eThe clinical respiratory journal, 16\u003c/em\u003e(2), 84-96.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eGuo, F., Sun, Y., Su, L., Li, S., Liu, Z., Li, J., . . . Li, J. (2015). Losartan attenuates paraquat-induced pulmonary fibrosis in rats. \u003cem\u003eHuman \u0026amp; Experimental Toxicology, 34\u003c/em\u003e(5), 497-505.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eHamidi, N., Feizi, F., Azadmehr, A., Zabihi, E., Khafri, S., Zarei-Behjani, Z., \u0026amp; Babazadeh, Z. (2023). Disulfiram ameliorates bleomycin induced pulmonary inflammation and fibrosis in rats. \u003cem\u003eBiotechnic \u0026amp; Histochemistry, 98\u003c/em\u003e(8), 584-592.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eHan, D., Wu, G., Chang, C., Zhu, F., Xiao, Y., Li, Q., . . . Zhang, L. (2015). Disulfiram inhibits TGF-\u0026beta;-induced epithelial-mesenchymal transition and stem-like features in breast cancer via ERK/NF-\u0026kappa;B/Snail pathway. \u003cem\u003eOncotarget, 6\u003c/em\u003e(38), 40907.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eHu, J.-Q., Zheng, D.-C., Huang, L., Yang, X., Ning, C.-Q., Zhou, J., . . . Xie, Y. (2024). Suppression of ZEB1 by Ethyl caffeate attenuates renal fibrosis via switching glycolytic reprogramming. \u003cem\u003ePharmacological Research, 209\u003c/em\u003e, 107407.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eHuang, Y., Zhan, H., Bhatt, P., \u0026amp; Chen, S. (2019). Paraquat degradation from contaminated environments: current achievements and perspectives. \u003cem\u003eFrontiers in Microbiology, 10\u003c/em\u003e, 1754.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eHuang, Z., Zhang, Z., Zhou, C., Liu, L., \u0026amp; Huang, C. (2022). Epithelial\u0026ndash;mesenchymal transition: The history, regulatory mechanism, and cancer therapeutic opportunities. \u003cem\u003eMedComm, 3\u003c/em\u003e(2), e144.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eKhazraei, S., Marashi, S. M., \u0026amp; Sanaei-Zadeh, H. (2019). Ventilator settings and outcome of respiratory failure in paraquat-induced pulmonary injury. \u003cem\u003eScientific Reports, 9\u003c/em\u003e(1), 16541.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eKhodayar, M. J., Kiani, M., Hemmati, A. A., Rezaie, A., Zerafatfard, M. R., Nooshabadi, M. R. R., \u0026amp; Goudarzi, M. (2014). The preventive effect of atorvastatin on paraquat-induced pulmonary fibrosis in the rats. \u003cem\u003eAdvanced pharmaceutical bulletin, 4\u003c/em\u003e(4), 345.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eKing, T. E., Pardo, A., \u0026amp; Selman, M. (2011). Idiopathic pulmonary fibrosis. \u003cem\u003eThe Lancet, 378\u003c/em\u003e(9807), 1949-1961.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eKoeppen, B. M., \u0026amp; Stanton, B. A. (2017). \u003cem\u003eBerne \u0026amp; Levy Physiology: First South Asia Edition-E-book\u003c/em\u003e: Elsevier Health Sciences.\u003c/li\u003e\n \u003cli\u003eLanz, J., Biniaz-Harris, N., Kuvaldina, M., Jain, S., Lewis, K., \u0026amp; Fallon, B. A. (2023). Disulfiram: mechanisms, applications, and challenges. \u003cem\u003eAntibiotics, 12\u003c/em\u003e(3), 524.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eLi, C., Pei, X., Zheng, F., Cao, K., \u0026amp; Ren, D. (2021). Disulfiram Regulates Epithelial-Mesenchymal Transition by Activating PGE2 Biosynthesis to Improve Idiopathic Pulmonary Fibrosis \u003cem\u003eTP116. TP116 PRECLINICAL THERAPEUTIC MODELS OF FIBROSIS\u003c/em\u003e (pp. A4439-A4439): American Thoracic Society.\u003c/li\u003e\n \u003cli\u003eLi, L., Lv, S., Li, X., \u0026amp; Liu, J. (2022). Wnt-induced secreted proteins-1 play an important role in paraquat-induced pulmonary fibrosis. \u003cem\u003eBMC Pharmacology and Toxicology, 23\u003c/em\u003e(1), 21.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eLiu, J., Lv, S., Ma, W., Yang, D., \u0026amp; Zhang, X. (2023). Effect of WISP1 on paraquat-induced EMT. \u003cem\u003eToxicology in Vitro, 93\u003c/em\u003e, 105693.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eLiu, M., Song, L., Lai, Y., Gao, F., \u0026amp; Man, J. (2024). LncRNA FEZF1-AS1 promotes pulmonary fibrosis via up-regulating EZH2 and targeting miR-200c-3p to regulate the ZEB1 pathway. \u003cem\u003eScientific Reports, 14\u003c/em\u003e(1), 26044.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eMei, Q., Liu, Z., Zuo, H., Yang, Z., \u0026amp; Qu, J. (2022). Idiopathic pulmonary fibrosis: an update on pathogenesis. \u003cem\u003eFrontiers in Pharmacology, 12\u003c/em\u003e, 797292.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eMenche, C., Schuhwerk, H., Armstark, I., Gupta, P., Fuchs, K., van Roey, R., . . . Clavel Ezquerra, A. (2024). ZEB1-mediated fibroblast polarization controls inflammation and sensitivity to immunotherapy in colorectal cancer. \u003cem\u003eEMBO reports, 25\u003c/em\u003e(8), 3406-3431.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eMutschler, J., Grosshans, M., Soyka, M., \u0026amp; R\u0026ouml;sner, S. (2016). Current findings and mechanisms of action of disulfiram in the treatment of alcohol dependence. \u003cem\u003ePharmacopsychiatry, 49\u003c/em\u003e(04), 137-141.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eOkabe, Y., Toda, E., Urushiyama, H., Terashima, Y., Kunugi, S., Kajimoto, Y., . . . Yamauchi, Y. (2023). Antifibrotic effect of disulfiram on bleomycin-induced lung fibrosis in mice.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003ePalipoch, S., Punsawad, C., Koomhin, P., Na-Ek, P., Poonsawat, W., Kimseng, R., . . . Suwannalert, P. (2022). Aqueous Thunbergia laurifolia leaf extract alleviates paraquat-induced lung injury in rats by inhibiting oxidative stress and inflammation. \u003cem\u003eBMC complementary medicine and therapies, 22\u003c/em\u003e(1), 83.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003ePark, Y. S., Park, C. M., Lee, H. J., Goo, J. M., Chung, D. H., Lee, S.-M., . . . Yoo, C.-G. (2013). Clinical implication of protease-activated receptor-2 in idiopathic pulmonary fibrosis. \u003cem\u003eRespiratory medicine, 107\u003c/em\u003e(2), 256-262.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003ePatil, V. S., Patil, C. R., Patel, H. M., \u0026amp; Kumar, A. (2025). Exploring disulfiram mechanisms in renal fibrosis: insights from biological data and computational approaches. \u003cem\u003eFrontiers in Pharmacology, 16\u003c/em\u003e, 1480732.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eRodrigues da Silva, M., Schapochnik, A., Peres Leal, M., Esteves, J., Bichels Hebeda, C., Sandri, S., . . . Lino-dos-Santos-Franco, A. (2018). Beneficial effects of ascorbic acid to treat lung fibrosis induced by paraquat. \u003cem\u003ePLoS One, 13\u003c/em\u003e(11), e0205535.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eRunyan, R. B., \u0026amp; Savagner, P. (2018). Epithelial-mesenchymal transition and plasticity in the developmental basis of cancer and fibrosis. \u003cem\u003eDev Dyn, 247\u003c/em\u003e(3), 330-331.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eSaitoh, M. (2023). \u003cem\u003eTranscriptional regulation of EMT transcription factors in cancer.\u003c/em\u003e Paper presented at the Seminars in cancer biology.\u003c/li\u003e\n \u003cli\u003eSalton, F., Volpe, M. C., \u0026amp; Confalonieri, M. (2019). Epithelial\u0026ndash;mesenchymal transition in the pathogenesis of idiopathic pulmonary fibrosis. \u003cem\u003eMedicina, 55\u003c/em\u003e(4), 83.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eSato, M., Urushiyama, H., Toda, E., Takumida, H., Enokido, T., Saito, A., . . . Kage, H. (2024). Exploring Combined Therapy: Disulfiram and Antifibrotic Agents in Attenuating Pulmonary Fibrosis in Bleomycin-Induced Mouse Model: European Respiratory Society.\u003c/li\u003e\n \u003cli\u003eShao, X., Li, M., Luo, C., Wang, Y.-y., Lu, Y.-y., Feng, S., . . . Lin, C. (2015). Effects of rapamycin against paraquat-induced pulmonary fibrosis in mice. \u003cem\u003eJournal of Zhejiang University-SCIENCE B, 16\u003c/em\u003e(1), 52-61.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eStokes, M., Patel, P., \u0026amp; Abdijadid, S. (2024). Disulfiram \u003cem\u003eStatPearls [Internet]\u003c/em\u003e: StatPearls Publishing.\u003c/li\u003e\n \u003cli\u003eSubbiah, R., \u0026amp; Tiwari, R. R. (2021). The herbicide paraquat-induced molecular mechanisms in the development of acute lung injury and lung fibrosis. \u003cem\u003eCritical reviews in Toxicology, 51\u003c/em\u003e(1), 36-64.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eSuthakaran, S., Singh, D., Deshmukh, R. K., \u0026amp; Das, A. (2022). Targeting Epithelial-to-Mesenchymal Transition for Breast Cancer Stem Cells Therapeutics \u003cem\u003eHandbook of Oxidative Stress in Cancer: Therapeutic Aspects\u003c/em\u003e (pp. 2539-2563): Springer.\u003c/li\u003e\n \u003cli\u003eWang, X., Yang, S., Ye, H., Chen, J., Shi, L., Feng, L., . . . Xiao, W. (2022). Disulfiram exerts antiadipogenic, anti-inflammatory, and antifibrotic therapeutic effects in an in vitro model of Graves\u0026apos; orbitopathy. \u003cem\u003eThyroid, 32\u003c/em\u003e(3), 294-305.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eWang, X., Ye, H., Yang, S., Sha, X., Wang, X., Zhang, T., . . . Yang, H. (2022). Disulfiram exerts antifibrotic and anti-inflammatory therapeutic effects on perimysial orbital fibroblasts in Graves\u0026rsquo; orbitopathy. \u003cem\u003eInternational Journal of Molecular Sciences, 23\u003c/em\u003e(9), 5261.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eWu, X., Xu, H., Zhang, Z., Ma, Z., Zhang, L., Wang, C., . . . Chen, M. (2025). Disulfiram alleviates MTX-induced pulmonary fibrosis by inhibiting EMT in Type 2 alveolar epithelial cells. \u003cem\u003eLung, 203\u003c/em\u003e(1), 4.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eYamada, A., Aki, T., Unuma, K., Funakoshi, T., \u0026amp; Uemura, K. (2015). Paraquat induces epithelial-mesenchymal transition-like cellular response resulting in fibrogenesis and the prevention of apoptosis in human pulmonary epithelial cells. \u003cem\u003ePLoS One, 10\u003c/em\u003e(3), e0120192.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eYang, X.-M., Wu, Z., Wang, X., Zhou, Y., Zhu, L., Li, D., . . . Ma, X. (2022). Disulfiram inhibits liver fibrosis in rats by suppressing hepatic stellate cell activation and viability. \u003cem\u003eBMC Pharmacology and Toxicology, 23\u003c/em\u003e(1), 54.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eYang, Z., Guo, F., Albers, A. E., Sehouli, J., \u0026amp; Kaufmann, A. M. (2019). Disulfiram modulates ROS accumulation and overcomes synergistically cisplatin resistance in breast cancer cell lines. \u003cem\u003eBiomedicine \u0026amp; Pharmacotherapy, 113\u003c/em\u003e, 108727.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eYang, Z., Sun, Z., Liu, H., Ren, Y., Shao, D., Zhang, W., . . . Nie, S. (2015). Connective tissue growth factor stimulates the proliferation, migration and differentiation of lung fibroblasts during paraquat‑induced pulmonary fibrosis. \u003cem\u003eMolecular medicine reports, 12\u003c/em\u003e(1), 1091-1097.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eZhang, Z., Wang, G., Li, Y., Lei, D., Xiang, J., Ouyang, L., . . . Yang, J. (2022). Recent progress in DNA methyltransferase inhibitors as anticancer agents. \u003cem\u003eFrontiers in Pharmacology, 13\u003c/em\u003e, 1072651.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eZhao, Q., Shao, T., Zhu, Y., Zong, G., Zhang, J., Tang, S., . . . Xu, Y. (2023). An MRTF-A\u0026ndash;ZEB1\u0026ndash;IRF9 axis contributes to fibroblast\u0026ndash;myofibroblast transition and renal fibrosis. \u003cem\u003eExperimental \u0026amp; molecular medicine, 55\u003c/em\u003e(5), 987-998. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-molecular-histology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"hijo","sideBox":"Learn more about [Journal of Molecular Histology](https://www.springer.com/journal/10735)","snPcode":"10735","submissionUrl":"https://submission.springernature.com/new-submission/10735/3","title":"Journal of Molecular Histology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Disulfiram, Paraquat, Pulmonary fibrosis, ZEB1, Antifibrotic therapy, Histopathology","lastPublishedDoi":"10.21203/rs.3.rs-7218465/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7218465/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePulmonary fibrosis is a fatal condition marked by excessive extracellular matrix deposition and myofibroblast activation, with paraquat (PQ) being a potent inducer via oxidative stress and profibrotic signaling. This study evaluated the antifibrotic effects of disulfiram (DSF), an FDA-approved medication, in rats with PQ-induced pulmonary fibrosis. Forty male Wistar rats were divided into eight groups receiving PQ (40 mg/kg) and DSF (1, 10, 100 mg/kg) for 21 days. Lung tissues were analyzed histopathologically (H\u0026amp;E, Mallory’s trichrome) for inflammation, alveolar septal thickening, vascular congestion, and fibrosis, while ZEB1 gene expression was assessed by real-time PCR. PQ exposure led to severe lung injury, collagen deposition, and significant upregulation of ZEB1 (p=0.0022). DSF at 10 mg/kg provided the most effective protection, significantly reducing histopathological damage and ZEB1 expression (p \u0026lt; 0.001). The 1 mg/kg dose showed moderate efficacy, and the 100 mg/kg dose had limited benefits, suggesting a dose-dependent toxicity. These findings indicate that DSF at 10 mg/kg attenuates PQ-induced pulmonary fibrosis by reducing inflammation, collagen accumulation, and ZEB1-mediated profibrotic signaling, supporting DSF as a potential repurposed antifibrotic therapy for PQ-induced and possibly idiopathic pulmonary fibrosis.\u003c/p\u003e","manuscriptTitle":"Repurposing Disulfiram: A Promising Antifibrotic Strategy Against Paraquat-Induced Pulmonary Fibrosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-30 15:15:49","doi":"10.21203/rs.3.rs-7218465/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-08-08T11:28:47+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-08T07:15:07+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-04T10:21:09+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"31960676715422770481315970254014179706","date":"2025-07-29T13:21:50+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"164432802749718209686577816114300373900","date":"2025-07-29T03:17:40+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-07-28T16:32:34+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-28T16:30:26+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-07-28T10:54:38+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Molecular Histology","date":"2025-07-26T04:45:37+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-molecular-histology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"hijo","sideBox":"Learn more about [Journal of Molecular Histology](https://www.springer.com/journal/10735)","snPcode":"10735","submissionUrl":"https://submission.springernature.com/new-submission/10735/3","title":"Journal of Molecular Histology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"4e267d90-22db-42e6-96f6-445e437959ed","owner":[],"postedDate":"July 30th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-09-22T15:58:46+00:00","versionOfRecord":{"articleIdentity":"rs-7218465","link":"https://doi.org/10.1007/s10735-025-10613-1","journal":{"identity":"journal-of-molecular-histology","isVorOnly":false,"title":"Journal of Molecular Histology"},"publishedOn":"2025-09-18 15:57:10","publishedOnDateReadable":"September 18th, 2025"},"versionCreatedAt":"2025-07-30 15:15:49","video":"","vorDoi":"10.1007/s10735-025-10613-1","vorDoiUrl":"https://doi.org/10.1007/s10735-025-10613-1","workflowStages":[]},"version":"v1","identity":"rs-7218465","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7218465","identity":"rs-7218465","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}