A zinc uptake transporter ZIP1-II is involved in zinc accumulation in the hepatopancreas of Pacific oyster Crassostrea gigas

A zinc uptake transporter ZIP1-II is involved in zinc accumulation in the hepatopancreas of Pacific oyster Crassostrea gigas | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article A zinc uptake transporter ZIP1-II is involved in zinc accumulation in the hepatopancreas of Pacific oyster Crassostrea gigas Ning Kong, Cong Luo, Mengjia Wang, Junyan Zhao, Xiang Li, Lingling Wang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5058990/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 27 Nov, 2024 Read the published version in Marine Biotechnology → Version 1 posted 10 You are reading this latest preprint version Abstract The Pacific oyster Crassostrea gigas is known to have an exceptional ability to accumulate zinc, which endows it with robust resistance to pathogens and makes it an excellent source of dietary zinc. ZIP1 has been identified as an important zinc uptake protein in other species, but its role in oysters remains unclear. In the present study, a ZIP1 homologue ( Cg ZIP1-II) of the Zrt/Irt-like protein (ZIP) family was identified in C . gigas . The mRNA transcripts of Cg ZIP1-II were constitutively expressed in examined tissues of C. gigas , with higher levels in the hepatopancreas and gill. After zinc exposure, the mRNA transcripts of Cg ZIP1-II in the hepatopancreas showed a significant decline from 12 h to 14 d, while those in the gill significantly decreased at 72 h, then followed by a recovery to basal levels at 7 d to 14 d. Immunocytochemical analysis revealed that the Cg ZIP1-II protein was mainly located at the plasma membrane of oyster haemocytes. Compared to the control cells, overexpression of Cg ZIP1-II in the transfected HEK293 cells resulted in a 2.44-fold ( p < 0.05) increase in zinc content after incubation with 100 µM zinc for 24 h. Inhibition of endogenous Cg ZIP1-II expression with siRNAs led to a 42% reduction in zinc content in the hepatopancreas of oysters. Similarly, in vivo blocking of Cg ZIP1-II with anti- Cg ZIP1-II antibody caused a 43% decrease in zinc content in the hepatopancreas. These results collectively indicated that Cg ZIP1-II functioned as a zinc uptake transporter in C. gigas and played an important role in zinc accumulation. Crassostrea gigas Zinc accumulation Zinc transporter CgZIP1-II Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Zinc is an essential component of more than 300 enzymes and plays a pivotal role in numerous physiological processes across all organisms (Plum et al., 2010 ). Intracellular zinc levels influence enzyme activity, gene expression, immune function and cell signaling pathways, necessitating the precise regulation of zinc homeostasis within cells (Padoan et al., 2024 ; Wessels et al., 2017 ). Previous research has demonstrated that cellular zinc homeostasis is tightly regulated by the coordinated actions of proteins responsible for zinc transport, sensing, storage and release, including zinc transporters, metallothioneins and metal-regulatory transcription factor 1 (Bafaro et al., 2017 ; Kambe et al., 2014 ). Zinc transporters are integral membrane proteins that transport zinc ions across cellular and intracellular membranes, which play a decisive role in regulating cellular zinc content (Kambe et al., 2014 ). Zinc transporters are categorized into two families: the Zrt/Irt-like protein (ZIP) family and the zinc transporter (ZnT) family (Bafaro et al., 2017 ; Lichten and Cousins, 2009 ). The ZIP family comprises 14 members (ZIP1-ZIP14), which function to increase the cytosolic zinc concentration by importing zinc into the cytoplasm from extracellular environment or intracellular compartments (Bafaro et al., 2017 ; Lichten and Cousins, 2009 ). ZIP1, one of the earliest discovered members of the ZIP family, is widely expressed in various tissues and cell types (Fan et al., 2024 ). It has been demonstrated that ZIP1 operates as a key zinc uptake transporter in human PC-3 prostate cells and K562 erythroleukemia cells, where overexpression of hZIP1 enhanced zinc uptake and accumulation, while suppressing its endogenous expression reduced zinc uptake activity (Franklin et al., 2003 ; Gaither and Eide, 2001 ). Mutation in ZIP1 significantly compromised the success of pregnancy when dietary zinc intake of zinc was limited (Dufner-Beattie et al., 2006 ). In Drosophila , ZIP1 was identified as plasma membrane-resident zinc transporter responsible for absorbing zinc from the lumen into the enterocytes (Qin et al., 2013 ). Given the pivotal role of ZIP1 in these diverse organisms, it presents a promising target for studying the mechanisms of zinc accumulation in oysters. The Pacific oyster, Crassostrea gigas , is one of the most widely cultivated oyster species and makes a significant contribution to the world aquaculture production (FAO, 2024 ). C . gigas is also recognized by its extraordinarily high zinc content (Luo et al., 2024 ), but the specific mechanism underlying zinc accumulation remains unclear. Four ZIP1 homologs have been identified in the genome of C . gigas , more than that found in vertebrate animals (Kong et al., 2020 ), which indicates their crucial role in zinc accumulation. In our previous work, the genetic polymorphism of a ZIP1 homologous gene, Cg ZIP1-II, was found to be associated with zinc content in C . gigas , but its specific role in zinc transport has yet to be elucidated. In the present study, the sequence characteristics and expression patterns of Cg ZIP1-II were explored, and its zinc transport function was investigated using in vitro overexpression and in vivo RNAi and antibody blocking techniques. Our results will provide valuable insights into the molecular mechanisms of zinc accumulation in oysters and contribute to the development of strategies to enhance zinc content in oysters. 2. Materials and methods 2.1 Ethics statement The present study was conducted in accordance with the regulations issued by the Ethics Review Committee of Dalian Ocean University, Dalian, China. 2.2 Oysters and sample collection Oysters with an average shell height of 14 cm were sampled from a local farm in Dalian, China. The individuals were acclimated in aerated seawater at 18 ℃ for one week before processing, with the seawater completely renewed every day. To investigate the mRNA distribution of Cg ZIP1-II, nine oysters were employed to sample tissues of hepatopancreas, gill, mantle, gonad, adductor muscle and haemocytes. Tissue samples from three individuals were pooled to form a single replicate, and three replicates were generated for each tissue type. To investigate the mRNA expression patterns of Cg ZIP1-II in response to zinc stimulation, 63 oysters were transferred into filtered seawater containing 1 mg/L of zinc. A stock solution of 1 g/L zinc was prepared by dissolving ZnSO 4 ·7H 2 O in deionized water, and then added to the filtered seawater to achieve the final concentration. The seawater with the desired zinc concentration was completely renewed once a day. Nine individuals were randomly sampled at 0 h, 12 h, 24 h, 72 h, 7 d, 9 d and 14 d after zinc stimulation. The gill and hepatopancreas from three individuals were pooled to form a single replicate, and three replicates were generated for each time point. 2.3 RNA isolation and cDNA synthesis The total RNA was isolated from oyster tissues using the TRIzol reagent (Thermo Fisher Scientific, USA). The cDNA synthesis was conducted using a commercial kit (TransGen, China), and the resulting cDNA mixture was diluted to 1:20 for subsequent processing. 2.4 Cloning and sequence analysis The sequence of Cg ZIP1-II (LOC105346440) was retrieved from the NCBI database. The open reading frame (ORF) of Cg ZIP1-II was cloned using primers Cg ZIP1-II-F and Cg ZIP1-II-R (Table 1 ). The PCR product was inserted into the pMD19-T plasmid (Takara, China) and verified by Sanger sequencing. The sequence characteristics were analyzed using Expasy, and the domain architecture was predicted using SMART and TMHMM. Phylogenetic analysis was conducted using MEGA 7.0 after performing a multiple sequence alignment with Clustal W. 2.5 Quantitative real-time PCR (qRT-PCR) analysis The mRNA expression of Cg ZIP1-II was examined by SYBR Green fluorescent qRT-PCR using primers Cg ZIP1-II-RT-F and Cg ZIP1-II-RT-R (Table 1 ). The mRNA expression was quantified using the 2 −ΔΔCt method (Livak and Schmittgen, 2001 ), with Cg EF (NM_001305313.2) as an internal reference. Table 1 The primers used in the present study. Primer Primer Sequence (5’-3’) Cloning primers qRT-PCR primers Cg ZIP1-II-F Cg ZIP1-II-R ACTTTGCCTTGTTGAGGA GACTCTGCAAGACACGAA EF-RT-F EF-RT-R Cg ZIP1-II-RT-F AGTCACCAAGGCTGCACAGAAAG TCATATTTCTTTGATGT AGTATCCTGTGACAGAGGCCAT Cg ZIP1-II-RT-R AGGTCCTTGGTTTTGG Recombinant expression primers pcDNA- Cg ZIP1-II-F TACTCAAAGCTTATGGTGGAGG pcDNA- Cg ZIP1-II-R TACTCAGGATCCATGGTTGACCTTTG RNA interference primers Cg ZIP1-II-Fi GGGCUUCCAACUAGAAGAATT Cg ZIP1-II-Ri UUCUUCUAGUUGGAAGCCCTT 2.6 Antibody preparation Polyclonal antibodies were generated by immunizing six-week-old female mice with a polypeptide fragment of Cg ZIP1-II. Briefly, 100 µL of the Cg ZIP1-II polypeptide fragment was used to immunize each mouse through four rounds of subcutaneous injection. The anti- Cg ZIP1-II serum samples were obtained from the mice one week after the final injection. The specificity of the Cg ZIP1-II polyclonal antibody was detected using Western blot with oyster haemocyte protein. 2.7 Immunocytochemical assay The subcellular localization of Cg ZIP1-II in oyster haemocytes was detected using immunocytochemical assay. After permeabilized with Triton-X, the haemocytes were incubated with Cg ZIP1-II antibody (diluted to 1:1000) at 4 ℃ overnight, followed by incubation with Alexa Fluor 488-labeled Goat Anti-Mouse IgG (diluted to 1:1000; Beyotime, China) at room temperature for 1.5 h. After three washes with PBST, the cells were stained with Dil and DAPI, and observed under a fluorescence microscope (Zeiss, Germany). 2.8 Plasmid construction and cell transfection The ORF of Cg ZIP1-II was amplified using primers pcDNA- Cg ZIP1-II-F and pcDNA- Cg ZIP1-II-R, which contain the Hind III and BamH I restriction sites, respectively (Table 1 ). The amplified product was digested with Hind III and BamH I restriction enzymes at 37 ℃ for 1 h, and then inserted into the pcDNA3.1 (+) expression plasmid (Clontech, Japan). The recombinant plasmid pcDNA- Cg ZIP1-II and empty plasmid pcDNA3.1(+) were transformed into DH5α competent cells (Sangon Biotech, China), and isolated from the positive transformants using an extraction kit (Tiangen Biotech, China). HEK293T cells were cultured in Dulbecco's Modified Eagle's medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco, USA). Transfection was conducted using Entranster™-H4000 (Engreen, China), and the transfection efficiency was determined by Western blot at 48 h post transfection. 2.9 Immunofluorescence and zinc measurement HEK293T cells were cultured in 24-well plates and transfected with either empty plasmid or pcDNA- Cg ZIP1-II plasmid. After 48 h, the transfected cells were incubated with 5 µM FluoZin TM -3 (Thermo Fisher Scientific, USA) in medium without FBS for 30 min. The cells were then treated with 100 µM zinc for 6 h to determine intracellular zinc accumulation using fluorescence microscopy. HEK293T cells were cultured in six-well plates and transfected with either empty plasmid or pcDNA- Cg ZIP1-II plasmid for 48 h. Afterward, the cells were treated with or without 100 µM zinc for 24 h. After being scrapped off the plates, the cells were fragmented using a pulveriser (Scientz, China). The fragmented samples were digested with 14% trichloroacetic acid, then centrifuged to obtain the supernatants. Zinc content in the supernatant was quantified using a zinc quantification kit (Nanjing Jiancheng, China). Proteins concentration in each sample was quantified using the BCA method. 2.10 In vivo RNA interference (RNAi) Specific siRNAs targeting Cg ZIP1-II were synthesized (GenePharma, China) to inhibit its in vivo expression. Eighteen oysters were randomly divided into two groups, with each group receiving an injection of 100 µL of siRNA (1 µg/µL in seawater) targeting Cg ZIP1-II or a negative control (NC-RNAi). Three injections were administered at 24 h intervals to enhance the effectiveness and duration of RNAi. After the first injection, all individuals were placed in seawater containing 1 mg/L of zinc, with the seawater being replaced every 24 h to maintain a consistent zinc concentration. At 24 h post the third injection, the hepatopancreas was collected from each individual and freeze-dried to measure the zinc content according to previous description (Luo et al., 2024 ). The tissues from three individuals were pooled to form a single replicate, and three replicates were generated for each group. 2.11 The blocking assay with anti-CgZIP1-II antibody Eighteen oysters were employed for the blocking assay and randomly divided into two groups named as the control and blocking groups. Oysters in the blocking group were injected with 100 µL of anti- Cg ZIP1-II antibody (3 µg/µL), while those in the control group received an equal volume of negative serum. After blocking for 1 h, the oysters were exposed to filtered seawater containing 1 mg/L of zinc. The hepatopancreas was collected at 3 h post zinc exposure to measure the zinc content as described in the RNAi assay. The tissues from three individuals were pooled to form a single replicate, and three replicates were generated for each group. 2.12 Statistical analysis Data were presented as mean ± SD. Statistical analysis was performed using two-tailed t -test for pairwise comparisons or one-way ANOVA followed by Tukey's test for multiple comparisons. Significant difference was designated at p < 0.05. 3. Results 3.1 Molecular characteristics of CgZIP1-II The ORF of Cg ZIP1-II was 960 bp, which encoded a polypeptide of 319 amino acids with a predicted molecular weight of 35.78 kDa. The protein sequence of Cg ZIP1-II contained a ZIP structural domain with eight transmembrane domains (TMDs) (Fig. S1 A and B). A histidine-rich sequence, HMHDHGHD, was identified in the long loop region located between TMDs III and IV of Cg ZIP1-II. Multiple sequence alignment analysis revealed that Cg ZIP1-II shared a 25.66–34.51% similarity with ZIP1s from other selected invertebrate and vertebrate species (Fig. S2 A). The neighbor-joining (NJ) phylogenetic tree showed a clear separation between the ZIP1s from invertebrates and vertebrates. Cg ZIP1-II was firstly clustered with ZIP1 from Mizuhopecten yessoensis and fell into the invertebrate branch (Fig. S2 B). Figure S2 Phylogenetic analysis of Cg ZIP1-II. (A) Multiple sequence alignment of Cg ZIP1-II with ZIP1s from Aplysia californica (XP_005102658.1) , Biomphalaria glabrata (XP_055862056.1) , Danio rerio (NP_997748.2) , Drosophila melanogaster (NP_525107.1) , Homo sapiens (NP_001258886.1) , Mizuhopecten yessoensis (XP_021342870.1) , Mus musculus (NP_001398434.1) , Octopus bimaculoides (XP_014786465.1) , Rattus norvegicus (XP_006232769.1) and Xenopus laevis (XP_018087222.1). (B) Phylogenetic tree of Cg ZIP1-II with ZIP1s from A . californica , B . glabrata , D . rerio , D . melanogaster , H . sapiens , M . yessoensis , Mus musculus , O . bimaculoides , R . norvegicus and X . laevis . 3.2 Tissue distribution of CgZIP1-II mRNA The mRNA transcripts of Cg ZIP1-II were constitutively expressed in all examined oyster tissues, with the expression levels ranking from highest to lowest in hepatopancreas, gill, adductor muscle, haemocytes, mantle and gonad. The mRNA expression level of Cg ZIP1-II in the hepatopancreas was 13.15-fold of that in the gonad (Fig. 1 ). 3.3 The temporal mRNA expression of CgZIP1-II in response to zinc stimulation The mRNA expression levels of Cg ZIP1-II in the hepatopancreas and gill were detected following exposure to 1 mg/L of zinc. In the hepatopancreas, the expression level of Cg ZIP1-II decreased significantly at 12 h post zinc stimulation (0.05-fold of that at 0 h, p < 0.05) and maintained at low levels from 24 h to 14 d (Fig. 2 A). In the gill, the expression level of Cg ZIP1-II decreased significantly at 72 h (0.32-fold of that at 0 h, p < 0.05) and then recovered to basal level at 7 d to 14 d (Fig. 2 B). 3.4 Preparation of polyclonal antibody and subcellular localization of CgZIP1-II in haemocytes The specificity of the polyclonal antibody against Cg ZIP1-II was examined using oyster haemocyte lysate. A distinct band with a similar molecular weight as Cg ZIP1-II (35.78 kDa) was observed (Fig. 3 A), indicating the high specificity of the polyclonal antibody. Subcellular localization of Cg ZIP1-II in haemocytes was detected using immunocytochemical assay. The cell membrane was stained red with Dil, the nucleus was stained blue with DAPI, and Cg ZIP1-II, conjugated with anti- Cg ZIP1-II antibody and Alexa Fluor 488-labeled Goat Anti-Mouse IgG, was observed in green. The positive signals of Cg ZIP1-II were mainly distributed in the plasma membrane of oyster haemocytes (Fig. 3 B). 3.5 Zinc transport function of CgZIP1-II In vitro cell transfection and in vivo RNAi and antibody blocking experiments were conducted to investigate the role of Cg ZIP1-II in zinc transport. In the cell transfection experiment, the transfection efficiency was verified by Western blot at 48 h post Cg ZIP1-II transfection. A distinct band with a molecular weight of about 40 kDa was observed in the pcDNA- Cg ZIP1-II transfection group (Fig. 4 A). Zinc uptake was monitored by fluorescence following the interaction of intracellular zinc ion with FluoZin TM -3. At 6 h post incubation with 100 µM zinc, intense fluorescence was observed in HEK293T cells transfected with pcDNA- Cg ZIP1-II, while no fluorescence was detected in cells that were either not transfected or transfected with an empty plasmid (Fig. 4 B). After adding 10 µM TPEN (a zinc chelator) into the medium for 10 min, the fluorescence in cells transfected with pcDNA- Cg ZIP1-II was significantly reduced. The zinc content in transfected cells was further measured using a zinc quantification kit. The zinc content increased significantly in cells transfected with pcDNA- Cg ZIP1-II (15.16 mg/g protein) compared to cells transfected with empty plasmid (6.22 mg/g protein) (Fig. 4 C). RNAi was performed to confirm the role for Cg ZIP1-II in zinc uptake. The mRNA expression of Cg ZIP1-II in the hepatopancreas was significantly down-regulated (0.24-fold of that in the NC-RNAi group, p < 0.05) after siRNA treatment (Fig. 5 A). The zinc content in the hepatopancreas of the Cg ZIP1-II-RNAi group decreased significantly to 0.58-fold of that in the control group (Fig. 5 B). The blocking assay showed that the zinc content in the hepatopancreas of Cg ZIP1-II antibody treated oysters decreased significantly (0.57-fold of that in the negative serum treated oysters, p < 0.05) at 3 h post zinc exposure (Fig. 6 ). Discussion Oysters are renowned for their extraordinary ability to accumulate zinc at concentrations that are several orders of magnitude higher than those in seawater (Jonathan et al., 2017 ; Luo et al., 2024 ). The highest zinc concentration was observed in the mantle and gill of C. gigas , followed by the hepatopancreas (Kong et al., 2020 ). ZIP transporters have been demonstrated to be involved in zinc transport and uptake, which play a crucial role in maintaining zinc homeostasis within the body (Bafaro et al., 2017 ). A total of 19 ZIP homologues have been identified in the genome of C. gigas (Kong et al., 2020 ). However, the specific proteins functionally responsible for zinc uptake remain to be investigated. In the present study, a ZIP1 homologue ( Cg ZIP1-II) was identified in C. gigas , which contained a typical ZIP structural domain. Consistent with most ZIP proteins, Cg ZIP1-II was predicted to have eight transmembrane domains, which may form a channel through which zinc ions can pass (Lichten and Cousins, 2009 ). A histidine-rich sequence (HMHDHGHD) was identified in the long loop region between TMDs III and IV of Cg ZIP1-II. This is a common feature among ZIP proteins and the histidine-rich sequence is thought to have potential metal binding ability (Guerinot, 2000 ). Given its structural conservation with orthologs in other animals, Cg ZIP1-II is predicted to have a similar functional characteristic. In the phylogenic tree, Cg ZIP1-II was firstly clustered with ZIP1 from M . yessoensis , confirming the evolutionary conservation of Cg ZIP1-II. Studies in the mammals and fish have demonstrated that ZIP1 is ubiquitously expressed in a wide range of tissues and cell types, indicating its vital role in systemic zinc homeostasis (Dufner-Beattie et al., 2003 ; Michalczyk and Ackland, 2013 ). In mice, ZIP1 exhibited the highest expression levels in the intestine and ovary (Dufner-Beattie et al., 2003 ). Similarly, dominant expression of ZIP1 in the intestine was observed in pufferfish, highlighting its universal role in dietary zinc uptake (Qiu et al., 2005 ). In the present study, the mRNA transcripts of Cg ZIP1-II were constitutively expressed in all examined tissues of C. gigas , with higher expression levels in the hepatopancreas and gill. The hepatopancreas is the primary digestive tissue of oysters, while the gill is a crucial tissue in aquatic animals that facilitates direct absorption of zinc ions from water. The high expression levels of Cg ZIP1-II in these two tissues suggested its involvement in zinc uptake from both dietary sources and the surrounding water. Moreover, the transcripts of Cg ZIP1-II in the hepatopancreas and gill exhibited a significant decrease at 12 h and 72 h post zinc exposure, respectively. Similar findings were observed in human Caco-2 cells and yellow catfish hepatocytes, where the mRNA levels of ZIP1 were significantly down-regulated under excess zinc treatment (Chen et al., 2020 ; Michalczyk and Ackland, 2013 ). This is regarded as a self-protective mechanism to mitigate the toxic effects of excess zinc accumulation. It was found that with prolonged zinc treatment, the zinc content in the hepatopancreas and gill of C. gigas did not exhibit a linear increase but initially rose and then declined (Meng, 2013 ). Subcellular localization analysis revealed that the Cg ZIP1-II protein was mainly located at the plasma membrane of oyster haemocytes, which provided the functional basis for its role in importing zinc into the cell. The evidence that Cg ZIP1-II functioned as an endogenous zinc uptake transporter was obtained through in vitro overexpression experiment and in vivo RNAi and antibody blocking experiments. Overexpression of Cg ZIP1-II resulted in a 1.43-fold increase in the zinc content of HEK293 cells. Similarly, transfected CHSE-214 cells that overexpressed zebrafish Dr ZIP1 accumulated about 1.6-fold higher zinc compared to the control cells after 90 min of zinc incubation (Qiu et al., 2005 ). Research on human ZIP1 (hZIP1) also demonstrated that both PC-3 cells and K562 cells overexpressing hZIP1 exhibited increased zinc uptake and accumulation (Gaither and Eide, 2001 ; Makhov et al., 2009 ). To further ascertain the role of Cg ZIP1-II in zinc accumulation, the zinc content in oyster hepatopancreas was examined following the knockdown of Cg ZIP1-II by RNAi. It was found that along with a 76% decrease in the mRNA expression of Cg ZIP1-II, the zinc content in the hepatopancreas showed a 42% reduction compared to the control group. Consistent with the RNAi results, the antibody blocking experiment demonstrated that blocking Cg ZIP1-II led to a 43% reduction in the zinc content in the hepatopancreas. These results suggested that Cg ZIP1-II functioned as a zinc uptake transporter in C. gigas . In summary, a ZIP1 homologue Cg ZIP1-II with a conserved ZIP domain was identified in the oyster C. gigas . The mRNA expression of Cg ZIP1-II was highest in the hepatopancreas and gill, which exhibited a significant decrease upon zinc exposure. The Cg ZIP1-II protein was mainly localized at the plasma membrane and functioned as a zinc uptake transporter to facilitate cellular zinc accumulation in C. gigas . These findings provide insights into the mechanisms of zinc uptake and accumulation in oysters, with potential implications for improving oyster health and zinc content. Declarations Conflict of interest The authors declare that there are no conflicts of interests. Funding This research was supported by the National Natural Science Foundation of China (32202894 and 41961124009), the earmarked fund for China Agriculture Research System (CARS-49) and for Outstanding Talents and Innovative Team of Agricultural Scientific Research in MARA, the innovation team of Aquaculture Environment Safety from Liaoning Province (LT202009) and Dalian High Level Talent Innovation Support Program (2022RG14). Author Contribution Ning Kong: Conceptualization, Investigation, Writing - original draft, Funding acquisition; Cong Luo: Investigation, Data curation, Formal analysis, Visualization, Writing - original draft; Mengjia Wang: Investigation, Formal analysis; Junyan Zhao: Formal analysis, Visualization; Xiang Li: Investigation, Visualization; Lingling Wang: Supervision, Writing - review & editing, Funding acquisition; Linsheng Song: Supervision, Writing - review & editing, Funding acquisition. Data Availability Data is provided within the manuscript or supplementary information files. References Bafaro E, Liu YT, Xu Y, Dempski RE (2017) The emerging role of zinc transporters in cellular homeostasis and cancer. Signal Transduct Tar 2 Chen SW, Wu K, Lv WH, Song CC, Luo Z (2020) Molecular characterization of ten zinc (Zn) transporter genes and their regulation to Zn metabolism in freshwater teleost yellow catfish Pelteobagrus fulvidraco . J Trace Elem Med Bio 59 Dufner-Beattie J, Huang ZX, Geiser J, Xu WH, Andrews GK (2006) Mouse ZIP1 and ZIP3 genes together are essential for adaptation to dietary zinc deficiency during pregnancy. Genesis 44(5):239–251 Dufner-Beattie J, Langmade SJ, Wang FD, Eide D, Andrews GK (2003) Structure, function, and regulation of a subfamily of mouse zinc transporter genes. J Biol Chem 278(50):50142–50150 Fan YG, Wu TY, Zhao LX, Jia RJ, Ren H, Hou WJ, Wang ZY (2024) From zinc homeostasis to disease progression: Unveiling the neurodegenerative puzzle. Pharmacol Res 199:107039 FAO (2024) The State of World Fisheries and Aquaculture 2024: Towards Blue Transformation. Rome Franklin RB, Ma J, Zou J, Guan Z, Kukoyi BI, Feng P, Costello LC (2003) Human ZIP1 is a major zinc uptake transporter for the accumulation of zinc in prostate cells. J Inorg Biochem 96(2–3):435–442 Gaither LA, Eide DJ (2001) The human ZIP1 transporter mediates zinc uptake in human K562 erythroleukemia cells. J Biol Chem 276(25):22258–22264 Guerinot ML (2000) The ZIP family of metal transporters. Biochim Biophys Acta Biomembr 1465(1–2):190–198 Jonathan MP, Muñoz-Sevilla NP, Góngora-Gómez AM, Varela RGL, Sujitha SB, Escobedo-Urías DC, Rodríguez-Espinosa PF, Villegas LEC (2017) Bioaccumulation of trace metals in farmed pacific oysters Crassostrea gigas from SW Gulf of California coast, Mexico. Chemosphere 187, 311–319 Kambe T, Hashimoto A, Fujimoto S (2014) Current understanding of ZIP and ZnT zinc transporters in human health and diseases. Cell Mol Life Sci 71:3281–3295 Kong N, Zhao Q, Liu C, Li JX, Liu ZQ, Gao L, Wang LL, Song LS (2020) The involvement of zinc transporters in the zinc accumulation in the Pacific oyster Crassostrea gigas . Gene 750 Lichten LA, Cousins RJ (2009) Mammalian zinc transporters: nutritional and physiologic regulation. Ann Rev Nutr 29:153–176 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 –∆∆Ct method. Methods 25(4):402–408 Luo C, Kong N, Li X, Sun SQ, Jiang CY, Qiao X, Wang LL, Song LS (2024) The c.503A > G polymorphism in ZIP1-II of Pacific oyster Crassostrea gigas associated with zinc content. Comp Biochem Phys B 273 Makhov P, Golovine K, Uzzo RG, Wuestefeld T, Scoll BJ, Kolenko VM (2009) Transcriptional regulation of the major zinc uptake protein hZip1 in prostate cancer cells. Gene 431(1–2):39–46 Meng J (2013) The genome responses and MTF-1 regulation mechanism to heavy metal stress in oyster. Ph.D. thesis, Institute of Oceanology, Chinese Academy of Sciences, Qingdao, China Michalczyk AA, Ackland ML (2013) hZip1 (hSLC39A1) regulates zinc homoeostasis in gut epithelial cells. Genes Nutr 8(5):475–486 Padoan F, Piccoli E, Pietrobelli A, Moreno LA, Piacentini G, Pecoraro L (2024) The role of zinc in developed countries in pediatric patients: a 360-degree view. Biomolecules 14(6):718 Plum LM, Rink L, Haase H (2010) The essential toxin: impact of zinc on human health. Int J Env Res Pub He 7(4):1342–1365 Qin QH, Wang XX, Zhou B (2013) Functional studies of Drosophila zinc transporters reveal the mechanism for dietary zinc absorption and regulation. BMC Biol. 11 Qiu A, Shayeghi M, Hogstrand C (2005) Molecular cloning and functional characterization of a high-affinity zinc importer ( Dr ZIP1) from zebrafish ( Danio rerio ). Biochem J 388(3):745–754 Wessels I, Maywald M, Rink L (2017) Zinc as a gatekeeper of immune function. Nutrients 9(12):1286 Additional Declarations No competing interests reported. Supplementary Files Fig.S1.pdf Fig.S2.pdf WBimages.rar Cite Share Download PDF Status: Published Journal Publication published 27 Nov, 2024 Read the published version in Marine Biotechnology → Version 1 posted Editorial decision: Revision requested 22 Oct, 2024 Reviews received at journal 22 Oct, 2024 Reviewers agreed at journal 26 Sep, 2024 Reviews received at journal 23 Sep, 2024 Reviewers agreed at journal 17 Sep, 2024 Reviewers agreed at journal 16 Sep, 2024 Reviewers invited by journal 16 Sep, 2024 Editor assigned by journal 16 Sep, 2024 Submission checks completed at journal 16 Sep, 2024 First submitted to journal 09 Sep, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5058990","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":369238549,"identity":"45c033b3-0fb2-42bf-b7a0-846e1a5312b5","order_by":0,"name":"Ning Kong","email":"","orcid":"","institution":"Dalian Ocean University","correspondingAuthor":false,"prefix":"","firstName":"Ning","middleName":"","lastName":"Kong","suffix":""},{"id":369238551,"identity":"fe136a4e-634e-44c9-b381-faab4ebbfbdc","order_by":1,"name":"Cong Luo","email":"","orcid":"","institution":"Dalian Ocean University","correspondingAuthor":false,"prefix":"","firstName":"Cong","middleName":"","lastName":"Luo","suffix":""},{"id":369238553,"identity":"df5b5339-1983-41d5-9d09-ab984989e498","order_by":2,"name":"Mengjia Wang","email":"","orcid":"","institution":"Dalian Ocean University","correspondingAuthor":false,"prefix":"","firstName":"Mengjia","middleName":"","lastName":"Wang","suffix":""},{"id":369238555,"identity":"b2904c0e-5048-4fe5-bdc6-e0dad4f1c1bd","order_by":3,"name":"Junyan Zhao","email":"","orcid":"","institution":"Dalian Ocean University","correspondingAuthor":false,"prefix":"","firstName":"Junyan","middleName":"","lastName":"Zhao","suffix":""},{"id":369238557,"identity":"752e058a-dc8e-486f-8d37-226f2564e686","order_by":4,"name":"Xiang Li","email":"","orcid":"","institution":"Dalian Ocean University","correspondingAuthor":false,"prefix":"","firstName":"Xiang","middleName":"","lastName":"Li","suffix":""},{"id":369238558,"identity":"e0917a74-dde2-4fa2-b4c0-7452de9229a2","order_by":5,"name":"Lingling Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABA0lEQVRIiWNgGAWjYLCCBwYMDHzMQMYHNguwgARBLQlALWxALYwz2CSI1QLEbEDMzEOMFoPjZw+/SCi4Y9fGznv4tU2ZhJzBAeaDt3kY7PJwajmTl2aRYPAsuY2ZL80655yEscEBtmRrHobkYlxazA7kmBkkGBxOZmPmMTPObZNI3HCAx0yah+FAYgMuLeffIGmxBGvh/4Zfy40c4wdALXZALcaPGSG2sOHVYn/jjRkwkA8ngGxh7AH6RfIwm7HlHINknFok+3OMP3z4c9ien/+M8YcfZTZyfMebH954U2GHUwsQgOMCpAAaKaBkwGCAWz1IyQeQA2GMUTAKRsEoGAUYAAABdVESijcObgAAAABJRU5ErkJggg==","orcid":"","institution":"Dalian Ocean University","correspondingAuthor":true,"prefix":"","firstName":"Lingling","middleName":"","lastName":"Wang","suffix":""},{"id":369238559,"identity":"f7fd1b21-da58-4ce7-895b-561418887069","order_by":6,"name":"Linsheng Song","email":"","orcid":"","institution":"Dalian Ocean University","correspondingAuthor":false,"prefix":"","firstName":"Linsheng","middleName":"","lastName":"Song","suffix":""}],"badges":[],"createdAt":"2024-09-09 15:11:47","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5058990/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5058990/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10126-024-10379-9","type":"published","date":"2024-11-27T15:58:17+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":68358191,"identity":"ded8e020-ea02-4372-8de1-9ac602dbe6f6","added_by":"auto","created_at":"2024-11-06 11:47:33","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":51870,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe mRNA transcripts of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1-II in different tissues detected by qRT-PCR. Different letters indicate significant differences (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026lt; 0.05).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-5058990/v1/402365c213ebc8173154a1a4.png"},{"id":68359380,"identity":"3fed8c93-0de0-46e0-adcb-ab79722bd468","added_by":"auto","created_at":"2024-11-06 11:55:33","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":130001,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe temporal mRNA expression levels of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1-II in response to zinc stimulation. (A) Expression levels of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1-II in the hepatopancreas of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. gigas\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. (B) Expression levels of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1-II in the gill of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. gigas\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. Different letters indicate significant differences (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026lt; 0.05).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-5058990/v1/cce01b52e8d630ab7f41937e.png"},{"id":68358195,"identity":"4410a739-d0c1-4ecc-8036-0dce5604725e","added_by":"auto","created_at":"2024-11-06 11:47:33","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":139549,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSubcellular localization of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1-II protein in oyster haemocytes. (A) The specificity detection of the polyclonal antibody against \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1-II by Western blot. Lane M: protein molecular standard; Lane 1: native protein in oyster haemocytes. (B) The distribution of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1-II in haemocytes detected by immunocytochemical assay. The cell membrane stained with Dil is shown in red; the nucleus stained with DAPI is shown in blue; the anti-\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1-II antibody conjugated with Goat Anti-Mouse IgG/Alexa Fluor 488 antibody is shown in green.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-5058990/v1/d43c4aeda68d40f58c5634b1.png"},{"id":68359633,"identity":"6a33c7ec-0d6a-474b-bd76-2181b335e63f","added_by":"auto","created_at":"2024-11-06 12:03:33","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":755721,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eZinc accumulation in HEK293T cells transfected with pcDNA-\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1-II.\u003c/strong\u003e \u003cstrong\u003e(A) The \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1 protein in HEK293T cells detected by Western blot with beta-tubulin as an internal reference. Lane M: protein molecular standard; Lane 1: blank; Lane 2: empty plasmid; Lane 3: pcDNA-\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1-II. (B) Intracellular labile zinc in HEK293T cells, either not transfected (Blank) or transfected with an empty plasmid or pcDNA-\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1-II plasmid, was detected with FluoZin\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003eTM\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e-3. Cells were transfected with plasmids for 48 h, and then treated by 100 μM zinc for 6 h after FluoZin\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003eTM\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e-3 treating. (C) Zinc content of transfected HEK293T cells was measured by zinc quantification kit. Cells were transfected with plasmids for 48 h, and then treated without (Basal) or with 100 μM zinc (+Zn\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e2+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e) for 24 h.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-5058990/v1/f0b6fcf64aef62a6a83f920a.png"},{"id":68359632,"identity":"f857da07-ddef-494d-9e4d-1605f94ca680","added_by":"auto","created_at":"2024-11-06 12:03:33","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":82723,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe zinc content in the hepatopancreas of\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eoysters after\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e Cg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1-II was knocked down.\u003c/strong\u003e \u003cstrong\u003e(A) RNAi efficiency of\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e Cg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1-II in the hepatopancreas of oysters. (B) The zinc content in the hepatopancreas of\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1-II-RNAi oysters. *: \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e\u0026lt; 0.05.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-5058990/v1/c046c6a538376e6b53926a0e.png"},{"id":68359382,"identity":"a454a0c7-e2a1-4b47-a7c7-fd718b4d4322","added_by":"auto","created_at":"2024-11-06 11:55:33","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":26461,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe zinc content in the hepatopancreas of anti-\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eZIP1-II antibody treated oysters after zinc exposure. *: \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e\u0026lt; 0.05.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Fig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-5058990/v1/eeb9353606dddb1a76436812.png"},{"id":70388986,"identity":"8128f2cf-b29d-400e-af2a-6bf6163bbe8a","added_by":"auto","created_at":"2024-12-02 17:27:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2405027,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5058990/v1/c7eb489b-53ce-447d-8d04-96d96940f407.pdf"},{"id":68358198,"identity":"e28e2370-4384-4d6d-b227-22ff4de48d1f","added_by":"auto","created_at":"2024-11-06 11:47:33","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":7282785,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.S1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5058990/v1/0ac5c1dc3c43e99a1a85094d.pdf"},{"id":68359385,"identity":"57fa76a4-5aa3-45d7-9eaf-f1dfeb4e4090","added_by":"auto","created_at":"2024-11-06 11:55:33","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":5498271,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.S2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5058990/v1/c8739ab6b8120f21437b5267.pdf"},{"id":68359384,"identity":"7abc7768-eb4d-4a9d-8719-7b01c7bc5560","added_by":"auto","created_at":"2024-11-06 11:55:33","extension":"rar","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":101738,"visible":true,"origin":"","legend":"","description":"","filename":"WBimages.rar","url":"https://assets-eu.researchsquare.com/files/rs-5058990/v1/9ae80829fc5cac88f90f515c.rar"}],"financialInterests":"No competing interests reported.","formattedTitle":"A zinc uptake transporter ZIP1-II is involved in zinc accumulation in the hepatopancreas of Pacific oyster Crassostrea gigas","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eZinc is an essential component of more than 300 enzymes and plays a pivotal role in numerous physiological processes across all organisms (Plum et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Intracellular zinc levels influence enzyme activity, gene expression, immune function and cell signaling pathways, necessitating the precise regulation of zinc homeostasis within cells (Padoan et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Wessels et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Previous research has demonstrated that cellular zinc homeostasis is tightly regulated by the coordinated actions of proteins responsible for zinc transport, sensing, storage and release, including zinc transporters, metallothioneins and metal-regulatory transcription factor 1 (Bafaro et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Kambe et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eZinc transporters are integral membrane proteins that transport zinc ions across cellular and intracellular membranes, which play a decisive role in regulating cellular zinc content (Kambe et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Zinc transporters are categorized into two families: the Zrt/Irt-like protein (ZIP) family and the zinc transporter (ZnT) family (Bafaro et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Lichten and Cousins, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The ZIP family comprises 14 members (ZIP1-ZIP14), which function to increase the cytosolic zinc concentration by importing zinc into the cytoplasm from extracellular environment or intracellular compartments (Bafaro et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Lichten and Cousins, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). ZIP1, one of the earliest discovered members of the ZIP family, is widely expressed in various tissues and cell types (Fan et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). It has been demonstrated that ZIP1 operates as a key zinc uptake transporter in human PC-3 prostate cells and K562 erythroleukemia cells, where overexpression of hZIP1 enhanced zinc uptake and accumulation, while suppressing its endogenous expression reduced zinc uptake activity (Franklin et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Gaither and Eide, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Mutation in ZIP1 significantly compromised the success of pregnancy when dietary zinc intake of zinc was limited (Dufner-Beattie et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). In \u003cem\u003eDrosophila\u003c/em\u003e, ZIP1 was identified as plasma membrane-resident zinc transporter responsible for absorbing zinc from the lumen into the enterocytes (Qin et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Given the pivotal role of ZIP1 in these diverse organisms, it presents a promising target for studying the mechanisms of zinc accumulation in oysters.\u003c/p\u003e \u003cp\u003eThe Pacific oyster, \u003cem\u003eCrassostrea gigas\u003c/em\u003e, is one of the most widely cultivated oyster species and makes a significant contribution to the world aquaculture production (FAO, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). \u003cem\u003eC\u003c/em\u003e. \u003cem\u003egigas\u003c/em\u003e is also recognized by its extraordinarily high zinc content (Luo et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), but the specific mechanism underlying zinc accumulation remains unclear. Four ZIP1 homologs have been identified in the genome of \u003cem\u003eC\u003c/em\u003e. \u003cem\u003egigas\u003c/em\u003e, more than that found in vertebrate animals (Kong et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), which indicates their crucial role in zinc accumulation. In our previous work, the genetic polymorphism of a ZIP1 homologous gene, \u003cem\u003eCg\u003c/em\u003eZIP1-II, was found to be associated with zinc content in \u003cem\u003eC\u003c/em\u003e. \u003cem\u003egigas\u003c/em\u003e, but its specific role in zinc transport has yet to be elucidated. In the present study, the sequence characteristics and expression patterns of \u003cem\u003eCg\u003c/em\u003eZIP1-II were explored, and its zinc transport function was investigated using \u003cem\u003ein vitro\u003c/em\u003e overexpression and \u003cem\u003ein vivo\u003c/em\u003e RNAi and antibody blocking techniques. Our results will provide valuable insights into the molecular mechanisms of zinc accumulation in oysters and contribute to the development of strategies to enhance zinc content in oysters.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Ethics statement\u003c/h2\u003e \u003cp\u003e The present study was conducted in accordance with the regulations issued by the Ethics Review Committee of Dalian Ocean University, Dalian, China.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Oysters and sample collection\u003c/h2\u003e \u003cp\u003eOysters with an average shell height of 14 cm were sampled from a local farm in Dalian, China. The individuals were acclimated in aerated seawater at 18 ℃ for one week before processing, with the seawater completely renewed every day.\u003c/p\u003e \u003cp\u003eTo investigate the mRNA distribution of \u003cem\u003eCg\u003c/em\u003eZIP1-II, nine oysters were employed to sample tissues of hepatopancreas, gill, mantle, gonad, adductor muscle and haemocytes. Tissue samples from three individuals were pooled to form a single replicate, and three replicates were generated for each tissue type.\u003c/p\u003e \u003cp\u003eTo investigate the mRNA expression patterns of \u003cem\u003eCg\u003c/em\u003eZIP1-II in response to zinc stimulation, 63 oysters were transferred into filtered seawater containing 1 mg/L of zinc. A stock solution of 1 g/L zinc was prepared by dissolving ZnSO\u003csub\u003e4\u003c/sub\u003e\u0026middot;7H\u003csub\u003e2\u003c/sub\u003eO in deionized water, and then added to the filtered seawater to achieve the final concentration. The seawater with the desired zinc concentration was completely renewed once a day. Nine individuals were randomly sampled at 0 h, 12 h, 24 h, 72 h, 7 d, 9 d and 14 d after zinc stimulation. The gill and hepatopancreas from three individuals were pooled to form a single replicate, and three replicates were generated for each time point.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 RNA isolation and cDNA synthesis\u003c/h2\u003e \u003cp\u003eThe total RNA was isolated from oyster tissues using the TRIzol reagent (Thermo Fisher Scientific, USA). The cDNA synthesis was conducted using a commercial kit (TransGen, China), and the resulting cDNA mixture was diluted to 1:20 for subsequent processing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e\u003cem\u003e2.4 Cloning and sequence analysis\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eThe sequence of \u003cem\u003eCg\u003c/em\u003eZIP1-II (LOC105346440) was retrieved from the NCBI database. The open reading frame (ORF) of \u003cem\u003eCg\u003c/em\u003eZIP1-II was cloned using primers \u003cem\u003eCg\u003c/em\u003eZIP1-II-F and \u003cem\u003eCg\u003c/em\u003eZIP1-II-R (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The PCR product was inserted into the pMD19-T plasmid (Takara, China) and verified by Sanger sequencing. The sequence characteristics were analyzed using Expasy, and the domain architecture was predicted using SMART and TMHMM. Phylogenetic analysis was conducted using MEGA 7.0 after performing a multiple sequence alignment with Clustal W.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Quantitative real-time PCR (qRT-PCR) analysis\u003c/h2\u003e \u003cp\u003eThe mRNA expression of \u003cem\u003eCg\u003c/em\u003eZIP1-II was examined by SYBR Green fluorescent qRT-PCR using primers \u003cem\u003eCg\u003c/em\u003eZIP1-II-RT-F and \u003cem\u003eCg\u003c/em\u003eZIP1-II-RT-R (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The mRNA expression was quantified using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method (Livak and Schmittgen, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e), with \u003cem\u003eCg\u003c/em\u003eEF (NM_001305313.2) as an internal reference.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primers used in the present study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer Sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCloning primers\u003c/p\u003e \u003cp\u003eqRT-PCR primers\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCg\u003c/em\u003eZIP1-II-F\u003c/p\u003e \u003cp\u003e\u003cem\u003eCg\u003c/em\u003eZIP1-II-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTTTGCCTTGTTGAGGA\u003c/p\u003e \u003cp\u003eGACTCTGCAAGACACGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEF-RT-F\u003c/p\u003e \u003cp\u003eEF-RT-R\u003c/p\u003e \u003cp\u003e\u003cem\u003eCg\u003c/em\u003eZIP1-II-RT-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGTCACCAAGGCTGCACAGAAAG\u003c/p\u003e \u003cp\u003eTCATATTTCTTTGATGT\u003c/p\u003e \u003cp\u003eAGTATCCTGTGACAGAGGCCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCg\u003c/em\u003eZIP1-II-RT-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGTCCTTGGTTTTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRecombinant expression primers\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epcDNA-\u003cem\u003eCg\u003c/em\u003eZIP1-II-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTACTCAAAGCTTATGGTGGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epcDNA-\u003cem\u003eCg\u003c/em\u003eZIP1-II-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTACTCAGGATCCATGGTTGACCTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRNA interference primers\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCg\u003c/em\u003eZIP1-II-Fi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGCUUCCAACUAGAAGAATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCg\u003c/em\u003eZIP1-II-Ri\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eUUCUUCUAGUUGGAAGCCCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Antibody preparation\u003c/h2\u003e \u003cp\u003ePolyclonal antibodies were generated by immunizing six-week-old female mice with a polypeptide fragment of \u003cem\u003eCg\u003c/em\u003eZIP1-II. Briefly, 100 \u0026micro;L of the \u003cem\u003eCg\u003c/em\u003eZIP1-II polypeptide fragment was used to immunize each mouse through four rounds of subcutaneous injection. The anti-\u003cem\u003eCg\u003c/em\u003eZIP1-II serum samples were obtained from the mice one week after the final injection. The specificity of the \u003cem\u003eCg\u003c/em\u003eZIP1-II polyclonal antibody was detected using Western blot with oyster haemocyte protein.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Immunocytochemical assay\u003c/h2\u003e \u003cp\u003eThe subcellular localization of \u003cem\u003eCg\u003c/em\u003eZIP1-II in oyster haemocytes was detected using immunocytochemical assay. After permeabilized with Triton-X, the haemocytes were incubated with \u003cem\u003eCg\u003c/em\u003eZIP1-II antibody (diluted to 1:1000) at 4 ℃ overnight, followed by incubation with Alexa Fluor 488-labeled Goat Anti-Mouse IgG (diluted to 1:1000; Beyotime, China) at room temperature for 1.5 h. After three washes with PBST, the cells were stained with Dil and DAPI, and observed under a fluorescence microscope (Zeiss, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Plasmid construction and cell transfection\u003c/h2\u003e \u003cp\u003eThe ORF of \u003cem\u003eCg\u003c/em\u003eZIP1-II was amplified using primers pcDNA-\u003cem\u003eCg\u003c/em\u003eZIP1-II-F and pcDNA-\u003cem\u003eCg\u003c/em\u003eZIP1-II-R, which contain the \u003cem\u003eHind\u003c/em\u003e III and \u003cem\u003eBamH\u003c/em\u003e I restriction sites, respectively (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The amplified product was digested with \u003cem\u003eHind\u003c/em\u003e III and \u003cem\u003eBamH\u003c/em\u003e I restriction enzymes at 37 ℃ for 1 h, and then inserted into the pcDNA3.1 (+) expression plasmid (Clontech, Japan). The recombinant plasmid pcDNA-\u003cem\u003eCg\u003c/em\u003eZIP1-II and empty plasmid pcDNA3.1(+) were transformed into DH5α competent cells (Sangon Biotech, China), and isolated from the positive transformants using an extraction kit (Tiangen Biotech, China).\u003c/p\u003e \u003cp\u003eHEK293T cells were cultured in Dulbecco's Modified Eagle's medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco, USA). Transfection was conducted using Entranster\u0026trade;-H4000 (Engreen, China), and the transfection efficiency was determined by Western blot at 48 h post transfection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Immunofluorescence and zinc measurement\u003c/h2\u003e \u003cp\u003eHEK293T cells were cultured in 24-well plates and transfected with either empty plasmid or pcDNA-\u003cem\u003eCg\u003c/em\u003eZIP1-II plasmid. After 48 h, the transfected cells were incubated with 5 \u0026micro;M FluoZin\u003csup\u003eTM\u003c/sup\u003e-3 (Thermo Fisher Scientific, USA) in medium without FBS for 30 min. The cells were then treated with 100 \u0026micro;M zinc for 6 h to determine intracellular zinc accumulation using fluorescence microscopy.\u003c/p\u003e \u003cp\u003eHEK293T cells were cultured in six-well plates and transfected with either empty plasmid or pcDNA-\u003cem\u003eCg\u003c/em\u003eZIP1-II plasmid for 48 h. Afterward, the cells were treated with or without 100 \u0026micro;M zinc for 24 h. After being scrapped off the plates, the cells were fragmented using a pulveriser (Scientz, China). The fragmented samples were digested with 14% trichloroacetic acid, then centrifuged to obtain the supernatants. Zinc content in the supernatant was quantified using a zinc quantification kit (Nanjing Jiancheng, China). Proteins concentration in each sample was quantified using the BCA method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 In vivo RNA interference (RNAi)\u003c/h2\u003e \u003cp\u003eSpecific siRNAs targeting \u003cem\u003eCg\u003c/em\u003eZIP1-II were synthesized (GenePharma, China) to inhibit its \u003cem\u003ein vivo\u003c/em\u003e expression. Eighteen oysters were randomly divided into two groups, with each group receiving an injection of 100 \u0026micro;L of siRNA (1 \u0026micro;g/\u0026micro;L in seawater) targeting \u003cem\u003eCg\u003c/em\u003eZIP1-II or a negative control (NC-RNAi). Three injections were administered at 24 h intervals to enhance the effectiveness and duration of RNAi. After the first injection, all individuals were placed in seawater containing 1 mg/L of zinc, with the seawater being replaced every 24 h to maintain a consistent zinc concentration. At 24 h post the third injection, the hepatopancreas was collected from each individual and freeze-dried to measure the zinc content according to previous description (Luo et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The tissues from three individuals were pooled to form a single replicate, and three replicates were generated for each group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 The blocking assay with anti-CgZIP1-II antibody\u003c/h2\u003e \u003cp\u003eEighteen oysters were employed for the blocking assay and randomly divided into two groups named as the control and blocking groups. Oysters in the blocking group were injected with 100 \u0026micro;L of anti-\u003cem\u003eCg\u003c/em\u003eZIP1-II antibody (3 \u0026micro;g/\u0026micro;L), while those in the control group received an equal volume of negative serum. After blocking for 1 h, the oysters were exposed to filtered seawater containing 1 mg/L of zinc. The hepatopancreas was collected at 3 h post zinc exposure to measure the zinc content as described in the RNAi assay. The tissues from three individuals were pooled to form a single replicate, and three replicates were generated for each group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Statistical analysis\u003c/h2\u003e \u003cp\u003eData were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Statistical analysis was performed using two-tailed \u003cem\u003et\u003c/em\u003e-test for pairwise comparisons or one-way ANOVA followed by Tukey's test for multiple comparisons. Significant difference was designated at \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Molecular characteristics of CgZIP1-II\u003c/h2\u003e \u003cp\u003eThe ORF of \u003cem\u003eCg\u003c/em\u003eZIP1-II was 960 bp, which encoded a polypeptide of 319 amino acids with a predicted molecular weight of 35.78 kDa. The protein sequence of \u003cem\u003eCg\u003c/em\u003eZIP1-II contained a ZIP structural domain with eight transmembrane domains (TMDs) (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e A and B). A histidine-rich sequence, HMHDHGHD, was identified in the long loop region located between TMDs III and IV of \u003cem\u003eCg\u003c/em\u003eZIP1-II. Multiple sequence alignment analysis revealed that \u003cem\u003eCg\u003c/em\u003eZIP1-II shared a 25.66–34.51% similarity with ZIP1s from other selected invertebrate and vertebrate species (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eA). The neighbor-joining (NJ) phylogenetic tree showed a clear separation between the ZIP1s from invertebrates and vertebrates. \u003cem\u003eCg\u003c/em\u003eZIP1-II was firstly clustered with ZIP1 from \u003cem\u003eMizuhopecten yessoensis\u003c/em\u003e and fell into the invertebrate branch (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e \u003cb\u003ePhylogenetic analysis of\u003c/b\u003e \u003cb\u003eCg\u003c/b\u003e\u003cb\u003eZIP1-II. (A) Multiple sequence alignment of\u003c/b\u003e \u003cb\u003eCg\u003c/b\u003e\u003cb\u003eZIP1-II with ZIP1s from\u003c/b\u003e \u003cb\u003eAplysia californica\u003c/b\u003e \u003cb\u003e(XP_005102658.1)\u003c/b\u003e, \u003cb\u003eBiomphalaria glabrata\u003c/b\u003e \u003cb\u003e(XP_055862056.1)\u003c/b\u003e, \u003cb\u003eDanio rerio\u003c/b\u003e \u003cb\u003e(NP_997748.2)\u003c/b\u003e, \u003cb\u003eDrosophila melanogaster\u003c/b\u003e \u003cb\u003e(NP_525107.1)\u003c/b\u003e, \u003cb\u003eHomo sapiens\u003c/b\u003e \u003cb\u003e(NP_001258886.1)\u003c/b\u003e, \u003cb\u003eMizuhopecten yessoensis\u003c/b\u003e \u003cb\u003e(XP_021342870.1)\u003c/b\u003e, \u003cb\u003eMus musculus\u003c/b\u003e \u003cb\u003e(NP_001398434.1)\u003c/b\u003e, \u003cb\u003eOctopus bimaculoides\u003c/b\u003e \u003cb\u003e(XP_014786465.1)\u003c/b\u003e, \u003cb\u003eRattus norvegicus\u003c/b\u003e \u003cb\u003e(XP_006232769.1) and\u003c/b\u003e \u003cb\u003eXenopus laevis\u003c/b\u003e \u003cb\u003e(XP_018087222.1). (B) Phylogenetic tree of\u003c/b\u003e \u003cb\u003eCg\u003c/b\u003e\u003cb\u003eZIP1-II with ZIP1s from\u003c/b\u003e \u003cb\u003eA\u003c/b\u003e. \u003cb\u003ecalifornica\u003c/b\u003e, \u003cb\u003eB\u003c/b\u003e. \u003cb\u003eglabrata\u003c/b\u003e, \u003cb\u003eD\u003c/b\u003e. \u003cb\u003ererio\u003c/b\u003e, \u003cb\u003eD\u003c/b\u003e. \u003cb\u003emelanogaster\u003c/b\u003e, \u003cb\u003eH\u003c/b\u003e. \u003cb\u003esapiens\u003c/b\u003e, \u003cb\u003eM\u003c/b\u003e. \u003cb\u003eyessoensis\u003c/b\u003e, \u003cb\u003eMus musculus\u003c/b\u003e, \u003cb\u003eO\u003c/b\u003e. \u003cb\u003ebimaculoides\u003c/b\u003e, \u003cb\u003eR\u003c/b\u003e. \u003cb\u003enorvegicus\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eX\u003c/b\u003e. \u003cb\u003elaevis\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Tissue distribution of CgZIP1-II mRNA\u003c/h2\u003e \u003cp\u003eThe mRNA transcripts of \u003cem\u003eCg\u003c/em\u003eZIP1-II were constitutively expressed in all examined oyster tissues, with the expression levels ranking from highest to lowest in hepatopancreas, gill, adductor muscle, haemocytes, mantle and gonad. The mRNA expression level of \u003cem\u003eCg\u003c/em\u003eZIP1-II in the hepatopancreas was 13.15-fold of that in the gonad (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.3 The temporal mRNA expression of CgZIP1-II in response to zinc stimulation\u003c/h2\u003e \u003cp\u003eThe mRNA expression levels of \u003cem\u003eCg\u003c/em\u003eZIP1-II in the hepatopancreas and gill were detected following exposure to 1 mg/L of zinc. In the hepatopancreas, the expression level of \u003cem\u003eCg\u003c/em\u003eZIP1-II decreased significantly at 12 h post zinc stimulation (0.05-fold of that at 0 h, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05) and maintained at low levels from 24 h to 14 d (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). In the gill, the expression level of \u003cem\u003eCg\u003c/em\u003eZIP1-II decreased significantly at 72 h (0.32-fold of that at 0 h, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05) and then recovered to basal level at 7 d to 14 d (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Preparation of polyclonal antibody and subcellular localization of CgZIP1-II in haemocytes\u003c/h2\u003e \u003cp\u003eThe specificity of the polyclonal antibody against \u003cem\u003eCg\u003c/em\u003eZIP1-II was examined using oyster haemocyte lysate. A distinct band with a similar molecular weight as \u003cem\u003eCg\u003c/em\u003eZIP1-II (35.78 kDa) was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA), indicating the high specificity of the polyclonal antibody. Subcellular localization of \u003cem\u003eCg\u003c/em\u003eZIP1-II in haemocytes was detected using immunocytochemical assay. The cell membrane was stained red with Dil, the nucleus was stained blue with DAPI, and \u003cem\u003eCg\u003c/em\u003eZIP1-II, conjugated with anti-\u003cem\u003eCg\u003c/em\u003eZIP1-II antibody and Alexa Fluor 488-labeled Goat Anti-Mouse IgG, was observed in green. The positive signals of \u003cem\u003eCg\u003c/em\u003eZIP1-II were mainly distributed in the plasma membrane of oyster haemocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Zinc transport function of CgZIP1-II\u003c/h2\u003e \u003cp\u003e \u003cem\u003eIn vitro\u003c/em\u003e cell transfection and \u003cem\u003ein vivo\u003c/em\u003e RNAi and antibody blocking experiments were conducted to investigate the role of \u003cem\u003eCg\u003c/em\u003eZIP1-II in zinc transport. In the cell transfection experiment, the transfection efficiency was verified by Western blot at 48 h post \u003cem\u003eCg\u003c/em\u003eZIP1-II transfection. A distinct band with a molecular weight of about 40 kDa was observed in the pcDNA-\u003cem\u003eCg\u003c/em\u003eZIP1-II transfection group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Zinc uptake was monitored by fluorescence following the interaction of intracellular zinc ion with FluoZin\u003csup\u003eTM\u003c/sup\u003e-3. At 6 h post incubation with 100 µM zinc, intense fluorescence was observed in HEK293T cells transfected with pcDNA-\u003cem\u003eCg\u003c/em\u003eZIP1-II, while no fluorescence was detected in cells that were either not transfected or transfected with an empty plasmid (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). After adding 10 µM TPEN (a zinc chelator) into the medium for 10 min, the fluorescence in cells transfected with pcDNA-\u003cem\u003eCg\u003c/em\u003eZIP1-II was significantly reduced. The zinc content in transfected cells was further measured using a zinc quantification kit. The zinc content increased significantly in cells transfected with pcDNA-\u003cem\u003eCg\u003c/em\u003eZIP1-II (15.16 mg/g protein) compared to cells transfected with empty plasmid (6.22 mg/g protein) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eRNAi was performed to confirm the role for \u003cem\u003eCg\u003c/em\u003eZIP1-II in zinc uptake. The mRNA expression of \u003cem\u003eCg\u003c/em\u003eZIP1-II in the hepatopancreas was significantly down-regulated (0.24-fold of that in the NC-RNAi group, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05) after siRNA treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). The zinc content in the hepatopancreas of the \u003cem\u003eCg\u003c/em\u003eZIP1-II-RNAi group decreased significantly to 0.58-fold of that in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe blocking assay showed that the zinc content in the hepatopancreas of \u003cem\u003eCg\u003c/em\u003eZIP1-II antibody treated oysters decreased significantly (0.57-fold of that in the negative serum treated oysters, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05) at 3 h post zinc exposure (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOysters are renowned for their extraordinary ability to accumulate zinc at concentrations that are several orders of magnitude higher than those in seawater (Jonathan et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Luo et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The highest zinc concentration was observed in the mantle and gill of \u003cem\u003eC. gigas\u003c/em\u003e, followed by the hepatopancreas (Kong et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). ZIP transporters have been demonstrated to be involved in zinc transport and uptake, which play a crucial role in maintaining zinc homeostasis within the body (Bafaro et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). A total of 19 ZIP homologues have been identified in the genome of \u003cem\u003eC. gigas\u003c/em\u003e (Kong et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, the specific proteins functionally responsible for zinc uptake remain to be investigated.\u003c/p\u003e\u003cp\u003eIn the present study, a ZIP1 homologue (\u003cem\u003eCg\u003c/em\u003eZIP1-II) was identified in \u003cem\u003eC. gigas\u003c/em\u003e, which contained a typical ZIP structural domain. Consistent with most ZIP proteins, \u003cem\u003eCg\u003c/em\u003eZIP1-II was predicted to have eight transmembrane domains, which may form a channel through which zinc ions can pass (Lichten and Cousins, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). A histidine-rich sequence (HMHDHGHD) was identified in the long loop region between TMDs III and IV of \u003cem\u003eCg\u003c/em\u003eZIP1-II. This is a common feature among ZIP proteins and the histidine-rich sequence is thought to have potential metal binding ability (Guerinot, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). Given its structural conservation with orthologs in other animals, \u003cem\u003eCg\u003c/em\u003eZIP1-II is predicted to have a similar functional characteristic. In the phylogenic tree, \u003cem\u003eCg\u003c/em\u003eZIP1-II was firstly clustered with ZIP1 from \u003cem\u003eM\u003c/em\u003e. \u003cem\u003eyessoensis\u003c/em\u003e, confirming the evolutionary conservation of \u003cem\u003eCg\u003c/em\u003eZIP1-II.\u003c/p\u003e\u003cp\u003eStudies in the mammals and fish have demonstrated that ZIP1 is ubiquitously expressed in a wide range of tissues and cell types, indicating its vital role in systemic zinc homeostasis (Dufner-Beattie et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Michalczyk and Ackland, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). In mice, ZIP1 exhibited the highest expression levels in the intestine and ovary (Dufner-Beattie et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Similarly, dominant expression of ZIP1 in the intestine was observed in pufferfish, highlighting its universal role in dietary zinc uptake (Qiu et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). In the present study, the mRNA transcripts of \u003cem\u003eCg\u003c/em\u003eZIP1-II were constitutively expressed in all examined tissues of \u003cem\u003eC. gigas\u003c/em\u003e, with higher expression levels in the hepatopancreas and gill. The hepatopancreas is the primary digestive tissue of oysters, while the gill is a crucial tissue in aquatic animals that facilitates direct absorption of zinc ions from water. The high expression levels of \u003cem\u003eCg\u003c/em\u003eZIP1-II in these two tissues suggested its involvement in zinc uptake from both dietary sources and the surrounding water. Moreover, the transcripts of \u003cem\u003eCg\u003c/em\u003eZIP1-II in the hepatopancreas and gill exhibited a significant decrease at 12 h and 72 h post zinc exposure, respectively. Similar findings were observed in human Caco-2 cells and yellow catfish hepatocytes, where the mRNA levels of ZIP1 were significantly down-regulated under excess zinc treatment (Chen et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Michalczyk and Ackland, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). This is regarded as a self-protective mechanism to mitigate the toxic effects of excess zinc accumulation. It was found that with prolonged zinc treatment, the zinc content in the hepatopancreas and gill of \u003cem\u003eC. gigas\u003c/em\u003e did not exhibit a linear increase but initially rose and then declined (Meng, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Subcellular localization analysis revealed that the \u003cem\u003eCg\u003c/em\u003eZIP1-II protein was mainly located at the plasma membrane of oyster haemocytes, which provided the functional basis for its role in importing zinc into the cell.\u003c/p\u003e\u003cp\u003eThe evidence that \u003cem\u003eCg\u003c/em\u003eZIP1-II functioned as an endogenous zinc uptake transporter was obtained through \u003cem\u003ein vitro\u003c/em\u003e overexpression experiment and \u003cem\u003ein vivo\u003c/em\u003e RNAi and antibody blocking experiments. Overexpression of \u003cem\u003eCg\u003c/em\u003eZIP1-II resulted in a 1.43-fold increase in the zinc content of HEK293 cells. Similarly, transfected CHSE-214 cells that overexpressed zebrafish \u003cem\u003eDr\u003c/em\u003eZIP1 accumulated about 1.6-fold higher zinc compared to the control cells after 90 min of zinc incubation (Qiu et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Research on human ZIP1 (hZIP1) also demonstrated that both PC-3 cells and K562 cells overexpressing hZIP1 exhibited increased zinc uptake and accumulation (Gaither and Eide, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Makhov et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). To further ascertain the role of \u003cem\u003eCg\u003c/em\u003eZIP1-II in zinc accumulation, the zinc content in oyster hepatopancreas was examined following the knockdown of \u003cem\u003eCg\u003c/em\u003eZIP1-II by RNAi. It was found that along with a 76% decrease in the mRNA expression of \u003cem\u003eCg\u003c/em\u003eZIP1-II, the zinc content in the hepatopancreas showed a 42% reduction compared to the control group. Consistent with the RNAi results, the antibody blocking experiment demonstrated that blocking \u003cem\u003eCg\u003c/em\u003eZIP1-II led to a 43% reduction in the zinc content in the hepatopancreas. These results suggested that \u003cem\u003eCg\u003c/em\u003eZIP1-II functioned as a zinc uptake transporter in \u003cem\u003eC. gigas\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eIn summary, a ZIP1 homologue \u003cem\u003eCg\u003c/em\u003eZIP1-II with a conserved ZIP domain was identified in the oyster \u003cem\u003eC. gigas\u003c/em\u003e. The mRNA expression of \u003cem\u003eCg\u003c/em\u003eZIP1-II was highest in the hepatopancreas and gill, which exhibited a significant decrease upon zinc exposure. The \u003cem\u003eCg\u003c/em\u003eZIP1-II protein was mainly localized at the plasma membrane and functioned as a zinc uptake transporter to facilitate cellular zinc accumulation in \u003cem\u003eC. gigas\u003c/em\u003e. These findings provide insights into the mechanisms of zinc uptake and accumulation in oysters, with potential implications for improving oyster health and zinc content.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflict of interest\u003c/h2\u003e\n\u003cp\u003eThe authors declare that there are no conflicts of interests.\u003c/p\u003e\n\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eThis research was supported by the National Natural Science Foundation of China (32202894 and 41961124009), the earmarked fund for China Agriculture Research System (CARS-49) and for Outstanding Talents and Innovative Team of Agricultural Scientific Research in MARA, the innovation team of Aquaculture Environment Safety from Liaoning Province (LT202009) and Dalian High Level Talent Innovation Support Program (2022RG14).\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eNing Kong: Conceptualization, Investigation, Writing - original draft, Funding acquisition; Cong Luo: Investigation, Data curation, Formal analysis, Visualization, Writing - original draft; Mengjia Wang: Investigation, Formal analysis; Junyan Zhao: Formal analysis, Visualization; Xiang Li: Investigation, Visualization; Lingling Wang: Supervision, Writing - review \u0026amp; editing, Funding acquisition; Linsheng Song: Supervision, Writing - review \u0026amp; editing, Funding acquisition.\u003c/p\u003e\n\u003ch2\u003eData Availability\u003c/h2\u003e\n\u003cp\u003eData is provided within the manuscript or supplementary information files.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBafaro E, Liu YT, Xu Y, Dempski RE (2017) The emerging role of zinc transporters in cellular homeostasis and cancer. Signal Transduct Tar 2\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen SW, Wu K, Lv WH, Song CC, Luo Z (2020) Molecular characterization of ten zinc (Zn) transporter genes and their regulation to Zn metabolism in freshwater teleost yellow catfish \u003cem\u003ePelteobagrus fulvidraco\u003c/em\u003e. J Trace Elem Med Bio 59\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDufner-Beattie J, Huang ZX, Geiser J, Xu WH, Andrews GK (2006) Mouse \u003cem\u003eZIP1\u003c/em\u003e and \u003cem\u003eZIP3\u003c/em\u003e genes together are essential for adaptation to dietary zinc deficiency during pregnancy. Genesis 44(5):239\u0026ndash;251\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDufner-Beattie J, Langmade SJ, Wang FD, Eide D, Andrews GK (2003) Structure, function, and regulation of a subfamily of mouse zinc transporter genes. J Biol Chem 278(50):50142\u0026ndash;50150\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan YG, Wu TY, Zhao LX, Jia RJ, Ren H, Hou WJ, Wang ZY (2024) From zinc homeostasis to disease progression: Unveiling the neurodegenerative puzzle. Pharmacol Res 199:107039\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFAO (2024) The State of World Fisheries and Aquaculture 2024: Towards Blue Transformation. Rome\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFranklin RB, Ma J, Zou J, Guan Z, Kukoyi BI, Feng P, Costello LC (2003) Human ZIP1 is a major zinc uptake transporter for the accumulation of zinc in prostate cells. J Inorg Biochem 96(2\u0026ndash;3):435\u0026ndash;442\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGaither LA, Eide DJ (2001) The human ZIP1 transporter mediates zinc uptake in human K562 erythroleukemia cells. J Biol Chem 276(25):22258\u0026ndash;22264\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuerinot ML (2000) The ZIP family of metal transporters. Biochim Biophys Acta Biomembr 1465(1\u0026ndash;2):190\u0026ndash;198\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJonathan MP, Mu\u0026ntilde;oz-Sevilla NP, G\u0026oacute;ngora-G\u0026oacute;mez AM, Varela RGL, Sujitha SB, Escobedo-Ur\u0026iacute;as DC, Rodr\u0026iacute;guez-Espinosa PF, Villegas LEC (2017) Bioaccumulation of trace metals in farmed pacific oysters \u003cem\u003eCrassostrea gigas\u003c/em\u003e from SW Gulf of California coast, Mexico. Chemosphere 187, 311\u0026ndash;319\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKambe T, Hashimoto A, Fujimoto S (2014) Current understanding of ZIP and ZnT zinc transporters in human health and diseases. Cell Mol Life Sci 71:3281\u0026ndash;3295\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKong N, Zhao Q, Liu C, Li JX, Liu ZQ, Gao L, Wang LL, Song LS (2020) The involvement of zinc transporters in the zinc accumulation in the Pacific oyster \u003cem\u003eCrassostrea gigas\u003c/em\u003e. Gene 750\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLichten LA, Cousins RJ (2009) Mammalian zinc transporters: nutritional and physiologic regulation. Ann Rev Nutr 29:153\u0026ndash;176\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2\u003csup\u003e\u0026ndash;∆∆Ct\u003c/sup\u003e method. Methods 25(4):402\u0026ndash;408\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo C, Kong N, Li X, Sun SQ, Jiang CY, Qiao X, Wang LL, Song LS (2024) The c.503A\u0026thinsp;\u0026gt;\u0026thinsp;G polymorphism in ZIP1-II of Pacific oyster \u003cem\u003eCrassostrea gigas\u003c/em\u003e associated with zinc content. Comp Biochem Phys B 273\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMakhov P, Golovine K, Uzzo RG, Wuestefeld T, Scoll BJ, Kolenko VM (2009) Transcriptional regulation of the major zinc uptake protein hZip1 in prostate cancer cells. Gene 431(1\u0026ndash;2):39\u0026ndash;46\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeng J (2013) The genome responses and MTF-1 regulation mechanism to heavy metal stress in oyster. Ph.D. thesis, Institute of Oceanology, Chinese Academy of Sciences, Qingdao, China\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMichalczyk AA, Ackland ML (2013) hZip1 (hSLC39A1) regulates zinc homoeostasis in gut epithelial cells. Genes Nutr 8(5):475\u0026ndash;486\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePadoan F, Piccoli E, Pietrobelli A, Moreno LA, Piacentini G, Pecoraro L (2024) The role of zinc in developed countries in pediatric patients: a 360-degree view. Biomolecules 14(6):718\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePlum LM, Rink L, Haase H (2010) The essential toxin: impact of zinc on human health. Int J Env Res Pub He 7(4):1342\u0026ndash;1365\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQin QH, Wang XX, Zhou B (2013) Functional studies of \u003cem\u003eDrosophila\u003c/em\u003e zinc transporters reveal the mechanism for dietary zinc absorption and regulation. BMC Biol. 11\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiu A, Shayeghi M, Hogstrand C (2005) Molecular cloning and functional characterization of a high-affinity zinc importer (\u003cem\u003eDr\u003c/em\u003eZIP1) from zebrafish (\u003cem\u003eDanio rerio\u003c/em\u003e). Biochem J 388(3):745\u0026ndash;754\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWessels I, Maywald M, Rink L (2017) Zinc as a gatekeeper of immune function. Nutrients 9(12):1286\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"marine-biotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mbte","sideBox":"Learn more about [Marine Biotechnology](http://link.springer.com/journal/10126)","snPcode":"10126","submissionUrl":"https://submission.nature.com/new-submission/10126/3","title":"Marine Biotechnology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Crassostrea gigas, Zinc accumulation, Zinc transporter, CgZIP1-II","lastPublishedDoi":"10.21203/rs.3.rs-5058990/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5058990/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe Pacific oyster \u003cem\u003eCrassostrea gigas\u003c/em\u003e is known to have an exceptional ability to accumulate zinc, which endows it with robust resistance to pathogens and makes it an excellent source of dietary zinc. ZIP1 has been identified as an important zinc uptake protein in other species, but its role in oysters remains unclear. In the present study, a ZIP1 homologue (\u003cem\u003eCg\u003c/em\u003eZIP1-II) of the Zrt/Irt-like protein (ZIP) family was identified in \u003cem\u003eC\u003c/em\u003e. \u003cem\u003egigas\u003c/em\u003e. The mRNA transcripts of \u003cem\u003eCg\u003c/em\u003eZIP1-II were constitutively expressed in examined tissues of \u003cem\u003eC. gigas\u003c/em\u003e, with higher levels in the hepatopancreas and gill. After zinc exposure, the mRNA transcripts of \u003cem\u003eCg\u003c/em\u003eZIP1-II in the hepatopancreas showed a significant decline from 12 h to 14 d, while those in the gill significantly decreased at 72 h, then followed by a recovery to basal levels at 7 d to 14 d. Immunocytochemical analysis revealed that the \u003cem\u003eCg\u003c/em\u003eZIP1-II protein was mainly located at the plasma membrane of oyster haemocytes. Compared to the control cells, overexpression of \u003cem\u003eCg\u003c/em\u003eZIP1-II in the transfected HEK293 cells resulted in a 2.44-fold (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) increase in zinc content after incubation with 100 \u0026micro;M zinc for 24 h. Inhibition of endogenous \u003cem\u003eCg\u003c/em\u003eZIP1-II expression with siRNAs led to a 42% reduction in zinc content in the hepatopancreas of oysters. Similarly, \u003cem\u003ein vivo\u003c/em\u003e blocking of \u003cem\u003eCg\u003c/em\u003eZIP1-II with anti-\u003cem\u003eCg\u003c/em\u003eZIP1-II antibody caused a 43% decrease in zinc content in the hepatopancreas. These results collectively indicated that \u003cem\u003eCg\u003c/em\u003eZIP1-II functioned as a zinc uptake transporter in \u003cem\u003eC. gigas\u003c/em\u003e and played an important role in zinc accumulation.\u003c/p\u003e","manuscriptTitle":"A zinc uptake transporter ZIP1-II is involved in zinc accumulation in the hepatopancreas of Pacific oyster Crassostrea gigas","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-06 11:47:28","doi":"10.21203/rs.3.rs-5058990/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-10-22T20:39:39+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-22T19:51:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"302582957252905449737131481724784919312","date":"2024-09-26T04:43:10+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-09-23T08:46:26+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"122447489585812852711996835231696740857","date":"2024-09-18T00:54:52+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"162248015521305689793400127683325737558","date":"2024-09-16T23:15:25+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-09-16T15:25:10+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-09-16T11:04:35+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-09-16T11:02:43+00:00","index":"","fulltext":""},{"type":"submitted","content":"Marine Biotechnology","date":"2024-09-09T15:10:04+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"marine-biotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mbte","sideBox":"Learn more about [Marine Biotechnology](http://link.springer.com/journal/10126)","snPcode":"10126","submissionUrl":"https://submission.nature.com/new-submission/10126/3","title":"Marine Biotechnology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"93e90e77-a279-4c47-9fe3-b981797128d6","owner":[],"postedDate":"November 6th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-12-02T17:23:25+00:00","versionOfRecord":{"articleIdentity":"rs-5058990","link":"https://doi.org/10.1007/s10126-024-10379-9","journal":{"identity":"marine-biotechnology","isVorOnly":false,"title":"Marine Biotechnology"},"publishedOn":"2024-11-27 15:58:17","publishedOnDateReadable":"November 27th, 2024"},"versionCreatedAt":"2024-11-06 11:47:28","video":"","vorDoi":"10.1007/s10126-024-10379-9","vorDoiUrl":"https://doi.org/10.1007/s10126-024-10379-9","workflowStages":[]},"version":"v1","identity":"rs-5058990","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5058990","identity":"rs-5058990","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}