Expression patterns and functional exploration of CO 2 receptor genes in Anopheles sinensis (Diptera: Culicidae)

preprint OA: closed
Full text JSON View at publisher
AI-generated deep summary by claude@2026-07, 2026-07-04 · read from full text

This preprint studied the CO2 receptor genes (CRGs) AsinGR22, AsinGR23, and AsinGR24 in the malaria vector Anopheles sinensis, using genome mining and protein-based characterization, maximum-likelihood phylogenetic analysis across multiple dipteran species, RT-qPCR of expression in different tissues and sexes, and RNA interference to test functional roles in CO2 detection and mosquito behaviors. The authors found three mosquito CRGs that cluster into groups (GR1, GR2, GR3), with GR2 being mosquito-specific, and reported that all three AsinCRGs are specifically expressed in female maxillary palps; AsinGR22 and AsinGR24 are up-regulated in females and all three are down-regulated after blood feeding. RNAi showed that AsinGR22 and AsinGR24 mediate female adult capacity for CO2 detection, while AsinGR23 may act as a regulatory factor rather than a functional receptor, and none of the genes affected blood-feeding behavior. The study is an unpeer-reviewed preprint. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Carbon dioxide (CO 2 ), as a chemical signal, plays an essential role for the host-seeking of mosquitoes, and CO 2 receptor genes (CRGs) have been proposed to be responsible of the host-seeking behavior in some insects. However, the expression patterns of CRGs have yet to explore, and the function in host-seeking behavior response has only limitedly understood. In this study, we investigated the characteristics, phylogenetics, expression patterns, and function of three CRGs in An. sinensis . The CRGs from six mosquito and four other dipteran species were identified and phylogenetically classified in three groups, and all mosquitoes have three CRGs that are classified into GR1, GR2 and GR3 with GR2 being specific for mosquitoes, and other dipteran insects have only two CRGs that are classified into GR1 and GR3. All three CRGs were specifically expressed in maxillary palps in An. sinensis ; however, only AsinGR22 and AsinGR24 were significantly up-regulated in females than in males, and all three CRGs were significantly down-regulated post blood feeding. Functional analysis using RNAi revealed that AsinGR22 and AsinGR24 mediate the capacity for CO 2 detection of female adults, but AsinGR23 might enhance the capacity as a regulatory factor rather than a functional gene. All these three genes demonstrated no influence to blood feeding behavior. This is the first comprehensive study on CRGs in An. sinensis . This study revealed the function of CRGs in CO 2 detection and blood-sucking behavior, and provided a comprehensive information frame for further research on function and application of CRGs in mosquitoes.
Full text 121,695 characters · extracted from preprint-html · click to expand
Expression patterns and functional exploration of CO 2 receptor genes in Anopheles sinensis (Diptera: Culicidae) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Expression patterns and functional exploration of CO 2 receptor genes in Anopheles sinensis (Diptera: Culicidae) Xiao Mou, Feng-Ling Si, Shuang Ren, Chao Song, Bin Chen This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6979096/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Carbon dioxide (CO 2 ), as a chemical signal, plays an essential role for the host-seeking of mosquitoes, and CO 2 receptor genes (CRGs) have been proposed to be responsible of the host-seeking behavior in some insects. However, the expression patterns of CRGs have yet to explore, and the function in host-seeking behavior response has only limitedly understood. In this study, we investigated the characteristics, phylogenetics, expression patterns, and function of three CRGs in An. sinensis . The CRGs from six mosquito and four other dipteran species were identified and phylogenetically classified in three groups, and all mosquitoes have three CRGs that are classified into GR1, GR2 and GR3 with GR2 being specific for mosquitoes, and other dipteran insects have only two CRGs that are classified into GR1 and GR3. All three CRGs were specifically expressed in maxillary palps in An. sinensis ; however, only AsinGR22 and AsinGR24 were significantly up-regulated in females than in males, and all three CRGs were significantly down-regulated post blood feeding. Functional analysis using RNAi revealed that AsinGR22 and AsinGR24 mediate the capacity for CO 2 detection of female adults, but AsinGR23 might enhance the capacity as a regulatory factor rather than a functional gene. All these three genes demonstrated no influence to blood feeding behavior. This is the first comprehensive study on CRGs in An. sinensis . This study revealed the function of CRGs in CO 2 detection and blood-sucking behavior, and provided a comprehensive information frame for further research on function and application of CRGs in mosquitoes. Biological sciences/Biochemistry Biological sciences/Molecular biology Anopheles sinensis CO2 receptor gene characteristics phylogenetics expression pattern function Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Carbon dioxide (CO 2 ) is ubiquitous in the natural environment. It is not merely one of the principal raw materials for photosynthesis in plants but also serves as a chemical signal to mediate insect behaviors such as feeding and oviposition 1 , 2 , 3 . For example, haemophagous insects use CO 2 to locate their hosts 4 , lepidopteran insects utilize CO 2 to assess the quality of flowers 5 and herbivorous insects take CO 2 as a significant cue for feeding and oviposition 6 . For hemophagous insects, like mosquitoes, CO 2 , heat and human odors are capable of guiding blood-feeding females to their hosts 7 . The receptor cells responsible for the detection of CO 2 in insects are located in the antennae of flies, the maxillary palps of mosquitoes, and the labial palps of lepidopteran insects 8 , 9 , 10 . The molecular mechanism of CO 2 detection in insects was first revealed in Drosophila melanogaster , where two gustatory receptor genes, DmelGR21a and DmelGR63a , are co-expressed in ab1C neuron of the Dr. melanogaster antennae 11 . The D. melanogaster could sense CO 2 only when the two genes are co-expressed, and could not sense CO 2 when either gene is expressed independently. These two receptors, which are thought to be a heterodimeric receptor, jointly perform the function of sensing CO 2 . Mosquitoes are main threat for human being health, due to transmission of a large number of diseases, including malaria, dengue fever, chikungunya fever, lymphatic filariasis and epidemic encephalitis B 12 , 13 . In mosquitoes, three CRGs ( AgamGR22 , AgamGR23 and AgamGR24 ) have been identified in An. gambiae , which were co-expressed in the cpA neuron of the maxillary palps by in situ hybridization 14 . Orthologs of these three CO 2 receptors have subsequently been identified in Aedes aegypti , Culex pipiens , Cx. quinquefasciatus , and Aedes albopictus 15 , 16 , 17 , 18 . An investigation showed that the AgamGR22 and AgamGR24 in An. gambiae produced a significant response to CO 2 when co-expressed in Drosophila empty neurons, and this response was enhanced by AgamGR23 14 Three CRGs in Ae. aegypti were co-expressed in maxillary palps, and knockdown of AaegGR1 or AaegGR3 led to the loss of CO 2 sensitivity in both male and female mosquitoes using RNAi, while knockdown of AaegGR2 had no impact on CO 2 perception 19 . The combination expression of CquiGR2 and CquiGR3 had the greatest response to sodium bicarbonate solution, and CquiGR1 may be a regulatory factor in Cx. quinquefasciens 20 . These findings emphasize the conserved and specific role of CRGs in different mosquito species. However, the molecular mechanisms of CRGs remain poorly understood in different mosquito species. Although the importance of CO 2 in the long-distance host seeking of mosquitoes has been confirmed, the expression patterns of CRGs in different sensing organs and their its impact on the blood-sucking behavior of mosquitoes has yet to explore. An. sinensis is a vital malaria vector in China and other Southeast Asian countries, and also transmits lymphatic filariasis 7 . In recent years, our laboratory has sequenced and annotated the genome of An. sinensis 21 , 22 , and conducted systematical studies on the molecular mechanism of insecticide resistance using An. sinensis as a model species 23 . In earlier study, we have identified a total of 54 gustatory receptor genes in the genome of An. sinensis , which including three CRGs ( AsinGR22 , AsinGR23 and AsinGR24 ) in the subfamily of the taste receptors 24 . However, little is known about the characterization and expression patterns of these three genes, and their function in response of CO 2 exploration. In this study, we conducted characteristics and phylogenetic analysis of these three CRGs, and investigated their expression patterns using RT-qPCR in An. sinensis . More importantly, we revealed their function in behavior response for CO 2 exploration and blood sucking using RNAi. This study lays a crucial foundation for further functional exploration and application of the CRGs in mosquitoes. Materials and Methods Mosquitos rearing, sequence retrieving, and sample collecting The WX-LS strain of An. sinensis in the Institute of Insect and Molecular Biology, Chongqing Normal University was reared at 27 ± 1℃, 70 ± 10% relative humidity and 12 h: 12 h (light: dark). Eggs were hatched in dechlorinated water, and larvae were fed fish feed. Adult mosquitoes were reared on a 10% glucose solution. The genome data, and CO 2 receptor gene and protein sequences of An. sinensis used in this study were obtained from the Institute of Insect and Molecular Biology, Chongqing Normal University 21 , 22 . Amino acid sequences of other known dipteran CO 2 receptors used to perform phylogenetic analysis were downloaded from NCBI ( https://www.ncbi.nlm.nih.gov/ ) and Vectorbase ( https://vectorbase.org/ ) databases. The gene expression patterns of three CRGs were analyzed for male and female adults, four tissues of adults (maxillary palp, proboscises, antennae, and leg), and female adults both before and post blood feeding. Three female or male adult (3 days old), maxillary palps and proboscises of 160 females, antennae of 200 females, and legs of 40 females were collected, immediately stored in RNAlater, and used as a single sample for expression analysis. Characteristics and phylogenetic analysis of CO 2 receptor genes The number of amino acids, molecular weight, isoelectric point and hydrophilicity of the CO 2 receptors were analyzed using ExPASy ProtParam ( https://web.expasy.org/protparam/ ). The transmembrane region of CO 2 receptors was predicted by TMHMM ( http://www.cbs.dtu.dk/services/TMHMM-2.0/ ). Introns and exons were displayed from the genome sequence and coding sequence of the CRGs using GSDS ( http://gsds.cbi.pku.edu.cn/ ). The genome distribution of CRGs in An. sinensis was mapped using MG2C ( http://mg2c.iask.in/mg2c_v2.1/ ). The amino acid sequences of AsinGR22 , AsinGR23 and AsinGR24 were phylogenetically analyzed with other known dipteran insects CO 2 receptors from An. gambiae , Ae. aegypti , Ae. albopictus , Cx. quasifasciatus and Cx. pipiens , Dr. melanogaster , Musca domestica , Chrysomya megacephala , Ceratitis capitate 14 , 15 , 16 , 17 , 18 , 25 (Table 1 ). The maximum-likelihood phylogenetic tree was constructed based on Jones-Taylor-Thornton (JTT) model and 1000 bootstrap replications by MEGA 11.0 26 . Table 1 Accession numbers of amino acids of dipteran CO 2 receptor genes used in this study. Species CO 2 receptor Accession number Anopheles sinensis AsinGR22 An.sin09348 AsinGR23 An.sin04137 AsinGR24 An.sin04919 Anopheles gambiae AgamGR22 XP_319142.1 AgamGR23 XP_312786.1 AgamGR24 ABK97614.1 Culex quinquefasciatus CquiGR22 XP_001848097.1 CquiGR6 XP_001848828.1 CquiGR24 XP_001848689.1 Aedes aegypti AaegGR21a XP_001655150.1 AaegGR2 XP_001654839.1 AaegGR63a XP_001660602.1 Culex pipiens CpipGR1 XP_039432013.1 CpipGR2 XP_039448054.1 CpipGR3 XP_039446312.1 Aedes albopictus AalbGR1 AALF013834-RA AalbGR2 AALF019900-RA AalbGR3 AALF019265-RA Musca domestica MdomGR1 AFH96948.1 MdomGR2 NP_001273828.1 Chrysomya megacephala CmegGR1 AFH96947.1 CmegGR2 AFH96946.1 Ceratitis capitata CcapGR21a XP_004517826.1 CcapGR63a XP_004524608.1 Drosophila melanogaster DmelGR21a NP_523448.1 DmelGR63a ABK97613.1 Real-time quantitative PCR RT-qPCR was carried out on a thermal cycler (CFX, Bio-Rad, USA) with three biological and technological repeats applied for each analysis, and gene-specific primers were designed with Primer Premier 5.0 (Table 2 ). Total RNA extraction, cDNA template synthesis, and RT-qPCR experiments were performed according to the manufacturer's protocol. The cycling conditions for RT-qPCR were as follows: 94℃ for 30 s; 40 cycles of 94℃ for 5 s and 60℃ for 30 s. The internal reference genes were the ribosomal protein S7 ( RPS7 ). The relative expression level of the target gene in the sample compared to the control sample was calculated using the 2 −ΔΔCt method 27 . The one-way analysis of variance (ANOVA) was employed for statistical analysis and the Tukey test (at P < 0.05) for statistical significance using the SPSS 27.0. Table 2 Primers used for RT-qPCR and RNA interference Primers Primer sequences (5′−3′) AsinGR22 F: GCTACGCAGAAGGAGGTGGAA R: GGATAGGTTTGCTTTAAGGGAGG AsinGR23 F: AAGGACGAGCGGATGGTAAACG R: CCTCGGAATAGCACAAGCAGTAGC AsinGR24 F: GGCGAAGATACTGGCGGAAGA R: GGTAAAGGTGTAGCAGGTGGAGAAC dsEGFP-T7 F: TAATACGACTCACTATAGGGAGACGTAAACGGCCACAAGTTC R: TAATACGACTCACTATAGGGAGAGCTCAGGTAGTGGTTGTC dsAsinGR22-T7 F: TAATACGACTCACTATAGGGAGATATCTCGACCAACGACAAGC R: TAATACGACTCACTATAGGGAGAACCAAAGACTACAGAACCCATT dsAsinGR23-T7 F: TAATACGACTCACTATAGGGAGATTCCAGACCACGACCCAG R: TAATACGACTCACTATAGGGAGAATGCCACGGCTGTTGATG dsAsinGR24-T7 F: TAATACGACTCACTATAGGGAGAAGGTCGCGTACCGTAAGAC R: TAATACGACTCACTATAGGGAGAAAAGGTGTAGCAGGTGGAGA RNA interference RNAi and behavioral experiments were carried out using female WX-LS strain of mosquitoes to investigate the function of the three target genes in the detection of CO 2 in An. sinensis . Specific primers were designed using primer premier 5.0 (Table 2 ), and the enhanced green fluorescent protein (EGFP) was employed as a control in this experiment. The dsRNA fragments of AsinGR22 , AsinGR23 , AsinGR24 and EGFP were synthesized in vitro using T7 RiboMAX ™ Express RNAi System (Promega) kit. The dsRNA fragment concentration was determined using Nano-Drop™ 1000 (Thermo Fisher Scientific Inc, USA). Female pupae (< 24 h old) were injected with 800 ng dsRNA at the junction of second and third ventral segments, and the control group was injected with the same amount of ds EGFP . RT-qPCR was employed to assess the interference efficiency of the target genes after silencing. Behavior experiments A Y-shaped glass tube olfactometer was used for the determination of response of female mosquitoes to CO 2 after RNA interference 28 . Human-exhaled CO 2 was used as the CO 2 source, and 10 female mosquitoes (3 days old) after RNAi were selected to assess their response to CO 2 using the Y-shaped olfactometer. Before the test commenced, these mosquitoes to be tested were placed in the Y-olfactometer to adapt for 1 min. One end of the Y-olfactometer was gently exhaled through the nose for 5 s every 30 s to provide a CO 2 source, while the other end remained blank 29 . The number of mosquitoes at both ports was counted after 5 min. To eliminate positional differences, the experimental and control ports should exchange positions. Next, we also investigated the effects of silencing these three genes on blood feeding in female mosquitoes. In our experiment, mice were used as the blood source, 15 female mosquitoes (3 days old) that had mated and fasted for 10–12 h after RNAi were selected. The anesthetized mice were used to feed these female mosquitos, the number of blood-sucking and non-blood-sucking mosquitoes were counted after 10 min. Results and discussion Characteristics and phylogenetics of CO 2 receptor genes The numbers of amino acids of AsinGR22 , AsinGR23 and AsinGR24 are 466, 569 and 456 based on our analysis, respectively, and their proteins predicted all have seven transmembrane regions (Table 3 ). Both the AsinGR23 and AsinGR24 genes are located on chromosome 1 with each having three exons and two introns, whereas the AsinGR22 on chromosome 2 with five exons and four introns (Fig. 1 ). Previous studies have revealed the genetic coding characteristics of insect olfactory receptors (ORs) and gustatory receptors (GRs), which typically consist of seven transmembrane domains (TMDs) with the N-terminus located intracellularly and the C-terminus extracellularly 30 . In this study, the CO 2 receptor protein of An. sinensis was also found to possess seven transmembrane regions, a finding consistent with earlier research on CO 2 receptors in other insects 31 , 32 , 33 . This suggests that the structure of CO 2 receptor proteins may be somewhat conserved among insects, which holds significant implications for understanding how insects perceive environmental carbon dioxide. Table 3 Characteristics of CO 2 receptor genes in An. sinensis Gene Gene ID CDS Length Number of amino acids Molecular weight (kD) Isoelectric point Hydrophilicity Transmembrane region AsinGR22 An.sin09348 1 401 466 54.14 8.92 0.115 7 AsinGR23 An.sin04137 1 710 569 64.47 6.57 0.323 7 AsinGR24 An.sin04919 1 371 456 51.77 8.32 0.348 7 All six mosquito species investigated in this study have three CO 2 receptors genes, whereas four other dipteran insects have only two CO 2 receptors genes. Phylogenetic analysis of the all these CRGs shows that they are divided into three groups (GR1, GR2 and GR3), with each group being supported by 100% of bootstrap value (Fig. 2 ). The three CRGs from each mosquito species are classified into each group; however, two CRGs from each other dipteran insect are classified in GR1 and GR3. This result proposes that the GR2 is specific for mosquitoes, which might stem from recent gene duplication. Notably, dipteran insects such as Dr. melanogaster , M. domestica , C. megacephala , Dr. simulans , and C. capitata , possess only two CRGs 16 , 25 , whereas mosquitoes have three CRGs 15 , 16 , 17 , 18 . The presence of an additional CO 2 receptor gene in mosquitoes may be linked to their specific ecological adaptations, particularly the requirement to detect host CO 2 emissions for blood-feeding. Future research should focus on the functional characterization of these genes to elucidate their roles in CO 2 detection and the potential implications for vector control strategies. Expression patterns of CO 2 receptor genes in An. sinensis The analysis of expression patterns demonstrated that all three CRGs were expressed in both sexes, with the expression level of AsinGR24 (110.32-fold) and AsinGR22 (19.58-fold) were significantly higher in females than in males, while that of AsinGR23 (1.65-fold) had no significant difference (Fig. 3 a- 3 c). AsinGR22 is homologous to CquiGR1 and AaegGR1 , AsinGR24 to CquiGR3 and AaegGR3 , and AsinGR23 to AaegGR2 and CquiGR2 . Earlier study showed that the CquiGR1 or CquiGR3 in Cx. quinquefasciatus also was significantly upregulated in females than in males, respectively 19 . The expressions of AsinGR22 and AsinGR24 , as well as CquiGR1 and CquiGR3 , are significantly higher in female adults than in males. This may be closely related to the blood-feeding behavior characteristic of female mosquitoes. CO 2 is a critical clue for female mosquitoes to locate their hosts 34 , 35 . These two highly expressed CRGs likely enhance the sensitivity of female mosquitoes to CO 2 released by hosts, enabling them to accurately locate hosts in complex environments. In contrast, male mosquitoes mainly feed on nectar. The concentration of CO 2 released from nectar sources differs from that produced by animal respiration, and nectar localization also depends on volatile substances such as floral scents. Therefore, male mosquitoes do not need high sensitivity to CO 2 , explaining the relatively low expression levels of these two genes in males. Interestingly, the AaegGR1 and AaegGR3 in Ae. aegypti were significantly down-regulated in males than in females 19 . The up-regulated expression of AaegGR1 / GR3 in males may reflect ecological adaptations that enable them to utilize CO 2 for locating nectar in specific environments or engaging in courtship behaviors 36 , 37 . The expression of AsinGR23 showed no significant difference between males and females, which might be due to its role as a regulatory factor rather than a functional gene. The molecular basis underlying the sex-differential expression of CO₂ receptor genes remains unclear, highlighting the need for further investigation into gene functions and regulatory mechanisms. Tissue expression analysis showed that all three CO 2 receptor genes ( AsinGR22 , AsinGR23 and AsinGR24 ) were specifically expressed in maxillary palps (Fig. 4 a- 4 c). This discovery is consistent with previous research findings on the CRGs of mosquitoes 38 , 39 , further confirming the critical role of maxillary palps in the CO 2 sensing process of mosquitoes. The maxillary palps, as an essential olfactory organ of mosquitoes, is densely populated with a large number of olfactory sensory neurons. Their surface CO 2 receptors precisely detect CO 2 in the environment and regulate key behaviors such as seeking a host (sucking blood) and courtship 38 , 40 . In contrast, Drosophila possess only two CRGs, which are expressed in their antennae, the primary organs for sensing external chemical signals. This expression pattern adapts with their feeding habits, such as consuming rotten fruits and locating food sources in complex odor environments 8 The three CRGs in mosquitoes are predominantly expressed in the maxillary palps. Compared to antennae, the maxillary palp may have higher sensitivity and specificity to CO 2 signals, closely linked to the survival strategy of mosquitoes that rely on CO 2 to locate hosts and complete blood-sucking reproduction 14 , 33 , 41 . In moths ( Helicoverpa armigera , Hyphantria cunea , and Manduca sexta ), the CRGs are expressed in the labial palps 10 , 42 , 43 . Labial palps play a crucial role in moth behaviors, including nectar search and egg-laying. Moreover, the concentration of CO 2 also influences the perception of sex pheromones by moths 44 . These differences reflect evolutionary adaptations in CO₂ detection mechanisms across insect species. Our findings confirmed the key role of maxillary palps in the detection of CO₂ in mosquitoes, providing a basis for further research on the CO₂ signal transduction mechanism of maxillary palp neurons. We also conducted an analysis of three CRGs expression levels in females before and post blood feeding. The findings revealed that the expression levels of these genes ( AsinGR22 , AsinGR23 , and AsinGR24 ) were significantly down-regulated at 1 h, 12 h, 24 h, and 48 h post blood feeding compared with non-blood-fed females (Fig. 4 d- 4 f). This suggests that these three genes are crucial for female mosquitoes in host-seeking behavior. In mosquitoes, CO 2 serves as a critical cue for adult mosquitoes to search nectar sources for their flight and survival energy. Female mosquitoes additionally rely on CO 2 to locate their hosts for the nutrients required for reproduction 45 , 46 . Some studies have demonstrated that CO 2 , heat and odorants, play a significant role in female mosquito host-seeking behavior 47 , 48 , 49 . This indicates that the three CO 2 -related genes play a significant role in the host-seeking process of female mosquitoes. Function in CO 2 -responsing behavior of CO 2 receptor genes in An. sinensis Functional studies on CO 2 -responsing behavior of these three genes showed that the RNAi down-regulated the expression of AsinGR22 , AsinGR23 and AsinGR24 by approximately 66.01%, 65.70%, and 40.68%, respectively (Fig. 5 a- 5 c). AsinGR22 - and AsinGR24 -silenced female adults significantly reduced the sensitivity to CO 2 by 34.17% and 25%, respectively, compared with control injected with dsEGFP in the test using a Y-tube olfactometer; however, AsinGR23 -silenced female adults did not (Fig. 5 d- 5 f). Although these two genes ( AsinGR22 and AsinGR24 ) were not completely knocked out, the reduction in their expression was sufficient to affect CO 2 detection, indicating their critical role in CO 2 sensing in An. sinensis . In contrast, no significant reduction to CO 2 sensitivity in AsinGR23 -silenced females suggests that this gene may not be directly involved in CO 2 perception. The involvement of AsinGR23 in CO₂ detection could depend on its interaction with AsinGR22/24, potentially stabilizing the receptor or enhancing signal transduction. This result is similar to the reported function of CRGs in An. gambiae and Ae. Aegypti 14 , 19 . Similar findings have been observed in other phytophagous insects. For example, in He. armigera , only the co-expression of HarmGR1 and HarmGR3 , and HarmGR1 , HarmGR2 and HarmGR3 strongly reacted to sodium bicarbonate (NaHCO 3 ), suggesting that HarmGR1 and HarmGR3 are essential for CO 2 perception in the species, while the role of HarmGR2 remains unclear 10 . In Hy. cunea , HcunGR1 and HcunGR3 produced a strong response to CO 2 only when they were co-expressed in Xenopus oocytes, whereas HcunGR2 exhibited an inhibitory effect on CO 2 perception 43 . However, intriguingly, studies in Cx. quinquefasciatus using the Xenopus oocyte expression system combined with two-electrode voltage clamp revealed that CquiGR2 and CquiGR3 exhibited the strongest response to sodium bicarbonate solution when co-expressed, while CquiGR1 may act as a regulatory factor. This discrepancy may reflect adaptive evolutionary differences in host-seeking chemosensation among mosquito species 20 . This indicates that the CRGs may show species specificity. The function of the CRGs still needs to be verified through both in vivo and in vitro experiments. Function in blood-sucking behavior of CO 2 receptor genes in An. sinensis The blood feeding assays showed that the female adults with AsinGR22 , AsinGR23 or AsinGR24 silenced using RNAi demonstrated no significant difference in the blood feeding rate in comparison of the ds EGFP -injected control group (Fig. 5 g- 5 i). This is the first study on the function in blood-sucking behavior of CRGs, and the finding suggests that the three CO₂ receptor genes may not directly regulate the blood feeding behavior of mosquitoes, although they participate in long-distance host-seeking processes. The blood-sucking behavior might be mediated by other genes or environmental factors, which need be elucidated in further research. Conclusions In this study, we explored the characteristics, phylogenetics, expression patterns, and function of three CRGs ( AsinGR22 , AsinGR23 , and AsinGR24 ) in An. sinensis . AsinGR23 and AsinGR24 are located on chromosome 1 with each having three exons and two introns, and the AsinGR22 on chromosome 2 with five exons and four introns. The CRGs from six mosquito and four other dipteran species were identified and phylogenetically classified in three groups, and all mosquitoes have three CRGs that are classified into GR1 (containing AsinGR22 ), GR2 ( AsinGR23 ) and GR3 ( AsinGR24 ) with GR2 being specific for mosquitoes; however, other dipteran insects might only have two CRGs that be classified into GR1 and GR3. All three CRGs in An. sinensis were specifically expressed in maxillary palps; however, only AsinGR22 and AsinGR24 were significantly up-regulated in females than in males, and all these three genes were significantly down-regulated post blood feeding. Functional analysis using RNAi revealed that AsinGR22 and AsinGR24 mediate the capacity for CO 2 detection of female adults, but AsinGR23 might enhance the capacity as a regulatory factor rather than a functional gene. All these three genes demonstrated no influence to blood feeding behavior. This study revealed the characteristics, phylogenetics, and expression patterns of CRGs, and their function in CO 2 detection and blood-sucking behavior for the first time in An. sinensis . It provided comprehensive information frame for further research on function and application of CO 2 receptor genes in mosquitoes. Declarations Funding This research was supported by the following, The National Natural Science Foundation of China (31672363, 31872262). Author Contribution Conceived and designed the research: BC, XM. Performed the samples collecting and experiments: XM, BC, SR, FLS, CS. Analyzed the data and wrote the paper: XM, BC. Acknowledgement The authors acknowledge all the participants. Data Availability The datasets used and/or analysed during the current study available from the corresponding author on reasonable request. References Guerenstein, P. G. & Hildebrand, J. G. Roles and effects of environmental carbon dioxide in insect life. Annu. Rev. Entomol. 53 , 161–178 (2008). Majeed, S., Hill, S. R. & Ignell, R. Impact of elevated CO 2 background levels on the host-seeking behaviour of Aedes aegypti . J. Exp. Biol. 217 , 598–604 (2014). Gu, Z. et al. Responses of Thrips hawaiiensis and Thrips flavus populations to elevated CO 2 concentrations. J. Econ. Entomol. 116 , 416–425 (2023). Tauxe, G. M., MacWilliam, D., Boyle, S. M., Guda, T. & Ray, A. Targeting a dual detector of skin and CO 2 to modify mosquito host seeking. Cell 155 , 1365–1379 (2013). Goyret, J., Markwell, P. M. & Raguso, R. A. Context- and scale-dependent effects of floral CO 2 on nectar foraging by Manduca sexta . Proc. Natl. Acad. Sci. USA . 105 , 4565–4570 (2008). Murray, T. J., Ellsworth, D. S., Tissue, D. T. & Riegler, M. Interactive direct and plant-mediated effects of elevated atmospheric [CO 2 ] and temperature on a eucalypt-feeding insect herbivore. Glob Chang. Biol. 19 , 1407–1416 (2013). Chang, X. et al. Multiple resistances and complex mechanisms of Anopheles sinensis mosquito: a major obstacle to mosquito-borne diseases control and elimination in China. PLoS Negl. Trop. Dis. 8 , e2889 (2014). Jones, W. D., Cayirlioglu, P., Kadow, I. G. & Vosshall, L. B. Two chemosensory receptors together mediate carbon dioxide detection in Drosophila . Nature 445 , 86–90 (2007). Syed, Z. & Leal, W. S. Maxillary palps are broad spectrum odorant detectors in Culex quinquefasciatus . Chem. Senses . 32 , 727–738 (2007). Ning, C., Yang, K., Xu, M., Huang, L. Q. & Wang, C. Z. Functional validation of the carbon dioxide receptor in labial palps of Helicoverpa armigera moths. Insect Biochem. Mol. Biol. 73 , 12–19 (2016). Kwon, J. Y., Dahanukar, A., Weiss, L. A. & Carlson, J. R. The molecular basis of CO 2 reception in Drosophila . Proc. Natl. Acad. Sci. USA . 104 , 3574–3578 (2007). Filho, W. L. et al. Climate change, health and mosquito-borne diseases: trends and implications to the pacific region. Int J. Environ. Res. Public. Health 16 , (2019). Guarner, J. & Hale, G. L. Four human diseases with significant public health impact caused by mosquito-borne flaviviruses: West Nile, Zika, dengue and yellow fever. Semin Diagn. Pathol. 36 , 170–176 (2019). Lu, T. et al. Odor coding in the maxillary palp of the malaria vector mosquito Anopheles gambiae . Curr. Biol. 17 , 1533–1544 (2007). Kent, L. B., Walden, K. K. & Robertson, H. M. The Gr family of candidate gustatory and olfactory receptors in the yellow-fever mosquito Aedes aegypti . Chem. Senses . 33 , 79–93 (2008). Robertson, H. M. & Kent, L. B. Evolution of the gene lineage encoding the carbon dioxide receptor in insects. J. Insect Sci. 9 , 19 (2009). Arensburger, P. et al. Sequencing of Culex quinquefasciatus establishes a platform for mosquito comparative genomics. Science 330 , 86–88 (2010). Lombardo, F. et al. Arcà, B. Deciphering the olfactory repertoire of the tiger mosquito Aedes albopictus . BMC Genom. 18 , 770 (2017). Erdelyan, C. N., Mahood, T. H., Bader, T. S. & Whyard, S. Functional validation of the carbon dioxide receptor genes in Aedes aegypti mosquitoes using RNA interference. Insect Mol. Biol. 21 , 119–127 (2012). Xu, P., Wen, X. & Leal, W. S. CO 2 per se activates carbon dioxide receptors. Insect Biochem. Mol. Biol. 117 , 103284 (2020). Zhang, Y. J., Lan, Y. & Chen, B. A. S. D. B. A comprehensive omics database for Anopheles sinensis . Genomics 113 , 976–982 (2021). Chen, B. et al. De novo transcriptome sequencing and sequence analysis of the malaria vector Anopheles sinensis (Diptera: Culicidae). Parasit. Vectors . 7 , 314 (2014). Chen, B. Genome biology and pyrethroid resistance mechanism of Anopheles sinensis . Scientific Res. Publishing Inc USA (2025). Mou, X., Ren, S. & Chen, B. Whole genomic identification and characteristic analysis of the GR gene family in Anopheles sinensis (Diptera: Culicidae). Acta Entomologica Sinica . 68 (01), 23–35 (2025). Xu, W. & Anderson, A. Carbon dioxide receptor genes in cotton bollworm Helicoverpa armigera . Naturwissenschaften 102 , 11 (2015). Tamura, K., Stecher, G. & Kumar, S. MEGA11: molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 38 , 3022–3027 (2021). Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25 , 402–408 (2001). Geier, M. & Boeckh, J. A new Y-tube olfactometer for mosquitoes to measure the attractiveness of host odours. Entomol. Exp. Appl. 92 , 9–19 (2010). DeGennaro, M. et al. Vosshall, L. B. Orco mutant mosquitoes lose strong preference for humans and are not repelled by volatile DEET. Nature 498 , 487–491 (2013). Ma, D. et al. Structural basis for sugar perception by Drosophila gustatory receptors. Science 383 (6685), eadj2609 (2024). Bibi, M. et al. In silico characterisation of the Aedes aegypti gustatory receptors. Int. J. Mol. Sci. 24 (15), 12263 (2023). 38.Rodrigues, T. B. et al. Carbon dioxide receptor genes and their expression profile in Diabrotica virgifera virgifera. BMC Res. Notes . 9 , 18 (2016). Coutinho-Abreu, I. V., Sharma, K., Cui, L., Yan, G. & Ray, A. Odorant ligands for the CO 2 receptor in two Anopheles vectors of malaria. Sci. Rep. 9 , 2549 (2019). Webster, B., Lacey, E. S. & Cardé, R. T. Waiting with bated breath: opportunistic orientation to human odor in the malaria mosquito, Anopheles gambiae , is modulated by minute changes in carbon dioxide concentration. J. Chem. Ecol. 41 (1), 59–66 (2015). Omondi, B. A., Majeed, S. & Ignell, R. Functional development of carbon dioxide detection in the maxillary palp of Anopheles gambiae . J. Exp. Biol. 218 , 2482–2488 (2015). Peach, D. A. H., Gries, R., Zhai, H., Young, N. & Gries, G. Multimodal floral cues guide mosquitoes to tansy inflorescences. Sci. Rep. 9 (1), 3908 (2019). Spitzen, J. & Takken, W. Keeping track of mosquitoes: a review of tools to track, record and analyse mosquito flight. Parasites vectors . 11 (1), 123 (2018). Athrey, G., Popkin-Hall, Z. R., Takken, W. & Slotman, M. A. The expression of chemosensory genes in male maxillary palps of Anopheles coluzzii (Diptera: Culicidae) and An. quadriannulatus . J. Med. Entomol. 58 , 1012–1020 (2021). Chen, S. T., Kowalewski, J. & Ray, A. Prolonged activation of carbon dioxide-sensitive neurons in mosquitoes. Interface Focus . 11 , 20200043 (2021). Nalikkaramal, S., Hill, S. R. & Ignell, R. Impact of elevated CO2 level and egg quiescence duration on gene expression in the peripheral olfactory system of Aedes aegypti . Sci. Rep. 15 (1), 14318 (2025). Grant, A. J. & Dickens, J. C. Functional characterization of the octenol receptor neuron on the maxillary palps of the yellow fever mosquito, Aedes aegypti . PLoS One . 6 , e21785 (2011). Guerenstein, P. G., Christensen, T. A. & Hildebrand, J. G. Sensory processing of ambient CO2 information in the brain of the moth Manduca sexta . J. Comp. Physiol. Neuroethol Sens. Neural Behav. Physiol. 190 , 707–725 (2004). Zhang, J., Duan, S., Wang, W., Liu, D. & Wang, Y. Molecular basis of CO 2 sensing in Hyphantria cunea . Int J. Mol. Sci 25 , (2024). Choi, K. S. et al. Elevated CO 2 may alter pheromonal communication in Helicoverpa armigera (lepidoptera: Noctuidae). Physiol. Entomol. 43 (3), 169–179 (2018). Nignan, C. et al. Comparison of swarming, mating performance and longevity of males Anopheles coluzzii between individuals fed with different natural fruit juices in laboratory and semi-field conditions. Malar. J. 19 , 173 (2020). Turner, S. L. et al. Ultra-prolonged activation of CO 2 -sensing neurons disorients mosquitoes. Nature 474 (7349), 87–91 (2011). Zhou, Y. H., Zhang, Z. W., Fu, Y. F., Zhang, G. C. & Yuan, S. Carbon dioxide, odorants, heat and visible cues affect wild mosquito landing in open spaces. Front. Behav. Neurosci. 12 , 86 (2018). Reinhold, J. M. et al. Species-specificity in thermopreference and CO 2 -gated heat-seeking in culex mosquitoes. Insects 13 , (2022). Metz, H. C., Zung, J. L. & McBride, C. S. Quantifying Aedes aegypti host odor preference using a two-port olfactometer. Cold Spring Harb Protoc , pdb.top107661 (2023). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6979096","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":507790589,"identity":"eb6c4d05-2d84-40e8-b99a-6d0a5573c65b","order_by":0,"name":"Xiao Mou","email":"","orcid":"","institution":"Chongqing Normal University","correspondingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"","lastName":"Mou","suffix":""},{"id":507790590,"identity":"c59a91d4-b2a0-46f1-8976-ae9d16970af4","order_by":1,"name":"Feng-Ling Si","email":"","orcid":"","institution":"Chongqing Normal University","correspondingAuthor":false,"prefix":"","firstName":"Feng-Ling","middleName":"","lastName":"Si","suffix":""},{"id":507790591,"identity":"25fae4df-65b9-4817-afa8-5acf5ada87fc","order_by":2,"name":"Shuang Ren","email":"","orcid":"","institution":"Chongqing Normal University","correspondingAuthor":false,"prefix":"","firstName":"Shuang","middleName":"","lastName":"Ren","suffix":""},{"id":507790592,"identity":"4550061e-5673-4093-babb-3a9421098ec2","order_by":3,"name":"Chao Song","email":"","orcid":"","institution":"Chongqing Normal University","correspondingAuthor":false,"prefix":"","firstName":"Chao","middleName":"","lastName":"Song","suffix":""},{"id":507790593,"identity":"cf4f8523-2c35-4c7c-b8b8-4b882029656f","order_by":4,"name":"Bin Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYBACA2YgwdjAwMAPFQCxidQi2UC0FpgygwPEajFn5z3A8HOHTZ7x8cPbHvMw2MhuOMD87AE+LZbNfAmMvWfSis3OpJUb8zCkGW84wGZugNdhh3kMmBnbDiduu8FjJs3DcDhxwwEeNgkitPxP3DwDrOU/0VoOJG6QAGs5QFiLZTOPwcHetuTEGWfSyiTnGCQbzzzMZoZXizn/GcMHP9vsEvvbD2+TeFNhJ9t3vPkZXi0gcADmSEg0MRNSjwTwBu0oGAWjYBSMYAAACEZDagJHj54AAAAASUVORK5CYII=","orcid":"","institution":"Chongqing Normal University","correspondingAuthor":true,"prefix":"","firstName":"Bin","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2025-06-26 03:23:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6979096/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6979096/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90584571,"identity":"3569f021-9f32-4eef-be5f-61eb604d892d","added_by":"auto","created_at":"2025-09-04 11:07:46","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":422239,"visible":true,"origin":"","legend":"\u003cp\u003eGene location (a) and gene structure (b) of the CO\u003csub\u003e2\u003c/sub\u003e receptor genes in \u003cem\u003eAn. sinensis\u003c/em\u003e. The left scale is the length of the chromosome (Mb), and the left and right sides of the chromosome are the gene names. CDS: coding sequence.\u003c/p\u003e","description":"","filename":"Fig.1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6979096/v1/2bab9ef8b8e4334d4edc25d0.jpg"},{"id":90584570,"identity":"8db3965a-5647-4ce8-a1e3-34f20feb60f3","added_by":"auto","created_at":"2025-09-04 11:07:46","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":348675,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic relationship of CO\u003csub\u003e2\u003c/sub\u003e receptor genes in \u003cem\u003eAn. sinensis\u003c/em\u003e and other dipteran insects. Bootstrap values are calculated by 1000 replications and those of \u0026gt;50% are shown on the branch. GR1, GR2, and GR3 represent three distinct branches of the GR genes analyzed.\u003c/p\u003e","description":"","filename":"Fig.2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6979096/v1/147534dc419a9acf871e31b8.jpg"},{"id":90585266,"identity":"b09434f6-ac29-448c-9bfb-91163334df93","added_by":"auto","created_at":"2025-09-04 11:15:46","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":225289,"visible":true,"origin":"","legend":"\u003cp\u003eRelative expression levels of CO\u003csub\u003e2\u003c/sub\u003e receptor genes in 3-day old male and female adults in \u003cem\u003eAn. sinensis\u003c/em\u003e (a, b, c). The relative expression levels of CO\u003csub\u003e2\u003c/sub\u003e receptor genes are shown as the mean ± SD of three biological and three technical replicates in RT-qPCR analysis. Asterisks on the columns indicate statistically significant differences in gene expression level between females and males (P \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig.3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6979096/v1/ad7e4e8fb897efff8b0dc093.jpg"},{"id":90584572,"identity":"a80d9851-2bf3-4416-a4d8-4e27e1d3821a","added_by":"auto","created_at":"2025-09-04 11:07:46","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":617051,"visible":true,"origin":"","legend":"\u003cp\u003eRelative expression levels of CO\u003csub\u003e2\u003c/sub\u003e receptor genes in different tissues (a, b, c), and before and post blood meal (d, e, f) of 3-day-old \u003cem\u003eAn. sinensis\u003c/em\u003e female adults. CK: negative control. PB: Post blood feeding. Different letters above columns indicate significant differences between two samples in comparison (P \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig.4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6979096/v1/d06990e1b061dc84e4383eaf.jpg"},{"id":90586106,"identity":"2c307ae3-dd72-4155-963a-d486e2049db2","added_by":"auto","created_at":"2025-09-04 11:23:46","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1198218,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of RNA interference on the transcription levels of \u003cem\u003eAsinGR22\u003c/em\u003e (a), \u003cem\u003eAsinGR23\u003c/em\u003e (b), and \u003cem\u003eAsinGR24\u003c/em\u003e (c). Response to CO\u003csub\u003e2\u003c/sub\u003e (d, e, f), and impact on blood feeding behavior (g, h, i) of female adult mosquitoes following RNAi treatment are quantified at percentage. The enhanced green fluorescent protein (EGFP) serves as the negative control. Asterisks indicate significant differences (P \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig.5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6979096/v1/e23d150a056529ec763c15df.jpg"},{"id":101397847,"identity":"7b7acaff-cbe3-423b-9800-f5924497f7b3","added_by":"auto","created_at":"2026-01-29 09:37:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3811883,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6979096/v1/71fd803a-dc75-4e3f-8c24-e3e883e07e08.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eExpression patterns and functional exploration of CO 2 receptor genes in \u003cem\u003eAnopheles sinensis\u003c/em\u003e (Diptera: Culicidae)\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCarbon dioxide (CO\u003csub\u003e2\u003c/sub\u003e) is ubiquitous in the natural environment. It is not merely one of the principal raw materials for photosynthesis in plants but also serves as a chemical signal to mediate insect behaviors such as feeding and oviposition\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. For example, haemophagous insects use CO\u003csub\u003e2\u003c/sub\u003e to locate their hosts\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e, lepidopteran insects utilize CO\u003csub\u003e2\u003c/sub\u003e to assess the quality of flowers\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e and herbivorous insects take CO\u003csub\u003e2\u003c/sub\u003e as a significant cue for feeding and oviposition\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. For hemophagous insects, like mosquitoes, CO\u003csub\u003e2\u003c/sub\u003e, heat and human odors are capable of guiding blood-feeding females to their hosts\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. The receptor cells responsible for the detection of CO\u003csub\u003e2\u003c/sub\u003e in insects are located in the antennae of flies, the maxillary palps of mosquitoes, and the labial palps of lepidopteran insects\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. The molecular mechanism of CO\u003csub\u003e2\u003c/sub\u003e detection in insects was first revealed in \u003cem\u003eDrosophila melanogaster\u003c/em\u003e, where two gustatory receptor genes, \u003cem\u003eDmelGR21a\u003c/em\u003e and \u003cem\u003eDmelGR63a\u003c/em\u003e, are co-expressed in ab1C neuron of the \u003cem\u003eDr. melanogaster\u003c/em\u003e antennae\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. The \u003cem\u003eD. melanogaster\u003c/em\u003e could sense CO\u003csub\u003e2\u003c/sub\u003e only when the two genes are co-expressed, and could not sense CO\u003csub\u003e2\u003c/sub\u003e when either gene is expressed independently. These two receptors, which are thought to be a heterodimeric receptor, jointly perform the function of sensing CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e\u003cp\u003eMosquitoes are main threat for human being health, due to transmission of a large number of diseases, including malaria, dengue fever, chikungunya fever, lymphatic filariasis and epidemic encephalitis B\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. In mosquitoes, three CRGs (\u003cem\u003eAgamGR22\u003c/em\u003e, \u003cem\u003eAgamGR23\u003c/em\u003e and \u003cem\u003eAgamGR24\u003c/em\u003e) have been identified in \u003cem\u003eAn. gambiae\u003c/em\u003e, which were co-expressed in the cpA neuron of the maxillary palps by in situ hybridization\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Orthologs of these three CO\u003csub\u003e2\u003c/sub\u003e receptors have subsequently been identified in \u003cem\u003eAedes aegypti\u003c/em\u003e, \u003cem\u003eCulex pipiens\u003c/em\u003e, \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e, and \u003cem\u003eAedes albopictus\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. An investigation showed that the \u003cem\u003eAgamGR22\u003c/em\u003e and \u003cem\u003eAgamGR24\u003c/em\u003e in \u003cem\u003eAn. gambiae\u003c/em\u003e produced a significant response to CO\u003csub\u003e2\u003c/sub\u003e when co-expressed in \u003cem\u003eDrosophila\u003c/em\u003e empty neurons, and this response was enhanced by \u003cem\u003eAgamGR23\u003c/em\u003e\u003csup\u003e14\u003c/sup\u003e Three CRGs in \u003cem\u003eAe. aegypti\u003c/em\u003e were co-expressed in maxillary palps, and knockdown of \u003cem\u003eAaegGR1\u003c/em\u003e or \u003cem\u003eAaegGR3\u003c/em\u003e led to the loss of CO\u003csub\u003e2\u003c/sub\u003e sensitivity in both male and female mosquitoes using RNAi, while knockdown of \u003cem\u003eAaegGR2\u003c/em\u003e had no impact on CO\u003csub\u003e2\u003c/sub\u003e perception\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. The combination expression of \u003cem\u003eCquiGR2\u003c/em\u003e and \u003cem\u003eCquiGR3\u003c/em\u003e had the greatest response to sodium bicarbonate solution, and \u003cem\u003eCquiGR1\u003c/em\u003e may be a regulatory factor in \u003cem\u003eCx. quinquefasciens\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. These findings emphasize the conserved and specific role of CRGs in different mosquito species. However, the molecular mechanisms of CRGs remain poorly understood in different mosquito species. Although the importance of CO\u003csub\u003e2\u003c/sub\u003e in the long-distance host seeking of mosquitoes has been confirmed, the expression patterns of CRGs in different sensing organs and their its impact on the blood-sucking behavior of mosquitoes has yet to explore.\u003c/p\u003e\u003cp\u003e\u003cem\u003eAn. sinensis\u003c/em\u003e is a vital malaria vector in China and other Southeast Asian countries, and also transmits lymphatic filariasis\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. In recent years, our laboratory has sequenced and annotated the genome of \u003cem\u003eAn. sinensis\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e, and conducted systematical studies on the molecular mechanism of insecticide resistance using \u003cem\u003eAn. sinensis\u003c/em\u003e as a model species\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. In earlier study, we have identified a total of 54 gustatory receptor genes in the genome of \u003cem\u003eAn. sinensis\u003c/em\u003e, which including three CRGs (\u003cem\u003eAsinGR22\u003c/em\u003e, \u003cem\u003eAsinGR23\u003c/em\u003e and \u003cem\u003eAsinGR24\u003c/em\u003e) in the subfamily of the taste receptors\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. However, little is known about the characterization and expression patterns of these three genes, and their function in response of CO\u003csub\u003e2\u003c/sub\u003e exploration.\u003c/p\u003e\u003cp\u003eIn this study, we conducted characteristics and phylogenetic analysis of these three CRGs, and investigated their expression patterns using RT-qPCR in \u003cem\u003eAn. sinensis\u003c/em\u003e. More importantly, we revealed their function in behavior response for CO\u003csub\u003e2\u003c/sub\u003e exploration and blood sucking using RNAi. This study lays a crucial foundation for further functional exploration and application of the CRGs in mosquitoes.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cb\u003eMosquitos rearing, sequence retrieving, and sample collecting\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe WX-LS strain of \u003cem\u003eAn. sinensis\u003c/em\u003e in the Institute of Insect and Molecular Biology, Chongqing Normal University was reared at 27\u0026thinsp;\u0026plusmn;\u0026thinsp;1℃, 70\u0026thinsp;\u0026plusmn;\u0026thinsp;10% relative humidity and 12 h: 12 h (light: dark). Eggs were hatched in dechlorinated water, and larvae were fed fish feed. Adult mosquitoes were reared on a 10% glucose solution. The genome data, and CO\u003csub\u003e2\u003c/sub\u003e receptor gene and protein sequences of \u003cem\u003eAn. sinensis\u003c/em\u003e used in this study were obtained from the Institute of Insect and Molecular Biology, Chongqing Normal University\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Amino acid sequences of other known dipteran CO\u003csub\u003e2\u003c/sub\u003e receptors used to perform phylogenetic analysis were downloaded from NCBI (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and Vectorbase (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://vectorbase.org/\u003c/span\u003e\u003cspan address=\"https://vectorbase.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) databases.\u003c/p\u003e\u003cp\u003eThe gene expression patterns of three CRGs were analyzed for male and female adults, four tissues of adults (maxillary palp, proboscises, antennae, and leg), and female adults both before and post blood feeding. Three female or male adult (3 days old), maxillary palps and proboscises of 160 females, antennae of 200 females, and legs of 40 females were collected, immediately stored in RNAlater, and used as a single sample for expression analysis.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCharacteristics and phylogenetic analysis of CO\u003c/b\u003e\u003csub\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sub\u003e \u003cb\u003ereceptor genes\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe number of amino acids, molecular weight, isoelectric point and hydrophilicity of the CO\u003csub\u003e2\u003c/sub\u003e receptors were analyzed using ExPASy ProtParam (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://web.expasy.org/protparam/\u003c/span\u003e\u003cspan address=\"https://web.expasy.org/protparam/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The transmembrane region of CO\u003csub\u003e2\u003c/sub\u003e receptors was predicted by TMHMM (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.cbs.dtu.dk/services/TMHMM-2.0/\u003c/span\u003e\u003cspan address=\"http://www.cbs.dtu.dk/services/TMHMM-2.0/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e).\u003c/span\u003e Introns and exons were displayed from the genome sequence and coding sequence of the CRGs using GSDS (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gsds.cbi.pku.edu.cn/\u003c/span\u003e\u003cspan address=\"http://gsds.cbi.pku.edu.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The genome distribution of CRGs in \u003cem\u003eAn. sinensis\u003c/em\u003e was mapped using MG2C (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://mg2c.iask.in/mg2c_v2.1/\u003c/span\u003e\u003cspan address=\"http://mg2c.iask.in/mg2c_v2.1/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe amino acid sequences of \u003cem\u003eAsinGR22\u003c/em\u003e, \u003cem\u003eAsinGR23\u003c/em\u003e and \u003cem\u003eAsinGR24\u003c/em\u003e were phylogenetically analyzed with other known dipteran insects CO\u003csub\u003e2\u003c/sub\u003e receptors from \u003cem\u003eAn. gambiae\u003c/em\u003e, \u003cem\u003eAe. aegypti\u003c/em\u003e, \u003cem\u003eAe. albopictus\u003c/em\u003e, \u003cem\u003eCx. quasifasciatus\u003c/em\u003e and \u003cem\u003eCx. pipiens\u003c/em\u003e, \u003cem\u003eDr. melanogaster\u003c/em\u003e, \u003cem\u003eMusca domestica\u003c/em\u003e, \u003cem\u003eChrysomya megacephala\u003c/em\u003e, \u003cem\u003eCeratitis capitate\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The maximum-likelihood phylogenetic tree was constructed based on Jones-Taylor-Thornton (JTT) model and 1000 bootstrap replications by MEGA 11.0\u003csup\u003e26\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAccession numbers of amino acids of dipteran CO\u003csub\u003e2\u003c/sub\u003e receptor genes used in this study.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSpecies\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCO\u003csub\u003e2\u003c/sub\u003e receptor\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAccession number\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003e\u003cem\u003eAnopheles sinensis\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAsinGR22\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAn.sin09348\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAsinGR23\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAn.sin04137\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAsinGR24\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAn.sin04919\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003e\u003cem\u003eAnopheles gambiae\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAgamGR22\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eXP_319142.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAgamGR23\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eXP_312786.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAgamGR24\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABK97614.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003e\u003cem\u003eCulex quinquefasciatus\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCquiGR22\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eXP_001848097.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCquiGR6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eXP_001848828.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCquiGR24\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eXP_001848689.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003e\u003cem\u003eAedes aegypti\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAaegGR21a\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eXP_001655150.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAaegGR2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eXP_001654839.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAaegGR63a\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eXP_001660602.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003e\u003cem\u003eCulex pipiens\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCpipGR1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eXP_039432013.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCpipGR2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eXP_039448054.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCpipGR3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eXP_039446312.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003e\u003cem\u003eAedes albopictus\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAalbGR1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAALF013834-RA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAalbGR2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAALF019900-RA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAalbGR3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAALF019265-RA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eMusca domestica\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMdomGR1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAFH96948.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMdomGR2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNP_001273828.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eChrysomya megacephala\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCmegGR1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAFH96947.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCmegGR2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAFH96946.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eCeratitis capitata\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCcapGR21a\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eXP_004517826.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCcapGR63a\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eXP_004524608.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eDrosophila melanogaster\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDmelGR21a\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNP_523448.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDmelGR63a\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABK97613.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eReal-time quantitative PCR\u003c/b\u003e\u003c/p\u003e\u003cp\u003eRT-qPCR was carried out on a thermal cycler (CFX, Bio-Rad, USA) with three biological and technological repeats applied for each analysis, and gene-specific primers were designed with Primer Premier 5.0 (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Total RNA extraction, cDNA template synthesis, and RT-qPCR experiments were performed according to the manufacturer's protocol. The cycling conditions for RT-qPCR were as follows: 94℃ for 30 s; 40 cycles of 94℃ for 5 s and 60℃ for 30 s. The internal reference genes were the ribosomal protein S7 (\u003cem\u003eRPS7\u003c/em\u003e). The relative expression level of the target gene in the sample compared to the control sample was calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. The one-way analysis of variance (ANOVA) was employed for statistical analysis and the Tukey test (at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) for statistical significance using the SPSS 27.0.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers used for RT-qPCR and RNA interference\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimers\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer sequences (5\u0026prime;\u0026minus;3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eAsinGR22\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GCTACGCAGAAGGAGGTGGAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR: GGATAGGTTTGCTTTAAGGGAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eAsinGR23\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: AAGGACGAGCGGATGGTAAACG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR: CCTCGGAATAGCACAAGCAGTAGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eAsinGR24\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GGCGAAGATACTGGCGGAAGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR: GGTAAAGGTGTAGCAGGTGGAGAAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003edsEGFP-T7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TAATACGACTCACTATAGGGAGACGTAAACGGCCACAAGTTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR: TAATACGACTCACTATAGGGAGAGCTCAGGTAGTGGTTGTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003edsAsinGR22-T7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TAATACGACTCACTATAGGGAGATATCTCGACCAACGACAAGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR: TAATACGACTCACTATAGGGAGAACCAAAGACTACAGAACCCATT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003edsAsinGR23-T7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TAATACGACTCACTATAGGGAGATTCCAGACCACGACCCAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR: TAATACGACTCACTATAGGGAGAATGCCACGGCTGTTGATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003edsAsinGR24-T7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TAATACGACTCACTATAGGGAGAAGGTCGCGTACCGTAAGAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR: TAATACGACTCACTATAGGGAGAAAAGGTGTAGCAGGTGGAGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eRNA interference\u003c/b\u003e\u003c/p\u003e\u003cp\u003eRNAi and behavioral experiments were carried out using female WX-LS strain of mosquitoes to investigate the function of the three target genes in the detection of CO\u003csub\u003e2\u003c/sub\u003e in \u003cem\u003eAn. sinensis\u003c/em\u003e. Specific primers were designed using primer premier 5.0 (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), and the enhanced green fluorescent protein (EGFP) was employed as a control in this experiment. The dsRNA fragments of \u003cem\u003eAsinGR22\u003c/em\u003e, \u003cem\u003eAsinGR23\u003c/em\u003e, \u003cem\u003eAsinGR24\u003c/em\u003e and \u003cem\u003eEGFP\u003c/em\u003e were synthesized in vitro using T7 RiboMAX\u003csup\u003e\u0026trade;\u003c/sup\u003e Express RNAi System (Promega) kit. The dsRNA fragment concentration was determined using Nano-Drop\u0026trade; 1000 (Thermo Fisher Scientific Inc, USA). Female pupae (\u0026lt;\u0026thinsp;24 h old) were injected with 800 ng dsRNA at the junction of second and third ventral segments, and the control group was injected with the same amount of ds\u003cem\u003eEGFP\u003c/em\u003e. RT-qPCR was employed to assess the interference efficiency of the target genes after silencing.\u003c/p\u003e\u003cp\u003e\u003cb\u003eBehavior experiments\u003c/b\u003e\u003c/p\u003e\u003cp\u003eA Y-shaped glass tube olfactometer was used for the determination of response of female mosquitoes to CO\u003csub\u003e2\u003c/sub\u003e after RNA interference\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Human-exhaled CO\u003csub\u003e2\u003c/sub\u003e was used as the CO\u003csub\u003e2\u003c/sub\u003e source, and 10 female mosquitoes (3 days old) after RNAi were selected to assess their response to CO\u003csub\u003e2\u003c/sub\u003e using the Y-shaped olfactometer. Before the test commenced, these mosquitoes to be tested were placed in the Y-olfactometer to adapt for 1 min. One end of the Y-olfactometer was gently exhaled through the nose for 5 s every 30 s to provide a CO\u003csub\u003e2\u003c/sub\u003e source, while the other end remained blank\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. The number of mosquitoes at both ports was counted after 5 min. To eliminate positional differences, the experimental and control ports should exchange positions. Next, we also investigated the effects of silencing these three genes on blood feeding in female mosquitoes. In our experiment, mice were used as the blood source, 15 female mosquitoes (3 days old) that had mated and fasted for 10\u0026ndash;12 h after RNAi were selected. The anesthetized mice were used to feed these female mosquitos, the number of blood-sucking and non-blood-sucking mosquitoes were counted after 10 min.\u003c/p\u003e"},{"header":"Results and discussion","content":"\u003cp\u003e\u003cb\u003eCharacteristics and phylogenetics of CO\u003c/b\u003e\u003csub\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sub\u003e \u003cb\u003ereceptor genes\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe numbers of amino acids of \u003cem\u003eAsinGR22\u003c/em\u003e, \u003cem\u003eAsinGR23\u003c/em\u003e and \u003cem\u003eAsinGR24\u003c/em\u003e are 466, 569 and 456 based on our analysis, respectively, and their proteins predicted all have seven transmembrane regions (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Both the \u003cem\u003eAsinGR23\u003c/em\u003e and \u003cem\u003eAsinGR24\u003c/em\u003e genes are located on chromosome 1 with each having three exons and two introns, whereas the \u003cem\u003eAsinGR22\u003c/em\u003e on chromosome 2 with five exons and four introns (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Previous studies have revealed the genetic coding characteristics of insect olfactory receptors (ORs) and gustatory receptors (GRs), which typically consist of seven transmembrane domains (TMDs) with the N-terminus located intracellularly and the C-terminus extracellularly\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. In this study, the CO\u003csub\u003e2\u003c/sub\u003e receptor protein of \u003cem\u003eAn. sinensis\u003c/em\u003e was also found to possess seven transmembrane regions, a finding consistent with earlier research on CO\u003csub\u003e2\u003c/sub\u003e receptors in other insects\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e,\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. This suggests that the structure of CO\u003csub\u003e2\u003c/sub\u003e receptor proteins may be somewhat conserved among insects, which holds significant implications for understanding how insects perceive environmental carbon dioxide.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eCharacteristics of CO\u003csub\u003e2\u003c/sub\u003e receptor genes in \u003cem\u003eAn. sinensis\u003c/em\u003e\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"8\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGene ID\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCDS Length\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNumber of amino acids\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMolecular weight (kD)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eIsoelectric point\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eHydrophilicity\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003eTransmembrane region\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eAsinGR22\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAn.sin09348\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1 401\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e466\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e54.14\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e8.92\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e0.115\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eAsinGR23\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAn.sin04137\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1 710\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e569\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e64.47\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e6.57\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e0.323\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eAsinGR24\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAn.sin04919\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1 371\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e456\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e51.77\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e8.32\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e0.348\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eAll six mosquito species investigated in this study have three CO\u003csub\u003e2\u003c/sub\u003e receptors genes, whereas four other dipteran insects have only two CO\u003csub\u003e2\u003c/sub\u003e receptors genes. Phylogenetic analysis of the all these CRGs shows that they are divided into three groups (GR1, GR2 and GR3), with each group being supported by 100% of bootstrap value (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The three CRGs from each mosquito species are classified into each group; however, two CRGs from each other dipteran insect are classified in GR1 and GR3. This result proposes that the GR2 is specific for mosquitoes, which might stem from recent gene duplication. Notably, dipteran insects such as \u003cem\u003eDr. melanogaster\u003c/em\u003e, \u003cem\u003eM. domestica\u003c/em\u003e, \u003cem\u003eC. megacephala\u003c/em\u003e, \u003cem\u003eDr. simulans\u003c/em\u003e, and \u003cem\u003eC. capitata\u003c/em\u003e, possess only two CRGs\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e, whereas mosquitoes have three CRGs\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. The presence of an additional CO\u003csub\u003e2\u003c/sub\u003e receptor gene in mosquitoes may be linked to their specific ecological adaptations, particularly the requirement to detect host CO\u003csub\u003e2\u003c/sub\u003e emissions for blood-feeding. Future research should focus on the functional characterization of these genes to elucidate their roles in CO\u003csub\u003e2\u003c/sub\u003e detection and the potential implications for vector control strategies.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eExpression patterns of CO\u003c/b\u003e\u003csub\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sub\u003e \u003cb\u003ereceptor genes in\u003c/b\u003e \u003cb\u003eAn. sinensis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe analysis of expression patterns demonstrated that all three CRGs were expressed in both sexes, with the expression level of \u003cem\u003eAsinGR24\u003c/em\u003e (110.32-fold) and \u003cem\u003eAsinGR22\u003c/em\u003e (19.58-fold) were significantly higher in females than in males, while that of \u003cem\u003eAsinGR23\u003c/em\u003e (1.65-fold) had no significant difference (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea-\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). \u003cem\u003eAsinGR22\u003c/em\u003e is homologous to \u003cem\u003eCquiGR1\u003c/em\u003e and \u003cem\u003eAaegGR1\u003c/em\u003e, \u003cem\u003eAsinGR24\u003c/em\u003e to \u003cem\u003eCquiGR3\u003c/em\u003e and \u003cem\u003eAaegGR3\u003c/em\u003e, and \u003cem\u003eAsinGR23\u003c/em\u003e to \u003cem\u003eAaegGR2\u003c/em\u003e and \u003cem\u003eCquiGR2\u003c/em\u003e. Earlier study showed that the \u003cem\u003eCquiGR1\u003c/em\u003e or \u003cem\u003eCquiGR3\u003c/em\u003e in \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e also was significantly upregulated in females than in males, respectively\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. The expressions of \u003cem\u003eAsinGR22\u003c/em\u003e and \u003cem\u003eAsinGR24\u003c/em\u003e, as well as \u003cem\u003eCquiGR1\u003c/em\u003e and \u003cem\u003eCquiGR3\u003c/em\u003e, are significantly higher in female adults than in males. This may be closely related to the blood-feeding behavior characteristic of female mosquitoes. CO\u003csub\u003e2\u003c/sub\u003e is a critical clue for female mosquitoes to locate their hosts\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e,\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. These two highly expressed CRGs likely enhance the sensitivity of female mosquitoes to CO\u003csub\u003e2\u003c/sub\u003e released by hosts, enabling them to accurately locate hosts in complex environments. In contrast, male mosquitoes mainly feed on nectar. The concentration of CO\u003csub\u003e2\u003c/sub\u003e released from nectar sources differs from that produced by animal respiration, and nectar localization also depends on volatile substances such as floral scents. Therefore, male mosquitoes do not need high sensitivity to CO\u003csub\u003e2\u003c/sub\u003e, explaining the relatively low expression levels of these two genes in males. Interestingly, the \u003cem\u003eAaegGR1\u003c/em\u003e and \u003cem\u003eAaegGR3\u003c/em\u003e in \u003cem\u003eAe. aegypti\u003c/em\u003e were significantly down-regulated in males than in females\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. The up-regulated expression of \u003cem\u003eAaegGR1\u003c/em\u003e/\u003cem\u003eGR3\u003c/em\u003e in males may reflect ecological adaptations that enable them to utilize CO\u003csub\u003e2\u003c/sub\u003e for locating nectar in specific environments or engaging in courtship behaviors\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e,\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. The expression of \u003cem\u003eAsinGR23\u003c/em\u003e showed no significant difference between males and females, which might be due to its role as a regulatory factor rather than a functional gene. The molecular basis underlying the sex-differential expression of CO₂ receptor genes remains unclear, highlighting the need for further investigation into gene functions and regulatory mechanisms.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTissue expression analysis showed that all three CO\u003csub\u003e2\u003c/sub\u003e receptor genes (\u003cem\u003eAsinGR22\u003c/em\u003e, \u003cem\u003eAsinGR23\u003c/em\u003e and \u003cem\u003eAsinGR24\u003c/em\u003e) were specifically expressed in maxillary palps (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). This discovery is consistent with previous research findings on the CRGs of mosquitoes\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e, further confirming the critical role of maxillary palps in the CO\u003csub\u003e2\u003c/sub\u003e sensing process of mosquitoes. The maxillary palps, as an essential olfactory organ of mosquitoes, is densely populated with a large number of olfactory sensory neurons. Their surface CO\u003csub\u003e2\u003c/sub\u003e receptors precisely detect CO\u003csub\u003e2\u003c/sub\u003e in the environment and regulate key behaviors such as seeking a host (sucking blood) and courtship\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. In contrast, \u003cem\u003eDrosophila\u003c/em\u003e possess only two CRGs, which are expressed in their antennae, the primary organs for sensing external chemical signals. This expression pattern adapts with their feeding habits, such as consuming rotten fruits and locating food sources in complex odor environments\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e The three CRGs in mosquitoes are predominantly expressed in the maxillary palps. Compared to antennae, the maxillary palp may have higher sensitivity and specificity to CO\u003csub\u003e2\u003c/sub\u003e signals, closely linked to the survival strategy of mosquitoes that rely on CO\u003csub\u003e2\u003c/sub\u003e to locate hosts and complete blood-sucking reproduction\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e,\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. In moths (\u003cem\u003eHelicoverpa armigera\u003c/em\u003e, \u003cem\u003eHyphantria cunea\u003c/em\u003e, and \u003cem\u003eManduca sexta\u003c/em\u003e), the CRGs are expressed in the labial palps\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e,\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Labial palps play a crucial role in moth behaviors, including nectar search and egg-laying. Moreover, the concentration of CO\u003csub\u003e2\u003c/sub\u003e also influences the perception of sex pheromones by moths\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. These differences reflect evolutionary adaptations in CO₂ detection mechanisms across insect species. Our findings confirmed the key role of maxillary palps in the detection of CO₂ in mosquitoes, providing a basis for further research on the CO₂ signal transduction mechanism of maxillary palp neurons.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWe also conducted an analysis of three CRGs expression levels in females before and post blood feeding. The findings revealed that the expression levels of these genes (\u003cem\u003eAsinGR22\u003c/em\u003e, \u003cem\u003eAsinGR23\u003c/em\u003e, and \u003cem\u003eAsinGR24\u003c/em\u003e) were significantly down-regulated at 1 h, 12 h, 24 h, and 48 h post blood feeding compared with non-blood-fed females (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef). This suggests that these three genes are crucial for female mosquitoes in host-seeking behavior. In mosquitoes, CO\u003csub\u003e2\u003c/sub\u003e serves as a critical cue for adult mosquitoes to search nectar sources for their flight and survival energy. Female mosquitoes additionally rely on CO\u003csub\u003e2\u003c/sub\u003e to locate their hosts for the nutrients required for reproduction\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e,\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. Some studies have demonstrated that CO\u003csub\u003e2\u003c/sub\u003e, heat and odorants, play a significant role in female mosquito host-seeking behavior\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e,\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e,\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. This indicates that the three CO\u003csub\u003e2\u003c/sub\u003e-related genes play a significant role in the host-seeking process of female mosquitoes.\u003c/p\u003e\u003cp\u003e\u003cb\u003eFunction in CO\u003c/b\u003e\u003csub\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sub\u003e\u003cb\u003e-responsing behavior of CO\u003c/b\u003e\u003csub\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sub\u003e \u003cb\u003ereceptor genes in\u003c/b\u003e \u003cb\u003eAn. sinensis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFunctional studies on CO\u003csub\u003e2\u003c/sub\u003e-responsing behavior of these three genes showed that the RNAi down-regulated the expression of \u003cem\u003eAsinGR22\u003c/em\u003e, \u003cem\u003eAsinGR23\u003c/em\u003e and \u003cem\u003eAsinGR24\u003c/em\u003e by approximately 66.01%, 65.70%, and 40.68%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea-\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). \u003cem\u003eAsinGR22\u003c/em\u003e- and \u003cem\u003eAsinGR24\u003c/em\u003e-silenced female adults significantly reduced the sensitivity to CO\u003csub\u003e2\u003c/sub\u003e by 34.17% and 25%, respectively, compared with control injected with dsEGFP in the test using a Y-tube olfactometer; however, \u003cem\u003eAsinGR23\u003c/em\u003e-silenced female adults did not (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed-\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef). Although these two genes (\u003cem\u003eAsinGR22\u003c/em\u003e and \u003cem\u003eAsinGR24\u003c/em\u003e) were not completely knocked out, the reduction in their expression was sufficient to affect CO\u003csub\u003e2\u003c/sub\u003e detection, indicating their critical role in CO\u003csub\u003e2\u003c/sub\u003e sensing in \u003cem\u003eAn. sinensis\u003c/em\u003e. In contrast, no significant reduction to CO\u003csub\u003e2\u003c/sub\u003e sensitivity in \u003cem\u003eAsinGR23\u003c/em\u003e-silenced females suggests that this gene may not be directly involved in CO\u003csub\u003e2\u003c/sub\u003e perception. The involvement of AsinGR23 in CO₂ detection could depend on its interaction with AsinGR22/24, potentially stabilizing the receptor or enhancing signal transduction. This result is similar to the reported function of CRGs in \u003cem\u003eAn. gambiae\u003c/em\u003e and \u003cem\u003eAe. Aegypti\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Similar findings have been observed in other phytophagous insects. For example, in \u003cem\u003eHe. armigera\u003c/em\u003e, only the co-expression of \u003cem\u003eHarmGR1\u003c/em\u003e and \u003cem\u003eHarmGR3\u003c/em\u003e, and \u003cem\u003eHarmGR1\u003c/em\u003e, \u003cem\u003eHarmGR2\u003c/em\u003e and \u003cem\u003eHarmGR3\u003c/em\u003e strongly reacted to sodium bicarbonate (NaHCO\u003csub\u003e3\u003c/sub\u003e), suggesting that \u003cem\u003eHarmGR1\u003c/em\u003e and \u003cem\u003eHarmGR3\u003c/em\u003e are essential for CO\u003csub\u003e2\u003c/sub\u003e perception in the species, while the role of \u003cem\u003eHarmGR2\u003c/em\u003e remains unclear\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. In \u003cem\u003eHy. cunea\u003c/em\u003e, \u003cem\u003eHcunGR1\u003c/em\u003e and \u003cem\u003eHcunGR3\u003c/em\u003e produced a strong response to CO\u003csub\u003e2\u003c/sub\u003e only when they were co-expressed in \u003cem\u003eXenopus\u003c/em\u003e oocytes, whereas \u003cem\u003eHcunGR2\u003c/em\u003e exhibited an inhibitory effect on CO\u003csub\u003e2\u003c/sub\u003e perception\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. However, intriguingly, studies in \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e using the \u003cem\u003eXenopus\u003c/em\u003e oocyte expression system combined with two-electrode voltage clamp revealed that \u003cem\u003eCquiGR2\u003c/em\u003e and \u003cem\u003eCquiGR3\u003c/em\u003e exhibited the strongest response to sodium bicarbonate solution when co-expressed, while \u003cem\u003eCquiGR1\u003c/em\u003e may act as a regulatory factor. This discrepancy may reflect adaptive evolutionary differences in host-seeking chemosensation among mosquito species\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. This indicates that the CRGs may show species specificity. The function of the CRGs still needs to be verified through both in vivo and in vitro experiments.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eFunction in blood-sucking behavior of CO\u003c/b\u003e\u003csub\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sub\u003e \u003cb\u003ereceptor genes in\u003c/b\u003e \u003cb\u003eAn. sinensis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe blood feeding assays showed that the female adults with \u003cem\u003eAsinGR22\u003c/em\u003e, \u003cem\u003eAsinGR23\u003c/em\u003e or \u003cem\u003eAsinGR24\u003c/em\u003e silenced using RNAi demonstrated no significant difference in the blood feeding rate in comparison of the ds\u003cem\u003eEGFP\u003c/em\u003e-injected control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg-\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ei). This is the first study on the function in blood-sucking behavior of CRGs, and the finding suggests that the three CO₂ receptor genes may not directly regulate the blood feeding behavior of mosquitoes, although they participate in long-distance host-seeking processes. The blood-sucking behavior might be mediated by other genes or environmental factors, which need be elucidated in further research.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn this study, we explored the characteristics, phylogenetics, expression patterns, and function of three CRGs (\u003cem\u003eAsinGR22\u003c/em\u003e, \u003cem\u003eAsinGR23\u003c/em\u003e, and \u003cem\u003eAsinGR24\u003c/em\u003e) in \u003cem\u003eAn. sinensis\u003c/em\u003e. \u003cem\u003eAsinGR23\u003c/em\u003e and \u003cem\u003eAsinGR24\u003c/em\u003e are located on chromosome 1 with each having three exons and two introns, and the \u003cem\u003eAsinGR22\u003c/em\u003e on chromosome 2 with five exons and four introns. The CRGs from six mosquito and four other dipteran species were identified and phylogenetically classified in three groups, and all mosquitoes have three CRGs that are classified into GR1 (containing \u003cem\u003eAsinGR22\u003c/em\u003e), GR2 (\u003cem\u003eAsinGR23\u003c/em\u003e) and GR3 (\u003cem\u003eAsinGR24\u003c/em\u003e) with GR2 being specific for mosquitoes; however, other dipteran insects might only have two CRGs that be classified into GR1 and GR3. All three CRGs in \u003cem\u003eAn. sinensis\u003c/em\u003e were specifically expressed in maxillary palps; however, only \u003cem\u003eAsinGR22\u003c/em\u003e and \u003cem\u003eAsinGR24\u003c/em\u003e were significantly up-regulated in females than in males, and all these three genes were significantly down-regulated post blood feeding. Functional analysis using RNAi revealed that \u003cem\u003eAsinGR22\u003c/em\u003e and \u003cem\u003eAsinGR24\u003c/em\u003e mediate the capacity for CO\u003csub\u003e2\u003c/sub\u003e detection of female adults, but \u003cem\u003eAsinGR23\u003c/em\u003e might enhance the capacity as a regulatory factor rather than a functional gene. All these three genes demonstrated no influence to blood feeding behavior. This study revealed the characteristics, phylogenetics, and expression patterns of CRGs, and their function in CO\u003csub\u003e2\u003c/sub\u003e detection and blood-sucking behavior for the first time in \u003cem\u003eAn. sinensis\u003c/em\u003e. It provided comprehensive information frame for further research on function and application of CO\u003csub\u003e2\u003c/sub\u003e receptor genes in mosquitoes.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis research was supported by the following, The National Natural Science Foundation of China (31672363, 31872262).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceived and designed the research: BC, XM. Performed the samples collecting and experiments: XM, BC, SR, FLS, CS. Analyzed the data and wrote the paper: XM, BC.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors acknowledge all the participants.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets used and/or analysed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGuerenstein, P. G. \u0026amp; Hildebrand, J. G. Roles and effects of environmental carbon dioxide in insect life. \u003cem\u003eAnnu. Rev. Entomol.\u003c/em\u003e \u003cb\u003e53\u003c/b\u003e, 161\u0026ndash;178 (2008).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMajeed, S., Hill, S. R. \u0026amp; Ignell, R. Impact of elevated CO\u003csub\u003e2\u003c/sub\u003e background levels on the host-seeking behaviour of \u003cem\u003eAedes aegypti\u003c/em\u003e. \u003cem\u003eJ. Exp. Biol.\u003c/em\u003e \u003cb\u003e217\u003c/b\u003e, 598\u0026ndash;604 (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGu, Z. et al. Responses of Thrips hawaiiensis and Thrips flavus populations to elevated CO\u003csub\u003e2\u003c/sub\u003e concentrations. \u003cem\u003eJ. Econ. Entomol.\u003c/em\u003e \u003cb\u003e116\u003c/b\u003e, 416\u0026ndash;425 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTauxe, G. M., MacWilliam, D., Boyle, S. M., Guda, T. \u0026amp; Ray, A. Targeting a dual detector of skin and CO\u003csub\u003e2\u003c/sub\u003e to modify mosquito host seeking. \u003cem\u003eCell\u003c/em\u003e \u003cb\u003e155\u003c/b\u003e, 1365\u0026ndash;1379 (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGoyret, J., Markwell, P. M. \u0026amp; Raguso, R. A. Context- and scale-dependent effects of floral CO\u003csub\u003e2\u003c/sub\u003e on nectar foraging by \u003cem\u003eManduca sexta\u003c/em\u003e. \u003cem\u003eProc. Natl. Acad. Sci. USA\u003c/em\u003e. \u003cb\u003e105\u003c/b\u003e, 4565\u0026ndash;4570 (2008).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMurray, T. J., Ellsworth, D. S., Tissue, D. T. \u0026amp; Riegler, M. Interactive direct and plant-mediated effects of elevated atmospheric [CO\u003csub\u003e2\u003c/sub\u003e] and temperature on a eucalypt-feeding insect herbivore. \u003cem\u003eGlob Chang. Biol.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e, 1407\u0026ndash;1416 (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChang, X. et al. Multiple resistances and complex mechanisms of \u003cem\u003eAnopheles sinensis\u003c/em\u003e mosquito: a major obstacle to mosquito-borne diseases control and elimination in China. \u003cem\u003ePLoS Negl. Trop. Dis.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, e2889 (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJones, W. D., Cayirlioglu, P., Kadow, I. G. \u0026amp; Vosshall, L. B. Two chemosensory receptors together mediate carbon dioxide detection in \u003cem\u003eDrosophila\u003c/em\u003e. \u003cem\u003eNature\u003c/em\u003e \u003cb\u003e445\u003c/b\u003e, 86\u0026ndash;90 (2007).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSyed, Z. \u0026amp; Leal, W. S. Maxillary palps are broad spectrum odorant detectors in \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e. \u003cem\u003eChem. Senses\u003c/em\u003e. \u003cb\u003e32\u003c/b\u003e, 727\u0026ndash;738 (2007).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNing, C., Yang, K., Xu, M., Huang, L. Q. \u0026amp; Wang, C. Z. Functional validation of the carbon dioxide receptor in labial palps of \u003cem\u003eHelicoverpa armigera\u003c/em\u003e moths. \u003cem\u003eInsect Biochem. Mol. Biol.\u003c/em\u003e \u003cb\u003e73\u003c/b\u003e, 12\u0026ndash;19 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKwon, J. Y., Dahanukar, A., Weiss, L. A. \u0026amp; Carlson, J. R. The molecular basis of CO\u003csub\u003e2\u003c/sub\u003e reception in \u003cem\u003eDrosophila\u003c/em\u003e. \u003cem\u003eProc. Natl. Acad. Sci. USA\u003c/em\u003e. \u003cb\u003e104\u003c/b\u003e, 3574\u0026ndash;3578 (2007).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFilho, W. L. et al. Climate change, health and mosquito-borne diseases: trends and implications to the pacific region. \u003cem\u003eInt J. Environ. Res. Public. Health\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuarner, J. \u0026amp; Hale, G. L. Four human diseases with significant public health impact caused by mosquito-borne flaviviruses: West Nile, Zika, dengue and yellow fever. \u003cem\u003eSemin Diagn. Pathol.\u003c/em\u003e \u003cb\u003e36\u003c/b\u003e, 170\u0026ndash;176 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLu, T. et al. Odor coding in the maxillary palp of the malaria vector mosquito \u003cem\u003eAnopheles gambiae\u003c/em\u003e. \u003cem\u003eCurr. Biol.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e, 1533\u0026ndash;1544 (2007).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKent, L. B., Walden, K. K. \u0026amp; Robertson, H. M. The Gr family of candidate gustatory and olfactory receptors in the yellow-fever mosquito \u003cem\u003eAedes aegypti\u003c/em\u003e. \u003cem\u003eChem. Senses\u003c/em\u003e. \u003cb\u003e33\u003c/b\u003e, 79\u0026ndash;93 (2008).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRobertson, H. M. \u0026amp; Kent, L. B. Evolution of the gene lineage encoding the carbon dioxide receptor in insects. \u003cem\u003eJ. Insect Sci.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 19 (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eArensburger, P. et al. Sequencing of \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e establishes a platform for mosquito comparative genomics. \u003cem\u003eScience\u003c/em\u003e \u003cb\u003e330\u003c/b\u003e, 86\u0026ndash;88 (2010).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLombardo, F. et al. Arc\u0026agrave;, B. Deciphering the olfactory repertoire of the tiger mosquito \u003cem\u003eAedes albopictus\u003c/em\u003e. \u003cem\u003eBMC Genom.\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e, 770 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eErdelyan, C. N., Mahood, T. H., Bader, T. S. \u0026amp; Whyard, S. Functional validation of the carbon dioxide receptor genes in \u003cem\u003eAedes aegypti\u003c/em\u003e mosquitoes using RNA interference. \u003cem\u003eInsect Mol. Biol.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e, 119\u0026ndash;127 (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu, P., Wen, X. \u0026amp; Leal, W. S. CO\u003csub\u003e2\u003c/sub\u003e per se activates carbon dioxide receptors. \u003cem\u003eInsect Biochem. Mol. Biol.\u003c/em\u003e \u003cb\u003e117\u003c/b\u003e, 103284 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang, Y. J., Lan, Y. \u0026amp; Chen, B. A. S. D. B. A comprehensive omics database for \u003cem\u003eAnopheles sinensis\u003c/em\u003e. \u003cem\u003eGenomics\u003c/em\u003e \u003cb\u003e113\u003c/b\u003e, 976\u0026ndash;982 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, B. et al. De novo transcriptome sequencing and sequence analysis of the malaria vector \u003cem\u003eAnopheles sinensis\u003c/em\u003e (Diptera: Culicidae). \u003cem\u003eParasit. Vectors\u003c/em\u003e. \u003cb\u003e7\u003c/b\u003e, 314 (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, B. Genome biology and pyrethroid resistance mechanism of \u003cem\u003eAnopheles sinensis\u003c/em\u003e. \u003cem\u003eScientific Res. Publishing Inc USA\u003c/em\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMou, X., Ren, S. \u0026amp; Chen, B. Whole genomic identification and characteristic analysis of the GR gene family in \u003cem\u003eAnopheles sinensis\u003c/em\u003e (Diptera: Culicidae). \u003cem\u003eActa Entomologica Sinica\u003c/em\u003e. \u003cb\u003e68\u003c/b\u003e (01), 23\u0026ndash;35 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu, W. \u0026amp; Anderson, A. Carbon dioxide receptor genes in cotton bollworm \u003cem\u003eHelicoverpa armigera\u003c/em\u003e. \u003cem\u003eNaturwissenschaften\u003c/em\u003e \u003cb\u003e102\u003c/b\u003e, 11 (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTamura, K., Stecher, G. \u0026amp; Kumar, S. MEGA11: molecular evolutionary genetics analysis version 11. \u003cem\u003eMol. Biol. Evol.\u003c/em\u003e \u003cb\u003e38\u003c/b\u003e, 3022\u0026ndash;3027 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLivak, K. J. \u0026amp; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. \u003cem\u003eMethods\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 402\u0026ndash;408 (2001).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGeier, M. \u0026amp; Boeckh, J. A new Y-tube olfactometer for mosquitoes to measure the attractiveness of host odours. \u003cem\u003eEntomol. Exp. Appl.\u003c/em\u003e \u003cb\u003e92\u003c/b\u003e, 9\u0026ndash;19 (2010).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeGennaro, M. et al. Vosshall, L. B. Orco mutant mosquitoes lose strong preference for humans and are not repelled by volatile DEET. \u003cem\u003eNature\u003c/em\u003e \u003cb\u003e498\u003c/b\u003e, 487\u0026ndash;491 (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMa, D. et al. Structural basis for sugar perception by \u003cem\u003eDrosophila\u003c/em\u003e gustatory receptors. \u003cem\u003eScience\u003c/em\u003e \u003cb\u003e383\u003c/b\u003e (6685), eadj2609 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBibi, M. et al. In silico characterisation of the \u003cem\u003eAedes aegypti\u003c/em\u003e gustatory receptors. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e24\u003c/b\u003e (15), 12263 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e38.Rodrigues, T. B. et al. Carbon dioxide receptor genes and their expression profile in \u003cem\u003eDiabrotica virgifera\u003c/em\u003e virgifera. \u003cem\u003eBMC Res. Notes\u003c/em\u003e. \u003cb\u003e9\u003c/b\u003e, 18 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCoutinho-Abreu, I. V., Sharma, K., Cui, L., Yan, G. \u0026amp; Ray, A. Odorant ligands for the CO\u003csub\u003e2\u003c/sub\u003e receptor in two \u003cem\u003eAnopheles\u003c/em\u003e vectors of malaria. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 2549 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWebster, B., Lacey, E. S. \u0026amp; Card\u0026eacute;, R. T. Waiting with bated breath: opportunistic orientation to human odor in the malaria mosquito, \u003cem\u003eAnopheles gambiae\u003c/em\u003e, is modulated by minute changes in carbon dioxide concentration. \u003cem\u003eJ. Chem. Ecol.\u003c/em\u003e \u003cb\u003e41\u003c/b\u003e (1), 59\u0026ndash;66 (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOmondi, B. A., Majeed, S. \u0026amp; Ignell, R. Functional development of carbon dioxide detection in the maxillary palp of \u003cem\u003eAnopheles gambiae\u003c/em\u003e. \u003cem\u003eJ. Exp. Biol.\u003c/em\u003e \u003cb\u003e218\u003c/b\u003e, 2482\u0026ndash;2488 (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePeach, D. A. H., Gries, R., Zhai, H., Young, N. \u0026amp; Gries, G. Multimodal floral cues guide mosquitoes to tansy inflorescences. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e (1), 3908 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSpitzen, J. \u0026amp; Takken, W. Keeping track of mosquitoes: a review of tools to track, record and analyse mosquito flight. \u003cem\u003eParasites vectors\u003c/em\u003e. \u003cb\u003e11\u003c/b\u003e (1), 123 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAthrey, G., Popkin-Hall, Z. R., Takken, W. \u0026amp; Slotman, M. A. The expression of chemosensory genes in male maxillary palps of \u003cem\u003eAnopheles coluzzii\u003c/em\u003e (Diptera: Culicidae) and \u003cem\u003eAn. quadriannulatus\u003c/em\u003e. \u003cem\u003eJ. Med. Entomol.\u003c/em\u003e \u003cb\u003e58\u003c/b\u003e, 1012\u0026ndash;1020 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, S. T., Kowalewski, J. \u0026amp; Ray, A. Prolonged activation of carbon dioxide-sensitive neurons in mosquitoes. \u003cem\u003eInterface Focus\u003c/em\u003e. \u003cb\u003e11\u003c/b\u003e, 20200043 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNalikkaramal, S., Hill, S. R. \u0026amp; Ignell, R. Impact of elevated CO2 level and egg quiescence duration on gene expression in the peripheral olfactory system of \u003cem\u003eAedes aegypti\u003c/em\u003e. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e (1), 14318 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGrant, A. J. \u0026amp; Dickens, J. C. Functional characterization of the octenol receptor neuron on the maxillary palps of the yellow fever mosquito, \u003cem\u003eAedes aegypti\u003c/em\u003e. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cb\u003e6\u003c/b\u003e, e21785 (2011).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuerenstein, P. G., Christensen, T. A. \u0026amp; Hildebrand, J. G. Sensory processing of ambient CO2 information in the brain of the moth \u003cem\u003eManduca sexta\u003c/em\u003e. \u003cem\u003eJ. Comp. Physiol. Neuroethol Sens. Neural Behav. Physiol.\u003c/em\u003e \u003cb\u003e190\u003c/b\u003e, 707\u0026ndash;725 (2004).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang, J., Duan, S., Wang, W., Liu, D. \u0026amp; Wang, Y. Molecular basis of CO\u003csub\u003e2\u003c/sub\u003e sensing in \u003cem\u003eHyphantria cunea\u003c/em\u003e. \u003cem\u003eInt J. Mol. Sci\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChoi, K. S. et al. Elevated CO\u003csub\u003e2\u003c/sub\u003e may alter pheromonal communication in \u003cem\u003eHelicoverpa armigera\u003c/em\u003e (lepidoptera: Noctuidae). \u003cem\u003ePhysiol. Entomol.\u003c/em\u003e \u003cb\u003e43\u003c/b\u003e (3), 169\u0026ndash;179 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNignan, C. et al. Comparison of swarming, mating performance and longevity of males \u003cem\u003eAnopheles coluzzii\u003c/em\u003e between individuals fed with different natural fruit juices in laboratory and semi-field conditions. \u003cem\u003eMalar. J.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e, 173 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTurner, S. L. et al. Ultra-prolonged activation of CO\u003csub\u003e2\u003c/sub\u003e-sensing neurons disorients mosquitoes. \u003cem\u003eNature\u003c/em\u003e \u003cb\u003e474\u003c/b\u003e (7349), 87\u0026ndash;91 (2011).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhou, Y. H., Zhang, Z. W., Fu, Y. F., Zhang, G. C. \u0026amp; Yuan, S. Carbon dioxide, odorants, heat and visible cues affect wild mosquito landing in open spaces. \u003cem\u003eFront. Behav. Neurosci.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 86 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eReinhold, J. M. et al. Species-specificity in thermopreference and CO\u003csub\u003e2\u003c/sub\u003e-gated heat-seeking in culex mosquitoes. \u003cem\u003eInsects\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMetz, H. C., Zung, J. L. \u0026amp; McBride, C. S. Quantifying \u003cem\u003eAedes aegypti\u003c/em\u003e host odor preference using a two-port olfactometer. \u003cem\u003eCold Spring Harb Protoc\u003c/em\u003e, pdb.top107661 (2023).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Anopheles sinensis, CO2 receptor gene, characteristics, phylogenetics, expression pattern, function","lastPublishedDoi":"10.21203/rs.3.rs-6979096/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6979096/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCarbon dioxide (CO\u003csub\u003e2\u003c/sub\u003e), as a chemical signal, plays an essential role for the host-seeking of mosquitoes, and CO\u003csub\u003e2\u003c/sub\u003e receptor genes (CRGs) have been proposed to be responsible of the host-seeking behavior in some insects. However, the expression patterns of CRGs have yet to explore, and the function in host-seeking behavior response has only limitedly understood. In this study, we investigated the characteristics, phylogenetics, expression patterns, and function of three CRGs in \u003cem\u003eAn. sinensis\u003c/em\u003e. The CRGs from six mosquito and four other dipteran species were identified and phylogenetically classified in three groups, and all mosquitoes have three CRGs that are classified into GR1, GR2 and GR3 with GR2 being specific for mosquitoes, and other dipteran insects have only two CRGs that are classified into GR1 and GR3. All three CRGs were specifically expressed in maxillary palps in \u003cem\u003eAn. sinensis\u003c/em\u003e; however, only \u003cem\u003eAsinGR22\u003c/em\u003e and \u003cem\u003eAsinGR24\u003c/em\u003e were significantly up-regulated in females than in males, and all three CRGs were significantly down-regulated post blood feeding. Functional analysis using RNAi revealed that \u003cem\u003eAsinGR22\u003c/em\u003e and \u003cem\u003eAsinGR24\u003c/em\u003e mediate the capacity for CO\u003csub\u003e2\u003c/sub\u003e detection of female adults, but \u003cem\u003eAsinGR23\u003c/em\u003e might enhance the capacity as a regulatory factor rather than a functional gene. All these three genes demonstrated no influence to blood feeding behavior. This is the first comprehensive study on CRGs in \u003cem\u003eAn. sinensis\u003c/em\u003e. This study revealed the function of CRGs in CO\u003csub\u003e2\u003c/sub\u003e detection and blood-sucking behavior, and provided a comprehensive information frame for further research on function and application of CRGs in mosquitoes.\u003c/p\u003e","manuscriptTitle":"Expression patterns and functional exploration of CO 2 receptor genes in Anopheles sinensis (Diptera: Culicidae)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-04 11:07:42","doi":"10.21203/rs.3.rs-6979096/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b315c491-290f-4b84-acca-1370ff717841","owner":[],"postedDate":"September 4th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":54191606,"name":"Biological sciences/Biochemistry"},{"id":54191607,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2026-01-28T10:04:17+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-04 11:07:42","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6979096","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6979096","identity":"rs-6979096","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00