Expression of the Wnt signaling pathway and hair follicle development in Rex rabbits of different ages | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Expression of the Wnt signaling pathway and hair follicle development in Rex rabbits of different ages Ce Liu, Yin Zhang, Liya Bai, Shuxia Gao, Haitao Sun, Liping Yang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5087646/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract In the present study, we aimed to observe hair follicle development and describe the Wnt signaling pathways related to hair follicle development in Rex rabbits of different ages. Six Rex rabbits aged 15, 30, 60, 90, 120 and 150 days were selected, and skin samples were collected for hair follicle development and Wnt signaling pathway gene expression detection. The results revealed that the values for body weight, coat length, skin thickness, skin area, and skin weight of Rex rabbits were increased significantly with age ( p < 0.05). The total hair follicle density, secondary hair follicle density and ratio of the secondary hair follicle density to the primary hair follicle density at the age of 120 days in Rex rabbits were greater than those at the other ages ( p < 0.05), and the major hair follicles were in the growing period at 15 days and 30 days of age. Some of them had already entered the degeneration period at 60 days of age, and most of them had entered the degeneration period at 90 days of age. The presence of quiescent hair follicles and the enlargement of primary hair follicles were also observed. At 120 and 150 days of age, the back hair follicles entered the growing period, and the secondary hair follicles had clearly differentiated. Furthermore, the expression levels of the Wnt10b , CTNNB1 , adenomatosis polyposis protein (APC) , disheveled 2 (DVL2) , glycogen synthase kinase 3β (GSK-3β) , Lymphoid enhancer-binding factor 1 (LEF1) , dickkopf-1 (DKK1) and transforming growth factor beta 1 (TGFβ-1) genes in the skin tissue of Rex rabbits at different age was significantly different ( p < 0.05), and the expression of the Wnt10b , CTNNB1 , DVL2 , GSK-3β , and TGFβ-1 genes at 90 days were greater than those at the other days. The expression levels of the LEF1 and DKK1 genes at 60 days were greater than those at the other days. As indicated by western blotting, the β-catenin protein phosphorylation (P-CTNNB1) levels in the skin tissue of Rex rabbits first tended to increase, then decreased and then increased, and the levels at 60, 120 and 150 days were significantly greater than those at 15, 30 and 90 days ( p < 0.05). With increasing age, the GSK-3β protein phosphorylation (P-GSK-3β) level in the skin tissue of Rex rabbits increased, reaching a maximum at 120 days of age ( p < 0.05). These results show that age could influence the fur quality and hair follicle traits of Rex rabbits and that the Wnt signaling pathway is involved in the biological process of periodic hair follicle development in Rex rabbits. Considering the rules of fur growth, the slaughter age of Rex rabbits should not be earlier than 120 days. Biological sciences/Genetics/Gene expression Biological sciences/Developmental biology Age Rabbit Wnt signaling pathway Fur quality Hair follicle development Figures Figure 1 Figure 2 Figure 3 Introduction The hair follicle is an kind of adjunct organ of the skin that exists in the dermis and subcutaneous tissue 1 . Hair follicles are the base of hair growth and provide hair fixation and protection, and wool-production animals provide important textile materials for humans. The hair follicles of mammals after birth have the periodic regeneration functions, with stages including hair shaft active growth (anagen phase), apoptosis (catagen phase) and relatively static hair follicles (telogen phase) 2 . During the anagen, hairs grow vertically and erectly, and the dermal papilla appears as a tight, spherical with a string of thickened keratinocytes between it and the hair shaft, and the duration of anagen determines the length of the fur animals. The catagen, also known as the dynamic transition period between anagen and telogen, is regulated by a variety of signaling molecules, and the hair pap within the hair bulb shrinks and hair growth gradually stops. For telogen stage, hair follicle activity basically stops, the hair shaft matures, and will eventually be shed from the follicle. During this period, the hair papilla is completely absent, and the dermal papilla is embedded in theermis of the skin. The resting hair follicle stem cells respond to the signaling factors and are rapidly activated, causing the hair follicle to enter the anagen. Hair follicles depend on periodic cycle growth to realize the growth and renewal of hair, and their periodic changes determine the periodic growth and shedding of hair. The periodic development of hair follicles is affected by many factors, that are regulated by a series of signaling molecules 3 , 4 , 5 . The Wnt signaling pathway is a group of signal transduction pathways regulated by the Wnt protein and β-catenin gene (CTNNB1); these proteins include Wnt, β-catenin, frizzled, dishevelled and low-density lipoprotein receptor-related protein 5/6 (LRP5/6) proteins 6 . In addition, a complex of glycogen synthase kinase 3β (GSK-3β), adenomatosis polyposis protein (APC), axin and casein kinase 1 also plays a key regulatory role, and the polyprotein complex can phosphorylate β-catenin residues and ultimately mediate the degradation of ubiquitinated β-catenin. Wnt protein ligands activate the Wnt signaling pathway by binding to receptors, and the Wnt-frizzled/lipoprotein receptor complex can induce β-catenin phosphorylation, thereby enabling β-catenin and T-cell factor (TCF)/lymphoid enhancer factor (LEF)/β-catenin-mediated gene expression to regulate the proliferation and differentiation of hair follicle cells 7 , 8 , 9 . The canonical Wnt signaling pathway not only regulates embryonic growth and development, tumorigenesis and formation but also plays key regulatory roles in hair follicle development and hair shaft growth 10 , 11 , 12 . Rex rabbits are important fur rabbits, and its fur quality has important economic value; however, the effects of the Wnt signaling pathway on fur rabbits have rarely been reported, and the mechanism by which the Wnt signaling pathway influences hair follicle development remains unclear. In this study, the gene expression and protein phosphorylation levels of the components of the Wnt signaling pathway in Rex rabbits of different ages were studied to determine the relationship between Wnt signaling and hair follicle development. In addition, an appropriate slaughter age for Rex rabbits was determined, it will be important to improve the fur quality of animals. Materials and methods The experimental procedures were approved by the Institute of Animal Husbandry and Veterinary Medicine, Shandong Academy of Agricultural Sciences Animal Care and Use Committee (IASVM-2022-08). All the experiments were performed in accordance with the internationally accepted standard ethical guidelines for animal use and care. The study is reported in accordance with the ARRIVE guidelines ( https://arriveguidelines.org ). Experimental design Six Rex rabbits (3 male and 3 female) that were 15, 30, 60, 90, 120 and 150 days of age that had been fed the same feed and housed in the same house were selected (Taian Xinglong Rabbit Industry Professional Cooperative, Taian). The experimental rabbits were sacrificed via cervical dislocation. The skin samples were collected and stored in cryopreservation tubes and 4% paraformaldehyde solution. The expression levels of Wnt signaling pathway genes were detected by fluorescence after reverse transcription, and changes in β-catenin and GSK-3β phosphorylation levels were detected. The fixed samples were made into paraffin sections and subjected to hematoxylin‒eosin (HE) staining. The longitudinal samples were used to observe the hair follicle location period, and the transverse samples were used to count the hair follicle density. Determination of indicators and methods Body weight and visceral development The experimental rabbits were fasted for 12 hours prior to slaughter and weighed. Before slaughter, 1 mL xylazine hydrochloride (Changsha Best Biological Technology Institute Co. Ltd.) per kilogram of body weight were subcutaneous injected for general anesthesia, and the animals were then slaughtered by bloodletting. The heart, lung, liver and kidney were carefully peeled and weighed. Then, the heart, lung, liver and kidney indices were calculated by dividing their weights by the live weight before slaughter. Fur quality The fur quality indices of Rex rabbits of different ages were detected as described previously 13 . The adhesive tissue and fat were removed from the fur, weighed, the relative weight of the fur was calculated as fur weight/body weight. Then cut the fur in the middle of the abdomen, and the length and width of the skin were measured using a soft ruler. The skin area was calculated as skin length*skin width. The thickness of the skin was measured using Vernier calipers, and the length of the coat was measured using a straightedge. The hair follicle density was observed with paraffin sectioning and HE staining. After HE staining, photos were taken under ordinary light conditions with a microscope (Nikon, ECLIPSE 80i, Japan), and Image-Pro Plus 6.0 analysis software was used to calculate the hair follicle density (primary hair follicle density, secondary hair follicle density, and total hair follicle density). The ratio of the secondary hair follicle density to the primary hair follicle density was also calculated. RNA isolation and real-time PCR analysis The SYBR Green I method was used to detect gene expression in the skin tissues of the rabbits. Total RNA extraction and real-time PCR were performed as described previously 14 . The RNA quality was determined by agarose gel electrophoresis, and the purity was assessed using a nucleic acid spectrophotometer (DENOVIX, DS-11 Spectrophotometer, USA). The A260/A280 ratios of all the samples were in the range of 1.8–2.0, and 1.0% agarose gel electrophoresis with ethidium bromide (Sigma‒Aldrich, Germany) revealed good integrity of the RNA bands. The sequences of the primers used in this study are shown in Table 1 . Using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the normalization gene, the relative amounts of mRNA encoded by the genes were calculated using the 2 delta‒delta CT method 15 . Table 1 Information on primers. Gene Accession number Primer sequence (5′-3′) Product length, bp GAPDH NM_001082253.1 F: TTCCAGTATGATTCCACCCACG 232 R: GGGCTGAGATGATGACCCTTTT Wnt10b XM_002711076.4 F: GGCGAGAATGAGAATCCATAACAA 196 R: GTTGTGGGTGTCAATGAAGATGG Fzd4 XM_002708648 F: AAGTGGGTCAGATGGTCCTG 117 R: CCCGATGAAGTGAAACTGGT CTNNB1 XM_051852655.1 F: TGGATACCTCCCAAGTCCTGTA 207 R: CCAGACGCTGAACATTAGTAGGAT APC XM_008248401 F: GACTCCAGGCTTCTGGTTTG 121 R: TAGTGCTCTGGTGGGCTCTT DVL2 XM_008270807 F: ACTCCACCATGTCCCTCAAC 117 R: CGATGTAGATGCCTCCGTCT GSK-3β XM_017347066.1 F: TGAGGTCTATCTTAATCTGGTGCTG 183 R: TGTGGTTTAATATCCCGATGGC TCF3 NM_001171390 F: CGGGAGATAGAGCAGGTGAA 127 R: GGTAGTCATCGCCGTAGGAG LEF1 XM_008267508 F: GCGTCCACACCTGTAACCTT 122 R: CTCTTCCTCAAATCCCTCCA DKK1 NM_001082737.2 F: ATGGGTATTCCCGCAGAACC 150 R: CCTTGAGGACGGGCTTACAG TGF-β1 XM_008249704.2 F: CTGCTGTGGCTCCTAGTGTTGA 134 R: AGCCGCAGTTTGGACAGGAT GAPDH: glyceraldehyde-3-phosphate dehydrogenase; Fzd4: Frizzled 4; CTNNB1: catenin beta 1; APC: Adenomatosis polyposis protein; DVL2: Disheveled 2; GSK-3β: glycogen synthase kinase 3 beta; TCF3: Transcription factor 3; Lef1: Lymphoid enhancer-binding factor 1; DKK1: dickkopf-1; TGF-β1: transforming growth factor beta 1 ; F: forward primer; R: reverse primer. Western blotting Total protein extraction and sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) were performed according to Liu et al. 16 . Total protein was extracted from skin tissue using radioimmunoprecipitation lysis buffer (Beyotime, Shanghai, China), and the protein concentration was determined using a BCA protein assay kit (Conwin, Beijing, China). The extracted protein (50 ng/sample) was dissolved in 40 mL of SDS loading buffer (Solarbio, Beijing, China), electrophoresed on 12.5% SDS‒PAGE gels (Bio-Rad, Richmond, USA) and transferred to polyvinylidene fluoride membranes (Millipore, Billerica, USA). Protein molecular mass standard markers were purchased from Thermo (USA). The membranes were blocked with 5% skim milk in PBS (Solarbio, China) at 4°C overnight and incubated with primary antibodies (ACTIN, Servicebio, Wuhan, China; P-CTNNB1, BIOSS, Beijing, China; P-GSK-3β, Servicebio, Wuhan, China) at a 1:1,000 dilution. The membranes were then washed with Tris-buffered saline containing Tween (Solarbio, Beijing, China) and incubated with a 1:3000 dilution of a horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG antibody (Servicebio, Wuhan, China) at 37°C for 1 h. The proteins were visualized using Beyo ECL reagent (Beyotime, Shanghai, China). Band intensity was quantified using an AIWBwell™ Bioimage Analysis System (Servicebio, Wuhan, China). The relative content of each sample was calculated as the ratio of the index gray value to the internal parameter gray value. Statistical analysis SPSS 26.0 statistical software was used for one-way ANOVA of the data, and Duncan’s test was used for multiple comparisons. The results are presented as the mean value and standard error of the mean (SEM), and p < 0.05 was considered to indicate a significant difference. Results Growth and development of internal organs The effects of different ages on the growth and development of internal organs in Rex rabbits are shown in Table 2 . The values for body weight, heart weight, lung weight, liver weight and kidney weight of Rex rabbits increased significantly with age ( p < 0.05), and those of 150-day-old Rex rabbits were significantly greater than those of 15-, 30-, 60- or 90-day-old Rex rabbits. However, the heart, lung, and kidney indices decreased significantly with age ( p < 0.05), and those of the 15-day-old group were greater than those of the older groups (i.e., 60, 90, 120 and 150 days). The liver index first increased but then decreased with increasing age and reached a maximum at 60 days of age ( p < 0.05). Table 2 Effects of different ages on growth and development of internal organs in Rex rabbits. Items Age (days) SEM p -value 15 30 60 90 120 150 Body weight (g) 340.0 f 785.0 e 1455.0 d 2073.3 c 2601.7 b 3178.3 a 169.15 < 0.001 Heart weight (g) 1.73 e 3.15 d 5.48 c 6.97 b 7.18 b 8.62 a 0.441 < 0.001 Lung weight (g) 3.30 d 7.28 c 10.13 bc 11.58 b 10.27 bc 17.20 a 0.877 < 0.001 Liver weight (g) 11.25 d 27.43 c 58.28 b 60.30 b 66.98 b 80.22 a 4.174 < 0.001 Kidney weight (g) 4.27 e 8.13 d 11.43 cd 13.77 bc 17.48 ab 18.65 a 0.985 < 0.001 Heart index (g/kg) 5.21 a 3.98 b 3.79 bc 3.37 bc 2.75 c 2.71 c 0.200 < 0.001 Lung index (g/kg) 9.95 a 9.26 ab 6.98 abc 5.65 bc 3.96 c 5.37 bc 0.609 0.018 Liver index (g/kg) 33.02 b 34.53 b 41.62 a 28.12 c 25.81 c 25.24 c 1.129 < 0.001 Kidney index (g/kg) 12.56 a 10.32 ab 7.89 bc 6.64 c 6.81 c 5.87 c 0.515 < 0.001 Means with different superscripts in a row are significantly different ( p < 0.05), n = 6. SEM: standard error of means. Fur quality The effects of different ages on the fur quality of Rex rabbits are shown in Table 3 . The values for coat length, skin thickness, skin area, and skin weight of Rex rabbits increased significantly with age ( p < 0.05), and those of 150-day-old rabbits were significantly greater than those of 15-day-old rabbits. However, there was no significant difference in the relative weight of the skin of Rex rabbits at different ages ( p > 0.05). Table 3 Effects of different ages on the fur quality of Rex rabbits. Items Age (days) SEM p -value 15 30 60 90 120 150 Coat length (cm) 1.81 b 1.82 b 1.88 ab 1.86 ab 1.87 ab 1.95 a 0.013 0.026 Skin thickness (mm) 4.67 b 6.62 a 6.87 a 6.92 a 7.25 a 7.28 a 0.174 < 0.001 Skin area (cm 2 ) 367.50 f 649.67 e 996.50 d 1354.75 c 1699.00 b 1937.80 a 169.145 < 0.001 Skin weight (g) 55.0 f 118.8 e 227.6 d 322.9 c 435.1 b 545.4 a 29.928 < 0.001 Relative weight of skin (%) 16.19 14.26 15.59 15.56 16.64 17.16 0.316 0.119 Means with different superscripts in a row are significantly different ( p < 0.05), n = 6. SEM: standard error of means. Hair follicle development and density Hair follicle development in the dorsal skin was observed via paraffin vertical sectioning and HE staining. According to the specific morphological characteristics of three distinct stages (anagen, catagen and telogen), the major hair follicles were in the growing period at 15 (Fig. 1 a) and 30 days (Fig. 1 b) of age. Some of the the hair follicles had already entered the degeneration period at 60 days of age (Fig. 1 c), and most of them had entered the degeneration period at 90 days of age (Fig. 1 d). The presence of quiescent hair follicles and the enlargement of primary hair follicles were also observed. At 120 days (Fig. 1 e) and 150 days (Fig. 1 f) of age, the back hair follicles entered the growing period, and the secondary hair follicles had clearly differentiated. Besides, the hair follicle density in the dorsal skin was observed via paraffin transverse sectioning, and the results of HE staining are shown in Fig. 2 . Statistical analysis revealed that the total hair follicle density, secondary hair follicle density and ratio of the secondary hair follicle density to the primary hair follicle density were greater at 120 days (Fig. 2 e) in Rex rabbits than that at the 15 days (Fig. 2 a), 30 days (Fig. 2 b), 60 days (Fig. 2 c), 90 days (Fig. 2 d) or 150 days (Fig. 2 f) of age ( p 0.05; Table 4 ). Table 4 Effects of different ages on the hair follicle density of Rex rabbits. Items Age (days) SEM p -value 15 30 60 90 120 150 Total hair follicle density (count/mm 2 ) 232.8 d 287.8 c 308.7 bc 334.9 b 370.8 a 319.4 bc 8.508 < 0.001 Primary hair follicle density (count/mm 2 ) 12.02 14.36 12.17 13.58 13.11 14.04 0.291 0.089 Secondary hair follicle density (count/mm 2 ) 220.8 d 273.4 c 296.5 bc 321.3 b 357.7 a 305.4 bc 8.421 < 0.001 Secondary hair follicle/ Primary hair follicle ratio 18.47 d 19.46 cd 24.52 ab 23.85 b 27.42 a 21.87 bc 0.667 < 0.001 Means with different superscripts in a row are significantly different ( p < 0.05), n = 6. SEM: standard error of means. Gene expression related to hair follicle development The effects of different ages on the gene expression associated with hair follicle development in Rex rabbits are shown in Table 5 . The expression levels of the Wnt10b , CTNNB1 , APC , DVL2 , GSK-3β , LEF1 , DKK1 and TGF-β1 genes in the skin tissue of Rex rabbits at different age was significantly different ( p < 0.05), and the expression levels of the Wnt10b , CTNNB1 , DVL2 , GSK-3β , and TGF-β1 genes at 90 days was greater than those in the other days. The expression levels of the LEF1 and DKK1 genes at 60 days were greater than those at the other days. There was no significant difference in Fzd4 or TCF3 gene expression in Rex rabbits at different ages ( p > 0.05). Table 5 Effects of different ages on the gene expression of hair follicle development in Rex rabbits. Items Age (days) SEM p -value 15 30 60 90 120 150 Wnt10b 1.00 b 2.43 b 2.54 b 4.24 a 1.85 b 1.29 b 0.273 0.003 Fzd4 1.00 1.12 2.53 1.30 2.06 1.69 0.169 0.052 CTNNB1 1.00 b 3.05 a 1.39 b 2.68 a 0.59 b 0.52 b 0.220 < 0.001 APC 1.00 b 1.68 b 5.38 a 1.89 b 5.46 a 3.66 a 0.376 < 0.001 DVL2 1.00 c 0.87 c 1.39 bc 2.10 a 1.74 ab 1.45 bc 0.103 0.001 GSK-3β 1.00 b 2.61 a 0.98 b 2.21 a 0.66 b 0.82 b 0.178 0.001 TCF3 1.00 1.11 1.13 1.64 1.38 1.45 0.089 0.281 LEF1 1.00 c 1.64 bc 3.93 a 3.42 ab 3.27 ab 2.57 abc 0.311 0.037 DKK1 1.00 b 0.35 c 1.83 a 0.43 bc 0.45 bc 0.56 b 0.112 < 0.001 TGF-β1 1.00 bc 1.40 ab 1.04 bc 2.04 a 1.47 ab 0.53 c 0.115 0.001 Means with different superscripts in a row are significantly different ( p < 0.05), n = 6. SEM: standard error of means. Fzd4: Frizzled 4; CTNNB1: catenin beta 1; APC: Adenomatosis polyposis protein; DVL2: Disheveled 2; GSK-3β: glycogen synthase kinase 3 beta; TCF3: Transcription factor 3; Lef1: Lymphoid enhancer-binding factor 1; DKK1: dickkopf-1; TGF-β1: transforming growth factor beta 1. Protein phosphorylation levels The effects of different ages on the protein phosphorylation levels during hair follicle development in Rex rabbits are shown in Fig. 3 . As indicated, the β-catenin protein phosphorylation (P-CTNNB1) level in the skin tissue of Rex rabbits tended to increase and then decrease; they increased again, and the levels at 60, 120 and 150 days were significantly higher than those at 15, 30 and 90 days ( p < 0.05, Fig. 3 a). With increasing age, the GSK-3β protein phosphorylation (P-GSK-3β) levels in the skin tissue of Rex rabbits increased, reaching a maximum at 120 days of age ( p < 0.05, Fig. 3 c). Discussion Rabbits exhibit fast growth in the early stage and slow growth in the late stage. The growth rates of Tianfu black rabbits and New Zealand rabbits tended to increase at ages of 30–75 days and decrease at the age of 75 days 17 . Qin et al. 18 reported that the average weights of 15-, 30-, 45-, 60-, 75- and 90-day-old German white rabbits were 64.3 g, 194.6 g, 373.3 g, 495.0 g, 648.4 g and 732.2 g, respectively. The peak growth of the rabbits ranged from 30–75 days of age, and the growth rate decreased after 90 days. As a local variety, the growth rate of southwest Minxinan black rabbits is slow; the best slaughter time is later than that of commercial rabbits (the appropriate age is 110–130 days) 19 . An age of 84 days at slaughter is appropriate for Laiwu black rabbits because of their muscle quality and potential commercial value 20 . In actual production, the slaughter of medium-sized meat rabbits at the age of 2.5–3 months is economical, and the greatest economic benefit can be obtained. The internal organs are the basic facilities of animal life and carry out physiological functions. As indicated in this study (Table 2 ), the body weight, heart weight, lung weight, liver weight and kidney weight of Rex rabbits increased with age. However, the heart, lung, and kidney indices decreased with age. The liver index first increased but then decreased with increasing age and reached a maximum at 60 days of age. Therefore, the growth and development of the internal organs of Rex rabbits exhibit nonlinear characteristics. Rex rabbits are a typical type of rabbit whose skin has important economic value. The early stage (30–90 days of age) of Rex rabbits involves mainly individual growth; after 90 days of age, the fur begins to mature 21 . In this work, the values for coat length, skin thickness, skin area, and skin weight of Rex rabbits increased with age. However, the relative weights of the skin of Rex rabbits were similar across different ages (Table 3 ). The hair follicle is an adjunct organ of the skin that exists in the dermis and subcutaneous tissue. Hair follicles are complex suborgan structures that are formed during embryonic development through interactions between the neuroectoderm and mesenchyme and can be divided into primary and secondary hair follicles. Primary follicles develop from a variety of cell taxa, and secondary follicles develop from primary follicles 22 . The hair follicle development of Rex rabbits is mainly concentrated at 20–26 days of gestational age, with the most active development occurring at 23–24 days of gestational age and basic development occurring at 25–26 days of gestational age 23 . Activation of the Wnt signaling pathway is a critical initial step in hair basal plate formation during hair follicle development in the embryonic period 24 , 25 . After birth, the hair of Rex rabbits has a certain growth period, growing to the end of maturity because undifferentiated cells at the bottom of the hair follicle gradually slow differentiation and finally stop growing. This process of growth, decay and repose of rabbit hair and its replacement by new hair is called reflexing 26 . The basis of Rex rabbit hair replacement includes the growth, decline and resting periods of hair follicle development. The hair follicle cycle can be divided into anagen, catagen and telogen phases according to the morphological characteristics of hair follicles. Hair follicles undergo a cycle of growth, decline, and rest before re-entering the growth cycle, a process known as hair follicle periodic regeneration 27 . In this study, we found that there are periodic changes in the development of Rex rabbits’ hair follicles. The major hair follicles were in the growing period at 15 and 30 days of age, some of which had already entered the degeneration period at 60 days of age, and most of them had entered the degeneration period at 90 days of age. The presence of quiescent hair follicles and the enlargement of primary hair follicles were also observed. At 120 and 150 days of age, the back hair follicles entered the growing period, and the secondary hair follicles had clearly differentiated (Fig. 1 ). The hair follicle density of the Rex rabbits was greater at 120 days (Table 4 ; Fig. 2 ), which is consistent with previous reports. The Wnt protein is a secretory glycoprotein rich in cysteines that can act in a paracrine or autocrine manner 28 ; it binds to the frizzled receptor family and low-density lipoprotein receptor-related protein (LRP) on the cell membrane and stabilizes and accumulates β-catenin in the cytoplasm 29 . Adenovirus-mediated overexpression of the Wnt10b protein induces hair follicles to grow from the quiescent phase. Lei et al. 30 demonstrated that overexpression of the mouse whisker Wnt10b protein can activate the canonical Wnt signaling pathway, promoting the proliferation of hair stromal cells and thereby inducing hair follicles to enter the growth phase. In contrast, siRNA-mediated knockout of the Wnt10b gene can prevent hair follicles from entering the growth phase 31 . Wnt10b-mediated aberrant activation of the Wnt pathway increases the number of CD 34+ hair follicle stem cells in a proliferative state, resulting in enlargement of the hair bulb, hair shaft, and dermal papilla 32 . Beta-catenin is an important molecule in the Wnt signaling pathway and is involved in many biological processes. When β-catenin enters the nucleus, displaces the transducin-like enhancer while binding to the lymphoid enhancer factor/T-cell factor, recruits two histone modifiers, cAMP-response element binding protein binding protein and brahma-related gene-1, and activates the expression of target genes 33 . Beta-catenin is transiently expressed in the epidermis of adult mice, and the normal hair follicle cycle is interrupted to enter the growth phase and form new hair follicles de novo 34 . These results suggest that the β-catenin-dependent Wnt pathway is sufficient to induce the proliferation of hair follicle stem cells and the subsequent growth of new hair follicles. High expression of β-catenin induces hair follicle stem cells to differentiate into hair follicle-forming cells; when β-catenin is expressed at low levels or absent, hair follicle stem cells no longer participate in hair self-renewal, instead differentiating in the direction of epithelial keratinocytes 35 . Dasgupta et al. 36 , upon the occurrence of the above phenomena, reoverexpressed β-catenin, a process that reverses this effect; that is, cells that would otherwise have differentiated in the epithelial direction differentiate in the direction of forming hair follicle structures, allowing hair growth to continue. In addition, studies have shown that increasing the content of stable β-catenin can induce the formation of new hair follicles in the adult epidermis 37 . When the Wnt signaling pathway is activated, β-catenin dephosphorylates and stably exists, which allows cytosolic β-catenin to enter the nucleus, initiates the expression of downstream genes, and regulates hair follicle periodic growth. However, when the local epidermal activity of β-catenin is increased, hair follicles are periodically dysregulated, which can lead to the suppression of folliculogenesis 38 , 39 , 40 , 41 . In this study, the β-catenin protein phosphorylation (P-CTNNB1) level in the skin tissue of Rex rabbits first tended to increase but then decreased and then increased; the P-CTNNB1 levels at 60, 120 and 150 days were greater than those at 15, 30 and 90 days (Fig. 3 a), which suggests that the P-CTNNB1 level in the skin tissue of Rex rabbits is related to the biological process of hair follicle development. Dickkopf-associated protein 1 (DKK1) is an important antagonist of the Wnt signaling pathway 42 , it can inhibit the Wnt signaling pathway by inhibiting β-catenin activity, leading to hair follicle degeneration 43 . During embryogenesis, conditional knockout of the β-catenin gene in the epidermis results in blocked formation of the hair substrate, thereby blocking hair follicle morphogenesis 44 . When Wnt10b binds to frizzled and LRP5/6, the cytosolic protein dishevelled (DVL) is activated, resulting in the phosphorylation of GSK-3β, the binding of axin to LRP5/6, and the accumulation of free β-catenin in the cytoplasm without phosphorylation. Therefore, Wnt signaling also requires the sequestration of GSK-3β inside multivesicular endosomes 45 . In this study, with increasing age, the GSK-3β protein phosphorylation (P-GSK-3β) level in the skin tissue of Rex rabbits increased and peaked at 120 days of age (Fig. 3 c), suggesting that GSK-3β, an important member of the Wnt pathway, participates in the biological process of Rex rabbit hair follicle development. In addition, transforming growth factor-β (TGF-β) can regulate the quiescence or activation state of hair follicle stem cells, and hair follicles can advance into the growth phase after the injection of recombinant TGF-β2 protein 46 . Dermal papilla cells can secrete TGF-β2 after knockout of the TGF-β receptor in hair follicle stem cells and are unable to receive TGF-β2 signaling, which activates hair follicle stem cells to transition from the resting phase to the growth phase 47 . Furthermore, their growth/rest switching mechanism in hair follicles is based on Eng-dependent feedback cross-talk between Wnt and bone morphogenetic protein signals 48 . The expression levels of the Wnt10b, CTNNB1, APC, DVL2, GSK-3β, LEF1, DKK1 and TGF-β1 genes in the skin tissue of Rex rabbits at different ages differed, and the expression levels of the Wnt10b, CTNNB1, DVL2, GSK-3β , and TGF-β1 genes at 90 days were greater than those on the other days (Table 5 ). Therefore, the Wnt signaling pathway is involved in the biological process of periodic hair follicle development in Rex rabbits of different ages. Conclusion There are periodic changes in the development of Rex rabbit hair follicles; the major hair follicles were in the growing period at 15 and 30 days of age; some of them had already entered the degeneration period at 60 days of age, and most of them had entered the degeneration period at 90 days of age. The presence of quiescent hair follicles and the enlargement of primary hair follicles were also observed. At 120 and 150 days of age, the back hair follicles entered the growing period, and the secondary hair follicles had clearly differentiated. The hair follicle density of Rex rabbits was greater at 120 days, and the Wnt signaling pathway is involved in the biological process of periodic hair follicle development in Rex rabbits of different ages. Considering the rules of fur growth, these results indicate that the slaughter age of Rex rabbits should not be earlier than 120 days. Declarations Competing interests The authors declare no competing interests. Funding This work has been financially supported by funds from the Natural Science Foundation of Shandong Province (ZR2023QC017); Action Plan for Rural Revitalization of Science and Technology Innovation, Key Research and Development Program of Shandong Province (2023TZXD044); Shandong Province Modern Agricultural Industry Technology System (SDAIT-21-09); Earmarked Fund for Modern Agro-industry Technology Research System (CARS-43-G-7). Author Contribution Ce Liu and Gongyan Liu conceived and planned experiments; Yin Zhang methodology; Shuxia Gao, Haitao Sun, Liya Bai carried out experimental part; Ce Liu, Liping Yang and Gongyan Liu carried out molecular analysis; Yin Zhang carried out statistical analysis; Ce Liu prepared the manuscript draft, Gongyan Liu, Shuxia Gao and Haitao Sun were funding acquisition. All authors provided critical feedback and helped share the research, analysis, and manuscript. All authors have read and agreed to the published version of the manuscript. Acknowledgement The author thanks the staff of Taian Xinglong Rabbit Industry Professional Cooperative help in the feeding experiments. Data Availability The data that support the findings of this study are available from the corresponding author upon reasonable request. References Schneider, M. R., Schmidt-Ullrich, R. & Paus, R. The hair follicle as a dynamic miniorgan. Curr. Biol. 19 , R132–R142 (2009). Hsu, Y. C., Li, L. & Fuchs, E. Transit-amplifying cells orchestrate stem cell activity and tissue regeneration. Cell 157 (4), 935–949 (2014). Millar, S. E. Molecular mechanisms regulating hair follicle development. J. Invest. Dermatol. 118 , 216–225 (2002). Lee, J. & Tumbar, T. Hairy tale of signaling in hair follicle development and cycling. Semin Cell. Dev. Biol. 23 (8), 906–916 (2012). Huang, D., Ding, H., Wang, Y., Wang, X. & Zhao, H. Integration analysis of hair follicle transcriptome and proteome reveals the mechanisms regulating wool fiber diameter in Angora rabbits. Int. J. Mol. Sci. 25 (6), 1647–1670 (2024). Xiang, M. Gene regulation by Wnt signaling pathway in the oriented differentiation of hair follicle stem cells. J. Tissue Eng. Reconstr. Surg. 7 (5), 290–294 (2011). Lin, C. et al. Expression of Wnt/β-catenin signaling, stem-cell markers and proliferating cell markers in rat whisker hair follicles. J. Mol. Histol. 46 (3), 233–240 (2015). González-Sancho, J. M., Brennan, K. R., Castelo-Soccio, L. A. & Brown, A. M. C. Wnt proteins induce dishevelled phosphorylation via an LRP5/6-independent mechanism: irrespective of their ability to stabilize b-catenin. Mol. Cell. Biol. 24 , 4757–4768 (2004). Enshell-Seijffers, D., Lindon, C., Kashiwagi, M. & Morgan, B. A. beta-catenin activity in the dermal papilla regulates morphogenesis and regeneration of hair. Develop Cell. 18 , 633–642 (2010). Majidinia, M., Aghazadeh, J., Jahanban-Esfahlani, R. & Yousefi, B. The roles of Wnt/beta-catenin pathway in tissue development and regenerative medicine. J. Cell. Physiol. 233 (8), 5598–5612 (2018). Tian, H., Wang, X., Lu, J., Tian, W. & Chen, P. MicroRNA-621 inhibits cell proliferation and metastasis in bladder cancer by suppressing Wnt/beta-catenin signaling. Chem. Biol. Interact. 308 , 244–251 (2019). Wu, Z., Zhu, Y., Liu, H., Liu, G. & Li, F. Wnt10b promotes hair follicles growth and dermal papilla cells proliferation via Wnt/β-Catenin signaling pathway in Rex rabbits. Bioscience Rep. 40 , BSR20191248 (2020). Liu, G. et al. Hair follicle development of Rex rabbits is regulated seasonally by Wnt, TGFβ-BMP, IGF1, and EGF signaling pathways. Animals 13 , 3742 (2023). Liu, G. Y., Wu, Z. Y., Zhu, Y. L., Liu, L. & Li, F. C. Effects of dietary vitamin B6 on the skeletal muscle protein metabolism of growing rabbits. Anim. Prod. Sci. 57 , 2007–2015 (2017). LiLivak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 -∆∆CT method. Methods 25 , 402–408 (2001). Liu, G. et al. The functions of ocu-miR-205 in regulating hair follicle development in Rex rabbits. BMC Dev. Biol. 20 (8), 1–13 (2020). Lai, S., Yang, G. & Li, Y. A comparison between Tianfu black rabbit and New Zealand rabbit in growth rate and feed conversion efficiency. J. Sichuan Agricul Univ. 20 (4), 362–363 (2002). Qin, Y., Li, L. & Du, Y. Comparison of early growth and feed conversion efficiency between German White Rabbit and New Zealand Rabbit. Chin. Rabbit Breed. 2 , 18–20 (2000). Liu, G. et al. Effects of different slaughter ages on slaughter performance, fat deposition and muscle quality of Minxinan black rabbit. Chin. J. Anim. Husb. 58 (2), 224–228 (2022). Zhou, B. et al. Comparative analysis of production performance and muscle quality of Laiwu black rabbits at different slaughter ages. Chin. J. Anim. Nutr. 35 (8), 5322–5332 (2023). Yurniati, Y., Raharjo, Y. & Kusmajadi, S. The effect of restricted feeding and different of slaughtering age on production of Rex rabbit pelt. J. Indonesian Trop. Anim. Agric. 35 (3), 192–196 (2014). Alonso, L. & Fuchs, E. Stem cells in the skin: waste not, Wnt not. Genes Dev. 17 (10), 1189–1200 (2003). Liu, L., Li, B., Zhu, Y., Wang, C. & Li, F. Differential gene expression profiles in foetal skin of Rex rabbits with different wool density. World Rabbit Sci. 24 (3), 223–231 (2016). Fu, J. & Hsu, W. Epidermal Wnt controls hair follicle induction by orchestrating dynamic signaling crosstalk between the epidermis and dermis. J. Invest. Dermatol. 133 (4), 890–898 (2013). Chen, D., Jarrell, A. & Guo, C. Dermal beta catenin activity in response to epidermal Wntligands is required for fibroblast proliferation and hair follicle initiation. Development 139 (8), 1522–1533 (2012). Wu, Z. et al. Hair follicle development and related gene and protein expression of skins in Rex rabbits during the first 8 weeks of life. Asian Austral J. Anim. 32 (4), 477–484 (2019). Woo, C., Eleanor, W. & Bruce, A. Morgan dermal papilla cell number specifies hair size, shape and cycling and its reduction causes follicular decline. Develop Stem Cells . 140 , 1676–1683 (2013). Augustin, I. Wnt signaling in skin homeostasis and pathology. J. Dtsch. Dermatol. Ges . 13 (4), 302–306 (2015). Clevers, H. & Nusse, R. Wnt/beta catenin signaling and diseease. Cell 149 (6), 1192–1205 (2012). Lei, M. et al. Prolonged overexpression of Wnt10b induces epidermal keratinocyte transformation through activating EGF pathway. Histochem. Cell. Biol. 144 (3), 209–221 (2015). Li, Y. H. et al. Adenovirus-mediated Wnt10b overexpression induces hair follicle regeneration. J. Invest. Dermatol. 133 (1), 42–48 (2013). Lei, M. et al. Modulating hair follicle size with Wnt10b/DKK1 during hair regeneration. Exp. Dermatol. 23 (6), 407–413 (2014). Saito-Diaz, K. et al. The way Wnt works: components and mechanism. Growth Factors 31(1),1–31 (2013). (2013). Lichtenberger, B. M., Mastrogiannaki, M. & Watt, F. M. Epidermal beta-catenin activation remodels the dermis via paracrine signalling to distinct fibroblast lineages. Nat. Commun. 7 , 10537 (2016). Huelsken, J., Vogel, R., Erdmann, B., Cotsarelis, G. & Birchmeier, W. Beta catenin controls hair follicle morphogenesis and stem cell differentiation in the skin. Cell 105 (4), 533–545 (2001). Dasgupta, R. & Fuchs, E. Multiple roles for activated LEF/TCF transcription complexes during hair follicle development and differentiation. Develop 126 (20), 4557–4568 (1999). Niezgoda, A. et al. Properties of skin stem cells and their potential clinical applications in modern dermatology. Eur. J. Dermatol. 27 (3), 227–236 (2017). Mastrogiannaki, M. et al. Beta-catenin stabilization in skin fibroblasts causes fibrotic lesions by preventing adipocyte differentiation of the reticular dermis. J. Invest. Dermatol. 136 (6), 1130–1142 (2016). Jahoda, C. & Gilmore, A. C. What lies beneath: Wnt/beta-catenin signaling and cell fate in the lower dermis. J. Invest. Dermatol. 136 (6), 1084–1087 (2016). Lin, B. J. et al. LncRNA-PCAT1 maintains characteristics of dermal papilla cells and promotes hair follicle regeneration by regulating miR-329/Wnt10b axis. Exp. Cell. Res. 394 (1), 112031 (2020). Rishikaysh, P. et al. Signaling involved in hair follicle morphogenesis and development. Int. J. Mol. Sci. 15 (1), 1647–1670 (2014). Taelman, V. F. et al. Wnt signaling requires sequestration of glycogen synthase kinase 3 inside multivesicular endosomes. Cell 143 (7), 1136–1148 (2010). Kwack, M. H., Kim, M. K., Kim, J. C. & Sung, Y. K. Dickkopf 1 promotes regression of hair follicles. J. Invest. Dermatol. 132 , 1554–1560 (2012). Lim, X. & Nusse, R. Wnt signaling in skin development, homeostasis, and disease. Cold Spring Harb Perspect. Biol. 5 (2), a008029 (2013). Yuan, Y. P. et al. Canonical and non-canonical Wnt signaling control the regeration of amputated rodent vibrissae follicles. J. Mol. Histol. 47 (1), 1–8 (2016). Foitzik, K., Paus, R. & Doetschman, T. The TGF-beta 2 isoform is both a required and sufficient inducer of murine hair follicle morphogenesis. Deve Biol. 212 , 278–289 (1999). Oshimori, N. & Fuchs, E. Paracrine TGF-beta signaling counterbalances BMP-mediated repression in hair follicle stem cell activation. Cell. Stem Cell. 10 , 63–75 (2012). Calvo-Sanchez, M. I. et al. A role for the Tgf-beta/bmp co-receptor endoglin in the molecular oscillator that regulates the hair follicle cycle. J. Mol. Cell. Biol. 11 (1), 39–52 (2019). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5087646","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":443682345,"identity":"b2d0c12e-7625-46d0-b659-446c305f4fe1","order_by":0,"name":"Ce Liu","email":"","orcid":"","institution":"Shandong Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Ce","middleName":"","lastName":"Liu","suffix":""},{"id":443682346,"identity":"667d743f-8de6-411d-8c42-77777c18e261","order_by":1,"name":"Yin Zhang","email":"","orcid":"","institution":"Shandong Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Yin","middleName":"","lastName":"Zhang","suffix":""},{"id":443682354,"identity":"c7d495e9-7e78-4c19-890d-b51b5010ad29","order_by":2,"name":"Liya Bai","email":"","orcid":"","institution":"Shandong Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Liya","middleName":"","lastName":"Bai","suffix":""},{"id":443682355,"identity":"3936024b-c4b9-42d7-bddb-418245ebc527","order_by":3,"name":"Shuxia Gao","email":"","orcid":"","institution":"Shandong Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Shuxia","middleName":"","lastName":"Gao","suffix":""},{"id":443682356,"identity":"fa72ec98-d2ea-4b85-8598-71044ff7fea5","order_by":4,"name":"Haitao Sun","email":"","orcid":"","institution":"Shandong Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Haitao","middleName":"","lastName":"Sun","suffix":""},{"id":443682357,"identity":"86b7c468-da50-4337-a995-64720778a4f5","order_by":5,"name":"Liping Yang","email":"","orcid":"","institution":"Shandong Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Liping","middleName":"","lastName":"Yang","suffix":""},{"id":443682360,"identity":"a0cf87d8-5637-4a87-9ca9-9a0438674e33","order_by":6,"name":"Gongyan Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6klEQVRIiWNgGAWjYBADGTYG5gMfQCw2diK18LAxsCXOAGthJlYLEBmCtTAQ0iLv3nv4NU/NHR4+iZyPDR/btsnzMTMwfviYg1uL4ZlzadY8x57xsEnkbmyccea2YRszA7PkzG14tMzIMTPmYTsM0rL9MU/FbUagFjZmXoJa/oG05Dxs5jG4bU9Qi7xEjvFj3jawFsZmoC2JBLUY8JwxY5zbB9TC88wQ5JfkNmbGZrx+kW/vMf7w5tthOfn25IfAELttO7+9+eCHj/hsOcDAJsWDKsbYgFs9yJYGBuaPP/AqGQWjYBSMghEPAB7LTMyVrKNHAAAAAElFTkSuQmCC","orcid":"","institution":"Shandong Academy of Agricultural Sciences","correspondingAuthor":true,"prefix":"","firstName":"Gongyan","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2024-09-14 07:27:57","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5087646/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5087646/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":80805891,"identity":"e9d5da9c-8978-42a5-96b2-b1919039373e","added_by":"auto","created_at":"2025-04-17 09:25:58","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4127403,"visible":true,"origin":"","legend":"\u003cp\u003eLongitudinal incision of skin and hair follicle tissue of Rex rabbits, (a) skinning in 15 days; (b) skinning in 30 days; (c) skinning in 60 days; (d) skinning in 90 days; (e) skinning in 120 days; (f) skinning in 150 days. The major hair follicles were in the growing period at 15 and 30 days of age. Some of the hair follicles had already entered the degeneration period at 60 days of age, and most of them had entered the degeneration period at 90 days of age. The presence of quiescent hair follicles and the enlargement of primary hair follicles were also observed. At 120 and 150 days of age, the back hair follicles entered the growing period, and the secondary hair follicles had clearly differentiated. Scale bars =500 μm.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5087646/v1/b9bf09b4e592097a033e37a6.png"},{"id":80806363,"identity":"e6e642bb-a1b0-446c-a1b8-5f29c4756c67","added_by":"auto","created_at":"2025-04-17 09:33:58","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5109670,"visible":true,"origin":"","legend":"\u003cp\u003eCross-cutting of skin and hair follicle tissue of Rex rabbits, (a) skinning in 15 days; (b) skinning in 30 days; (c) skinning in 60 days; (d) skinning in 90 days; (e) skinning in 120 days; (f) skinning in 150 days. The total hair follicle density, secondary hair follicle density and the ratio of the secondary hair follicle density to the primary hair follicle density in 120 days. Scale bars =500 μm.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5087646/v1/ef55fafdc78b9fa92477dcb1.png"},{"id":80805893,"identity":"c4cd2052-911e-4f6a-92b2-52d4d3ce951d","added_by":"auto","created_at":"2025-04-17 09:25:58","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":480365,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of different ages on the protein phosphorylation levels in Rex rabbits. (a) β-catenin protein phosphorylation (P-CTNNB1) levels in skin tissue; (b) Blotting strip of P-CTNNB1 in skin tissue; (c) GSK-3β protein phosphorylation (P-GSK-3β) levels in skin tissue; (d) Blotting strip of P-GSK-3β in skin tissue; Means with different superscripts are significantly different (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05), n=6.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5087646/v1/98eacdef56471d8078635252.png"},{"id":84880129,"identity":"70f59b39-d145-410b-8c2f-916a89acb891","added_by":"auto","created_at":"2025-06-18 10:47:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9654794,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5087646/v1/dc845157-905c-4431-bd4e-1c458e754ba6.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Expression of the Wnt signaling pathway and hair follicle development in Rex rabbits of different ages","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe hair follicle is an kind of adjunct organ of the skin that exists in the dermis and subcutaneous tissue\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Hair follicles are the base of hair growth and provide hair fixation and protection, and wool-production animals provide important textile materials for humans. The hair follicles of mammals after birth have the periodic regeneration functions, with stages including hair shaft active growth (anagen phase), apoptosis (catagen phase) and relatively static hair follicles (telogen phase)\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. During the anagen, hairs grow vertically and erectly, and the dermal papilla appears as a tight, spherical with a string of thickened keratinocytes between it and the hair shaft, and the duration of anagen determines the length of the fur animals. The catagen, also known as the dynamic transition period between anagen and telogen, is regulated by a variety of signaling molecules, and the hair pap within the hair bulb shrinks and hair growth gradually stops. For telogen stage, hair follicle activity basically stops, the hair shaft matures, and will eventually be shed from the follicle. During this period, the hair papilla is completely absent, and the dermal papilla is embedded in theermis of the skin. The resting hair follicle stem cells respond to the signaling factors and are rapidly activated, causing the hair follicle to enter the anagen. Hair follicles depend on periodic cycle growth to realize the growth and renewal of hair, and their periodic changes determine the periodic growth and shedding of hair. The periodic development of hair follicles is affected by many factors, that are regulated by a series of signaling molecules\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. The Wnt signaling pathway is a group of signal transduction pathways regulated by the Wnt protein and \u003cem\u003eβ-catenin\u003c/em\u003e gene (CTNNB1); these proteins include Wnt, β-catenin, frizzled, dishevelled and low-density lipoprotein receptor-related protein 5/6 (LRP5/6) proteins\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. In addition, a complex of glycogen synthase kinase 3β (GSK-3β), adenomatosis polyposis protein (APC), axin and casein kinase 1 also plays a key regulatory role, and the polyprotein complex can phosphorylate β-catenin residues and ultimately mediate the degradation of ubiquitinated β-catenin. Wnt protein ligands activate the Wnt signaling pathway by binding to receptors, and the Wnt-frizzled/lipoprotein receptor complex can induce β-catenin phosphorylation, thereby enabling β-catenin and T-cell factor (TCF)/lymphoid enhancer factor (LEF)/β-catenin-mediated gene expression to regulate the proliferation and differentiation of hair follicle cells\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. The canonical Wnt signaling pathway not only regulates embryonic growth and development, tumorigenesis and formation but also plays key regulatory roles in hair follicle development and hair shaft growth\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Rex rabbits are important fur rabbits, and its fur quality has important economic value; however, the effects of the Wnt signaling pathway on fur rabbits have rarely been reported, and the mechanism by which the Wnt signaling pathway influences hair follicle development remains unclear. In this study, the gene expression and protein phosphorylation levels of the components of the Wnt signaling pathway in Rex rabbits of different ages were studied to determine the relationship between Wnt signaling and hair follicle development. In addition, an appropriate slaughter age for Rex rabbits was determined, it will be important to improve the fur quality of animals.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e The experimental procedures were approved by the Institute of Animal Husbandry and Veterinary Medicine, Shandong Academy of Agricultural Sciences Animal Care and Use Committee (IASVM-2022-08). All the experiments were performed in accordance with the internationally accepted standard ethical guidelines for animal use and care. The study is reported in accordance with the ARRIVE guidelines (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://arriveguidelines.org\u003c/span\u003e\u003cspan address=\"https://arriveguidelines.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eExperimental design\u003c/h2\u003e \u003cp\u003eSix Rex rabbits (3 male and 3 female) that were 15, 30, 60, 90, 120 and 150 days of age that had been fed the same feed and housed in the same house were selected (Taian Xinglong Rabbit Industry Professional Cooperative, Taian). The experimental rabbits were sacrificed via cervical dislocation. The skin samples were collected and stored in cryopreservation tubes and 4% paraformaldehyde solution. The expression levels of Wnt signaling pathway genes were detected by fluorescence after reverse transcription, and changes in β-catenin and GSK-3β phosphorylation levels were detected. The fixed samples were made into paraffin sections and subjected to hematoxylin‒eosin (HE) staining. The longitudinal samples were used to observe the hair follicle location period, and the transverse samples were used to count the hair follicle density.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDetermination of indicators and methods\u003c/h3\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eBody weight and visceral development\u003c/h2\u003e \u003cp\u003eThe experimental rabbits were fasted for 12 hours prior to slaughter and weighed. Before slaughter, 1 mL xylazine hydrochloride (Changsha Best Biological Technology Institute Co. Ltd.) per kilogram of body weight were subcutaneous injected for general anesthesia, and the animals were then slaughtered by bloodletting. The heart, lung, liver and kidney were carefully peeled and weighed. Then, the heart, lung, liver and kidney indices were calculated by dividing their weights by the live weight before slaughter.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eFur quality\u003c/h3\u003e\n\u003cp\u003eThe fur quality indices of Rex rabbits of different ages were detected as described previously\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. The adhesive tissue and fat were removed from the fur, weighed, the relative weight of the fur was calculated as fur weight/body weight. Then cut the fur in the middle of the abdomen, and the length and width of the skin were measured using a soft ruler. The skin area was calculated as skin length*skin width. The thickness of the skin was measured using Vernier calipers, and the length of the coat was measured using a straightedge. The hair follicle density was observed with paraffin sectioning and HE staining. After HE staining, photos were taken under ordinary light conditions with a microscope (Nikon, ECLIPSE 80i, Japan), and Image-Pro Plus 6.0 analysis software was used to calculate the hair follicle density (primary hair follicle density, secondary hair follicle density, and total hair follicle density). The ratio of the secondary hair follicle density to the primary hair follicle density was also calculated.\u003c/p\u003e\n\u003ch3\u003eRNA isolation and real-time PCR analysis\u003c/h3\u003e\n\u003cp\u003eThe SYBR Green I method was used to detect gene expression in the skin tissues of the rabbits. Total RNA extraction and real-time PCR were performed as described previously\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. The RNA quality was determined by agarose gel electrophoresis, and the purity was assessed using a nucleic acid spectrophotometer (DENOVIX, DS-11 Spectrophotometer, USA). The A260/A280 ratios of all the samples were in the range of 1.8\u0026ndash;2.0, and 1.0% agarose gel electrophoresis with ethidium bromide (Sigma‒Aldrich, Germany) revealed good integrity of the RNA bands. The sequences of the primers used in this study are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the normalization gene, the relative amounts of mRNA encoded by the genes were calculated using the 2 delta‒delta CT method\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eInformation on primers.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGene\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAccession number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer sequence (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eProduct length, bp\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001082253.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TTCCAGTATGATTCCACCCACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e232\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: GGGCTGAGATGATGACCCTTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eWnt10b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_002711076.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GGCGAGAATGAGAATCCATAACAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e196\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: GTTGTGGGTGTCAATGAAGATGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFzd4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_002708648\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: AAGTGGGTCAGATGGTCCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e117\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CCCGATGAAGTGAAACTGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCTNNB1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_051852655.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TGGATACCTCCCAAGTCCTGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e207\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CCAGACGCTGAACATTAGTAGGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAPC\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_008248401\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GACTCCAGGCTTCTGGTTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e121\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: TAGTGCTCTGGTGGGCTCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eDVL2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_008270807\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: ACTCCACCATGTCCCTCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e117\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CGATGTAGATGCCTCCGTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGSK-3β\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_017347066.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TGAGGTCTATCTTAATCTGGTGCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e183\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: TGTGGTTTAATATCCCGATGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTCF3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001171390\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CGGGAGATAGAGCAGGTGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e127\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: GGTAGTCATCGCCGTAGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eLEF1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_008267508\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GCGTCCACACCTGTAACCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e122\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CTCTTCCTCAAATCCCTCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eDKK1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001082737.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: ATGGGTATTCCCGCAGAACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e150\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CCTTGAGGACGGGCTTACAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTGF-β1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_008249704.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CTGCTGTGGCTCCTAGTGTTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e134\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: AGCCGCAGTTTGGACAGGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cem\u003eGAPDH: glyceraldehyde-3-phosphate dehydrogenase; Fzd4: Frizzled 4; CTNNB1: catenin beta 1; APC: Adenomatosis polyposis protein; DVL2: Disheveled 2; GSK-3β: glycogen synthase kinase 3 beta; TCF3: Transcription factor 3; Lef1: Lymphoid enhancer-binding factor 1; DKK1: dickkopf-1; TGF-β1: transforming growth factor beta 1\u003c/em\u003e; F: forward primer; R: reverse primer.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eTotal protein extraction and sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) were performed according to Liu et al.\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Total protein was extracted from skin tissue using radioimmunoprecipitation lysis buffer (Beyotime, Shanghai, China), and the protein concentration was determined using a BCA protein assay kit (Conwin, Beijing, China). The extracted protein (50 ng/sample) was dissolved in 40 mL of SDS loading buffer (Solarbio, Beijing, China), electrophoresed on 12.5% SDS‒PAGE gels (Bio-Rad, Richmond, USA) and transferred to polyvinylidene fluoride membranes (Millipore, Billerica, USA). Protein molecular mass standard markers were purchased from Thermo (USA). The membranes were blocked with 5% skim milk in PBS (Solarbio, China) at 4\u0026deg;C overnight and incubated with primary antibodies (ACTIN, Servicebio, Wuhan, China; P-CTNNB1, BIOSS, Beijing, China; P-GSK-3β, Servicebio, Wuhan, China) at a 1:1,000 dilution. The membranes were then washed with Tris-buffered saline containing Tween (Solarbio, Beijing, China) and incubated with a 1:3000 dilution of a horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG antibody (Servicebio, Wuhan, China) at 37\u0026deg;C for 1 h. The proteins were visualized using Beyo ECL reagent (Beyotime, Shanghai, China). Band intensity was quantified using an AIWBwell\u0026trade; Bioimage Analysis System (Servicebio, Wuhan, China). The relative content of each sample was calculated as the ratio of the index gray value to the internal parameter gray value.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eSPSS 26.0 statistical software was used for one-way ANOVA of the data, and Duncan\u0026rsquo;s test was used for multiple comparisons. The results are presented as the mean value and standard error of the mean (SEM), and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered to indicate a significant difference.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eGrowth and development of internal organs\u003c/h2\u003e\n \u003cp\u003eThe effects of different ages on the growth and development of internal organs in Rex rabbits are shown in Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e. The values for body weight, heart weight, lung weight, liver weight and kidney weight of Rex rabbits increased significantly with age (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and those of 150-day-old Rex rabbits were significantly greater than those of 15-, 30-, 60- or 90-day-old Rex rabbits. However, the heart, lung, and kidney indices decreased significantly with age (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and those of the 15-day-old group were greater than those of the older groups (i.e., 60, 90, 120 and 150 days). The liver index first increased but then decreased with increasing age and reached a maximum at 60 days of age (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003cdiv align=\"char\" class=\"colspec\"\u003e\u003cbr\u003e\u003c/div\u003e\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eEffects of different ages on growth and development of internal organs in Rex rabbits.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"9\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eItems\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"6\"\u003e\n \u003cp\u003eAge (days)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSEM\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003ep\u003c/em\u003e-value\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e90\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e120\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e150\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBody weight (g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e340.0 \u003csup\u003ef\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e785.0 \u003csup\u003ee\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1455.0 \u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2073.3 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2601.7 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3178.3 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e169.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeart weight (g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.73 \u003csup\u003ee\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.15 \u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.48 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.97 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.18 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8.62 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.441\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLung weight (g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.30 \u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.28 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.13 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11.58 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.27 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e17.20 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.877\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLiver weight (g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11.25 \u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e27.43 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e58.28 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e60.30 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e66.98 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e80.22 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4.174\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eKidney weight (g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.27 \u003csup\u003ee\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8.13 \u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11.43 \u003csup\u003ecd\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13.77 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e17.48 \u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18.65 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.985\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeart index (g/kg)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.21 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.98 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.79 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.37 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.75 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.71 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.200\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLung index (g/kg)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9.95 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9.26 \u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.98 \u003csup\u003eabc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.65 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.96 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.37 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.609\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.018\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLiver index (g/kg)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e33.02 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e34.53 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e41.62 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e28.12 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e25.81 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e25.24 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.129\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eKidney index (g/kg)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12.56 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.32 \u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.89 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.64 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.81 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.87 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.515\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"9\"\u003eMeans with different superscripts in a row are significantly different (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), n\u0026thinsp;=\u0026thinsp;6. SEM: standard error of means.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eFur quality\u003c/h2\u003e\n \u003cp\u003eThe effects of different ages on the fur quality of Rex rabbits are shown in Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e. The values for coat length, skin thickness, skin area, and skin weight of Rex rabbits increased significantly with age (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and those of 150-day-old rabbits were significantly greater than those of 15-day-old rabbits. However, there was no significant difference in the relative weight of the skin of Rex rabbits at different ages (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab3\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eEffects of different ages on the fur quality of Rex rabbits.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"9\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eItems\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"6\"\u003e\n \u003cp\u003eAge (days)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSEM\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003ep\u003c/em\u003e-value\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e90\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e120\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e150\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCoat length (cm)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.81 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.82 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.88 \u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.86 \u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.87 \u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.95 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.013\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.026\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSkin thickness (mm)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.67 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.62 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.87 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.92 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.25 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.28 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.174\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSkin area (cm\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e367.50 \u003csup\u003ef\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e649.67 \u003csup\u003ee\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e996.50 \u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1354.75 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1699.00 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1937.80 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e169.145\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSkin weight (g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e55.0 \u003csup\u003ef\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e118.8 \u003csup\u003ee\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e227.6 \u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e322.9 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e435.1 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e545.4 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e29.928\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRelative weight of skin (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e15.59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e15.56\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16.64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e17.16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.316\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.119\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"9\"\u003eMeans with different superscripts in a row are significantly different (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), n\u0026thinsp;=\u0026thinsp;6. SEM: standard error of means.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eHair follicle development and density\u003c/h2\u003e\n \u003cp\u003eHair follicle development in the dorsal skin was observed via paraffin vertical sectioning and HE staining. According to the specific morphological characteristics of three distinct stages (anagen, catagen and telogen), the major hair follicles were in the growing period at 15 (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea) and 30 days (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb) of age. Some of the the hair follicles had already entered the degeneration period at 60 days of age (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ec), and most of them had entered the degeneration period at 90 days of age (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ed). The presence of quiescent hair follicles and the enlargement of primary hair follicles were also observed. At 120 days (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ee) and 150 days (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ef) of age, the back hair follicles entered the growing period, and the secondary hair follicles had clearly differentiated. Besides, the hair follicle density in the dorsal skin was observed via paraffin transverse sectioning, and the results of HE staining are shown in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e. Statistical analysis revealed that the total hair follicle density, secondary hair follicle density and ratio of the secondary hair follicle density to the primary hair follicle density were greater at 120 days (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ee) in Rex rabbits than that at the 15 days (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea), 30 days (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb), 60 days (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec), 90 days (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ed) or 150 days (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ef) of age (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, the primary hair follicle density did not change significantly with age (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05; Table \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab4\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eEffects of different ages on the hair follicle density of Rex rabbits.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"9\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eItems\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"6\"\u003e\n \u003cp\u003eAge (days)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSEM\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003ep\u003c/em\u003e-value\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e90\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e120\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e150\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTotal hair follicle density (count/mm\u003csup\u003e2\u003c/sup\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e232.8 \u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e287.8 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e308.7 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e334.9 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e370.8 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e319.4 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e8.508\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePrimary hair follicle density (count/mm\u003csup\u003e2\u003c/sup\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14.36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12.17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13.58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13.11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.291\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.089\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSecondary hair follicle density (count/mm\u003csup\u003e2\u003c/sup\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e220.8 \u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e273.4 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e296.5 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e321.3 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e357.7 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e305.4 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e8.421\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSecondary hair follicle/ Primary hair follicle ratio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18.47 \u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e19.46 \u003csup\u003ecd\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e24.52 \u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e23.85 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e27.42 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e21.87 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.667\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"9\"\u003eMeans with different superscripts in a row are significantly different (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), n\u0026thinsp;=\u0026thinsp;6. SEM: standard error of means.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eGene expression related to hair follicle development\u003c/h2\u003e\n \u003cp\u003eThe effects of different ages on the gene expression associated with hair follicle development in Rex rabbits are shown in Table \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e. The expression levels of the \u003cem\u003eWnt10b\u003c/em\u003e, \u003cem\u003eCTNNB1\u003c/em\u003e, \u003cem\u003eAPC\u003c/em\u003e, \u003cem\u003eDVL2\u003c/em\u003e, \u003cem\u003eGSK-3\u0026beta;\u003c/em\u003e, \u003cem\u003eLEF1\u003c/em\u003e, \u003cem\u003eDKK1\u003c/em\u003e and \u003cem\u003eTGF-\u0026beta;1\u003c/em\u003e genes in the skin tissue of Rex rabbits at different age was significantly different (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the expression levels of the \u003cem\u003eWnt10b\u003c/em\u003e, \u003cem\u003eCTNNB1\u003c/em\u003e, \u003cem\u003eDVL2\u003c/em\u003e, \u003cem\u003eGSK-3\u0026beta;\u003c/em\u003e, and \u003cem\u003eTGF-\u0026beta;1\u003c/em\u003e genes at 90 days was greater than those in the other days. The expression levels of the \u003cem\u003eLEF1\u003c/em\u003e and \u003cem\u003eDKK1\u003c/em\u003e genes at 60 days were greater than those at the other days. There was no significant difference in \u003cem\u003eFzd4\u003c/em\u003e or \u003cem\u003eTCF3\u003c/em\u003e gene expression in Rex rabbits at different ages (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab5\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eEffects of different ages on the gene expression of hair follicle development in Rex rabbits.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"9\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eItems\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"6\"\u003e\n \u003cp\u003eAge (days)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSEM\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003ep\u003c/em\u003e-value\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e90\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e120\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e150\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eWnt10b\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.00 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.43 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.54 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.24 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.85 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.29 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.273\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eFzd4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.69\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.169\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.052\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCTNNB1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.00 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.05 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.39 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.68 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.59 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.52 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.220\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eAPC\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.00 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.68 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.38 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.89 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.46 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.66 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.376\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eDVL2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.00 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.87 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.39 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.10 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.74 \u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.45 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.103\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eGSK-3\u0026beta;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.00 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.61 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.98 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.21 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.66 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.82 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.178\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eTCF3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.089\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.281\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLEF1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.00 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.64 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.93 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.42 \u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.27 \u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.57 \u003csup\u003eabc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.311\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.037\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eDKK1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.00 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.35 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.83 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.43 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.45 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.56 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.112\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eTGF-\u0026beta;1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.00 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.40 \u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.04 \u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.04 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.47 \u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.53 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.115\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"9\"\u003eMeans with different superscripts in a row are significantly different (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), n\u0026thinsp;=\u0026thinsp;6. SEM: standard error of means. \u003cem\u003eFzd4: Frizzled 4; CTNNB1: catenin beta 1; APC: Adenomatosis polyposis protein; DVL2: Disheveled 2; GSK-3\u0026beta;: glycogen synthase kinase 3 beta; TCF3: Transcription factor 3; Lef1: Lymphoid enhancer-binding factor 1; DKK1: dickkopf-1; TGF-\u0026beta;1: transforming growth factor beta 1.\u003c/em\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eProtein phosphorylation levels\u003c/h2\u003e\n \u003cp\u003eThe effects of different ages on the protein phosphorylation levels during hair follicle development in Rex rabbits are shown in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e. As indicated, the \u0026beta;-catenin protein phosphorylation (P-CTNNB1) level in the skin tissue of Rex rabbits tended to increase and then decrease; they increased again, and the levels at 60, 120 and 150 days were significantly higher than those at 15, 30 and 90 days (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea). With increasing age, the GSK-3\u0026beta; protein phosphorylation (P-GSK-3\u0026beta;) levels in the skin tissue of Rex rabbits increased, reaching a maximum at 120 days of age (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ec).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eRabbits exhibit fast growth in the early stage and slow growth in the late stage. The growth rates of Tianfu black rabbits and New Zealand rabbits tended to increase at ages of 30\u0026ndash;75 days and decrease at the age of 75 days\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Qin et al.\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e reported that the average weights of 15-, 30-, 45-, 60-, 75- and 90-day-old German white rabbits were 64.3 g, 194.6 g, 373.3 g, 495.0 g, 648.4 g and 732.2 g, respectively. The peak growth of the rabbits ranged from 30\u0026ndash;75 days of age, and the growth rate decreased after 90 days. As a local variety, the growth rate of southwest Minxinan black rabbits is slow; the best slaughter time is later than that of commercial rabbits (the appropriate age is 110\u0026ndash;130 days)\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. An age of 84 days at slaughter is appropriate for Laiwu black rabbits because of their muscle quality and potential commercial value\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. In actual production, the slaughter of medium-sized meat rabbits at the age of 2.5\u0026ndash;3 months is economical, and the greatest economic benefit can be obtained. The internal organs are the basic facilities of animal life and carry out physiological functions. As indicated in this study (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), the body weight, heart weight, lung weight, liver weight and kidney weight of Rex rabbits increased with age. However, the heart, lung, and kidney indices decreased with age. The liver index first increased but then decreased with increasing age and reached a maximum at 60 days of age. Therefore, the growth and development of the internal organs of Rex rabbits exhibit nonlinear characteristics.\u003c/p\u003e \u003cp\u003eRex rabbits are a typical type of rabbit whose skin has important economic value. The early stage (30\u0026ndash;90 days of age) of Rex rabbits involves mainly individual growth; after 90 days of age, the fur begins to mature\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. In this work, the values for coat length, skin thickness, skin area, and skin weight of Rex rabbits increased with age. However, the relative weights of the skin of Rex rabbits were similar across different ages (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The hair follicle is an adjunct organ of the skin that exists in the dermis and subcutaneous tissue. Hair follicles are complex suborgan structures that are formed during embryonic development through interactions between the neuroectoderm and mesenchyme and can be divided into primary and secondary hair follicles. Primary follicles develop from a variety of cell taxa, and secondary follicles develop from primary follicles\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. The hair follicle development of Rex rabbits is mainly concentrated at 20\u0026ndash;26 days of gestational age, with the most active development occurring at 23\u0026ndash;24 days of gestational age and basic development occurring at 25\u0026ndash;26 days of gestational age\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Activation of the Wnt signaling pathway is a critical initial step in hair basal plate formation during hair follicle development in the embryonic period\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e,\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. After birth, the hair of Rex rabbits has a certain growth period, growing to the end of maturity because undifferentiated cells at the bottom of the hair follicle gradually slow differentiation and finally stop growing. This process of growth, decay and repose of rabbit hair and its replacement by new hair is called reflexing\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. The basis of Rex rabbit hair replacement includes the growth, decline and resting periods of hair follicle development. The hair follicle cycle can be divided into anagen, catagen and telogen phases according to the morphological characteristics of hair follicles. Hair follicles undergo a cycle of growth, decline, and rest before re-entering the growth cycle, a process known as hair follicle periodic regeneration\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. In this study, we found that there are periodic changes in the development of Rex rabbits\u0026rsquo; hair follicles. The major hair follicles were in the growing period at 15 and 30 days of age, some of which had already entered the degeneration period at 60 days of age, and most of them had entered the degeneration period at 90 days of age. The presence of quiescent hair follicles and the enlargement of primary hair follicles were also observed. At 120 and 150 days of age, the back hair follicles entered the growing period, and the secondary hair follicles had clearly differentiated (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The hair follicle density of the Rex rabbits was greater at 120 days (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), which is consistent with previous reports.\u003c/p\u003e \u003cp\u003eThe Wnt protein is a secretory glycoprotein rich in cysteines that can act in a paracrine or autocrine manner\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e; it binds to the frizzled receptor family and low-density lipoprotein receptor-related protein (LRP) on the cell membrane and stabilizes and accumulates β-catenin in the cytoplasm\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Adenovirus-mediated overexpression of the Wnt10b protein induces hair follicles to grow from the quiescent phase. Lei et al.\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e demonstrated that overexpression of the mouse whisker Wnt10b protein can activate the canonical Wnt signaling pathway, promoting the proliferation of hair stromal cells and thereby inducing hair follicles to enter the growth phase. In contrast, siRNA-mediated knockout of the Wnt10b gene can prevent hair follicles from entering the growth phase\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Wnt10b-mediated aberrant activation of the Wnt pathway increases the number of CD\u003csup\u003e34+\u003c/sup\u003e hair follicle stem cells in a proliferative state, resulting in enlargement of the hair bulb, hair shaft, and dermal papilla\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Beta-catenin is an important molecule in the Wnt signaling pathway and is involved in many biological processes. When β-catenin enters the nucleus, displaces the transducin-like enhancer while binding to the lymphoid enhancer factor/T-cell factor, recruits two histone modifiers, cAMP-response element binding protein binding protein and brahma-related gene-1, and activates the expression of target genes \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. Beta-catenin is transiently expressed in the epidermis of adult mice, and the normal hair follicle cycle is interrupted to enter the growth phase and form new hair follicles de novo\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. These results suggest that the β-catenin-dependent Wnt pathway is sufficient to induce the proliferation of hair follicle stem cells and the subsequent growth of new hair follicles. High expression of β-catenin induces hair follicle stem cells to differentiate into hair follicle-forming cells; when β-catenin is expressed at low levels or absent, hair follicle stem cells no longer participate in hair self-renewal, instead differentiating in the direction of epithelial keratinocytes\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Dasgupta et al.\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e, upon the occurrence of the above phenomena, reoverexpressed β-catenin, a process that reverses this effect; that is, cells that would otherwise have differentiated in the epithelial direction differentiate in the direction of forming hair follicle structures, allowing hair growth to continue. In addition, studies have shown that increasing the content of stable β-catenin can induce the formation of new hair follicles in the adult epidermis\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. When the Wnt signaling pathway is activated, β-catenin dephosphorylates and stably exists, which allows cytosolic β-catenin to enter the nucleus, initiates the expression of downstream genes, and regulates hair follicle periodic growth. However, when the local epidermal activity of β-catenin is increased, hair follicles are periodically dysregulated, which can lead to the suppression of folliculogenesis\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e,\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e,\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. In this study, the β-catenin protein phosphorylation (P-CTNNB1) level in the skin tissue of Rex rabbits first tended to increase but then decreased and then increased; the P-CTNNB1 levels at 60, 120 and 150 days were greater than those at 15, 30 and 90 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea), which suggests that the P-CTNNB1 level in the skin tissue of Rex rabbits is related to the biological process of hair follicle development.\u003c/p\u003e \u003cp\u003eDickkopf-associated protein 1 (DKK1) is an important antagonist of the Wnt signaling pathway\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e, it can inhibit the Wnt signaling pathway by inhibiting β-catenin activity, leading to hair follicle degeneration\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. During embryogenesis, conditional knockout of the β-catenin gene in the epidermis results in blocked formation of the hair substrate, thereby blocking hair follicle morphogenesis\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. When Wnt10b binds to frizzled and LRP5/6, the cytosolic protein dishevelled (DVL) is activated, resulting in the phosphorylation of GSK-3β, the binding of axin to LRP5/6, and the accumulation of free β-catenin in the cytoplasm without phosphorylation. Therefore, Wnt signaling also requires the sequestration of GSK-3β inside multivesicular endosomes\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. In this study, with increasing age, the GSK-3β protein phosphorylation (P-GSK-3β) level in the skin tissue of Rex rabbits increased and peaked at 120 days of age (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec), suggesting that GSK-3β, an important member of the Wnt pathway, participates in the biological process of Rex rabbit hair follicle development. In addition, transforming growth factor-β (TGF-β) can regulate the quiescence or activation state of hair follicle stem cells, and hair follicles can advance into the growth phase after the injection of recombinant TGF-β2 protein\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. Dermal papilla cells can secrete TGF-β2 after knockout of the TGF-β receptor in hair follicle stem cells and are unable to receive TGF-β2 signaling, which activates hair follicle stem cells to transition from the resting phase to the growth phase\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. Furthermore, their growth/rest switching mechanism in hair follicles is based on Eng-dependent feedback cross-talk between Wnt and bone morphogenetic protein signals\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. The expression levels of the \u003cem\u003eWnt10b, CTNNB1, APC, DVL2, GSK-3β, LEF1, DKK1\u003c/em\u003e and \u003cem\u003eTGF-β1\u003c/em\u003e genes in the skin tissue of Rex rabbits at different ages differed, and the expression levels of the \u003cem\u003eWnt10b, CTNNB1, DVL2, GSK-3β\u003c/em\u003e, and \u003cem\u003eTGF-β1\u003c/em\u003e genes at 90 days were greater than those on the other days (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Therefore, the Wnt signaling pathway is involved in the biological process of periodic hair follicle development in Rex rabbits of different ages.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThere are periodic changes in the development of Rex rabbit hair follicles; the major hair follicles were in the growing period at 15 and 30 days of age; some of them had already entered the degeneration period at 60 days of age, and most of them had entered the degeneration period at 90 days of age. The presence of quiescent hair follicles and the enlargement of primary hair follicles were also observed. At 120 and 150 days of age, the back hair follicles entered the growing period, and the secondary hair follicles had clearly differentiated. The hair follicle density of Rex rabbits was greater at 120 days, and the Wnt signaling pathway is involved in the biological process of periodic hair follicle development in Rex rabbits of different ages. Considering the rules of fur growth, these results indicate that the slaughter age of Rex rabbits should not be earlier than 120 days.\u003c/p\u003e"},{"header":"Declarations","content":" \u003cp\u003e \u003cstrong\u003eCompeting interests\u003c/strong\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work has been financially supported by funds from the Natural Science Foundation of Shandong Province (ZR2023QC017); Action Plan for Rural Revitalization of Science and Technology Innovation, Key Research and Development Program of Shandong Province (2023TZXD044); Shandong Province Modern Agricultural Industry Technology System (SDAIT-21-09); Earmarked Fund for Modern Agro-industry Technology Research System (CARS-43-G-7).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eCe Liu and Gongyan Liu conceived and planned experiments; Yin Zhang methodology; Shuxia Gao, Haitao Sun, Liya Bai carried out experimental part; Ce Liu, Liping Yang and Gongyan Liu carried out molecular analysis; Yin Zhang carried out statistical analysis; Ce Liu prepared the manuscript draft, Gongyan Liu, Shuxia Gao and Haitao Sun were funding acquisition. All authors provided critical feedback and helped share the research, analysis, and manuscript. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe author thanks the staff of Taian Xinglong Rabbit Industry Professional Cooperative help in the feeding experiments.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSchneider, M. R., Schmidt-Ullrich, R. \u0026amp; Paus, R. The hair follicle as a dynamic miniorgan. \u003cem\u003eCurr. Biol.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e, R132\u0026ndash;R142 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHsu, Y. C., Li, L. \u0026amp; Fuchs, E. Transit-amplifying cells orchestrate stem cell activity and tissue regeneration. \u003cem\u003eCell\u003c/em\u003e \u003cb\u003e157\u003c/b\u003e (4), 935\u0026ndash;949 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMillar, S. E. Molecular mechanisms regulating hair follicle development. \u003cem\u003eJ. Invest. Dermatol.\u003c/em\u003e \u003cb\u003e118\u003c/b\u003e, 216\u0026ndash;225 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee, J. \u0026amp; Tumbar, T. Hairy tale of signaling in hair follicle development and cycling. \u003cem\u003eSemin Cell. Dev. Biol.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e (8), 906\u0026ndash;916 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang, D., Ding, H., Wang, Y., Wang, X. \u0026amp; Zhao, H. Integration analysis of hair follicle transcriptome and proteome reveals the mechanisms regulating wool fiber diameter in Angora rabbits. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e (6), 1647\u0026ndash;1670 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiang, M. Gene regulation by Wnt signaling pathway in the oriented differentiation of hair follicle stem cells. \u003cem\u003eJ. Tissue Eng. Reconstr. Surg.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e (5), 290\u0026ndash;294 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin, C. et al. Expression of Wnt/β-catenin signaling, stem-cell markers and proliferating cell markers in rat whisker hair follicles. \u003cem\u003eJ. Mol. Histol.\u003c/em\u003e \u003cb\u003e46\u003c/b\u003e (3), 233\u0026ndash;240 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGonz\u0026aacute;lez-Sancho, J. M., Brennan, K. R., Castelo-Soccio, L. A. \u0026amp; Brown, A. M. C. Wnt proteins induce dishevelled phosphorylation via an LRP5/6-independent mechanism: irrespective of their ability to stabilize b-catenin. \u003cem\u003eMol. Cell. Biol.\u003c/em\u003e \u003cb\u003e24\u003c/b\u003e, 4757\u0026ndash;4768 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEnshell-Seijffers, D., Lindon, C., Kashiwagi, M. \u0026amp; Morgan, B. A. beta-catenin activity in the dermal papilla regulates morphogenesis and regeneration of hair. \u003cem\u003eDevelop Cell.\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e, 633\u0026ndash;642 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMajidinia, M., Aghazadeh, J., Jahanban-Esfahlani, R. \u0026amp; Yousefi, B. The roles of Wnt/beta-catenin pathway in tissue development and regenerative medicine. \u003cem\u003eJ. Cell. Physiol.\u003c/em\u003e \u003cb\u003e233\u003c/b\u003e (8), 5598\u0026ndash;5612 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian, H., Wang, X., Lu, J., Tian, W. \u0026amp; Chen, P. MicroRNA-621 inhibits cell proliferation and metastasis in bladder cancer by suppressing Wnt/beta-catenin signaling. \u003cem\u003eChem. Biol. Interact.\u003c/em\u003e \u003cb\u003e308\u003c/b\u003e, 244\u0026ndash;251 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, Z., Zhu, Y., Liu, H., Liu, G. \u0026amp; Li, F. Wnt10b promotes hair follicles growth and dermal papilla cells proliferation via Wnt/β-Catenin signaling pathway in Rex rabbits. \u003cem\u003eBioscience Rep.\u003c/em\u003e \u003cb\u003e40\u003c/b\u003e, BSR20191248 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, G. et al. Hair follicle development of Rex rabbits is regulated seasonally by Wnt, TGFβ-BMP, IGF1, and EGF signaling pathways. \u003cem\u003eAnimals\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 3742 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, G. Y., Wu, Z. Y., Zhu, Y. L., Liu, L. \u0026amp; Li, F. C. Effects of dietary vitamin B6 on the skeletal muscle protein metabolism of growing rabbits. \u003cem\u003eAnim. Prod. Sci.\u003c/em\u003e \u003cb\u003e57\u003c/b\u003e, 2007\u0026ndash;2015 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiLivak, K. J. \u0026amp; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 -∆∆CT method. \u003cem\u003eMethods\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 402\u0026ndash;408 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, G. et al. The functions of ocu-miR-205 in regulating hair follicle development in Rex rabbits. \u003cem\u003eBMC Dev. Biol.\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e (8), 1\u0026ndash;13 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLai, S., Yang, G. \u0026amp; Li, Y. A comparison between Tianfu black rabbit and New Zealand rabbit in growth rate and feed conversion efficiency. \u003cem\u003eJ. Sichuan Agricul Univ.\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e (4), 362\u0026ndash;363 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQin, Y., Li, L. \u0026amp; Du, Y. Comparison of early growth and feed conversion efficiency between German White Rabbit and New Zealand Rabbit. \u003cem\u003eChin. Rabbit Breed.\u003c/em\u003e \u003cb\u003e2\u003c/b\u003e, 18\u0026ndash;20 (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, G. et al. Effects of different slaughter ages on slaughter performance, fat deposition and muscle quality of Minxinan black rabbit. \u003cem\u003eChin. J. Anim. Husb.\u003c/em\u003e \u003cb\u003e58\u003c/b\u003e (2), 224\u0026ndash;228 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou, B. et al. Comparative analysis of production performance and muscle quality of Laiwu black rabbits at different slaughter ages. \u003cem\u003eChin. J. Anim. Nutr.\u003c/em\u003e \u003cb\u003e35\u003c/b\u003e (8), 5322\u0026ndash;5332 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYurniati, Y., Raharjo, Y. \u0026amp; Kusmajadi, S. The effect of restricted feeding and different of slaughtering age on production of Rex rabbit pelt. \u003cem\u003eJ. Indonesian Trop. Anim. Agric.\u003c/em\u003e \u003cb\u003e35\u003c/b\u003e (3), 192\u0026ndash;196 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlonso, L. \u0026amp; Fuchs, E. Stem cells in the skin: waste not, Wnt not. \u003cem\u003eGenes Dev.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e (10), 1189\u0026ndash;1200 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, L., Li, B., Zhu, Y., Wang, C. \u0026amp; Li, F. Differential gene expression profiles in foetal skin of Rex rabbits with different wool density. \u003cem\u003eWorld Rabbit Sci.\u003c/em\u003e \u003cb\u003e24\u003c/b\u003e (3), 223\u0026ndash;231 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu, J. \u0026amp; Hsu, W. Epidermal Wnt controls hair follicle induction by orchestrating dynamic signaling crosstalk between the epidermis and dermis. \u003cem\u003eJ. Invest. Dermatol.\u003c/em\u003e \u003cb\u003e133\u003c/b\u003e (4), 890\u0026ndash;898 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, D., Jarrell, A. \u0026amp; Guo, C. Dermal beta catenin activity in response to epidermal Wntligands is required for fibroblast proliferation and hair follicle initiation. \u003cem\u003eDevelopment\u003c/em\u003e \u003cb\u003e139\u003c/b\u003e (8), 1522\u0026ndash;1533 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, Z. et al. Hair follicle development and related gene and protein expression of skins in Rex rabbits during the first 8 weeks of life. \u003cem\u003eAsian Austral J. Anim.\u003c/em\u003e \u003cb\u003e32\u003c/b\u003e (4), 477\u0026ndash;484 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWoo, C., Eleanor, W. \u0026amp; Bruce, A. Morgan dermal papilla cell number specifies hair size, shape and cycling and its reduction causes follicular decline. \u003cem\u003eDevelop Stem Cells\u003c/em\u003e. \u003cb\u003e140\u003c/b\u003e, 1676\u0026ndash;1683 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAugustin, I. Wnt signaling in skin homeostasis and pathology. \u003cem\u003eJ. Dtsch. Dermatol. Ges\u003c/em\u003e. \u003cb\u003e13\u003c/b\u003e (4), 302\u0026ndash;306 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClevers, H. \u0026amp; Nusse, R. Wnt/beta catenin signaling and diseease. \u003cem\u003eCell\u003c/em\u003e \u003cb\u003e149\u003c/b\u003e (6), 1192\u0026ndash;1205 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLei, M. et al. Prolonged overexpression of Wnt10b induces epidermal keratinocyte transformation through activating EGF pathway. \u003cem\u003eHistochem. Cell. Biol.\u003c/em\u003e \u003cb\u003e144\u003c/b\u003e (3), 209\u0026ndash;221 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, Y. H. et al. Adenovirus-mediated Wnt10b overexpression induces hair follicle regeneration. \u003cem\u003eJ. Invest. Dermatol.\u003c/em\u003e \u003cb\u003e133\u003c/b\u003e (1), 42\u0026ndash;48 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLei, M. et al. Modulating hair follicle size with Wnt10b/DKK1 during hair regeneration. \u003cem\u003eExp. Dermatol.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e (6), 407\u0026ndash;413 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaito-Diaz, K. et al. The way Wnt works: components and mechanism. \u003cem\u003eGrowth Factors\u003c/em\u003e 31(1),1\u0026ndash;31 (2013). (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLichtenberger, B. M., Mastrogiannaki, M. \u0026amp; Watt, F. M. Epidermal beta-catenin activation remodels the dermis via paracrine signalling to distinct fibroblast lineages. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e, 10537 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuelsken, J., Vogel, R., Erdmann, B., Cotsarelis, G. \u0026amp; Birchmeier, W. Beta catenin controls hair follicle morphogenesis and stem cell differentiation in the skin. \u003cem\u003eCell\u003c/em\u003e \u003cb\u003e105\u003c/b\u003e (4), 533\u0026ndash;545 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDasgupta, R. \u0026amp; Fuchs, E. Multiple roles for activated LEF/TCF transcription complexes during hair follicle development and differentiation. \u003cem\u003eDevelop\u003c/em\u003e \u003cb\u003e126\u003c/b\u003e (20), 4557\u0026ndash;4568 (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiezgoda, A. et al. Properties of skin stem cells and their potential clinical applications in modern dermatology. \u003cem\u003eEur. J. Dermatol.\u003c/em\u003e \u003cb\u003e27\u003c/b\u003e (3), 227\u0026ndash;236 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMastrogiannaki, M. et al. Beta-catenin stabilization in skin fibroblasts causes fibrotic lesions by preventing adipocyte differentiation of the reticular dermis. \u003cem\u003eJ. Invest. Dermatol.\u003c/em\u003e \u003cb\u003e136\u003c/b\u003e (6), 1130\u0026ndash;1142 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJahoda, C. \u0026amp; Gilmore, A. C. What lies beneath: Wnt/beta-catenin signaling and cell fate in the lower dermis. \u003cem\u003eJ. Invest. Dermatol.\u003c/em\u003e \u003cb\u003e136\u003c/b\u003e (6), 1084\u0026ndash;1087 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin, B. J. et al. LncRNA-PCAT1 maintains characteristics of dermal papilla cells and promotes hair follicle regeneration by regulating miR-329/Wnt10b axis. \u003cem\u003eExp. Cell. Res.\u003c/em\u003e \u003cb\u003e394\u003c/b\u003e (1), 112031 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRishikaysh, P. et al. Signaling involved in hair follicle morphogenesis and development. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e (1), 1647\u0026ndash;1670 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaelman, V. F. et al. Wnt signaling requires sequestration of glycogen synthase kinase 3 inside multivesicular endosomes. \u003cem\u003eCell\u003c/em\u003e \u003cb\u003e143\u003c/b\u003e (7), 1136\u0026ndash;1148 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKwack, M. H., Kim, M. K., Kim, J. C. \u0026amp; Sung, Y. K. Dickkopf 1 promotes regression of hair follicles. \u003cem\u003eJ. Invest. Dermatol.\u003c/em\u003e \u003cb\u003e132\u003c/b\u003e, 1554\u0026ndash;1560 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLim, X. \u0026amp; Nusse, R. Wnt signaling in skin development, homeostasis, and disease. \u003cem\u003eCold Spring Harb Perspect. Biol.\u003c/em\u003e \u003cb\u003e5\u003c/b\u003e (2), a008029 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan, Y. P. et al. Canonical and non-canonical Wnt signaling control the regeration of amputated rodent vibrissae follicles. \u003cem\u003eJ. Mol. Histol.\u003c/em\u003e \u003cb\u003e47\u003c/b\u003e (1), 1\u0026ndash;8 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFoitzik, K., Paus, R. \u0026amp; Doetschman, T. The TGF-beta 2 isoform is both a required and sufficient inducer of murine hair follicle morphogenesis. \u003cem\u003eDeve Biol.\u003c/em\u003e \u003cb\u003e212\u003c/b\u003e, 278\u0026ndash;289 (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOshimori, N. \u0026amp; Fuchs, E. Paracrine TGF-beta signaling counterbalances BMP-mediated repression in hair follicle stem cell activation. \u003cem\u003eCell. Stem Cell.\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 63\u0026ndash;75 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCalvo-Sanchez, M. I. et al. A role for the Tgf-beta/bmp co-receptor endoglin in the molecular oscillator that regulates the hair follicle cycle. \u003cem\u003eJ. Mol. Cell. Biol.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e (1), 39\u0026ndash;52 (2019).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Age, Rabbit, Wnt signaling pathway, Fur quality, Hair follicle development","lastPublishedDoi":"10.21203/rs.3.rs-5087646/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5087646/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn the present study, we aimed to observe hair follicle development and describe the Wnt signaling pathways related to hair follicle development in Rex rabbits of different ages. Six Rex rabbits aged 15, 30, 60, 90, 120 and 150 days were selected, and skin samples were collected for hair follicle development and Wnt signaling pathway gene expression detection. The results revealed that the values for body weight, coat length, skin thickness, skin area, and skin weight of Rex rabbits were increased significantly with age (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The total hair follicle density, secondary hair follicle density and ratio of the secondary hair follicle density to the primary hair follicle density at the age of 120 days in Rex rabbits were greater than those at the other ages (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the major hair follicles were in the growing period at 15 days and 30 days of age. Some of them had already entered the degeneration period at 60 days of age, and most of them had entered the degeneration period at 90 days of age. The presence of quiescent hair follicles and the enlargement of primary hair follicles were also observed. At 120 and 150 days of age, the back hair follicles entered the growing period, and the secondary hair follicles had clearly differentiated. Furthermore, the expression levels of the \u003cem\u003eWnt10b\u003c/em\u003e, \u003cem\u003eCTNNB1\u003c/em\u003e, \u003cem\u003eadenomatosis polyposis protein (APC)\u003c/em\u003e, \u003cem\u003edisheveled 2 (DVL2)\u003c/em\u003e, \u003cem\u003eglycogen synthase kinase 3β (GSK-3β)\u003c/em\u003e, \u003cem\u003eLymphoid enhancer-binding factor 1 (LEF1)\u003c/em\u003e, \u003cem\u003edickkopf-1 (DKK1)\u003c/em\u003e and \u003cem\u003etransforming growth factor beta 1 (TGFβ-1)\u003c/em\u003e genes in the skin tissue of Rex rabbits at different age was significantly different (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the expression of the \u003cem\u003eWnt10b\u003c/em\u003e, \u003cem\u003eCTNNB1\u003c/em\u003e, \u003cem\u003eDVL2\u003c/em\u003e, \u003cem\u003eGSK-3β\u003c/em\u003e, and \u003cem\u003eTGFβ-1\u003c/em\u003e genes at 90 days were greater than those at the other days. The expression levels of the \u003cem\u003eLEF1\u003c/em\u003e and \u003cem\u003eDKK1\u003c/em\u003e genes at 60 days were greater than those at the other days. As indicated by western blotting, the β-catenin protein phosphorylation (P-CTNNB1) levels in the skin tissue of Rex rabbits first tended to increase, then decreased and then increased, and the levels at 60, 120 and 150 days were significantly greater than those at 15, 30 and 90 days (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). With increasing age, the GSK-3β protein phosphorylation (P-GSK-3β) level in the skin tissue of Rex rabbits increased, reaching a maximum at 120 days of age (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These results show that age could influence the fur quality and hair follicle traits of Rex rabbits and that the Wnt signaling pathway is involved in the biological process of periodic hair follicle development in Rex rabbits. Considering the rules of fur growth, the slaughter age of Rex rabbits should not be earlier than 120 days.\u003c/p\u003e","manuscriptTitle":"Expression of the Wnt signaling pathway and hair follicle development in Rex rabbits of different ages","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-17 09:25:53","doi":"10.21203/rs.3.rs-5087646/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"69dc4c2c-2b42-4fd3-8696-eeb8050a7724","owner":[],"postedDate":"April 17th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":47236877,"name":"Biological sciences/Genetics/Gene expression"},{"id":47236878,"name":"Biological sciences/Developmental biology"}],"tags":[],"updatedAt":"2025-06-18T10:38:45+00:00","versionOfRecord":[],"versionCreatedAt":"2025-04-17 09:25:53","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5087646","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5087646","identity":"rs-5087646","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.