PML-1 protein ubiquitinates TAB1/TAK1 for LRP1 anti-inflammation signal

PML-1 protein ubiquitinates TAB1/TAK1 for LRP1 anti-inflammation signal | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article PML-1 protein ubiquitinates TAB1/TAK1 for LRP1 anti-inflammation signal fubing shen This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8725456/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Promyelocytic leukaemia (PML) protein is multifunctional protein involved in numerous important cellular processes, such as tumour suppression, transcriptional regulation, apoptosis, DNA damage response, and viral defence 1 – 3 . Recent studies have also shown that the PML protein plays a crucial role in regulating immune responses and inflammation 4 – 6 . However, the precise mechanism by which it acts remains unclear. PML protein has the characteristic structural features of RBCC (RING, B-box, coiled-coil) and belongs to the single-ring E3 ubiquitin ligase family 12 – 16 . Nevertheless, to date, no PML protein have been reported to exhibit ubiquitin ligase activity. Here, we show that PML protein can mediate the anti-inflammatory pathway of lipoprotein receptor-related protein 1 (LRP1) by inhibiting the protein TAB1/TAK1 in the Toll like receptor (TLR) pathway in vitro and in vivo. The PML-1 isoform mediating this pathway and the inhibitory effect of PML-1 on TAB1/TAK1 occurred via ubiquitin modification. These findings confirm that the PML-1 protein has E3 ubiquitin ligase activity and mediates the LRP1-PML-1-TAB1/TAK1 anti-inflammatory pathway. The newly discovered ubiquitin ligase function of the PML protein represents a major breakthrough in elucidating its multiple cellular functional mechanisms, and provides a novel strategy for developing anti-inflammatory immunotherapies targeting the human PML-1 protein. Biological sciences/Cell biology/Cell signalling/Extracellular signalling molecules Health sciences/Diseases/Immunological disorders/Inflammatory diseases Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The PML protein is multifunctional protein that have been extensively studied because it is involved in many important cellular processes 1 – 3 . Recent studies have shown that the PML protein is a key regulator of cytokine signalling, where it plays a crucial role in regulating the immune response and inflammation 4 – 6 . Most reports indicate that the PML protein is generally proinflammatory, but several reports indicate that it also has anti-inflammatory effects 4 , 7 – 10 . For example, in one case, the PML protein was linked to the upregulation of the inflammatory cytokine IL-1β in PML knockout cells 4 , 11 . These two opposing findings demonstrate the complex role that the PML protein plays in inflammation. PML protein is a member of the tripartite motif (TRIM) family, known as TRIM19, and exhibits the typical structural features of RBCC 12 – 14 . RBCC/TRIM motifs are associated with ubiquitination and represent a novel class of single-ring finger E3-type ubiquitin ligases 15 , 16 . Ubiquitination, as a key posttranslational modification in eukaryotic cells, plays a crucial role in regulating protein degradation, cellular signalling, cell cycle control, DNA damage repair, immune responses, and inflammatory responses 17 , 18 . We hypothesised that the PML protein may have E3 ubiquitin ligase activity and exert anti-inflammatory effects via the ubiquitination of specific inflammation-related proteins. However, no PML proteins have been reported to exhibit E3 ubiquitin ligase activity. Previous studies by our laboratory have demonstrated that the anti-inflammatory immunomodulator α-momorcharin (α-MMC) can inhibit the activity of the TAK1 signalling protein in the TLR pathway 19 – 21 . It does so by binding to the LRP1 receptor and thereby suppressing the cytokine storm induced by lipopolysaccharide (LPS) 22 – 24 . In this study, we used α-MMC as an immunosuppressive probe to investigate whether the PML protein participates in anti-inflammatory processes and to explore its possible ubiquitination mechanism. Results PML protein is activated by α-MMC Previous studies have demonstrated that α-MMC can inhibit the cytokine storm by binding to the LRP1 receptor to inhibit the inflammatory signalling protein TAK1. To identify the signalling target protein that mediates communication between the LPR1 receptor and the TAK1 protein, we performed a phosphoproteomic analysis and then validated the results using immunoblotting. We stimulated M1 inflammatory macrophages with LPS and administered α-MMC for 0.25 or 4 h. The differentially phosphorylated peptides were grouped and classified for visualization as heatmaps (Extended Data Fig. 2 a). The differentially expressed proteins between groups are presented as volcano plots (Extended Data Fig. 2 b), and KEGG pathway analysis was performed on the major signalling pathways (Extended Data Fig. 2 c). The PML protein level increased with increasing duration of α-MMC treatment, with a fold change (FC) of 2.54 after 0.25 h and 3.50 after 4 h (Extended Data Fig. 2 c). No changes in the activity of the PI3K/AKT or JAK/STAT pathway were detected. A significant decrease in the level of p-TAK1, which is involved in the TLR pathway, was observed after treatment with α-MMC for 4 h (FC = 0.582). The results of the phosphoproteomic analysis revealed that α-MMC increased the PML protein levels and decreased the TAK1 protein levels. We then conducted immunoblotting experiments to validate the results of the omics analysis. The results revealed that the PML and p-PML signals increased over time after M1 macrophages were treated with α-MMC for 0, 4, and 8 h. However, over time, the signal intensities of the proteins involved in the TLR pathway downstream of TRAF6 signalling, including TAB1, total TAK1 and p-TAK1, p-JNK, p-AP-1, and p-p65, significantly decreased ( P < 0.05, Fig. 1 a, b). Immunoblotting validation experiments revealed that α-MMC activated the PML proteins and inhibited the TAB1/TAK1 signalling proteins. PML mediates signal between LRP1 and TAB1/TAK1 We designed an LRP1 receptor blocking assay, a PML protein knockout assay, and a PML interaction assay with the LRP1 receptor or TAB1/TAK1 proteins to explore the possible signalling pathways involved. First, a receptor blockade approach was used to demonstrate the activation of PML by LRP1. Receptor-associated protein (RAP) is a molecular chaperone of the LRP1 protein and is often used as an LRP1 blocker. The increase in PML/p-PML expression was significantly inhibited in the group treated with α-MMC combined with RAP for 8 h compared with that in the group treated with α-MMC for 8 h; additionally, the inhibition of the downstream signalling proteins TAB1, TAK1/p-TAK1, p-AP1, and p-p65 was significantly suppressed (Extended Data Fig. 3 a, b). These findings demonstrate the role of LRP1 in mediating the activation of PML by α-MMC. We next used a PML knockout cell model to demonstrate that increased PML protein activation is associated with decreased TAB1/TAK1 expression. CRISPR/Cas9 gene editing technology was used to knockout the PML gene in THP-1 cells, generating PML −/− THP-1 cells. In the WT M1 macrophages, the signal intensities of the PML and p-PML proteins were significantly greater at 8 h after α-MMC administration, whereas the signals for TAB1 and TAK1/p-TAK1 were significantly weaker ( P < 0.05) (Extended Data Fig. 3 c, d). In the PML −/− M1 macrophages, the signal intensities of TAB1 and TAK1/p-TAK1 at 8 and 0 hours after α-MMC administration essentially remained unchanged, with no sign of inhibition. The expression levels of signalling proteins downstream of TAB1/TAK1, such as p-AP-1 and p-p65, were also not inhibited. These results revealed that the inhibitory effect of α-MMC on TAB1 and TAK1 proteins was blocked in the absence of the PML protein, as was the effect on downstream signalling proteins. These findings suggest that the PML protein is essential for regulating TAB1/TAK1 protein signalling and mediating the inhibitory effect of α-MMC on both TAB1/TAK1 and downstream signalling. We next used immunoprecipitation (IP) to determine whether LRP1 interacts directly with the PML protein (Extended Data Fig. 3 e). In the IP group, a strong LRP1 band (85 kDa, corresponding to the light chain of the LRP1 protein) and a strong PML band (110 kDa) were detected. The results revealed good interaction between the LRP1 and PML proteins after α-MMC treatment. Additionally, IP was performed to determine whether the PML protein directly inhibited the TAB1 and TAK1 proteins (Extended Data Fig. 3 f-h). The lysates of M1 macrophages treated with α-MMC for 4 h and a PML-specific antibody was used for the procedure. Western blotting was conducted to measure the TAB1 and TAK1 protein levels in the immunoprecipitate. Distinct PML, TAB1, and TAK1 protein bands were detected in the input and in the immunoprecipitate, indicating that the PML protein interacted with the TAB1 and TAK1 proteins. Similarly, strong PML and TAK1 signals were detected in the immunoprecipitate after pull-down with TAB1- and TAK1-specific antibodies. These findings confirmed that the PML, TAB1, and TAK1 proteins bind to each other in three ways following α-MMC activation. Thus, these results demonstrate that α-MMC binds to the LRP1 receptor and activates PML proteins, which in turn inhibit TAB1/TAK1, thereby inhibiting the TLR inflammatory pathway via the LRP1-PML-TAB1/TAK1 signalling pathway. PML mediates anti-inflammatory effects in vivo To further confirm that the PML proteins mediate anti-inflammatory effects in vivo, we treated WT and PML −/− mice with LPS (mg/kg)-induced pneumonia-related acute lung injury using α-MMC (1.5 mg/kg) for 8 h. Lung tissue homogenates from each animal were analysed via western blotting and enzyme-linked immunosorbent assay (ELISA) to determine the levels of signalling proteins (PML, TAB1, and TAK1/p-TAK1) and inflammatory cytokines (TNF-α, IL-1β, and IL-6). The lung tissues from each animal were subsequently subjected to histopathological analysis. In WT mice, the signal intensity of the major PML protein band (110 kDa) was not increased in the control or model group but was significantly increased after α-MMC administration; correspondingly, the signal intensities of the TAB1, TAK1 and p-TAK1 bands were significantly lower in the α-MMC-treated group than in the model group (Fig. 2 a). In contrast, owing to the deletion of the PML protein in the PML −/− mice, the signal intensities of TAB1, TAK1, and p-TAK1 did not differ between the α-MMC-treated group and the model group. The three proinflammatory cytokines TNF-α, IL-1β, and IL-6 were highly expressed in WT LPS-induced pneumonia model mice (Fig. 2 b), indicating the occurrence of a cytokine storm; α-MMC treatment significantly reduced the expression of these cytokines, indicating a strong inhibitory effect ( P 0.05). Histopathological changes in each group of mice revealed significant inflammatory changes, such as a reduction in the alveolar space, significant thickening of the alveolar septa, and infiltration of many inflammatory cells, including neutrophils and macrophages, in the WT mice (Fig. 2 c). However, the degrees of alveolar septal thickening, haemorrhage, and inflammatory cell infiltration were significantly reduced after α-MMC treatment, and α-MMC treatment significantly improved lung inflammation in these animals. Conversely, the degrees of alveolar septal thickening, haemorrhage, and inflammatory cell infiltration were not significantly altered by α-MMC treatment in the PML −/− mice, indicating that α-MMC treatment did not ameliorate LPS-induced lung inflammation in these mice. These findings indicate that knocking out the PML protein blocks the inhibitory effects of α-MMC on TAB1 and TAK1/p-TAK1, the expression of proinflammatory cytokines, and the anti-inflammatory effect in vivo. PML isoform screening PML is known to have multiple isoforms, which are distributed variably in cells 12 . The PML-2, PML-3, PML-4, PML-5, and PML-6 isoforms are localized in the nucleus because they contain nuclear localization signals (NLSs). However, PML-7b lacks nuclear NLSs and is localized in the cytoplasm (known as cPML). The cPML is known to mediate the pro-apoptotic transforming growth factor β (TGF-β) signalling pathway (SMAD2/3 pathway) 2 . PML-1 possesses both NLSs and nuclear export signals and can shuttle between the nucleus and the cytoplasm 25 – 27 . In this study, we used nucleocytoplasmic isolation experiments to identify the PML isoform responsible for inhibiting the expression of the TAB1/TAK1 proteins. The expression of PML increased in both the cytoplasm and nucleus with increasing concentrations of α-MMC whereas TGF-β increased the PML levels only in the cytoplasm (Fig. 3 a, b). The PML that coprecipitated with the LRP1 receptor protein and the TAB1/TAK1 protein in the reciprocal experiments described above was a single protein with a molecular weight of 110 kDa (Extended Data Fig. 4 d-f), suggesting that it must be a nuclear PML, given that the molecular weight of cPML is approximately 70 kDa. The PML-1 protein is the only isoform capable of shuttling between the nucleus and the cytoplasm; therefore, α-MMC can increase PML levels in both the cytoplasm and the nucleus, indicating that α-MMC specifically targets the PML-1 isoform. The protein expression levels of TAB1 and TAK1/p-TAK1 in the nucleus decreased with increasing α-MMC dose (Fig. 3 a, b). This decrease was inhibited when PML was knocked out, suggesting that PML primarily exerts its regulatory effect on TAB1 and TAK1 proteins in the cell nucleus. PML-1 isoform validation Recombinant human PML-1 protein (rhPML-1) was produced to confirm that the PML-1 isoform mediates the anti-inflammatory effects of α-MMC. The purified rhPML-1 protein exhibited two distinct bands: a major band with a molecular weight of 110 kDa and a minor band with a molecular weight of 48 kDa (Extended Data Fig. 4 a, b). Repeated experiments confirmed that hPML-1 overexpression involves two recombinant constructs, possibly because of the PML gene variants ( https://www.ncbi.nlm.nih.gov/gene/5371 ). We next used a PML gene knockout M1 macrophage model to observe the inhibitory effects of rhPML-1 on inflammatory signalling proteins and cytokines in cells. The expression levels of TAB1, TAK1, and p-TAK1 in the PML −/− M1 macrophages decreased with increasing doses of rhPML-1, indicating a gradient inhibitory effect (Extended Data Fig. 4 c, d). Since none of the PML isoforms were expressed in PML knockout cells, the inhibitory effect demonstrates that the anti-inflammatory effect is mediated by the PML-1 isoform. rhPML-1 inhibited the expression of the inflammatory cytokines TNF-α, IL-1β, and IL-6 in both WT and PML −/− M1 macrophages (Extended Data Fig. 4 e), which also demonstrated a pronounced anti-inflammatory gradient effect. However, due to the current unavailability of high-quality samples, this experiment could only be conducted within the limited concentration range of 20–35 µg/ml. Consequently, the inhibitory effect of hPML-1 on these cytokines was not particularly pronounced due to the excessively narrow dose gradient. Bioinformatics of PML-1-LRP1 binding Bioinformatics analysis was conducted to analyze the interaction between the LRP1 and PML-1 proteins. The three-dimensional spatial structures of the PML-1 protein and the light chain of the LRP1 protein (LRP1-85 kDa) were predicted using AlphaFold2 software (Extended Data Fig. 5 a, b). A protein‒protein docking analysis of PML-1 and LRP1-85 kDa was conducted using HDOCK protein–protein molecular docking software. On the basis of the docking energy values, the top 10 docking patterns were clustered and plotted (Extended Data Fig. 5 c), and pose 1, which had the lowest energy, was selected for structural biology analysis of the binding mode (Extended Data Fig. 5 d). There are 54 amino acid residues in the tail domain of the PML-1 protein that interact with 40 amino acid residues in the C-terminal region of LPR1-85 kDa. The tight association between the intracellular region of the LRP1 receptor and the tail domain of the PML-1 protein provides a basis for the activation of PML-1 via the phosphorylation of LRP1. This binding site is offset from the binding region of the target protein of PML-1, demonstrating the structural rationality of the functional region of the PML-1 protein (Fig. 4 f). Bioinformatics of PML-1-TAB1/TAK1 binding Table 1 is a TAK1-binding protein that promotes TAK1 self-phosphorylation; therefore, the two proteins tend to exist as complexes in cells. The above experiments revealed that the PML protein binds to these complexes (Extended Data Fig. 4 d-f). Therefore, we performed molecular docking simulations of the TAB1 and TAK1 proteins, followed by simulations of the TAB1/TAK1 complexes and PML-1 proteins. The results revealed that the TAB1 protein was tightly bound to the TAK1 protein (Fig. 4 c). The top 10 docking patterns in the TAK1/TAB1 complex and the PML-1 protein were clustered and plotted on the basis of the docking energy values (Fig. 4 d). We selected pose 5, which has the largest binding surface, for protein–protein interaction analysis to confirm the amino acid sites between the amino acid atoms of PML-1 and the TAB1 and TAK1 proteins. The results revealed that the TAB1/TAK1 complex formed a triple complex with the PML-1 protein and that both TAB1 and TAK1 could bind to PML-1 (Fig. 4 f). We observed RBCC domain functional domains at the PML-1 protein N-terminus, and the TAB1/TAK1 protein complex bound to the target protein-binding region of PML-1 after the coiled-coil domain. Therefore, the results shown in Fig. 4 f depict the structural features of the E3 ubiquitination ligase domain of the PML-1 protein as well as the mode by which PML-1 binds TAB1/TAK1. PML-1 ubiquitinates TAB1/TAK1 in cells To demonstrate that the inhibitory effect of PML-1 on TAB1/TAK1 involves ubiquitination, we coexpressed the hPML-1 protein with the hTAB1 and hTAK1 proteins in HEK293T cells and assessed its ubiquitination activity. In the input group, we detected an hTAB1-overexpressing protein with a molecular weight of approximately 57 kDa and an hPML-1-double protein band measuring 110 and 48 kDa, respectively (Fig. 5 a). In the IP (3Flag) group, strong hTAB1-3Flag and hPML-1-MYC bands were detected, indicating good interactions between the hTAB1 proteins and the hPML-1 protein. In the ubiquitination assay, strongly ubiquitinated bands were detected at approximately 72 kDa along with multiple ubiquitinated bands when hTAB1-3Flag was coexpressed with hPML1-MYC and HA-Ub. The intensities of the ubiquitinated bands were significantly reduced in the group without the proteasome inhibitor MG-132. These results suggest that hPML-1 overexpression enables hPML-1 to bind to and modify hTAB1 through ubiquitination in cells. However, no interaction or ubiquitination was detected between the rhPML-1-MYC and rhTAK1-3Flag proteins, indicating that PML-1 and TAK1 proteins cannot interact directly on their own. We then investigated the effect of PML-1 on TAB1/TAK1 ubiquitination using an M1-type inflammatory macrophage model with recombinant human PML-1 (rhPML-1). The results revealed that the 60-kDa TAB1 and 77-kDa TAK1 proteins were detected in the input and IP groups (Fig. 5 b, c). In the TAB1 IP enrichment solution, multiple ubiquitinated bands were detected, primarily concentrated between 55 and 130 kDa. Following treatment with MG-132, these bands appeared significantly darker. The same phenomenon was observed in the TAK1 IP enrichment solution. One possible explanation is that, in the inflammatory cell model, LPS induction causes activated TAB1 to bind to TAK1. Upon entering the cell, rhPML-1 then binds to the TAB1/TAK1 complex ubiquitinates it. Therefore, the three-protein complex can be enriched when TAB1 or TAK1 is pulled down. The multiple ubiquitinated bands between 55 and 130 kDa corresponded to the ubiquitinated bands of TAB1 and TAK1, as well as the self-ubiquitinated band of rhPML-1. PML-1 ubiquitinates TAB1/TAK1 in vitro We used the Abcam E3 Ligase Auto-Ubiquitination Assay Kit to test the ubiquitin E3 ligase activity of the rhPML-1 protein by assessing its ability to undergo autoubiquitination. The human double minute 2 (Hdm2) RING domain was provided as a positive control ubiquitin E3 ligase for use in autoubiquitinylation assays. Distinct self-ubiquitination bands of Hdm2 and rhPML-1 were observed at the E3 ubiquitin ligase site, and the molecular weight of the rhPML-1 self-ubiquitination band was approximately 110 kDa (Fig. 5 d). This experiment has yielded the most direct evidence for the activity of the PML-1 E3 ubiquitin ligase. Next, we detected the ubiquitination by rhPML-1 on rhTAB1 and rhTAK1 under the aforementioned ubiquitination reaction conditions. As illustrated in Fig. 5 e and g, new, intensified ubiquitinated bands (approximately 72 kDa) were observed in the rhTAB1 reaction wells, in addition to the self-ubiquitinated band of rhPML-1, demonstrating the ubiquitinating activity of rhPML-1 on the protein rhTAB1 in vitro. However, no new, intensified ubiquitinated bands were observed in the rhTAK1 reaction wells. The TAB1 and TAK1 proteins often exist as complexes within cells under inflammatory stimulation; therefore, we mixed the rhTAB1 and rhTAK1 proteins in vitro to form the rhTAB1/rhTAK1 complex, which was then combined with rhPML-1 for the ubiquitination reaction to simulate the ubiquitination of the TAB1/TAK1 complex by PML-1 in vivo. Following an overnight incubation at 4°C, SDS‒PAGE analysis revealed an intensely stained complex band formed by the tight binding of rhTAB1 and rhTAK1 (Fig. 5 f). After the ubiquitination reaction with rhPML-1, a significantly darker band of rhTAB1/rhTAK1 complex ubiquitination was observed (Fig. 5 g). These results demonstrated the direct ubiquitination of the TAB1/TAK1 complex by PML-1. Discussion The PML protein is multifunctional and involved in numerous cellular processes 1 – 3 . PML also plays a key role in regulating cytokine signalling and is involved in inflammation and cytokine-induced apoptosis 4 – 6 . Previous reports indicate that following LPS stimulation, IL-6 production is reduced in PML-knockout cells, whilst IL-1β production is severely impaired 7 – 10 . This is attributed to the involvement of the PML protein in activating NOD-like receptor family pyrin domain containing 3 (NLRP3). However, another publication reported opposing observations, describing enhanced IL-1β production in PML-deficient macrophages and likewise pointing to the NLRP3 inflammatory pathway as the mechanism 4 , 11 . Although both conflicting studies posit PML as a key regulator of the NLRP3 inflammasome, the precise role of PML in NLRP3 inflammasome assembly and activation, and which PML isoform is implicated, remains unclear 4 . In this study, utilising the anti-inflammatory immunomodulator α-MMC previously validated in our laboratory 19 – 21 , we demonstrated that PML can be activated by α-MMC in both PML-knockout macrophage and mouse models. The elevated activated PML protein inhibits the TAB1/TAK1 signalling proteins within the TLR inflammatory pathway, thereby suppressing the expression of inflammatory cytokines TNF-α, IL-1β, and IL-6. As NLRP3 is one of the gene products at the end of the TLR pathway and NLRP3 inflammasomes facilitate the processing and release of IL-1β and IL-18 9 , PML's regulatory action on TAB1/TAK1 would indirectly affect NLRP3 inflammasome activity. The controversy surrounding the inflammatory immune regulatory function of the PML protein was addressed in further experiments examining individual PML isoforms. Previous studies have shown that the multiple isoforms of PML are variably distributed in cells 12 , 27 – 29 . In this study, we used TGF-β as a control and used nuclear‒cytoplasmic separation technology to identify PML-1 as the PML isoform involved in the anti-inflammatory activity of α-MMC. We then confirmed that PML-1 inhibited TAB1/TAK1 in the PML −/− M1 macrophage model using recombinant PML-1 protein. The proinflammatory effects of the PML protein, as reported in the literature, can be attributed to other PML isoforms, primarily PML-4 4,7–11 . This finding indicates that, owing to structural and distributional differences, different PML isoforms perform different functions, which may even be diametrically opposed. Overall, the discovery of specific anti-inflammatory effects mediated by the PML-1 protein has revealed a new functional role for the PML protein. LRP1 initiates the anti-inflammatory pathway mediated by the PML-1 protein as it is the specific binding receptor for α-MMC. LRP1 is a member of the low-density lipoprotein receptor family and contains two heterodimeric peptide fragments: a 515 kDa heavy chain, which is the structural region that binds to ligands, and an 85 kDa light chain, which contains the transmembrane region and cytoplasmic tail domain 30 , 31 . There are more than 40 ligands for LRP1, including apolipoprotein E (ApoE), amyloid precursor protein, amyloid-beta (Aβ), α2-macroglobulin, and α-MMC 18 , 20 . The activation of LRP1 by these ligands enables intracellular signalling through the intracellular domain 32 . LRP1 has been reported to be involved in anti-inflammatory effects, such as the suppression of inflammatory cytokine expression through the PI3K/AKT pathway 33 – 36 . However, our phosphoproteomic analysis did not reveal the activation of the PI3K/AKT pathway by α-MMC. In this study, we used receptor blockade, immunoprecipitation and bioinformatics analyses to confirm the binding of the LRP1 receptor to the PML-1 protein, thereby elucidating an important element of the new PML-1 protein-mediated LRP1 receptor signalling pathway, i.e., LRP1-PML-1-TAB1/TAK1. This pathway is among the most precisely elucidated LRP1 receptor anti-inflammatory pathways to date 33 – 36 . PML-1 mediates the inhibitory cytokine storm and anti-inflammatory effects of α-MMC and has become a target for anti-inflammatory immunotherapy. This pathway indicates that the PML-1 protein may serve as a target for anti-inflammatory immunotherapy, with LRP1 receptor agonists exerting anti-inflammatory effects by activating the PML-1 protein. The presence of ubiquitination ligase activity in the PML-1 protein is a major finding of this study. The PML protein possesses the typical RBCC structure of the TRIM family protein, which is associated with sentrin/small ubiquitin-like modifier (SUMO) chemical modifications 37 . PML proteins exhibit SUMO E3 ligase activity because they can directly SUMOylate p53, murine double minute 2 (MDM2), and nuclear misfolding proteins using them as substrates 38 , 39 . The RBCC/TRIM motif has also been shown to be associated with ubiquitination, and TRIM family members represent a novel class of monocyclic finger E3-type ubiquitin ligases 40 , 41 . Some TRIM proteins exhibit both E3 SUMOylation and E3 ubiquitylation enzymatic activity. For example, TRIM27 can SUMOylate proteins such as those in urothelial bladder cancer (UBC), p53, and MDM2 and promote the ubiquitination of the p53 protein, thus resulting in dual E3 enzymatic activity 42 , 43 . However, whether PML has E3 ubiquitin-mediated enzymatic activity similar to that of TRIM27 remains unknown. While it has been proposed that PML proteins with the RBCC structure may possess E3 ubiquitination ligase activity 2 , 16 , 28 , no studies have investigated this possibility, probably because a specific substrate target protein has not been identified. In this study, we successfully identified a pair of substrate target proteins for PML-1—the TAB1 and TAK1 complex—through intracellular overexpression-based ubiquitination experiments and in vitro recombinant protein ubiquitination assays. Therefore, established the E3 ubiquitin ligase activity of the PML protein. In the intracellular co-expression-based ubiquitination assays, we observed that hTAB1 undergoes ubiquitination upon interacting with hPML-1, however, no such interaction was observed with hTAK1. Similarly, in vitro protein ubiquitination assays revealed that only hPML-1 mediates the ubiquitination of hTAB1 and that no ubiquitination occurs for hTAK1. These results imply that the PML-1 protein may not bind directly to TAK1. Since the TAB1 and TAK1 proteins exist as a complex within cells, PML-1 must interact with this complex to achieve TAK1 ubiquitination. Consequently, the optimal results for ubiquitination were obtained using a recombinant hTAB1/hTAK1 complex. The discovery of the PML protein E3 ubiquitin ligase represents a major breakthrough in understanding the function of the PML protein. Ubiquitination is a key post-translational modification in eukaryotic cells and plays a crucial role in regulating processes such as protein degradation, cellular signalling, the cell cycle, DNA damage repair, immune responses and inflammatory responses 17 , 18 . The PML protein is indeed involved in these cellular processes 1 – 3 , so elucidating the function of the PML ubiquitin ligase would greatly advance our understanding of these mechanisms. PML's ability to target proteins for degradation via ubiquitination may be a key mechanism underlying its diverse cellular functions. Therefore, in addition to the target proteins TAB1/TAK1, further substrate proteins of the PML protein ubiquitin ligase, as well as novel functions, will be identified in the future. In recent years, ubiquitinating enzyme proteins have been employed in biological therapeutic strategies targeting protein degradation 44 , 45 . The discovery of novel E3 ubiquitin ligases for the PML protein could pave the way for the use of proteolysis-targeting chimeras (PROTACs) and molecular glue technology in anti-tumour therapy. In this study, the discovery that PML-1 targets and degrades TAB1/TAK1 via ubiquitination provides a novel strategy for developing anti-inflammatory immunotherapies. A direct application involves the utilisation of recombinant human PML-1 protein to treat severe infectious diseases characterised by cytokine storms, such as novel coronavirus pneumonia (COVID-19), influenza, AIDS, bacteremia and sepsis. Declarations Competing interests All authors reviewed and approved the manuscript. The authors declare no competing financial interests. Additional information Supplementary information is available for this paper. Correspondence and requests for materials should be addressed to Fubing Shen ( [email protected] ). Supplementary Information is available for this paper. Reprints and permissions information is available at www.nature.com/reprints. All animal experiments were conducted in accordance with the ARRIVE 2.0 guidelines and were authorised and supervised by the Servicebio Ethics Committee (2022153) (Wuhan, China). Author contributions Shen, F. Cheng, J. and Li, C. conceptualized the project, designed and implemented experiments, analysed data, provided funding and constructed the manuscript. Peng, K. Liu, Y. and Meng, Y. provided funding and constructed the manuscript. Xu, J. designed and offered critical advice for manuscript construction. Pan, C. Meng, H. and Zhou Y. conceived the study, designed and performed experiments and bioinformatic analyses, interpreted data and wrote the manuscript. Luo, T. Huang, Y. and He, L. designed and implemented experiments, and analysed data and helped construct the manuscript. Yi, M. Dai, Y. Zhou, Y. Ruan, S. Xia, Y. Qin, K. and Yang Y. conceived and supervised the study, interpreted data and wrote the manuscript. Acknowledgements We thank Shanghai Applied Protein Technology Co. (APTBIO) for the phosphoproteomics and data analysis services and Cyagen Biosciences, Inc., for their assistance in the construction of the PML protein knockout cell line and knockout mouse model. We thank Peking Yanyuan Intelligent Brain Biotechnology Co., Ltd., and the Beijing Computing Centre for their assistance in the structural biology part of PML protein modelling and molecular docking. We thank Wuhan Corebiolab Co., Ltd., for providing the research platform. We would also like to thank Nianhua Deng for her early contributions to this work and the editorial teams of American Journal Experts and Enago for their editorial services. Data availability The mass spectrometry proteomic data have been deposited to the ProteomeXchange Consortium ( https://proteomecentral.proteomexchange.org ) via the iProX partner repository with the dataset identifier PXD058890. Source data are provided with this paper. Reporting summary Further information on the research design is available in the Nature Port-folio Reporting Summary linked to this article. References Hsu KS, Kao HY (2018) PML: Regulation and multifaceted function beyond tumor suppression. Cell Biosci 8:5 Lin HK, Bergmann S, Pandolfi PP (2004) Cytoplasmic PML function in TGF-beta signalling. Nature 431, 205 – 11 Ryabchenko B et al (2023) The interactions between PML nuclear bodies and small and medium size DNA viruses. Virol J 20:82 Maarifi G, Chelbi-Alix MK, Nisole S (2014) PML control of cytokine signaling. Cytokine Growth Factor Rev. 25, 551 – 61 Scherer M, Stamminger T (2016) Emerging Role of PML Nuclear Bodies in Innate Immune Signaling. J Virol 90:5850–5854 Lunardi A et al (2011) A Role for PML in Innate Immunity. Genes Cancer 2:10–19 Ohgiya D et al (2012) Association of promyelocytic leukemia protein with expression of IL-6 and resistance to treatment in multiple myeloma. Acta Haematol 128:213–222 Lo YH et al (2013) Selective inhibition of the NLRP3 inflammasome by targeting to promyelocytic leukemia protein in mouse and human. Blood 121:3185–3194 Jo EK, Kim JK, Shin DM, Sasakawa C (2016) Molecular mechanisms regulating NLRP3 inflammasome activation. Cell Mol Immunol 13:148–159 Ahmed A et al (2017) Regulation of NF-κB by PML and PML-RARα. Sci Rep 20:44539 Dowling JK et al (2014) Promyelocytic Leukemia Protein Interacts with the Apoptosis-associated Speck-like Protein to Limit Inflammasome Activation. J Biol Chem 289:6429–6437 Uggè M, Simoni M, Fracassi C, Bernardi R (2022) PML isoforms: a molecular basis for PML pleiotropic functions. Trends Biochem Sci 47:609–619 Silonov SA, Smirnov EY, Kuznetsova IM, Turoverov KK, Fonin A (2023) V. PML Body Biogenesis: A Delicate Balance of Interactions. Int J Mol Sci 24:16702 Xia Y, Zhao J, Yang C (2020) Identification of key genes and pathways for melanoma in the TRIM family. Cancer Med 9:8989–9005 Meroni G, Diez-Roux G (2005) TRIM/RBCC, a novel class of 'single protein RING finger' E3 ubiquitin ligases. BioEssays 27:1147–1157 Ikeda K, Inoue S (2012) TRIM proteins as RING finger E3 ubiquitin ligases. Adv Exp Med Biol 770:27–37 Zheng N, Shabek N (2017) Ubiquitin Ligases: Structure, Function, and Regulation. Annu Rev Biochem 86:129–157 Hershko A, Ciechanover A (1998) The ubiquitin system. Annu Rev Biochem. 67, 425 – 79 Peng K et al (2022) Alpha-Momorcharin Inhibits Proinflammatory Cytokine Expression by M1 Macrophages but Not Anti-Inflammatory Cytokine Expression by M2 Macrophages. J Inflamm Res 15:4853–4872 Deng N et al (2019) LRP1 receptor-mediated immunosuppression of α-MMC on monocytes. Int Immunopharmacol 70:80–87 Deng N et al (2019) Alpha-momorcharin regulates cytokine expression and induces apoptosis in monocytes. Immunopharmacol Immunotoxicol 41:258–266 Sun X et al (2020) Cytokine storm intervention in the early stages of COVID-19 pneumonia. Cytokine Growth Factor Rev 53:38–42 Gu Y et al (2019) Role of the Innate Cytokine Storm Induced by the Influenza A Virus. Viral Immunol 32:244–251 Guo XJ, Thomas PG (2017) New fronts emerge in the influenza cytokine storm. Semin Immunopathol 39:541–550 Nisole S, Maroui MA, Mascle XH, Aubry M, Chelbi-Alix MK (2013) Differential Roles of PML Isoforms. Front Oncol 3:125 Jin G, Gao Y, Lin HK (2014) Cytoplasmic PML: from molecular regulation to biological functions. J Cell Biochem 115:812–818 Abou-Ghali M, Lallemand-Breitenbach VPML (2024) Nuclear bodies: the cancer connection and beyond. Nucleu 15:2321265 Vogiatzoglou AP, Moretto F, Makkou M, Papamatheakis J, Kretsovali A (2022) Promyelocytic leukemia protein (PML) and stem cells: from cancer to pluripotency. Int J Dev Biol 66:85–95 El-Asmi F, Chelbi-Alix MK (2020) Les isoformes de PML et la réponse au TGF-β [PML isoforms and TGF-β response]. Med Sci (Paris) 36:50–56 French Chen J, Su Y, Pi S, Hu B, Mao L (2021) The Dual Role of Low-Density Lipoprotein Receptor-Related Protein 1 in Atherosclerosis. Front Cardiovasc Med 8:682389 Dekky B et al (2016) Cellular Cholesterol Distribution Influences Proteolytic Release of the LRP-1 Ectodomain. Front Pharmacol 7:25 Boucher P, Herz J (2011) Signaling through LRP1: Protection from atherosclerosis and beyond. Biochem Pharmacol 81:1–5 Luo L et al (2018) TLR Crosstalk Activates LRP1 to Recruit Rab8a and PI3Kγ for Suppression of Inflammatory Responses. Cell Rep 24:3033–3044 Yang L et al (2016) LRP1 modulates the microglial immune response via regulation of JNK and NF-κB signaling pathways. J Neuroinflammation 13:304 Xian X et al (2017) LRP1 integrates murine macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis. Elife 16:e29292 Zurhove K, Nakajima C, Herz J, Bock HH, May P (2008) Gamma-secretase limits the inflammatory response through the processing of LRP1. Sci Signal 1:ra15 Barroso-Gomila O et al (2021) Identification of proximal SUMO-dependent interactors using SUMO-ID. Nat Commun 12:6671 Wei X et al (2003) Physical and functional interactions between PML and MDM2. J Biol Chem 278:29288–29297 Guo L et al (2014) A cellular system that degrades misfolded proteins and protects against neurodegeneration. Mol Cell 55:15–30 Venuto S, Merla G (2019) E3 Ubiquitin Ligase TRIM Proteins, Cell Cycle and Mitosis. Cells 8:510 Hatakeyama STRIM, Family Proteins (2017) Roles in Autophagy, Immunity, and Carcinogenesis. Trends Biochem Sci 42:297–311 Chu Y, Yang X (2011) SUMO E3 ligase activity of TRIM proteins. Oncogene 30:1108–1116 Wang T et al (2023) SUMOylation of TUFT1 is essential for gastric cancer progression through AKT/mTOR signaling pathway activation. Cancer Sci 114:533–545 Rodríguez-Gimeno A, Galdeano C (2025) Drug Discovery Approaches to Target E3 Ligases. ChemBioChem 26:e202400656 Yim J, Kim S, Lee HH, Chung JS, Park J (2024) Fragment-based approaches to discover ligands for tumor-specific E3 ligases. Expert Opin Drug Discov 19:1471–1484 Methods Preparation of α-MMC The α-MMC protein was prepared as described by Meng, Y. et al. 46 , and sample verification was performed as reported by Peng, K. et al. (2022) 19 . Cells The THP-1 human monocyte cell line was purchased from Procell (Wuhan, China), and the HEK293T cell line was purchased from the Chinese Academy of Sciences. The cells were subjected to mycoplasma testing and STR typing. To generate M1 macrophages, PMA (30 ng/ml) and 20 ng/ml LPS were added to THP-1 human monocyte cells, which were subsequently cultured for 48 h. Primary antibodies Anti-PML (Abcam, ab179466), 1:1,000; anti-PML (Merck, SAB5700065), 1:1,000; anti-p-PML (Abcam, ab128932), 1:1,000; anti-TRAF6 (Abcam, ab137452), 1:1,000; anti-TAB1 (Abcam, Ab76412), 1:1,000; anti-TAB1 (Immunoway, YM1302), 1:1,000; anti-TAK1 (Immunoway, YT4535), 1:1,000; anti-p-TAK1 (Immunoway, YP0424), 1:600; anti-JNK (Immunoway, YT2440), 1:1,000; anti-p-JNK (Immunoway, YP0156), 1:600; anti-AP1 (Immunoway, YT0248), 1:1,000; anti-p-AP1 (Immunoway, YP0018), 1:1,000; anti-NF-kB p65 (Abcam, ab32536), 1:2,000; anti-p-p65 (Abcam, ab76302), 1:1,000; anti-LaminB1 (Proteintech, 66095-1-Ig), 1:10,000; anti-actin (Proteintech, 66009-1-Ig), 1:5,000; anti- LRP1(Abcam, ab92544), 1:1,000; anti-FLAG tag (Proteintech, 80010-1-RR), 1:1,000; anti-MYC tag (Proteintech, 16286-1-ap), 1:800；anti-HA tag antibody (Proteintech, 7c9, 1: 1,000). Phosphoproteomic assay The cells were divided into four groups: the M0 macrophage group, the LPS-stimulated macrophage (M1 0 h) group, the α-MMC-treated (0.25 h) LPS-induced macrophage (M1 0.25 h) group and the α-MMC-treated (4 h) LPS-induced macrophage (M1 4 h) group. α-MMC was administered at a dose of 0.5 μg/ml, and 3 wells were included in each group. At the end of the experiment, the cells were washed 3 times with PBS, scraped up with a spatula, collected, frozen in liquid nitrogen, and stored at -80°C. TMT labelling and LC‒MS/MS analysis were performed by a professional team from Shanghai Applied Protein Technology Co., Ltd. (APTBIO). Quantitative information about the target proteins was obtained, and the Complexheatmap package in R (R version 3.4) was subsequently used to classify the differentially expressed proteins in the groups and generate a hierarchical clustering heatmap. KEGG Automatic Annotation Server (KAAS) software and Fisher's exact method were used to compare the ranges of enriched KEGG pathways for the target proteins and overall proteins and to perform a KEGG pathway analysis of the target protein set 47-49 . Immunoblotting analysis Cell lysates from each experimental group were collected at each time point (in RIPA lysis buffer), and protein concentrations were determined using the BCA method. An appropriate volume of 5 × SDS loading buffer was added according to the volume of the solution, and the mixture was boiled at 100°C for 5 minutes. Protein samples (20 µg) were separated using 10% SDS polyacrylamide gels and 5% SDS gels. The samples were electrophoretically transferred onto PVDF membranes and blocked with 5% milk/TBST. After being washed, the membranes were incubated with primary antibody diluted as recommended with 1% BSA/TBST and placed in a hybridization bag. The samples were stored overnight in a refrigerator at 4°C. The samples were subsequently incubated with horseradish peroxidase-labelled goat anti-rabbit secondary antibody (1:5,000, Proteintech, SA00001-2) or horseradish peroxidase-labelled goat anti-mouse secondary antibody (1: 5,000, Proteintech, SA00001-1) for 1 hour and developed using the ECL chemiluminescence method. The bands were visualized via a chemiluminescence gel imager (ChemiDoc™ XRS + , Bio-Rad, USA). ImageJ 1.8.0 software was used to measure the grey value of each band. PML −/− THP-1 cells The coding DNA sequence region of the PML protein was downloaded from the NCBI database (https://www.ncbi.nlm.nih.gov/gene/5371), and gRNAs targeting the E2 region of the PML gene were designed. The sequences used were as follows: gRNA-A1 : CCCCCAGCGAGCCCG CTT - CGG ; gRNA-B1 : CCC - CCGCTTCGGAGGAGGAGGAGTTC ; and gRNA-C1 : CCC - CGCTTCGGAGGAGGAGGAGGAGTTCC . The Cas9 protein was incubated with a gRNA , andTHP-1 cells were subsequently transfected via the RNP method. DNA was extracted to determine the cutting efficiency, and the gRNA with the best cutting efficiency was selected for the next step of the experiment 50,51 . The cells were counted and cultured after 24 h of transfection. One hundred microlitres of medium was added to each well of a 96-well plate so that each well contained only one cell, and the cells were cultured for approximately one week. Animals Specific pathogen-free (SPF) C57BL/6J mice (6‒8 W) were obtained from Charles River (Beijing, China). All animal experiments were reported in accordance with the ARRIVE 2.0 guidelines and were approved by the Ethics Committee of Servicepio (2022153) (Wuhan, China). The animals were housed in animal chambers at a temperature of 22–25°C and a relative humidity of 50–70% on a 12-hour light/dark cycle. PML −/− mice The sequence of the CDS region of the PML protein was downloaded from the NCBI database (https://www.ncbi.nlm.nih.gov/gene/18854), and gRNAs targeting the E2 region of the PML gene were designed. The sequences were as follows: gRNA-A1 : GTTCATGCGTTCATGTGCTA AGG ; gRNA-A2 : ATAGTGGACATTTCCTTCGGAGG ; gRNA-B1 : TCCAGGTTGTTGAATGT ATCAGG ; and gRNA-B2 : GCAGGTCGGGGTAACCTTATCAGG . Cas9 and gRNA were coinjected into fertilized eggs to generate KO mice. F0-positive mice were bred 1 male to 2 females WT or 1 male WT to 2 females, and newborn mice were genotyped via PCR 52, 53 . The length of the PCR product amplified by primer 1 was 541 bp (upstream primer: 5'- ACAAATAAGGTCACATTGCCCTAAC -3', downstream primer: 5'- AGCGGTTTGGTTCCCATT GATTC -3'); the length of the PCR product amplified by primer 2 was 849 bp (upstream primer: 5'- ACAAATAAGGTCACATTGCCCTAAC -3', downstream primer: 5'- GTTCCTCATTTACTTC GTTCCTCATTTACTTCGAGCCTTG -3'). For breeding, F1-positive mice were bred from 1 male to 2 females, and 1 male was subjected to in vitro fertilization (IVF) to obtain 15 female heterozygotes. Twenty pure heterozygotes were obtained by crossing male heterozygotes obtained via natural mating with female heterozygotes obtained via IVF and then used for sequencing and analysis. The 20 pure heterozygous mice were bred for a predetermined number of weeks. Induction of ALI in mice The animals were randomly divided into six groups ( n = 6): (1) the normal saline (NS)-treated WT mouse group; (2) the LPS (8.0 mg/kg)-treated WT mouse group; (3) the LPS (8.0 mg/kg) + α-MMC (1.5 mg/kg)-treated WT mouse group; (4) the NS-treated PML −/− mouse group; (5) the LPS (8.0 mg/kg)-treated model PML −/− mouse group; and (6) the LPS (8.0 mg/kg) + α-MMC (1.5 mg/kg)-treated PML −/− mouse group. The mice were weighed and anaesthetized with 1% sodium pentobarbital (50 mg/kg), and 50 µl of dissolved LPS (or NS for normal control mice) was injected into the trachea via a microinjector. The mice were shaken from side to side to ensure the even distribution of the drug in the lungs. When the mice were able to breathe normally, they were returned to their cages for recovery. The mice in the intraperitoneal group were injected with α-MMC 1 h after LPS injection, whereas the mice in the model and normal control groups were injected intraperitoneally with the same amount of saline. Twenty-hours after the first administration of LPS, the mice in each group received a second dose of LPS and α-MMC in the same way. After 24 h, the mice in each group were anaesthetized with pentobarbital sodium, blood samples were taken, and the animals were sacrificed by cervical dislocation. The left lung was fixed in paraformaldehyde and prepared for paraffin embedding. The right lung was frozen in liquid nitrogen and stored at -80°C for ELISA and Western blot analyses. ELISAs Frozen lung tissue was thawed, weighed and homogenized by adding 9 volumes of RIPA lysis buffer supplemented with protein inhibitor cocktail III (Merck Millipore, USA) at a ratio of 1:9 (mg): volume (µl). The lysis buffer was centrifuged at 4°C and 4000 rpm for 10 min, and the supernatant was transferred to a clean centrifuge tube. Twenty microlitres of each supernatant was then collected and diluted, and the protein concentration was measured via the BCA method. TNF-α, IL-1β and IL-6 levels were measured via a mouse ELISA kit (ImmunoWay Biotech, USA) according to the manufacturer’s instructions. Histopathological evaluation of ALI Left lung tissue was used for microscopic examination of pathological lesions. The tissue was fixed in 4% buffered formalin for 24 h, dried, embedded in paraffin, cut into slices, stained with haematoxylin and eosin, and analysed via a Nikon Eclipse Ci microscope (Nikon Electronic Company, Osaka, Japan). Five sections of 300 alveoli were selected from each slide (10 × magnification), and an investigator who was blinded to the treatment groups assessed the extent of lung injury. Images were captured and processed via Caseviewer 2.4 software. IP M1 macrophages were treated, and the cells were harvested. Afterwards, 500 µl of IP cell lysate (containing the protease inhibitor PMSF) was added, and the mixture was lysed for 30 min on ice and centrifuged at 12,000 rpm for 5 min at 4°C. The supernatant was then collected, 100 µl of protein A + G agarose (P2078-1; Beyotime Biotechnology) beads was added, and the mixture was spun for 1 h at 4°C to block nonspecific binding. Fifty microlitres of the lysed supernatant was reserved for the input, and the remaining samples were set aside. Afterwards, the magnetic beads coupled to each antibody were separately added to lysates from each group and rotated at 4°C overnight to allow the protein to bind the antibodies. The samples from each group were then centrifuged at 1,000 × g for 5 minutes at 4°C, the supernatants were discarded, the samples were subsequently washed four times with PBS, and the supernatants were subsequently discarded. Finally, Western blotting was used to measure the protein levels in the immunoprecipitates. Nucleocytoplasmic analysis Cultured WT M1 macrophages and PML −/− M1 macrophages were treated with α-MMC (0, 0.1, 0.5, or 1.5 μg/ml) and TGF-β (0, 50, 150, or 450 ng/ml) for 8 h. The NE-PER Nuclear and Cytoplasmic Kit (Thermo, 78833) was then used to isolate the cytoplasmic and nuclear fractions of harvested cells from each group, and the levels of PML, TAB1, TAK1 and p-TAK1 were measured in the cytoplasmic and nuclear fractions by immunoblotting 54, 55 . Recombinant hPML-1 protein The amino acid sequence of the hPML-1 protein was optimized using MaxCodon TM Optimization Program (V13) codon optimization software (Nanjing DetaiBio, China). Afterwards, the hPML-1 plasmid was obtained by whole gene synthesis, and the hPML-1 gene was inserted into the pcDNA3.4 expression vector using double digestion. The hPML-1 plasmid was transformed into DH5α receptor cells using conventional methods, after which the plasmid was amplified and purified. Afterwards, the hPML-1 plasmid–transfection reagent mixture was added to in vitro-cultured HEK293 cells (1–1.5×10 6 cells/ml) and incubated at 110 rpm, 37°C, and 5% CO 2 . Afterwards, cells obtained by centrifugation of cell cultures after 5 days of transfection culture were collected and lysed in 50 mM Tris, 300 mM NaCl, 8 M urea, 20 mM imidazole, and pH 8.0 buffer and purified by affinity chromatography on a Ni-IDA (Ni-IDA 1000, Gene) column. The purified proteins were collected and complexed with buffer [1 × PBS (pH 7.4), 4 mM GSH, 0.4 mM GSSG, 0.4 M L-arginine]. rhPML-1 acts on PML −/− M1 macrophages PML −/− M1 macrophages (1×10⁶ cells) cultured in vitro were treated with 0 μg/ml, 20 μg/ml, 25 μg/ml, 30 μg/ml or 35 μg/ml recombinant hPML-1 protein for 8 h. Total protein was extracted from the harvested cells in each group. TAB1, TAK1, and p-TAK1 expression levels in protein samples were determined by immunoblotting analysis, and the levels of the inflammatory cytokines TNF-α, IL-1β, and IL-6 were determined using ELISAs. Ubiquitination assay with coexpression The open reading frame (ORF) of human PML-1 (NM_033238.3) was cloned with a MYC tag, and the ORFs of human TAB1 (NM_006116.3) and TAK1 (NM_079356.3) were cloned with a 3Flag tag. The sequences of the primers used for plasmid construction are listed in Supplementary Table 1. PCR amplification was performed using high-fidelity kodakaraensis (KOD) DNA polymerase (Toyobo) in a 30 μL reaction consisting of 1 μL of cDNA template, 0.5 μM each primer, 2.5 μL of dNTP mixture, 3 μL of 10 × KOD buffer and 22.5 μL of sterile ddH 2 O. Afterwards, the amplified PCR products were inserted into the pcDNA3.1 (+) expression vector (V79020; Invitrogen) at the NheI and BamHI restriction sites. The sequences of all the recombinant plasmids were confirmed via Sanger sequencing to ensure the accuracy of the cloning 56-57 . HEK293T cells were seeded in 6-well cell culture plates at a density of 4 × 10 5 cells per well, and 2.5 μg of the corresponding recombinant plasmid was diluted in 250 μl of Opti-MEM (Gibco) and gently mixed. The plasmid was then mixed with Lipofectamine 2000 and incubated for an additional 20 minutes at room temperature. The DNA-Lipofectamine complexes were then added to the appropriate wells, and the medium was replaced with fresh medium. Afterwards, the cells were washed twice with ice-cold PBS and lysed in RIPA buffer containing protease inhibitors (Beyotime, P1046), and the lysates were incubated on ice for 30 minutes and then centrifuged at 12,000 rpm for 15 minutes at 4°C. An immunoprecipitation experiment was subsequently performed. Finally, the eluted proteins were analysed by Western blotting using an anti-MYC tag antibody (Proteintech, 16286-1-AP, 1:800), an anti-FLAG tag antibody (Proteintech, 80010-1-RR, 1:1000) and an anti-HA tag antibody (Proteintech, 7c9, 1:1.000). Ubiquitination of TAB1/TAK1 in cells Cultured M1 macrophages (1×10 7 cells) were treated with recombinant hPML-1 protein (30 μg/ml) for 8 h, and 40 μM MG-132 (HY-13259; MCE, Inc.) was added 4 h prior to cell harvesting. Afterwards, cell lysates were prepared, and TAB1 and TAK1 proteins were enriched in the cell lysates using the IP method. Ubiquitination of TAB1 and TAK1 was detected using WB. Autoubiquitination assay The experimental groups were as follows: (1) rhPML-1 self-ubiquitination; (2) negative control (rhPML-1 without Mg-ATP); (3) Hdm2 self-ubiquitination control; and (4) negative control (Hdm2 without Mg-ATP). First, the assay components were added to a 0.5 ml Eppendorf tube in the order indicated in the protocol provided with the E3 Ligase Auto-Ubiquitylation Assay Kit (ab139469; Abcam, USA). Next, the contents of the tube were mixed gently and then incubated at 37°C for 1 hour. Quench assays were performed by adding 50 μl of 2 × SDS‒PAGE gel loading buffer followed by heating to 95°C for 5 minutes. Finally, the samples were analysed using Western blot. Ubiquitination of rhTAB1/hTAK1 in vitro Recombinant human PML-1 protein (0.2 mg/mL), recombinant human TAB1 protein (NM_006116; Origene, USA) and recombinant human TAK1 protein (NM_003188; Origene, USA) were prepared. The ubiquitinylation assay was performed according to the E3 ligase autoubiquitination detection kit protocol (ab139469; Abcam, USA). Experiment 1 included six groups: negative control (rhPML-1 and Mg-ATP absent), rhPML-1 autoubiquitination, rhTAB1 (with rhPML-1 absent), rhTAB1 and rhPML-1 proteins, rhTAK1 (with rhPML-1 absent), and rhTAK1 and rhPML-1 proteins. Experiment 2 included five groups: negative control (rhPML-1 and Mg-ATP absent); rhPML-1 autoubiquitination; rhTAB1 and rhPML-1 proteins; rhTAK1 and rhPML-1 proteins; and the rhTAB1/rhTAK1 complex (0.2 mg/ml of each protein mixed together and then incubated overnight at 4°C) and rhPML-1 proteins. In addition, the rhTAB1 and rhTAK1 samples as well as the reaction product sample of rhTAB1 with rhTAK1 were analysed separately using SDS-PAGE. 3D protein structure modelling The primary structural sequences of the PML-1 protein, TAB1 protein, TAK1 protein and LRP1-85 kDa protein were obtained separately via the Protein Data Bank sequence search tool available at NCBI (https://www.ncbi.nlm.nih. gov/). Once the sequences were obtained, they were converted to FASTA format for use in AlphaFold2 58-62 AlphaFold2 software is open source software available at https://github.com/deepmind/AlphaFold. Molecular docking of PML-1 with LRP1 PML-1 and LRP1-85 kDa protein docking was simulated via HDOCK software, and the binding modes for the PML-1 protein and LRP1-85 kDa with the top 10 energy values (Supplementary Table 2) were obtained 63-65 . Pose 1 was selected for protein‒protein interaction analysis to confirm the amino acid sites and distances between the amino acids of PML-1 that interact with the LRP1-85 kDa protein (Supplementary Table 3). Molecular docking of PML-1 with TAB1/TAK1 TAB1-TAK1 protein docking was performed via HDOCK software to obtain TAB1 and TAK1 protein binding bodes, after which the protein‒protein interactions of TAB1 and TAK1 were analysed to confirm the amino acid sites and distances between the amino acid residues involved in TAB1-TAK1 protein interactions (Supplementary Table 4) 63-65 . The docking of PML-1 with the TAB1/TAK1 protein complex was simulated using HDOCK software to determine the binding mode for the PML-1 protein and TAB1-TAK1 complex with the top 10 energy values (Supplementary Table 5) 63-65 . Pose 5 was selected for protein–protein interaction analysis to confirm the amino acid sites and distances between the amino acid atoms when PML-1 interacts with the TAB1 and TAK1 proteins (Supplementary Table 6). Data and statistical analysis The data are expressed as the means ± SDs unless otherwise stated. The group sizes were determined on the basis of the results of preliminary experiments. The mice were assigned at random to groups. The significance of differences in each experiment was determined as described in the figure legends, where n = the number of independent biological replicates (animals, unless noted as cells) per group, and N = the number of independent experimental replicates. One-way ANOVA was performed via GraphPad Prism 5.0, and P < 0.05 was considered to indicate statistical significance. Additional Declarations There is NO Competing Interest. Supplementary Files Supplementaryinformation.docx Supplementary information ExtendedDataFigs.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8725456","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":594315019,"identity":"224b45ff-af20-47a8-b51e-425b1e4276a7","order_by":0,"name":"fubing shen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA10lEQVRIiWNgGAWjYDACCSCuYDjAw8DAfODAhx/EajkD1sKWeHBmDwlagCSP8WEONiJ0yM9uPvbgYNsdGXP+NR8OM/AwyPOLHcCvxeDOsXSDg23PeCxnvN1wuMCCwXDm7AQCWiRyzKQ/th3mMbhxdsPhGTwMCQa3CWiRn5H/TeIgWMuZB4d52IjQwnAjhw2i5XwPA3FaDG6kmUkcOPcMaAubATCQJQj7RX5G8jOJA2V37A3OH3784cMPG3l+aUIOgwMJsEoJYpWDAP8BUlSPglEwCkbBSAIAwA9OOgrAUJkAAAAASUVORK5CYII=","orcid":"","institution":"Chengdu Medical College","correspondingAuthor":true,"prefix":"","firstName":"fubing","middleName":"","lastName":"shen","suffix":""}],"badges":[],"createdAt":"2026-01-28 22:55:44","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8725456/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8725456/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":103285042,"identity":"5b80e174-f609-4a13-86d7-df7ed2815b62","added_by":"auto","created_at":"2026-02-24 04:25:37","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":186187,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe PML protein is activated by α-MMC. a, \u003c/strong\u003eImmunoblotting analysis.\u003cstrong\u003e \u003c/strong\u003eα-MMC activates PML/p-PML proteins, inhibits TAB1/TAK1, and suppresses the phosphorylation of TAK1 and its downstream signalling proteins.\u003cstrong\u003e b, \u003c/strong\u003eRelative density value.\u003cstrong\u003e \u003c/strong\u003e*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; ns, not significant. The data are presented as the mean ± SD; \u003cem\u003eN\u003c/em\u003e = 5; \u003cem\u003en \u003c/em\u003e= 3; one-way ANOVA.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8725456/v1/ec28704d1e5557df5f0400f8.jpg"},{"id":103285048,"identity":"139302ce-8534-48fa-b33d-5374b16053a9","added_by":"auto","created_at":"2026-02-24 04:25:40","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":761977,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibitory effects of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePML\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e knockout on the anti-inflammatory response in mice. a,\u003c/strong\u003e Immunoblotting analysis of the expression of the PML, TAB1, TAK1, and p-TAK1 proteins. The mice were randomly divided into six groups (\u003cem\u003en \u003c/em\u003e= 6): (1) the normal saline (NS)-treated WT group; (2) the LPS (8.0 mg/kg)-treated WT group; (3) the LPS (8.0 mg/kg) + α-MMC (1.5 mg/kg)-treated WT group; (4) the NS-treated \u003cem\u003ePML\u003c/em\u003e\u003csup\u003e\u003cem\u003e−/−\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003egroup; (5) the LPS (8.0 mg/kg)-treated model \u003cem\u003ePML\u003c/em\u003e\u003csup\u003e\u003cem\u003e−/−\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003egroup; and (6) the LPS (8.0 mg/kg) + α-MMC (1.5 mg/kg)-treated \u003cem\u003ePML\u003c/em\u003e\u003csup\u003e\u003cem\u003e−/−\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003egroup. Three out of six mice in each group were selected for immunoblot analysis. WT, wild-type. \u003cstrong\u003eb,\u003c/strong\u003e ELISA analysis of TNF-α, IL-1β, and IL-6 levels.\u003cstrong\u003e \u003c/strong\u003e*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; ns, nonsignificant. The data are presented as the means ± SDs; \u003cem\u003en \u003c/em\u003e= 6; one-way ANOVA. \u003cstrong\u003ec,\u003c/strong\u003e Histopathological image (H\u0026amp;E staining). Scale bar, 200 μm for 5× magnification images and 50 μm for 20× magnification images.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8725456/v1/7ad5b56aa96940077e9fc69f.jpg"},{"id":103285044,"identity":"1bfc90f5-878b-4cbc-b85e-86c7ee2a7ca9","added_by":"auto","created_at":"2026-02-24 04:25:38","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":147585,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePML-1 isoform screening by nucleocytoplasmic isolation analysis. \u003c/strong\u003eWT M1 macrophages and \u003cem\u003ePML\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e cells were treated with α-MMC (0, 0.1, 0.5 or 1.5 μg/ml) and TGF-β (0, 50, 150 or 450 ng/ml) for 8 h. The cells were then harvested, and their cytoplasmic and nuclear fractions were isolated. \u003cstrong\u003ea,\u003c/strong\u003e Immunoblotting analysis of cytoplasmic samples. \u003cstrong\u003eb, \u003c/strong\u003eImmunoblotting analysis of nuclear samples.\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8725456/v1/503d0118350d87fbf7fe2847.jpg"},{"id":103285047,"identity":"4937c83e-c27b-4ab4-b05e-7d98c8d59108","added_by":"auto","created_at":"2026-02-24 04:25:40","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":132599,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBioinformatic analysis of the binding of the PML-1 protein to TAB1/TAK1.\u003c/strong\u003e \u003cstrong\u003ea\u003c/strong\u003e, \u003cstrong\u003eb,\u003c/strong\u003e Three-dimensional structural pattern of the TAK1 protein and TAB1 protein. \u003cstrong\u003ec, \u003c/strong\u003eTAK1 and TAB1 protein–protein moleculardocking patternsand binding structure analysis revealed that44 amino acids in the TAB1 protein interact with 38 amino acids in the TAK1 protein. \u003cstrong\u003ed, \u003c/strong\u003eTop ten poses cluster analysis diagramsof PML-1 and TAB1/TAK1 complex protein‒protein docking. \u003cstrong\u003ee, \u003c/strong\u003eThree-dimensional structural pattern of the PML-1 protein.\u003cstrong\u003e f, \u003c/strong\u003eAnalysis of the binding pattern of PML-1 with the TAB1/TAK1 complex;15 amino acids of TAB1 interact with seven amino acids of PML-1, and 41 amino acids of TAK1 interact with 32 amino acids of PML-1.\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8725456/v1/135bc7fa54476fd21f9cb755.jpg"},{"id":103285040,"identity":"0d3b6c72-3d77-4633-9992-2434fccc5442","added_by":"auto","created_at":"2026-02-24 04:25:37","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":143653,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePML-1 ubiquitinates TAB1/TAK1 proteins in cells and in vitro\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e. \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ea, \u003c/strong\u003eTAB1-3Flag, PML-1-MYC and Ub-HA were coexpressed and analysed using immunoprecipitation and ubiquitination assays.\u003cstrong\u003e b\u003c/strong\u003e, \u003cstrong\u003ec,\u003c/strong\u003e TAB1 and TAK1 ubiquitination assayswith recombinant human PML-1 (rhPML-1) in M1-type inflammatory macrophages. \u003cstrong\u003ed, \u003c/strong\u003eE3 ligase autoubiquitinationassay of the rhPML-1 protein and human double minute 2 (Hdm2). \u003cstrong\u003ee,\u003c/strong\u003eRecombinant human TAB1 (rhTAB1) and recombinant human TAK1 (rhTAK1) ubiquitination assayswith rhPML-1\u003cem\u003e \u003c/em\u003ein vitro. \u003cstrong\u003ef, \u003c/strong\u003eSDS‒PAGE assays of rhTAB1, rhTAK1 and the rhTAB1/rhTAK1 complex. \u003cstrong\u003eg, \u003c/strong\u003eAssay for the ubiquitination of rhTAB1, rhTAK1 and the rhTAB1/rhTAK1 complex by rhPML-1 in vitro. IB: immunoblotting; IP: immunoprecipitation.\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8725456/v1/9b3928c809a12103078aaa0c.jpg"},{"id":103285041,"identity":"3bad10ac-864a-48f8-83b9-ad17cbded065","added_by":"auto","created_at":"2026-02-24 04:25:37","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":62204,"visible":true,"origin":"","legend":"Supplementary information","description":"","filename":"Supplementaryinformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-8725456/v1/fe783054e3b4402ae96b521a.docx"},{"id":103285049,"identity":"34d76534-2783-4161-befe-adcc2465d0ba","added_by":"auto","created_at":"2026-02-24 04:25:40","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":14046213,"visible":true,"origin":"","legend":"","description":"","filename":"ExtendedDataFigs.docx","url":"https://assets-eu.researchsquare.com/files/rs-8725456/v1/6a27c18002bed7f23db156a0.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"PML-1 protein ubiquitinates TAB1/TAK1 for LRP1 anti-inflammation signal","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe PML protein is multifunctional protein that have been extensively studied because it is involved in many important cellular processes\u003csup\u003e\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Recent studies have shown that the PML protein is a key regulator of cytokine signalling, where it plays a crucial role in regulating the immune response and inflammation\u003csup\u003e\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Most reports indicate that the PML protein is generally proinflammatory, but several reports indicate that it also has anti-inflammatory effects\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. For example, in one case, the PML protein was linked to the upregulation of the inflammatory cytokine IL-1β in \u003cem\u003ePML\u003c/em\u003e knockout cells\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. These two opposing findings demonstrate the complex role that the PML protein plays in inflammation.\u003c/p\u003e \u003cp\u003ePML protein is a member of the tripartite motif (TRIM) family, known as TRIM19, and exhibits the typical structural features of RBCC\u003csup\u003e\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. RBCC/TRIM motifs are associated with ubiquitination and represent a novel class of single-ring finger E3-type ubiquitin ligases\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Ubiquitination, as a key posttranslational modification in eukaryotic cells, plays a crucial role in regulating protein degradation, cellular signalling, cell cycle control, DNA damage repair, immune responses, and inflammatory responses\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. We hypothesised that the PML protein may have E3 ubiquitin ligase activity and exert anti-inflammatory effects via the ubiquitination of specific inflammation-related proteins. However, no PML proteins have been reported to exhibit E3 ubiquitin ligase activity.\u003c/p\u003e \u003cp\u003ePrevious studies by our laboratory have demonstrated that the anti-inflammatory immunomodulator α-momorcharin (α-MMC) can inhibit the activity of the TAK1 signalling protein in the TLR pathway\u003csup\u003e\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. It does so by binding to the LRP1 receptor and thereby suppressing the cytokine storm induced by lipopolysaccharide (LPS)\u003csup\u003e\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. In this study, we used α-MMC as an immunosuppressive probe to investigate whether the PML protein participates in anti-inflammatory processes and to explore its possible ubiquitination mechanism.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePML protein is activated by α-MMC\u003c/h2\u003e \u003cp\u003ePrevious studies have demonstrated that α-MMC can inhibit the cytokine storm by binding to the LRP1 receptor to inhibit the inflammatory signalling protein TAK1. To identify the signalling target protein that mediates communication between the LPR1 receptor and the TAK1 protein, we performed a phosphoproteomic analysis and then validated the results using immunoblotting.\u003c/p\u003e \u003cp\u003eWe stimulated M1 inflammatory macrophages with LPS and administered α-MMC for 0.25 or 4 h. The differentially phosphorylated peptides were grouped and classified for visualization as heatmaps (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). The differentially expressed proteins between groups are presented as volcano plots (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eb), and KEGG pathway analysis was performed on the major signalling pathways (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). The PML protein level increased with increasing duration of α-MMC treatment, with a fold change (FC) of 2.54 after 0.25 h and 3.50 after 4 h (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). No changes in the activity of the PI3K/AKT or JAK/STAT pathway were detected. A significant decrease in the level of p-TAK1, which is involved in the TLR pathway, was observed after treatment with α-MMC for 4 h (FC\u0026thinsp;=\u0026thinsp;0.582). The results of the phosphoproteomic analysis revealed that α-MMC increased the PML protein levels and decreased the TAK1 protein levels.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe then conducted immunoblotting experiments to validate the results of the omics analysis. The results revealed that the PML and p-PML signals increased over time after M1 macrophages were treated with α-MMC for 0, 4, and 8 h. However, over time, the signal intensities of the proteins involved in the TLR pathway downstream of TRAF6 signalling, including TAB1, total TAK1 and p-TAK1, p-JNK, p-AP-1, and p-p65, significantly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, b). Immunoblotting validation experiments revealed that α-MMC activated the PML proteins and inhibited the TAB1/TAK1 signalling proteins.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePML mediates signal between LRP1 and TAB1/TAK1\u003c/h3\u003e\n\u003cp\u003eWe designed an LRP1 receptor blocking assay, a PML protein knockout assay, and a PML interaction assay with the LRP1 receptor or TAB1/TAK1 proteins to explore the possible signalling pathways involved.\u003c/p\u003e \u003cp\u003eFirst, a receptor blockade approach was used to demonstrate the activation of PML by LRP1. Receptor-associated protein (RAP) is a molecular chaperone of the LRP1 protein and is often used as an LRP1 blocker. The increase in PML/p-PML expression was significantly inhibited in the group treated with α-MMC combined with RAP for 8 h compared with that in the group treated with α-MMC for 8 h; additionally, the inhibition of the downstream signalling proteins TAB1, TAK1/p-TAK1, p-AP1, and p-p65 was significantly suppressed (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b). These findings demonstrate the role of LRP1 in mediating the activation of PML by α-MMC.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe next used a PML knockout cell model to demonstrate that increased PML protein activation is associated with decreased TAB1/TAK1 expression. CRISPR/Cas9 gene editing technology was used to knockout the PML gene in THP-1 cells, generating \u003cem\u003ePML\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e THP-1 cells. In the WT M1 macrophages, the signal intensities of the PML and p-PML proteins were significantly greater at 8 h after α-MMC administration, whereas the signals for TAB1 and TAK1/p-TAK1 were significantly weaker (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec, d). In the \u003cem\u003ePML\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e M1 macrophages, the signal intensities of TAB1 and TAK1/p-TAK1 at 8 and 0 hours after α-MMC administration essentially remained unchanged, with no sign of inhibition. The expression levels of signalling proteins downstream of TAB1/TAK1, such as p-AP-1 and p-p65, were also not inhibited. These results revealed that the inhibitory effect of α-MMC on TAB1 and TAK1 proteins was blocked in the absence of the PML protein, as was the effect on downstream signalling proteins. These findings suggest that the PML protein is essential for regulating TAB1/TAK1 protein signalling and mediating the inhibitory effect of α-MMC on both TAB1/TAK1 and downstream signalling.\u003c/p\u003e \u003cp\u003eWe next used immunoprecipitation (IP) to determine whether LRP1 interacts directly with the PML protein (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee). In the IP group, a strong LRP1 band (85 kDa, corresponding to the light chain of the LRP1 protein) and a strong PML band (110 kDa) were detected. The results revealed good interaction between the LRP1 and PML proteins after α-MMC treatment.\u003c/p\u003e \u003cp\u003eAdditionally, IP was performed to determine whether the PML protein directly inhibited the TAB1 and TAK1 proteins (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef-h). The lysates of M1 macrophages treated with α-MMC for 4 h and a PML-specific antibody was used for the procedure. Western blotting was conducted to measure the TAB1 and TAK1 protein levels in the immunoprecipitate. Distinct PML, TAB1, and TAK1 protein bands were detected in the input and in the immunoprecipitate, indicating that the PML protein interacted with the TAB1 and TAK1 proteins. Similarly, strong PML and TAK1 signals were detected in the immunoprecipitate after pull-down with TAB1- and TAK1-specific antibodies. These findings confirmed that the PML, TAB1, and TAK1 proteins bind to each other in three ways following α-MMC activation.\u003c/p\u003e \u003cp\u003eThus, these results demonstrate that α-MMC binds to the LRP1 receptor and activates PML proteins, which in turn inhibit TAB1/TAK1, thereby inhibiting the TLR inflammatory pathway via the LRP1-PML-TAB1/TAK1 signalling pathway.\u003c/p\u003e\n\u003ch3\u003ePML mediates anti-inflammatory effects in vivo\u003c/h3\u003e\n\u003cp\u003eTo further confirm that the PML proteins mediate anti-inflammatory effects in vivo, we treated WT and \u003cem\u003ePML\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice with LPS (mg/kg)-induced pneumonia-related acute lung injury using α-MMC (1.5 mg/kg) for 8 h. Lung tissue homogenates from each animal were analysed via western blotting and enzyme-linked immunosorbent assay (ELISA) to determine the levels of signalling proteins (PML, TAB1, and TAK1/p-TAK1) and inflammatory cytokines (TNF-α, IL-1β, and IL-6). The lung tissues from each animal were subsequently subjected to histopathological analysis.\u003c/p\u003e \u003cp\u003eIn WT mice, the signal intensity of the major PML protein band (110 kDa) was not increased in the control or model group but was significantly increased after α-MMC administration; correspondingly, the signal intensities of the TAB1, TAK1 and p-TAK1 bands were significantly lower in the α-MMC-treated group than in the model group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). In contrast, owing to the deletion of the PML protein in the \u003cem\u003ePML\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice, the signal intensities of TAB1, TAK1, and p-TAK1 did not differ between the α-MMC-treated group and the model group.\u003c/p\u003e \u003cp\u003eThe three proinflammatory cytokines TNF-α, IL-1β, and IL-6 were highly expressed in WT LPS-induced pneumonia model mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eb), indicating the occurrence of a cytokine storm; α-MMC treatment significantly reduced the expression of these cytokines, indicating a strong inhibitory effect (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Alternatively, in the \u003cem\u003ePML\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice, α-MMC treatment did not reduce the expression of the three cytokines (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003eHistopathological changes in each group of mice revealed significant inflammatory changes, such as a reduction in the alveolar space, significant thickening of the alveolar septa, and infiltration of many inflammatory cells, including neutrophils and macrophages, in the WT mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). However, the degrees of alveolar septal thickening, haemorrhage, and inflammatory cell infiltration were significantly reduced after α-MMC treatment, and α-MMC treatment significantly improved lung inflammation in these animals. Conversely, the degrees of alveolar septal thickening, haemorrhage, and inflammatory cell infiltration were not significantly altered by α-MMC treatment in the \u003cem\u003ePML\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice, indicating that α-MMC treatment did not ameliorate LPS-induced lung inflammation in these mice.\u003c/p\u003e \u003cp\u003eThese findings indicate that knocking out the PML protein blocks the inhibitory effects of α-MMC on TAB1 and TAK1/p-TAK1, the expression of proinflammatory cytokines, and the anti-inflammatory effect in vivo.\u003c/p\u003e\n\u003ch3\u003ePML isoform screening\u003c/h3\u003e\n\u003cp\u003ePML is known to have multiple isoforms, which are distributed variably in cells\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. The PML-2, PML-3, PML-4, PML-5, and PML-6 isoforms are localized in the nucleus because they contain nuclear localization signals (NLSs). However, PML-7b lacks nuclear NLSs and is localized in the cytoplasm (known as cPML). The cPML is known to mediate the pro-apoptotic transforming growth factor β (TGF-β) signalling pathway (SMAD2/3 pathway)\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. PML-1 possesses both NLSs and nuclear export signals and can shuttle between the nucleus and the cytoplasm\u003csup\u003e\u003cspan additionalcitationids=\"CR26\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. In this study, we used nucleocytoplasmic isolation experiments to identify the PML isoform responsible for inhibiting the expression of the TAB1/TAK1 proteins. The expression of PML increased in both the cytoplasm and nucleus with increasing concentrations of α-MMC whereas TGF-β increased the PML levels only in the cytoplasm (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b).\u003c/p\u003e \u003cp\u003eThe PML that coprecipitated with the LRP1 receptor protein and the TAB1/TAK1 protein in the reciprocal experiments described above was a single protein with a molecular weight of 110 kDa (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed-f), suggesting that it must be a nuclear PML, given that the molecular weight of cPML is approximately 70 kDa. The PML-1 protein is the only isoform capable of shuttling between the nucleus and the cytoplasm; therefore, α-MMC can increase PML levels in both the cytoplasm and the nucleus, indicating that α-MMC specifically targets the PML-1 isoform.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe protein expression levels of TAB1 and TAK1/p-TAK1 in the nucleus decreased with increasing α-MMC dose (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b). This decrease was inhibited when PML was knocked out, suggesting that PML primarily exerts its regulatory effect on TAB1 and TAK1 proteins in the cell nucleus.\u003c/p\u003e\n\u003ch3\u003ePML-1 isoform validation\u003c/h3\u003e\n\u003cp\u003eRecombinant human PML-1 protein (rhPML-1) was produced to confirm that the PML-1 isoform mediates the anti-inflammatory effects of α-MMC. The purified rhPML-1 protein exhibited two distinct bands: a major band with a molecular weight of 110 kDa and a minor band with a molecular weight of 48 kDa (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, b). Repeated experiments confirmed that hPML-1 overexpression involves two recombinant constructs, possibly because of the PML gene variants (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/gene/5371\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/gene/5371\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWe next used a PML gene knockout M1 macrophage model to observe the inhibitory effects of rhPML-1 on inflammatory signalling proteins and cytokines in cells. The expression levels of TAB1, TAK1, and p-TAK1 in the \u003cem\u003ePML\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e M1 macrophages decreased with increasing doses of rhPML-1, indicating a gradient inhibitory effect (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec, d). Since none of the PML isoforms were expressed in \u003cem\u003ePML\u003c/em\u003e knockout cells, the inhibitory effect demonstrates that the anti-inflammatory effect is mediated by the PML-1 isoform. rhPML-1 inhibited the expression of the inflammatory cytokines TNF-α, IL-1β, and IL-6 in both WT and \u003cem\u003ePML\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e M1 macrophages (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee), which also demonstrated a pronounced anti-inflammatory gradient effect. However, due to the current unavailability of high-quality samples, this experiment could only be conducted within the limited concentration range of 20\u0026ndash;35 \u0026micro;g/ml. Consequently, the inhibitory effect of hPML-1 on these cytokines was not particularly pronounced due to the excessively narrow dose gradient.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics of PML-1-LRP1 binding\u003c/h2\u003e \u003cp\u003eBioinformatics analysis was conducted to analyze the interaction between the LRP1 and PML-1 proteins. The three-dimensional spatial structures of the PML-1 protein and the light chain of the LRP1 protein (LRP1-85 kDa) were predicted using AlphaFold2 software (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea, b). A protein‒protein docking analysis of PML-1 and LRP1-85 kDa was conducted using HDOCK protein\u0026ndash;protein molecular docking software. On the basis of the docking energy values, the top 10 docking patterns were clustered and plotted (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec), and pose 1, which had the lowest energy, was selected for structural biology analysis of the binding mode (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed). There are 54 amino acid residues in the tail domain of the PML-1 protein that interact with 40 amino acid residues in the C-terminal region of LPR1-85 kDa. The tight association between the intracellular region of the LRP1 receptor and the tail domain of the PML-1 protein provides a basis for the activation of PML-1 via the phosphorylation of LRP1. This binding site is offset from the binding region of the target protein of PML-1, demonstrating the structural rationality of the functional region of the PML-1 protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eBioinformatics of PML-1-TAB1/TAK1 binding\u003c/h3\u003e\n\u003cp\u003eTable\u0026nbsp;1 is a TAK1-binding protein that promotes TAK1 self-phosphorylation; therefore, the two proteins tend to exist as complexes in cells. The above experiments revealed that the PML protein binds to these complexes (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed-f). Therefore, we performed molecular docking simulations of the TAB1 and TAK1 proteins, followed by simulations of the TAB1/TAK1 complexes and PML-1 proteins. The results revealed that the TAB1 protein was tightly bound to the TAK1 protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). The top 10 docking patterns in the TAK1/TAB1 complex and the PML-1 protein were clustered and plotted on the basis of the docking energy values (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). We selected pose 5, which has the largest binding surface, for protein\u0026ndash;protein interaction analysis to confirm the amino acid sites between the amino acid atoms of PML-1 and the TAB1 and TAK1 proteins. The results revealed that the TAB1/TAK1 complex formed a triple complex with the PML-1 protein and that both TAB1 and TAK1 could bind to PML-1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef). We observed RBCC domain functional domains at the PML-1 protein N-terminus, and the TAB1/TAK1 protein complex bound to the target protein-binding region of PML-1 after the coiled-coil domain. Therefore, the results shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef depict the structural features of the E3 ubiquitination ligase domain of the PML-1 protein as well as the mode by which PML-1 binds TAB1/TAK1.\u003c/p\u003e\n\u003ch3\u003ePML-1 ubiquitinates TAB1/TAK1 in cells\u003c/h3\u003e\n\u003cp\u003eTo demonstrate that the inhibitory effect of PML-1 on TAB1/TAK1 involves ubiquitination, we coexpressed the hPML-1 protein with the hTAB1 and hTAK1 proteins in HEK293T cells and assessed its ubiquitination activity. In the input group, we detected an hTAB1-overexpressing protein with a molecular weight of approximately 57 kDa and an hPML-1-double protein band measuring 110 and 48 kDa, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). In the IP (3Flag) group, strong hTAB1-3Flag and hPML-1-MYC bands were detected, indicating good interactions between the hTAB1 proteins and the hPML-1 protein. In the ubiquitination assay, strongly ubiquitinated bands were detected at approximately 72 kDa along with multiple ubiquitinated bands when hTAB1-3Flag was coexpressed with hPML1-MYC and HA-Ub. The intensities of the ubiquitinated bands were significantly reduced in the group without the proteasome inhibitor MG-132. These results suggest that hPML-1 overexpression enables hPML-1 to bind to and modify hTAB1 through ubiquitination in cells. However, no interaction or ubiquitination was detected between the rhPML-1-MYC and rhTAK1-3Flag proteins, indicating that PML-1 and TAK1 proteins cannot interact directly on their own.\u003c/p\u003e \u003cp\u003eWe then investigated the effect of PML-1 on TAB1/TAK1 ubiquitination using an M1-type inflammatory macrophage model with recombinant human PML-1 (rhPML-1). The results revealed that the 60-kDa TAB1 and 77-kDa TAK1 proteins were detected in the input and IP groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb, c). In the TAB1 IP enrichment solution, multiple ubiquitinated bands were detected, primarily concentrated between 55 and 130 kDa. Following treatment with MG-132, these bands appeared significantly darker. The same phenomenon was observed in the TAK1 IP enrichment solution. One possible explanation is that, in the inflammatory cell model, LPS induction causes activated TAB1 to bind to TAK1. Upon entering the cell, rhPML-1 then binds to the TAB1/TAK1 complex ubiquitinates it. Therefore, the three-protein complex can be enriched when TAB1 or TAK1 is pulled down. The multiple ubiquitinated bands between 55 and 130 kDa corresponded to the ubiquitinated bands of TAB1 and TAK1, as well as the self-ubiquitinated band of rhPML-1.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePML-1 ubiquitinates TAB1/TAK1 in vitro\u003c/h2\u003e \u003cp\u003eWe used the Abcam E3 Ligase Auto-Ubiquitination Assay Kit to test the ubiquitin E3 ligase activity of the rhPML-1 protein by assessing its ability to undergo autoubiquitination. The human double minute 2 (Hdm2) RING domain was provided as a positive control ubiquitin E3 ligase for use in autoubiquitinylation assays. Distinct self-ubiquitination bands of Hdm2 and rhPML-1 were observed at the E3 ubiquitin ligase site, and the molecular weight of the rhPML-1 self-ubiquitination band was approximately 110 kDa (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed). This experiment has yielded the most direct evidence for the activity of the PML-1 E3 ubiquitin ligase.\u003c/p\u003e \u003cp\u003eNext, we detected the ubiquitination by rhPML-1 on rhTAB1 and rhTAK1 under the aforementioned ubiquitination reaction conditions. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee and g, new, intensified ubiquitinated bands (approximately 72 kDa) were observed in the rhTAB1 reaction wells, in addition to the self-ubiquitinated band of rhPML-1, demonstrating the ubiquitinating activity of rhPML-1 on the protein rhTAB1 in vitro. However, no new, intensified ubiquitinated bands were observed in the rhTAK1 reaction wells.\u003c/p\u003e \u003cp\u003eThe TAB1 and TAK1 proteins often exist as complexes within cells under inflammatory stimulation; therefore, we mixed the rhTAB1 and rhTAK1 proteins in vitro to form the rhTAB1/rhTAK1 complex, which was then combined with rhPML-1 for the ubiquitination reaction to simulate the ubiquitination of the TAB1/TAK1 complex by PML-1 in vivo. Following an overnight incubation at 4\u0026deg;C, SDS‒PAGE analysis revealed an intensely stained complex band formed by the tight binding of rhTAB1 and rhTAK1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef). After the ubiquitination reaction with rhPML-1, a significantly darker band of rhTAB1/rhTAK1 complex ubiquitination was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg). These results demonstrated the direct ubiquitination of the TAB1/TAK1 complex by PML-1.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe PML protein is multifunctional and involved in numerous cellular processes\u003csup\u003e\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. PML also plays a key role in regulating cytokine signalling and is involved in inflammation and cytokine-induced apoptosis\u003csup\u003e\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Previous reports indicate that following LPS stimulation, IL-6 production is reduced in PML-knockout cells, whilst IL-1β production is severely impaired\u003csup\u003e\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. This is attributed to the involvement of the PML protein in activating NOD-like receptor family pyrin domain containing 3 (NLRP3). However, another publication reported opposing observations, describing enhanced IL-1β production in PML-deficient macrophages and likewise pointing to the NLRP3 inflammatory pathway as the mechanism\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Although both conflicting studies posit PML as a key regulator of the NLRP3 inflammasome, the precise role of PML in NLRP3 inflammasome assembly and activation, and which PML isoform is implicated, remains unclear\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. In this study, utilising the anti-inflammatory immunomodulator α-MMC previously validated in our laboratory\u003csup\u003e\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e, we demonstrated that PML can be activated by α-MMC in both PML-knockout macrophage and mouse models. The elevated activated PML protein inhibits the TAB1/TAK1 signalling proteins within the TLR inflammatory pathway, thereby suppressing the expression of inflammatory cytokines TNF-α, IL-1β, and IL-6. As NLRP3 is one of the gene products at the end of the TLR pathway and NLRP3 inflammasomes facilitate the processing and release of IL-1β and IL-18\u003csup\u003e9\u003c/sup\u003e, PML's regulatory action on TAB1/TAK1 would indirectly affect NLRP3 inflammasome activity.\u003c/p\u003e \u003cp\u003eThe controversy surrounding the inflammatory immune regulatory function of the PML protein was addressed in further experiments examining individual PML isoforms. Previous studies have shown that the multiple isoforms of PML are variably distributed in cells\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. In this study, we used TGF-β as a control and used nuclear‒cytoplasmic separation technology to identify PML-1 as the PML isoform involved in the anti-inflammatory activity of α-MMC. We then confirmed that PML-1 inhibited TAB1/TAK1 in the \u003cem\u003ePML\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e M1 macrophage model using recombinant PML-1 protein. The proinflammatory effects of the PML protein, as reported in the literature, can be attributed to other PML isoforms, primarily PML-4\u003csup\u003e4,7\u0026ndash;11\u003c/sup\u003e. This finding indicates that, owing to structural and distributional differences, different PML isoforms perform different functions, which may even be diametrically opposed. Overall, the discovery of specific anti-inflammatory effects mediated by the PML-1 protein has revealed a new functional role for the PML protein.\u003c/p\u003e \u003cp\u003eLRP1 initiates the anti-inflammatory pathway mediated by the PML-1 protein as it is the specific binding receptor for α-MMC. LRP1 is a member of the low-density lipoprotein receptor family and contains two heterodimeric peptide fragments: a 515 kDa heavy chain, which is the structural region that binds to ligands, and an 85 kDa light chain, which contains the transmembrane region and cytoplasmic tail domain\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. There are more than 40 ligands for LRP1, including apolipoprotein E (ApoE), amyloid precursor protein, amyloid-beta (Aβ), α2-macroglobulin, and α-MMC\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. The activation of LRP1 by these ligands enables intracellular signalling through the intracellular domain\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. LRP1 has been reported to be involved in anti-inflammatory effects, such as the suppression of inflammatory cytokine expression through the PI3K/AKT pathway\u003csup\u003e\u003cspan additionalcitationids=\"CR34 CR35\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. However, our phosphoproteomic analysis did not reveal the activation of the PI3K/AKT pathway by α-MMC. In this study, we used receptor blockade, immunoprecipitation and bioinformatics analyses to confirm the binding of the LRP1 receptor to the PML-1 protein, thereby elucidating an important element of the new PML-1 protein-mediated LRP1 receptor signalling pathway, i.e., LRP1-PML-1-TAB1/TAK1. This pathway is among the most precisely elucidated LRP1 receptor anti-inflammatory pathways to date\u003csup\u003e\u003cspan additionalcitationids=\"CR34 CR35\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. PML-1 mediates the inhibitory cytokine storm and anti-inflammatory effects of α-MMC and has become a target for anti-inflammatory immunotherapy. This pathway indicates that the PML-1 protein may serve as a target for anti-inflammatory immunotherapy, with LRP1 receptor agonists exerting anti-inflammatory effects by activating the PML-1 protein.\u003c/p\u003e \u003cp\u003eThe presence of ubiquitination ligase activity in the PML-1 protein is a major finding of this study. The PML protein possesses the typical RBCC structure of the TRIM family protein, which is associated with sentrin/small ubiquitin-like modifier (SUMO) chemical modifications \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. PML proteins exhibit SUMO E3 ligase activity because they can directly SUMOylate p53, murine double minute 2 (MDM2), and nuclear misfolding proteins using them as substrates\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. The RBCC/TRIM motif has also been shown to be associated with ubiquitination, and TRIM family members represent a novel class of monocyclic finger E3-type ubiquitin ligases\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e,\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. Some TRIM proteins exhibit both E3 SUMOylation and E3 ubiquitylation enzymatic activity. For example, TRIM27 can SUMOylate proteins such as those in urothelial bladder cancer (UBC), p53, and MDM2 and promote the ubiquitination of the p53 protein, thus resulting in dual E3 enzymatic activity\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e,\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. However, whether PML has E3 ubiquitin-mediated enzymatic activity similar to that of TRIM27 remains unknown. While it has been proposed that PML proteins with the RBCC structure may possess E3 ubiquitination ligase activity\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e, no studies have investigated this possibility, probably because a specific substrate target protein has not been identified. In this study, we successfully identified a pair of substrate target proteins for PML-1\u0026mdash;the TAB1 and TAK1 complex\u0026mdash;through intracellular overexpression-based ubiquitination experiments and in vitro recombinant protein ubiquitination assays. Therefore, established the E3 ubiquitin ligase activity of the PML protein. In the intracellular co-expression-based ubiquitination assays, we observed that hTAB1 undergoes ubiquitination upon interacting with hPML-1, however, no such interaction was observed with hTAK1. Similarly, \u003cem\u003ein vitro\u003c/em\u003e protein ubiquitination assays revealed that only hPML-1 mediates the ubiquitination of hTAB1 and that no ubiquitination occurs for hTAK1. These results imply that the PML-1 protein may not bind directly to TAK1. Since the TAB1 and TAK1 proteins exist as a complex within cells, PML-1 must interact with this complex to achieve TAK1 ubiquitination. Consequently, the optimal results for ubiquitination were obtained using a recombinant hTAB1/hTAK1 complex.\u003c/p\u003e \u003cp\u003eThe discovery of the PML protein E3 ubiquitin ligase represents a major breakthrough in understanding the function of the PML protein. Ubiquitination is a key post-translational modification in eukaryotic cells and plays a crucial role in regulating processes such as protein degradation, cellular signalling, the cell cycle, DNA damage repair, immune responses and inflammatory responses\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. The PML protein is indeed involved in these cellular processes\u003csup\u003e\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e, so elucidating the function of the PML ubiquitin ligase would greatly advance our understanding of these mechanisms. PML's ability to target proteins for degradation via ubiquitination may be a key mechanism underlying its diverse cellular functions. Therefore, in addition to the target proteins TAB1/TAK1, further substrate proteins of the PML protein ubiquitin ligase, as well as novel functions, will be identified in the future.\u003c/p\u003e \u003cp\u003eIn recent years, ubiquitinating enzyme proteins have been employed in biological therapeutic strategies targeting protein degradation\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e,\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. The discovery of novel E3 ubiquitin ligases for the PML protein could pave the way for the use of proteolysis-targeting chimeras (PROTACs) and molecular glue technology in anti-tumour therapy. In this study, the discovery that PML-1 targets and degrades TAB1/TAK1 via ubiquitination provides a novel strategy for developing anti-inflammatory immunotherapies. A direct application involves the utilisation of recombinant human PML-1 protein to treat severe infectious diseases characterised by cytokine storms, such as novel coronavirus pneumonia (COVID-19), influenza, AIDS, bacteremia and sepsis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003eAll authors reviewed and approved the manuscript. The authors declare no competing financial interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary information\u003c/strong\u003e is available for this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorrespondence and requests for materials\u0026nbsp;\u003c/strong\u003eshould be addressed to Fubing Shen ([email protected]).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary Information\u0026nbsp;\u003c/strong\u003eis available for this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReprints and permissions information\u003c/strong\u003e is available at www.nature.com/reprints.\u003c/p\u003e\u003cp\u003eAll animal experiments were conducted in accordance with the ARRIVE 2.0 guidelines and were authorised and supervised by the Servicebio Ethics Committee (2022153) (Wuhan, China).\u003c/p\u003e\u003ch2\u003eAuthor contributions\u003c/h2\u003e \u003cp\u003eShen, F. Cheng, J. and Li, C. conceptualized the project, designed and implemented experiments, analysed data, provided funding and constructed the manuscript. Peng, K. Liu, Y. and Meng, Y. provided funding and constructed the manuscript. Xu, J. designed and offered critical advice for manuscript construction. Pan, C. Meng, H. and Zhou Y. conceived the study, designed and performed experiments and bioinformatic analyses, interpreted data and wrote the manuscript. Luo, T. Huang, Y. and He, L. designed and implemented experiments, and analysed data and helped construct the manuscript. Yi, M. Dai, Y. Zhou, Y. Ruan, S. Xia, Y. Qin, K. and Yang Y. conceived and supervised the study, interpreted data and wrote the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eWe thank Shanghai Applied Protein Technology Co. (APTBIO) for the phosphoproteomics and data analysis services and Cyagen Biosciences, Inc., for their assistance in the construction of the PML protein knockout cell line and knockout mouse model. We thank Peking Yanyuan Intelligent Brain Biotechnology Co., Ltd., and the Beijing Computing Centre for their assistance in the structural biology part of PML protein modelling and molecular docking. We thank Wuhan Corebiolab Co., Ltd., for providing the research platform. We would also like to thank Nianhua Deng for her early contributions to this work and the editorial teams of American Journal Experts and Enago for their editorial services.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eThe mass spectrometry proteomic data have been deposited to the ProteomeXchange Consortium (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://proteomecentral.proteomexchange.org\u003c/span\u003e\u003cspan address=\"https://proteomecentral.proteomexchange.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) via the iProX partner repository with the dataset identifier PXD058890. Source data are provided with this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReporting summary\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFurther information on the research design is available in the Nature Port-folio Reporting Summary linked to this article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHsu KS, Kao HY (2018) PML: Regulation and multifaceted function beyond tumor suppression. Cell Biosci 8:5\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin HK, Bergmann S, Pandolfi PP (2004) Cytoplasmic PML function in TGF-beta signalling. \u003cem\u003eNature\u003c/em\u003e 431, 205\u0026thinsp;\u0026ndash;\u0026thinsp;11\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRyabchenko B et al (2023) The interactions between PML nuclear bodies and small and medium size DNA viruses. Virol J 20:82\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaarifi G, Chelbi-Alix MK, Nisole S (2014) PML control of cytokine signaling. \u003cem\u003eCytokine Growth Factor Rev.\u003c/em\u003e 25, 551\u0026thinsp;\u0026ndash;\u0026thinsp;61\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScherer M, Stamminger T (2016) Emerging Role of PML Nuclear Bodies in Innate Immune Signaling. J Virol 90:5850\u0026ndash;5854\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLunardi A et al (2011) A Role for PML in Innate Immunity. Genes Cancer 2:10\u0026ndash;19\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOhgiya D et al (2012) Association of promyelocytic leukemia protein with expression of IL-6 and resistance to treatment in multiple myeloma. Acta Haematol 128:213\u0026ndash;222\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLo YH et al (2013) Selective inhibition of the NLRP3 inflammasome by targeting to promyelocytic leukemia protein in mouse and human. Blood 121:3185\u0026ndash;3194\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJo EK, Kim JK, Shin DM, Sasakawa C (2016) Molecular mechanisms regulating NLRP3 inflammasome activation. Cell Mol Immunol 13:148\u0026ndash;159\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhmed A et al (2017) Regulation of NF-κB by PML and PML-RARα. Sci Rep 20:44539\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDowling JK et al (2014) Promyelocytic Leukemia Protein Interacts with the Apoptosis-associated Speck-like Protein to Limit Inflammasome Activation. J Biol Chem 289:6429\u0026ndash;6437\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUgg\u0026egrave; M, Simoni M, Fracassi C, Bernardi R (2022) PML isoforms: a molecular basis for PML pleiotropic functions. Trends Biochem Sci 47:609\u0026ndash;619\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilonov SA, Smirnov EY, Kuznetsova IM, Turoverov KK, Fonin A (2023) V. PML Body Biogenesis: A Delicate Balance of Interactions. Int J Mol Sci 24:16702\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia Y, Zhao J, Yang C (2020) Identification of key genes and pathways for melanoma in the TRIM family. Cancer Med 9:8989\u0026ndash;9005\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeroni G, Diez-Roux G (2005) TRIM/RBCC, a novel class of 'single protein RING finger' E3 ubiquitin ligases. BioEssays 27:1147\u0026ndash;1157\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIkeda K, Inoue S (2012) TRIM proteins as RING finger E3 ubiquitin ligases. Adv Exp Med Biol 770:27\u0026ndash;37\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng N, Shabek N (2017) Ubiquitin Ligases: Structure, Function, and Regulation. Annu Rev Biochem 86:129\u0026ndash;157\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHershko A, Ciechanover A (1998) The ubiquitin system. \u003cem\u003eAnnu Rev Biochem.\u003c/em\u003e 67, 425\u0026thinsp;\u0026ndash;\u0026thinsp;79\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng K et al (2022) Alpha-Momorcharin Inhibits Proinflammatory Cytokine Expression by M1 Macrophages but Not Anti-Inflammatory Cytokine Expression by M2 Macrophages. J Inflamm Res 15:4853\u0026ndash;4872\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng N et al (2019) LRP1 receptor-mediated immunosuppression of α-MMC on monocytes. Int Immunopharmacol 70:80\u0026ndash;87\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng N et al (2019) Alpha-momorcharin regulates cytokine expression and induces apoptosis in monocytes. Immunopharmacol Immunotoxicol 41:258\u0026ndash;266\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun X et al (2020) Cytokine storm intervention in the early stages of COVID-19 pneumonia. Cytokine Growth Factor Rev 53:38\u0026ndash;42\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGu Y et al (2019) Role of the Innate Cytokine Storm Induced by the Influenza A Virus. Viral Immunol 32:244\u0026ndash;251\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo XJ, Thomas PG (2017) New fronts emerge in the influenza cytokine storm. Semin Immunopathol 39:541\u0026ndash;550\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNisole S, Maroui MA, Mascle XH, Aubry M, Chelbi-Alix MK (2013) Differential Roles of PML Isoforms. Front Oncol 3:125\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin G, Gao Y, Lin HK (2014) Cytoplasmic PML: from molecular regulation to biological functions. J Cell Biochem 115:812\u0026ndash;818\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbou-Ghali M, Lallemand-Breitenbach VPML (2024) Nuclear bodies: the cancer connection and beyond. Nucleu 15:2321265\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVogiatzoglou AP, Moretto F, Makkou M, Papamatheakis J, Kretsovali A (2022) Promyelocytic leukemia protein (PML) and stem cells: from cancer to pluripotency. Int J Dev Biol 66:85\u0026ndash;95\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-Asmi F, Chelbi-Alix MK (2020) Les isoformes de PML et la r\u0026eacute;ponse au TGF-β [PML isoforms and TGF-β response]. Med Sci (Paris) 36:50\u0026ndash;56 French\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen J, Su Y, Pi S, Hu B, Mao L (2021) The Dual Role of Low-Density Lipoprotein Receptor-Related Protein 1 in Atherosclerosis. Front Cardiovasc Med 8:682389\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDekky B et al (2016) Cellular Cholesterol Distribution Influences Proteolytic Release of the LRP-1 Ectodomain. Front Pharmacol 7:25\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoucher P, Herz J (2011) Signaling through LRP1: Protection from atherosclerosis and beyond. Biochem Pharmacol 81:1\u0026ndash;5\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo L et al (2018) TLR Crosstalk Activates LRP1 to Recruit Rab8a and PI3Kγ for Suppression of Inflammatory Responses. Cell Rep 24:3033\u0026ndash;3044\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang L et al (2016) LRP1 modulates the microglial immune response via regulation of JNK and NF-κB signaling pathways. J Neuroinflammation 13:304\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXian X et al (2017) LRP1 integrates murine macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis. Elife 16:e29292\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZurhove K, Nakajima C, Herz J, Bock HH, May P (2008) Gamma-secretase limits the inflammatory response through the processing of LRP1. Sci Signal 1:ra15\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarroso-Gomila O et al (2021) Identification of proximal SUMO-dependent interactors using SUMO-ID. Nat Commun 12:6671\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei X et al (2003) Physical and functional interactions between PML and MDM2. J Biol Chem 278:29288\u0026ndash;29297\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo L et al (2014) A cellular system that degrades misfolded proteins and protects against neurodegeneration. Mol Cell 55:15\u0026ndash;30\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVenuto S, Merla G (2019) E3 Ubiquitin Ligase TRIM Proteins, Cell Cycle and Mitosis. Cells 8:510\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHatakeyama STRIM, Family Proteins (2017) Roles in Autophagy, Immunity, and Carcinogenesis. Trends Biochem Sci 42:297\u0026ndash;311\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChu Y, Yang X (2011) SUMO E3 ligase activity of TRIM proteins. Oncogene 30:1108\u0026ndash;1116\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang T et al (2023) SUMOylation of TUFT1 is essential for gastric cancer progression through AKT/mTOR signaling pathway activation. Cancer Sci 114:533\u0026ndash;545\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodr\u0026iacute;guez-Gimeno A, Galdeano C (2025) Drug Discovery Approaches to Target E3 Ligases. ChemBioChem 26:e202400656\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYim J, Kim S, Lee HH, Chung JS, Park J (2024) Fragment-based approaches to discover ligands for tumor-specific E3 ligases. Expert Opin Drug Discov 19:1471\u0026ndash;1484\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003ePreparation of \u0026alpha;-MMC\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe \u0026alpha;-MMC protein was prepared as described by Meng, Y. et al.\u003csup\u003e46\u003c/sup\u003e, and sample verification was performed as reported by Peng, K. et al.\u0026nbsp;(2022)\u003csup\u003e\u0026nbsp;\u003c/sup\u003e\u003csup\u003e19\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe THP-1 human monocyte cell line was purchased from Procell (Wuhan, China), and the HEK293T cell line was purchased from the Chinese Academy of Sciences. The cells were subjected to mycoplasma testing and STR typing. To generate M1 macrophages, PMA (30 ng/ml) and 20 ng/ml LPS were added to THP-1 human monocyte cells, which were subsequently cultured for 48 h.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrimary antibodies\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAnti-PML (Abcam, ab179466), 1:1,000; anti-PML (Merck, SAB5700065), 1:1,000; anti-p-PML (Abcam, ab128932), 1:1,000; anti-TRAF6 (Abcam, ab137452), 1:1,000; anti-TAB1 (Abcam, Ab76412), 1:1,000; anti-TAB1 (Immunoway, YM1302), 1:1,000; anti-TAK1 (Immunoway, YT4535), 1:1,000; anti-p-TAK1 (Immunoway, YP0424), 1:600; anti-JNK (Immunoway, YT2440), 1:1,000; anti-p-JNK (Immunoway, YP0156), 1:600; anti-AP1 (Immunoway, YT0248), 1:1,000; anti-p-AP1 (Immunoway, YP0018), 1:1,000; anti-NF-kB p65 (Abcam, ab32536), 1:2,000; anti-p-p65 (Abcam, ab76302), 1:1,000; anti-LaminB1 (Proteintech, 66095-1-Ig), 1:10,000; anti-actin (Proteintech, 66009-1-Ig), 1:5,000; anti- LRP1(Abcam, ab92544), 1:1,000; anti-FLAG tag (Proteintech, 80010-1-RR), 1:1,000; anti-MYC tag (Proteintech, 16286-1-ap), 1:800；anti-HA tag antibody (Proteintech, 7c9, 1: 1,000).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhosphoproteomic assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cells were divided into four groups: the M0 macrophage group, the LPS-stimulated macrophage (M1 0 h) group, the \u0026alpha;-MMC-treated (0.25 h) LPS-induced macrophage (M1 0.25 h) group and the \u0026alpha;-MMC-treated (4 h) LPS-induced macrophage (M1 4 h) group. \u0026alpha;-MMC was administered at a dose of 0.5 \u0026mu;g/ml, and 3 wells were included in each group. At the end of the experiment, the cells were washed 3 times with PBS, scraped up with a spatula, collected, frozen in liquid nitrogen, and stored at -80\u0026deg;C. TMT labelling and LC‒MS/MS analysis were performed by a professional team from Shanghai Applied Protein Technology Co., Ltd. (APTBIO). Quantitative information about the target proteins was obtained, and the Complexheatmap package in R (R version 3.4) was subsequently used to classify the differentially expressed proteins in the groups and generate a hierarchical clustering heatmap. KEGG Automatic Annotation Server (KAAS) software and Fisher\u0026apos;s exact method were used to compare the ranges of enriched KEGG pathways for the target proteins and overall proteins and to perform a KEGG pathway analysis of the target protein set\u003csup\u003e47-49\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunoblotting analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell lysates from each experimental group were collected at each time point (in RIPA lysis buffer), and protein concentrations were determined using the BCA method. An appropriate volume of 5 \u0026times; SDS loading buffer was added according to the volume of the solution, and the mixture was boiled at 100\u0026deg;C for 5 minutes. Protein samples (20 \u0026micro;g) were separated using 10% SDS polyacrylamide gels and 5% SDS gels. The samples were electrophoretically transferred onto PVDF membranes and blocked with 5% milk/TBST. After being washed, the membranes were incubated with primary antibody diluted as recommended with 1% BSA/TBST and placed in a hybridization bag. The samples were stored overnight in a refrigerator at 4\u0026deg;C. The samples were subsequently incubated with horseradish peroxidase-labelled goat anti-rabbit secondary antibody (1:5,000, Proteintech, SA00001-2) or horseradish peroxidase-labelled goat anti-mouse secondary antibody (1: 5,000, Proteintech, SA00001-1) for 1 hour and developed using the ECL chemiluminescence method. The bands were visualized via a chemiluminescence gel imager (ChemiDoc\u0026trade; XRS\u003csup\u003e+\u003c/sup\u003e, Bio-Rad, USA). ImageJ 1.8.0 software was used to measure the\u0026nbsp;grey\u0026nbsp;value of each band.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ePML\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;THP-1 cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe coding DNA sequence region of\u0026nbsp;the PML protein was downloaded from the NCBI database (https://www.ncbi.nlm.nih.gov/gene/5371),\u0026nbsp;and\u0026nbsp;gRNAs targeting the \u003cem\u003eE2\u003c/em\u003e region of\u0026nbsp;the\u0026nbsp;\u003cem\u003ePML\u0026nbsp;\u003c/em\u003egene were\u0026nbsp;designed. The sequences used were as follows:\u0026nbsp;\u003cem\u003egRNA-A1\u003c/em\u003e: \u003cem\u003eCCCCCAGCGAGCCCG CTT\u003c/em\u003e-\u003cem\u003eCGG\u003c/em\u003e;\u0026nbsp;\u003cem\u003egRNA-B1\u003c/em\u003e: \u003cem\u003eCCC\u003c/em\u003e-\u003cem\u003eCCGCTTCGGAGGAGGAGGAGTTC\u003c/em\u003e;\u0026nbsp;and \u003cem\u003egRNA-C1\u003c/em\u003e: \u003cem\u003eCCC\u003c/em\u003e-\u003cem\u003eCGCTTCGGAGGAGGAGGAGGAGTTCC\u003c/em\u003e. The Cas9 protein was incubated with a \u003cem\u003egRNA\u003c/em\u003e, andTHP-1 cells were subsequently transfected\u0026nbsp;via\u0026nbsp;the RNP method.\u0026nbsp;DNA was extracted to determine the cutting efficiency, and the \u003cem\u003egRNA\u003c/em\u003e with the best cutting efficiency was selected\u0026nbsp;for\u0026nbsp;the next step of the experiment\u003csup\u003e50,51\u003c/sup\u003e.\u0026nbsp;The cells were counted and cultured after 24\u0026nbsp;h\u0026nbsp;of transfection.\u0026nbsp;One hundred microlitres\u0026nbsp;of medium was added to each well of a 96-well plate so that each well contained only one cell, and the cells were cultured for approximately one week.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSpecific pathogen-free (SPF) C57BL/6J mice (6‒8 W) were obtained from Charles River (Beijing, China). All animal experiments were reported in accordance with the ARRIVE 2.0 guidelines and were approved by the Ethics Committee of Servicepio (2022153) (Wuhan, China). The animals were housed in animal chambers at a temperature of 22\u0026ndash;25\u0026deg;C and a relative humidity of 50\u0026ndash;70% on a 12-hour light/dark cycle.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ePML\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u0026nbsp;\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003emice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe sequence of the CDS region of the PML protein was downloaded from the NCBI database (https://www.ncbi.nlm.nih.gov/gene/18854), and gRNAs targeting the\u003cem\u003e\u0026nbsp;E2\u003c/em\u003e region of the\u003cem\u003e\u0026nbsp;PML\u003c/em\u003e gene were designed. The sequences were as follows: \u003cem\u003egRNA-A1\u003c/em\u003e:\u003cem\u003e\u0026nbsp;GTTCATGCGTTCATGTGCTA AGG\u003c/em\u003e;\u003cem\u003e\u0026nbsp;gRNA-A2\u003c/em\u003e:\u003cem\u003e\u0026nbsp;ATAGTGGACATTTCCTTCGGAGG\u003c/em\u003e;\u003cem\u003e\u0026nbsp;gRNA-B1\u003c/em\u003e:\u003cem\u003e\u0026nbsp;TCCAGGTTGTTGAATGT ATCAGG\u003c/em\u003e;\u003cem\u003e\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cem\u003egRNA-B2\u003c/em\u003e:\u003cem\u003e\u0026nbsp;GCAGGTCGGGGTAACCTTATCAGG\u003c/em\u003e. \u003cem\u003eCas9\u003c/em\u003e and \u003cem\u003egRNA\u003c/em\u003e were\u0026nbsp;coinjected\u0026nbsp;into\u0026nbsp;fertilized\u0026nbsp;eggs to generate KO mice. F0-positive mice were bred 1 male to 2 females WT or 1 male WT to 2 females, and newborn mice were genotyped\u0026nbsp;via\u0026nbsp;PCR\u003csup\u003e52, 53\u003c/sup\u003e. The length of the PCR product amplified by primer 1 was 541 bp (upstream primer: 5\u0026apos;-\u003cem\u003eACAAATAAGGTCACATTGCCCTAAC\u003c/em\u003e-3\u0026apos;, downstream primer: 5\u0026apos;-\u003cem\u003eAGCGGTTTGGTTCCCATT GATTC\u003c/em\u003e-3\u0026apos;);\u0026nbsp;the length of the PCR product amplified by primer 2 was 849 bp (upstream primer: 5\u0026apos;-\u003cem\u003eACAAATAAGGTCACATTGCCCTAAC\u003c/em\u003e-3\u0026apos;, downstream primer: 5\u0026apos;-\u003cem\u003eGTTCCTCATTTACTTC GTTCCTCATTTACTTCGAGCCTTG\u003c/em\u003e-3\u0026apos;).\u0026nbsp;For breeding, F1-positive mice were bred\u0026nbsp;from\u0026nbsp;1 male to 2 females, and 1 male was subjected to\u0026nbsp;in\u0026nbsp;vitro\u003cem\u003e\u0026nbsp;\u003c/em\u003efertilization (IVF) to\u0026nbsp;obtain 15 female heterozygotes.\u0026nbsp;Twenty\u0026nbsp;pure heterozygotes were obtained by crossing male heterozygotes obtained\u0026nbsp;via\u0026nbsp;natural mating with female heterozygotes obtained\u0026nbsp;via\u0026nbsp;IVF\u0026nbsp;and\u0026nbsp;then used for sequencing and analysis. The 20 pure heterozygous mice were bred\u0026nbsp;for\u0026nbsp;a predetermined number of weeks.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInduction of ALI in mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animals were randomly divided into six groups (\u003cem\u003en\u0026nbsp;\u003c/em\u003e= 6): (1) the normal saline (NS)-treated WT mouse group; (2) the LPS (8.0 mg/kg)-treated WT mouse group; (3) the LPS (8.0 mg/kg) + \u0026alpha;-MMC (1.5 mg/kg)-treated WT mouse group; (4) the NS-treated\u0026nbsp;\u003cem\u003ePML\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/em\u003e mouse\u0026nbsp;group;\u0026nbsp;(5) the LPS (8.0 mg/kg)-treated model \u003cem\u003ePML\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/em\u003e mouse\u0026nbsp;group; and (6) the LPS (8.0 mg/kg) + \u0026alpha;-MMC (1.5 mg/kg)-treated \u003cem\u003ePML\u003csup\u003e\u0026minus;/\u0026minus;\u0026nbsp;\u003c/sup\u003e\u003c/em\u003emouse\u0026nbsp;group.\u0026nbsp;The mice\u0026nbsp;were weighed\u0026nbsp;and anaesthetized\u0026nbsp;with 1% sodium pentobarbital (50 mg/kg),\u0026nbsp;and 50 \u0026micro;l of dissolved LPS (or NS for normal control mice) was injected into the trachea\u0026nbsp;via\u0026nbsp;a microinjector. The mice were shaken from side to side to ensure\u0026nbsp;the\u0026nbsp;even distribution of the drug in the lungs. When the mice were able to breathe normally, they were returned to their cages for recovery.\u0026nbsp;The mice\u0026nbsp;in the intraperitoneal group were injected with \u0026alpha;-MMC 1\u0026nbsp;h\u0026nbsp;after LPS injection,\u0026nbsp;whereas the\u0026nbsp;mice in the model and normal control groups were injected intraperitoneally with the same amount of saline. Twenty-hours\u0026nbsp;after the first administration of LPS,\u0026nbsp;the\u0026nbsp;mice in each group received a second dose of LPS and \u0026alpha;-MMC in the same way. After 24 h,\u0026nbsp;the\u0026nbsp;mice in each group were\u0026nbsp;anaesthetized\u0026nbsp;with pentobarbital sodium, blood samples were taken,\u0026nbsp;and the animals were sacrificed by cervical dislocation. The left lung was fixed in paraformaldehyde and prepared for paraffin embedding. The right lung was frozen in liquid nitrogen and stored at -80\u0026deg;C for ELISA and Western blot analyses.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eELISAs\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFrozen lung tissue was thawed, weighed and homogenized by adding 9 volumes of RIPA lysis buffer supplemented with protein inhibitor cocktail III (Merck Millipore, USA) at a ratio of 1:9 (mg): volume (\u0026micro;l). The lysis buffer was centrifuged at 4\u0026deg;C and 4000 rpm for 10 min, and the supernatant was transferred to a clean centrifuge tube. Twenty microlitres of each supernatant was then collected and diluted, and the protein concentration was measured via the BCA method. TNF-\u0026alpha;, IL-1\u0026beta; and IL-6 levels were measured via a mouse ELISA kit (ImmunoWay Biotech, USA) according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistopathological evaluation of ALI\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLeft lung tissue was used for microscopic examination of pathological lesions. The tissue was fixed in 4% buffered formalin for 24 h, dried, embedded in paraffin, cut into slices, stained with haematoxylin and eosin, and analysed via a Nikon Eclipse Ci microscope (Nikon Electronic Company, Osaka, Japan). Five sections of 300 alveoli were selected from each slide (10 \u0026times; magnification), and an investigator who was blinded to the treatment groups assessed the extent of lung injury. Images were captured and processed via Caseviewer 2.4 software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIP\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM1 macrophages were treated, and the cells were harvested.\u0026nbsp;Afterwards, 500 \u0026micro;l of IP cell lysate (containing the protease inhibitor PMSF) was added, and the mixture was lysed for 30 min on ice and centrifuged at 12,000 rpm for 5 min at 4\u0026deg;C. The supernatant was then collected, 100 \u0026micro;l of protein A + G agarose (P2078-1; Beyotime Biotechnology) beads was added, and the mixture was spun for 1 h at 4\u0026deg;C to block nonspecific binding. Fifty microlitres of the lysed supernatant was reserved for the input, and the remaining samples were set aside. Afterwards, the magnetic beads coupled to each antibody were separately added to lysates from each group and rotated at 4\u0026deg;C overnight to allow the protein to bind the antibodies. The samples from each group were then centrifuged at 1,000 \u0026times; g\u0026nbsp;for 5 minutes at 4\u0026deg;C, the supernatants were discarded, the samples\u0026nbsp;were subsequently\u0026nbsp;washed four times with PBS, and the supernatants were\u0026nbsp;subsequently\u0026nbsp;discarded. Finally, Western\u0026nbsp;blotting\u0026nbsp;was used to measure\u0026nbsp;the\u0026nbsp;protein levels in the\u0026nbsp;immunoprecipitates.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNucleocytoplasmic analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCultured WT M1 macrophages and \u003cem\u003ePML\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e M1 macrophages were treated with \u0026alpha;-MMC (0, 0.1, 0.5, or 1.5 \u0026mu;g/ml) and TGF-\u0026beta; (0, 50, 150, or 450 ng/ml) for 8 h. The NE-PER Nuclear and Cytoplasmic Kit (Thermo, 78833) was then used to isolate the cytoplasmic and nuclear fractions of harvested cells from each group, and the levels of PML, TAB1, TAK1 and p-TAK1 were measured in the cytoplasmic and nuclear fractions by immunoblotting\u003csup\u003e54, 55\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRecombinant hPML-1 protein\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe amino acid sequence of the hPML-1 protein was optimized using MaxCodon\u003csup\u003eTM\u003c/sup\u003e Optimization Program (V13) codon optimization software (Nanjing DetaiBio, China). Afterwards, the hPML-1 plasmid was obtained by whole gene synthesis, and the hPML-1 gene was inserted into the pcDNA3.4 expression vector using double digestion. The hPML-1 plasmid was transformed into DH5\u0026alpha; receptor cells using conventional methods, after which the plasmid was amplified and purified. Afterwards, the hPML-1 plasmid\u0026ndash;transfection reagent mixture was added to in vitro-cultured HEK293 cells (1\u0026ndash;1.5\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells/ml) and incubated at 110 rpm, 37\u0026deg;C, and 5% CO\u003csub\u003e2\u003c/sub\u003e. Afterwards, cells obtained by centrifugation of cell cultures after 5 days of transfection culture were collected and lysed in 50 mM Tris, 300 mM NaCl, 8 M urea, 20 mM imidazole, and pH 8.0 buffer and purified by affinity chromatography on a Ni-IDA (Ni-IDA 1000, Gene) column. The purified proteins were collected and complexed with buffer [1 \u0026times; PBS (pH 7.4), 4 mM GSH, 0.4 mM GSSG, 0.4 M L-arginine].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003erhPML-1 acts on\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ePML\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u0026nbsp;\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003eM1 macrophages\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePML\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/em\u003e\u003csup\u003e\u0026nbsp;\u003c/sup\u003eM1 macrophages (1\u0026times;10⁶ cells) cultured in vitro were treated with 0 \u0026mu;g/ml, 20 \u0026mu;g/ml, 25 \u0026mu;g/ml, 30 \u0026mu;g/ml or 35 \u0026mu;g/ml recombinant hPML-1 protein for 8 h. Total protein was extracted from the harvested cells in each group. TAB1, TAK1, and p-TAK1 expression levels in protein samples were determined by immunoblotting analysis, and the levels of the inflammatory cytokines TNF-\u0026alpha;, IL-1\u0026beta;, and IL-6 were determined using ELISAs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eUbiquitination assay with coexpression\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe open reading frame (ORF) of human \u003cem\u003ePML-1\u003c/em\u003e (NM_033238.3) was cloned with a \u003cem\u003eMYC\u003c/em\u003e tag, and the ORFs of human \u003cem\u003eTAB1\u003c/em\u003e (NM_006116.3) and \u003cem\u003eTAK1\u003c/em\u003e (NM_079356.3) were cloned with a \u003cem\u003e3Flag\u003c/em\u003e tag. The sequences of the primers used for plasmid construction are listed in Supplementary Table 1. PCR amplification was performed using high-fidelity kodakaraensis (KOD) DNA polymerase (Toyobo) in a 30 \u0026mu;L reaction consisting of 1 \u0026mu;L of cDNA template, 0.5 \u0026mu;M each primer, 2.5 \u0026mu;L of dNTP mixture, 3 \u0026mu;L of 10 \u0026times; KOD buffer and 22.5 \u0026mu;L of sterile ddH\u003csub\u003e2\u003c/sub\u003eO. Afterwards, the amplified PCR products were inserted into the pcDNA3.1 (+)\u003csup\u003e\u0026nbsp;\u003c/sup\u003eexpression vector (V79020; Invitrogen) at the NheI and BamHI restriction sites. The sequences of all the recombinant plasmids were confirmed via Sanger sequencing to ensure the accuracy of the cloning\u003csup\u003e56-57\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eHEK293T cells were seeded in 6-well cell culture plates at a density of 4 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells per well, and 2.5 \u0026mu;g of the corresponding recombinant plasmid was diluted in 250 \u0026mu;l of Opti-MEM (Gibco) and gently mixed. The plasmid was then mixed with Lipofectamine 2000 and incubated for an additional 20 minutes at room temperature. The DNA-Lipofectamine complexes were then added to the appropriate wells, and the medium was replaced with fresh medium. Afterwards, the cells were washed twice with ice-cold PBS and lysed in RIPA buffer containing protease inhibitors (Beyotime, P1046), and the lysates were incubated on ice for 30 minutes and then centrifuged at 12,000 rpm for 15 minutes at 4\u0026deg;C. An immunoprecipitation experiment was subsequently performed. Finally, the eluted proteins were analysed by Western blotting using an anti-MYC tag antibody (Proteintech, 16286-1-AP, 1:800), an anti-FLAG tag antibody (Proteintech, 80010-1-RR, 1:1000) and an anti-HA tag antibody (Proteintech, 7c9, 1:1.000).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eUbiquitination of TAB1/TAK1 in cells\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCultured M1 macrophages (1\u0026times;10\u003csup\u003e7\u003c/sup\u003e cells) were treated with recombinant hPML-1 protein (30 \u0026mu;g/ml) for 8 h, and 40 \u0026mu;M MG-132 (HY-13259; MCE, Inc.) was added 4 h prior to cell harvesting. Afterwards, cell lysates were prepared, and TAB1 and TAK1 proteins were enriched in the cell lysates using the IP method. Ubiquitination of TAB1 and TAK1 was detected using WB.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAutoubiquitination assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe experimental groups were as follows: (1) rhPML-1 self-ubiquitination; (2) negative control (rhPML-1 without Mg-ATP); (3) Hdm2 self-ubiquitination control; and (4) negative control (Hdm2 without Mg-ATP). First, the assay components were added to a 0.5 ml Eppendorf tube in the order indicated in the protocol provided with the E3 Ligase Auto-Ubiquitylation Assay\u0026nbsp;Kit (ab139469; Abcam, USA). Next, the\u0026nbsp;contents of the tube were mixed gently and then incubated at 37\u0026deg;C for 1 hour. Quench assays were performed by adding 50 \u0026mu;l of 2 \u0026times; SDS‒PAGE gel loading buffer followed by heating to 95\u0026deg;C for 5 minutes. Finally, the samples were analysed using Western blot.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eUbiquitination of rhTAB1/hTAK1 in vitro\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRecombinant human PML-1 protein (0.2 mg/mL), recombinant human TAB1 protein (NM_006116; Origene, USA) and recombinant human TAK1 protein (NM_003188; Origene, USA) were prepared. The ubiquitinylation assay was performed according to the E3 ligase autoubiquitination detection kit protocol (ab139469; Abcam, USA). Experiment 1 included six groups: negative control (rhPML-1 and Mg-ATP absent), rhPML-1 autoubiquitination, rhTAB1 (with rhPML-1 absent), rhTAB1 and rhPML-1 proteins, rhTAK1 (with rhPML-1 absent), and rhTAK1 and rhPML-1 proteins. Experiment 2 included five groups: negative control (rhPML-1 and Mg-ATP absent); rhPML-1 autoubiquitination; rhTAB1 and rhPML-1 proteins; rhTAK1 and rhPML-1 proteins; and the rhTAB1/rhTAK1 complex (0.2 mg/ml of each protein mixed together and then incubated overnight at 4\u0026deg;C) and rhPML-1 proteins. In addition, the rhTAB1 and rhTAK1 samples as well as the reaction product sample of rhTAB1 with rhTAK1 were analysed separately using SDS-PAGE.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3D protein structure modelling\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe primary structural sequences of the PML-1 protein, TAB1 protein, TAK1 protein and LRP1-85 kDa protein were obtained separately via the Protein Data Bank sequence search tool available at NCBI (https://www.ncbi.nlm.nih. gov/). Once the sequences were obtained, they were converted to FASTA format for use in AlphaFold2\u003csup\u003e58-62\u003c/sup\u003e AlphaFold2 software is open source software available at https://github.com/deepmind/AlphaFold.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular docking of PML-1 with LRP1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePML-1 and LRP1-85 kDa protein docking was simulated via HDOCK software, and the binding modes for the PML-1 protein and LRP1-85 kDa with the top 10 energy values (Supplementary Table 2) were obtained\u003csup\u003e63-65\u003c/sup\u003e. Pose 1 was selected for\u0026nbsp;protein‒protein\u0026nbsp;interaction analysis to confirm the amino acid sites and distances between the amino acids of PML-1 that interact with\u0026nbsp;the\u0026nbsp;LRP1-85\u0026nbsp;kDa\u0026nbsp;protein (Supplementary Table 3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular docking of PML-1 with TAB1/TAK1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTAB1-TAK1 protein docking was performed via HDOCK software to obtain TAB1 and TAK1 protein binding bodes, after which the protein‒protein interactions of TAB1 and TAK1 were analysed to confirm the amino acid sites and distances between the amino acid residues involved in TAB1-TAK1 protein interactions (Supplementary Table 4)\u003csup\u003e\u0026nbsp;63-65\u003c/sup\u003e. The docking of PML-1 with\u0026nbsp;the\u0026nbsp;TAB1/TAK1 protein complex was simulated\u0026nbsp;using\u0026nbsp;HDOCK software to\u0026nbsp;determine\u0026nbsp;the binding mode for the PML-1 protein and TAB1-TAK1 complex with the top 10 energy values (Supplementary Table 5)\u003csup\u003e\u0026nbsp;63-65\u003c/sup\u003e. Pose 5 was selected for\u0026nbsp;protein\u0026ndash;protein\u0026nbsp;interaction analysis to confirm the amino acid sites and distances between\u0026nbsp;the\u0026nbsp;amino acid atoms when PML-1 interacts with\u0026nbsp;the\u0026nbsp;TAB1 and TAK1 proteins (Supplementary Table 6).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData and statistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data are expressed as the means \u0026plusmn; SDs unless otherwise stated. The group sizes were determined on the basis of the results of preliminary experiments. The mice were assigned at random to groups. The significance of differences in each experiment was determined as described in the figure legends, where \u003cem\u003en\u003c/em\u003e = the number of independent biological replicates (animals, unless noted as cells) per group, and \u003cem\u003eN\u003c/em\u003e = the number of independent experimental replicates. One-way ANOVA was performed via GraphPad Prism 5.0, and \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 was considered to indicate statistical significance.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8725456/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8725456/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePromyelocytic leukaemia (PML) protein is multifunctional protein involved in numerous important cellular processes, such as tumour suppression, transcriptional regulation, apoptosis, DNA damage response, and viral defence\u003csup\u003e\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Recent studies have also shown that the PML protein plays a crucial role in regulating immune responses and inflammation\u003csup\u003e\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. However, the precise mechanism by which it acts remains unclear. PML protein has the characteristic structural features of RBCC (RING, B-box, coiled-coil) and belongs to the single-ring E3 ubiquitin ligase family\u003csup\u003e\u003cspan additionalcitationids=\"CR13 CR14 CR15\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Nevertheless, to date, no PML protein have been reported to exhibit ubiquitin ligase activity. Here, we show that PML protein can mediate the anti-inflammatory pathway of lipoprotein receptor-related protein 1 (LRP1) by inhibiting the protein TAB1/TAK1 in the Toll like receptor (TLR) pathway in vitro and in vivo. The PML-1 isoform mediating this pathway and the inhibitory effect of PML-1 on TAB1/TAK1 occurred via ubiquitin modification. These findings confirm that the PML-1 protein has E3 ubiquitin ligase activity and mediates the LRP1-PML-1-TAB1/TAK1 anti-inflammatory pathway. The newly discovered ubiquitin ligase function of the PML protein represents a major breakthrough in elucidating its multiple cellular functional mechanisms, and provides a novel strategy for developing anti-inflammatory immunotherapies targeting the human PML-1 protein.\u003c/p\u003e","manuscriptTitle":"PML-1 protein ubiquitinates TAB1/TAK1 for LRP1 anti-inflammation signal","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-24 04:25:16","doi":"10.21203/rs.3.rs-8725456/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1ef79bee-6f03-40ee-8f68-e6c58cde882f","owner":[],"postedDate":"February 24th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":63247123,"name":"Biological sciences/Cell biology/Cell signalling/Extracellular signalling molecules"},{"id":63247124,"name":"Health sciences/Diseases/Immunological disorders/Inflammatory diseases"}],"tags":[],"updatedAt":"2026-03-04T14:57:56+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-24 04:25:16","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8725456","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8725456","identity":"rs-8725456","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}