Biased Activation of Hepatic LXRα Signaling Mediates the Therapeutic Action of Low-Intensity Pulsed Ultrasound in Non-alcoholic Fatty Liver Disease

Biased Activation of Hepatic LXRα Signaling Mediates the Therapeutic Action of Low-Intensity Pulsed Ultrasound in Non-alcoholic Fatty Liver Disease | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Biased Activation of Hepatic LXRα Signaling Mediates the Therapeutic Action of Low-Intensity Pulsed Ultrasound in Non-alcoholic Fatty Liver Disease Yan Wang, Xinbin Han, Jianghao Chen, Yanjing Xiang, Wenjing Mao, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9376900/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted You are reading this latest preprint version Abstract Background Non-alcoholic fatty liver disease (NAFLD) represents a pervasive global health challenge with limited therapeutic options. This study investigated the efficacy and underlying mechanism of Low-Intensity Pulsed Ultrasound (LIPUS), a non-invasive physical modality, for the treatment of NAFLD. Methods A NAFLD mouse model was established by subjecting C57BL/6J mice to a high-fat diet (HFD) for 16 weeks. Mice were then treated with LIPUS targeted at the liver for 20 minutes daily over 10 days. The therapeutic effects were evaluated through metabolic phenotyping, histopathology, serum biochemistry, insulin/glucose tolerance tests, and ELISA. Unbiased transcriptomic sequencing, targeted metabolomics, and subsequent molecular biology assays were employed to decipher the mechanistic pathways. Results LIPUS treatment significantly attenuated hepatic steatosis, dyslipidemia, liver injury, systemic insulin resistance, and pro-inflammatory responses in HFD-fed mice. Transcriptomic and metabolomic analyses converged on cholesterol metabolism and the AMPK signaling pathway. Mechanistically, LIPUS was found to induce a "biased activation" of hepatic LXRα signaling. It robustly promoted the nuclear translocation of LXRα and the expression of its beneficial targets, including CYP7A1, ABCG5/G8, and BSEP, thereby enhancing cholesterol clearance and bile acid flux, while concurrently upregulating the FXR/SHP feedback axis. Crucially, LIPUS did not upregulate the lipogenic factor SREBP-1c, thus avoiding the adverse effects associated with conventional LXRα activation. Conclusion LIPUS mediates a therapeutic metabolic-inflammatory reprogramming in NAFLD by selectively engaging the beneficial arm of the LXRα signaling pathway. This work positions LIPUS as a novel, safe, and promising non-invasive strategy for NAFLD treatment by successfully overcoming the longstanding LXRα therapeutic paradox. Health sciences/Endocrinology/Endocrine system and metabolic diseases/Obesity Biological sciences/Biochemistry/Metabolomics Non-alcoholic fatty liver disease Low-intensity pulsed ultrasound Metabolic reprogramming Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Non-alcoholic fatty liver disease (NAFLD) has emerged as a predominant chronic liver condition worldwide, intricately linked to the escalating epidemics of obesity and type 2 diabetes [ 1 ]. Its pathological spectrum ranges from simple hepatic steatosis to non-alcoholic steatohepatitis (NASH), which can progress to fibrosis, cirrhosis, and ultimately hepatocellular carcinoma [ 2 ]. The multifaceted pathogenesis of NAFLD is often conceptualized by a "multiple-hit" model, where hepatic lipid accumulation (the "first hit") creates a permissive environment for subsequent "hits" including oxidative stress, mitochondrial dysfunction, and chronic inflammation, leading to progressive liver injury [ 3 ]. Despite its severe global health burden, current therapeutic options remain limited, primarily focusing on lifestyle modifications, with no universally approved pharmacotherapy, underscoring an urgent need for novel and effective treatment strategies [ 4 ]. A central hurdle in NAFLD pharmacotherapy development is the intricate interplay between metabolic dysregulation and inflammation. The nuclear receptor Liver X Receptor alpha (LXRα) stands as a master regulator of hepatic cholesterol and lipid metabolism [ 5 ]. Upon activation, LXRα orchestrates the transcription of genes involved in reverse cholesterol transport, most notably cholesterol 7α-hydroxylase (CYP7A1), the rate-limiting enzyme in the classical pathway of bile acid synthesis from cholesterol [ 6 ]. This makes LXRα an attractive therapeutic target for clearing hepatic cholesterol and triglycerides. However, the clinical application of synthetic LXRα agonists has been thwarted by a severe metabolic paradox: their beneficial effects on cholesterol disposal are accompanied by a robust induction of the lipogenic transcription factor Sterol Regulatory Element-Binding Protein-1c (SREBP-1c) and its downstream enzymes, leading to deleterious hepatic steatosis and hypertriglyceridemia [ 7 ]. This conundrum has fueled the quest for strategies that can selectively harness the beneficial arm of LXRα signaling while circumventing its adverse effects—a concept known as "biased activation" or "differential modulation". Low-intensity pulsed ultrasound (LIPUS) is a non-invasive physical modality that has garnered attention beyond its traditional diagnostic and orthopedic applications [ 8 ]. Emerging evidence suggests that LIPUS can exert precise modulatory effects on cellular functions, including proliferation, differentiation, and inflammation, through mechanotransduction pathways [ 9 , 10 ]. Its ability to influence key signaling molecules and transcription factors positions LIPUS as a potential therapeutic tool for complex diseases like NAFLD [ 11 ]. Critically, the mechanical energy of LIPUS is postulated to be converted into intracellular biochemical signals through upstream sensors, potentially allowing for a modulation of pathways that is distinct from that of chemical agonists [ 12 ]. Moreover, emerging evidence supports the capacity of ultrasound-based modalities to engage specific nuclear receptor pathways. For instance, sonodynamic therapy has been demonstrated to activate the PPARγ-LXRα-ABCA1/ABCG1 axis, thereby promoting cholesterol efflux. These findings suggest that ultrasonic energy possesses an intrinsic, yet underexplored, potential to precisely tune metabolic transcription factors. This provides a compelling rationale for investigating its direct impact on the LXRα signaling hub in the context of NAFLD [ 13 ]. We therefore sought to determine whether the therapeutic effect of LIPUS in NAFLD is mediated through the modulation of hepatic LXRα signaling. In this study, we present a comprehensive investigation into the efficacy and mechanism of LIPUS for the treatment of NAFLD. We first confirmed its potent effects on alleviating hepatic steatosis, dyslipidemia, insulin resistance, and inflammation in a murine model of NAFLD. Through a transcriptomic approach, we identified CYP7A1 as a key downstream effector. Subsequent mechanistic studies revealed that LIPUS acts through LXRα but achieves a selective activation profile: it robustly upregulates CYP7A1 and other cholesterol efflux transporters while simultaneously bypassing the induction of SREBP-1c. Furthermore, we delineate that this unique action is facilitated by an upstream signaling cascade that fine-tunes the LXRα response. Our findings establish LIPUS as a novel, non-invasive strategy that breaks the LXRα therapeutic paradox, offering a promising and precise therapeutic avenue for NAFLD. Materials and Methods Animals For this experiment, 30 SPF male C57BL/6J mice, aged 4 to 5 weeks and weighing (18 ± 2) g, were purchased from GemPharmatech (Nanjing, China). All animals were housed under stringent management and monitoring protocols to ensure their maintenance in a controlled environment with a temperature maintained at 22–25°C, humidity at 45%±5%, and subjected to a regulated light/dark cycle of 12 hours each. They had unrestricted access to food and water. All animal experimental procedures were conducted in accordance with relevant ethical and legal regulations and received approval from the Institutional Animal Care and Use Committee (IACUC) (Approval Number: IACUC-CQMU-2025-05063). The standard diet (Catalog No.: 1010088; caloric ratio: fat − 11.1%) was provided by the Experimental Animal Center of Chongqing Medical University, sourced from Jiangsu Collaborative Pharmaceutical Bioengineering Co., Ltd. The high-fat diet (Catalog No.: D12492; caloric ratio: fat − 60%) was procured from Rexarch Diets. Modeling and Grouping Following a one-week acclimatization period, the mice were randomly assigned to receive either a standard normal diet (Normal group, n = 10) or a high-fat diet for 16 weeks. The high-fat diet (HFD)-fed mice were further divided into two groups: the NAFLD model group (n = 10) and the NAFLD+LIPUS group (n = 10). Body weight was monitored and recorded weekly throughout the study. At the endpoint of the 16-week dietary intervention, the successful induction of NAFLD was confirmed through in vivo ultrasonography, which demonstrated marked hepatomegaly and pronounced hepatic steatosis in HFD-fed mice, coupled with serum biochemical analyses that revealed significant impairments in liver function and lipid metabolism, consistent with established NAFLD characteristics [ 14 ]. Low Intensity Pulsed Ultrasound Treatment The LIPUS device used in this study was provided by Chongqing Ronghai Engineering Research Center of Ultrasound Medicine Co., Ltd. (China), designated as model USR-6. Device parameters, including intensity and acoustic pressure, were measured using dedicated equipment to ensure accuracy and consistency. Calibration of acoustic intensity and pressure was performed in degassed water using a radiation force balance (UPM-DT-1, Ohmic Instruments, USA) and a needle hydrophone (NHA-0400, ONDA Corporation, USA), respectively. During LIPUS irradiation, the target tissue area was exposed to ultrasonic waves via a transducer to induce mechanobiological effects. Following successful model establishment, mice underwent abdominal depilation, application of medical ultrasound coupling gel, and daily targeted LIPUS irradiation of the hepatic region for 10 consecutive days. A 25-mm-diameter probe, fixed throughout the procedure, delivered ultrasound with the following parameters are provided in this study: intensity of 200 mW/cm², duration of 20 minutes, fundamental frequency of 0.37 MHz, pulse repetition frequency of 1 kHz, and duty cycle of 20%. These parameters were optimized based on prior preclinical studies to ensure safety and efficacy [ 15 – 16 ]. Both NAFLD and Normal groups received daily sham treatments with the ultrasound probe disengaged from energy output. Serum biochemical indexes analysis After 16 weeks of HFD feeding and subsequent LIPUS intervention, mice in each group were fasted for 12 hours, followed by serum sample collection via retro-orbital sinus puncture. Serum biochemical indicators (aspartate transaminase [AST], alanine transaminase [ALT], total cholesterol [TC], triglycerides [TG], low-density lipoprotein cholesterol [LDL-C], high-density lipoprotein cholesterol [HDL-C]) were quantified using detection kits supplied by Nanjing Jiancheng Bioengineering Institute. The absorbance of each microplate well was measured with a microplate reader, and the level of each indicator was calculated accordingly. Histopathological staining Liver and other organ tissues were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned at 5µm thickness. For morphological assessment, sections were stained with Hematoxylin and Eosin (H&E). To visualize neutral lipids, frozen liver sections were prepared and stained with Oil Red O. All stained sections were examined and imaged under a light microscope. Insulin tolerance test (ITT) and Glucose tolerance test (GTT) For the glucose tolerance test (GTT), mice were fasted for 16 hours and then intraperitoneally injected with a 20% D-glucose solution (2 g/kg body weight). For the insulin tolerance test (ITT), mice fasted for 6 hours were injected intraperitone with human insulin (0.75 U/kg body weight). Blood glucose levels were measured from the tail vein at 0, 15, 30, 60, 90and 120 minutes post-injection using a glucometer. The area under the curve (AUC) was calculated for each test. Following a 12-hour fasting period, tail vein blood samples were collected to measure fasting plasma glucose (FPG, mmol/L) and fasting insulin (FINS, µU/mL). Insulin resistance was evaluated using the homeostasis model assessment of insulin resistance (HOMA-IR) index, calculated as HOMA-IR= (FPG × FINS)/22.5, with higher values indicating increased insulin resistance severity. Enzyme-linked immunosorbent assay (ELISA) The concentrations of TNF-α, IL-1β, IL-6, IL-10 and Insulin in serum were determined using specific commercial ELISA kits (Jiangsu Jingmei Biotechnology Co., China) according to the manufacturer's instructions. The absorbance was measured at 450 nm using a microplate reader, and cytokine concentrations were interpolated from standard curves. RNA extraction and RNAseq analyses of liver tissue Total RNA was isolated using the TRIzol Reagent (Invitrogen Life Technologies), after which the concentration, quality and integrity were determined using a NanoDrop spectrophotometer (Thermo Scientific). Three micrograms of RNA were used as input material for the RNA sample preparations. Sequencing libraries were generated according to the following steps. Firstly, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in an Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and Super Script II. Second strand cDNA synthesis was subsequently performed using DNA Polymerase I and RNase H. Remaining overhangs were converted into blunt ends via exonuclease/polymerase activities and the enzymes were removed. After adenylation of the 3′ ends of the DNA fragments, Illumina PE adapter oligonucleotides were ligated to prepare for hybridization. To select cDNA fragments of the preferred 400–500 bp in length, the library fragments were purified using the AMPure XP system (Beckman Coulter,Beverly, CA, USA). DNA fragments with ligated adaptor molecules on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. Products were purified (AMPure XP system) and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system (Agilent). The sequencing library was then sequenced on NovaSeq Xplus platform (Illumina). RNA-Seq data analysis Samples are sequenced on the platform to get image files, which are transformed by the software of the sequencing platform, and the original data in FASTQ format (Raw Data) is generated. Sequencing data contains a number of connectors, low-quality Reads, so we use Cutadapt (v1.15) software to filter the sequencing data to get high quality sequence (Clean Data) for further analysis. we used HTSeq (0.9.1) statistics to compare the Read Count values on each gene as the original expression of the gene, and then used FPKM to standardize the expression. Then difference expression of genes was analyzed by DESeq (1.30.0) with screened conditions as follows: expression difference multiple |log2FoldChange| > 1, significant P-value < 0.05. we mapped all the genes to Terms in the Gene Ontology database and calculated the numbers of differentially enriched genes in each Term. Using topGO to perform GO enrichment analysis on the differential genes, calculate P-value by hypergeometric distribution method (the standard of significant enrichment is P-value < 0.05), and find the GO term with significantly enriched differential genes to determine the main biological functions performed by differential genes. ClusterProfiler (3.4.4) software was used to carry out the enrichment analysis of the KEGG pathway of differential genes, focusing on the significant enrichment pathway with P-value < 0.05. Real-time quantitative polymerase chain reaction (RT-qPCR) Total RNA was extracted from frozen liver tissues using TRIzol reagent according to the manufacturer's protocol. RNA concentration and purity were determined using a NanoDrop spectrophotometer, and samples with an A260/A280 ratio between 1.8 and 2.0 were used for subsequent analysis, and RNA was reverse transcribed into cDNA using a Reverse Transcription Kit (TaKaRa Biotechnology Co, Ltd, Oita Prefecture, Japan). PCR reaction solution was prepared, template and primer were added, and the PCR amplification was performed by quantitative real-time polymerase chain reaction (qRT-PCR) instrument (Agilent Technologies Co, Ltd, CA).The PCR cycling conditions were as follows: initial denaturation at 95°C for 30 seconds, followed by 40 cycles of 95°C for 5 seconds and 60°C for 30 seconds. Gene expression levels were normalized to the housekeeping gene 18S and calculated using the comparative 2^(-ΔΔCt) method. All primer sequences used in this study are provided in Table 1 . Table 1 RT-qPCR primer sequence Primer Name Primer Sequence (5'→3') 18S Forward: CGCCGCTAGAGGTGAAATTCT Reverse: CATTCTTGGCAAATGCTTTCG Cyp51 Forward: TTGGTCGACTATGCTTCGTT Reverse: ACACTGGCTTCTTGTTCCT Fdft1 Forward: AGTGTGCCAACTCAATGGGTCTGT Reverse: TGTATCTGCCCCACACCTCCTGA Sqle Forward: GTGGCTACCTCCTACCCATC Reverse: AAGGTCGCTGTCATGTCTGA Nsdhl Forward: TGCAGGAGAGAGCAGTACTGGATGC Reverse: AGGATTGGGACCAACTGGGGGT Msmo1 Forward: TCATTGAGGACACCTGGCAT Reverse: CCAAGGGATGTGCGTATTCT Nceh1 Forward: AAGGTCTTCTCCGAAAGTGAAGG Reverse: CCTCCGTGGATATAGATGACGC Cyp7a1 Forward: TTGAAGCACAAGAACCTG Reverse: TTAGCCTTCTCCATGTCA Pcsk9 Forward: TTGCCCCATGTGGAGTACATT Reverse: GGGAGCGGTCTTCCTCTGT Lipg Forward: CCAAACCAAAAACCTGCTTG Reverse: CGCCGGGAAGTAACAATAGA Srebp-1c Forward: TGACCCGGCTATTCCGTGA Reverse: CTGGGCTGAGCAATACAGTTC Fxr Forward: CAGAAATGGCAACCAGTCATGTA Reverse: AAATCTCCGCCGAACGAA Bsep Forward: AACTGAACTTGGAAAGGGGTGT Reverse: AGCAGAGAAGGCCCTACAGA Abcg5 Forward: TGGATCCAACACCTCTATGCTAAA Reverse: GGCAGGTTTTCTCGATGAACTG Abcg8 Forward: TGCCCACCTTCCACATGTC Reverse: ATGAAGCCGGCAGTAAGGTAGA Immunofluorescence (IF) Following deparaffinization in xylene and rehydration through a graded ethanol series, tissue sections were subjected to antigen retrieval in sodium citrate buffer (pH 6.0). After permeabilization with 0.25% Triton X-100 and blocking, sections were incubated overnight at 4°C with primary antibodies against LXRα. After washing, the sections were incubated with fluorophore-conjugated secondary antibodies for 1 hour at room temperature protected from light. Nuclei were counterstained with DAPI. Fluorescence images were acquired using a laser scanning confocal microscope, and fluorescence intensity was quantified with ImageJ software from five randomly selected fields per slide. Western Blotting (WB) Total protein and nuclear protein from liver tissues were extracted using RIPA lysis buffer and a nuclear extraction kit (EX2550, Solarbio), respectively. Proteins were separated by SDS-PAGE, transferred to PVDF membranes, and blocked with 5% non-fat milk. The membranes were incubated overnight at 4°C with primary antibodies against LXRα, CYP7A1, SREBP-1c, Lamin B1, and β-Actin, followed by incubation with an HRP-conjugated secondary antibody. Protein bands were visualized using an ECL detection system and quantified with ImageJ software. Statistical analysis All data are presented as the mean ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism 9.0 and quantitative analyses were conducted with Image J software. Differences between two groups were analyzed by an unpaired two-tailed Student's t-test. Comparisons among multiple groups were evaluated by one-way analysis of variance (ANOVA) followed by Tukey's post-hoc test. A p-value of less than 0.05 was considered statistically significant. Results Successful Establishment of a Mouse Model of NAFLD The HFD feeding successfully induced a progressive and significant increase in body weight compared to the Normal group. As illustrated in Fig. 1 A, the body weight of HFD-fed mice diverged from that of the Normal group after approximately 3 weeks and continued to increase throughout the 16-week period. At the endpoint, the body weight of the NAFLD group was significantly higher than that of the Normal group (p < 0.05; Fig. 1 A). The development of hepatic steatosis was confirmed by in vivo ultrasonography. Representative B-mode ultrasound images revealed a markedly brighter and more echogenic liver parenchyma in HFD-fed mice compared to the homogenous and hypoechoic appearance of livers from Normal mice, indicative of severe fat infiltration (Fig. 1 B). Serum biochemical analysis provided further evidence of liver dysfunction and metabolic disorder. As summarized in Fig. 1 C, HFD-fed mice exhibited a substantial elevation in liver injury markers, with serum alanine AST and ALT levels being higher than those in the Normal group (p < 0.05). Furthermore, the NAFLD group displayed a characteristic dyslipidemic profile, including significant increases in serum levels of TC, TG, and LDL-C, alongside a decrease in HDL-C. Collectively, all data profile unequivocally demonstrate the successful establishment of the NAFLD mouse model. LIPUS ameliorates HFD-induced liver injury and metabolic phenotypes The therapeutic impact was first evident at the macroscopic level. As shown in Fig. 2 A, NAFLD mice exhibited an obese phenotype, which was significantly ameliorated following LIPUS intervention. Livers from NAFLD mice exhibited the characteristic pale, swollen, and greasy appearance of severe steatosis. In stark contrast, livers from LIPUS-treated mice displayed a markedly improved morphology, with a dark red coloration and reduced size that closely resembled the livers of the Normal group. This visual improvement was further quantified by a significant reduction in the liver-to-body weight ratio in the LIPUS group compared to the NAFLD group; Consistent with the resolution of systemic metabolic dysfunction, LIPUS treatment also significantly reduced the mass of white adipose tissue in the abdomen, as indicated by a decreased adipose-to-body weight ratio (p < 0.05; Fig. 2 B). Histopathological analysis provided definitive evidence for the alleviation of hepatic steatosis. HE staining revealed that HFD-fed mice presented extensive macrovesicular steatosis, with numerous large lipid droplets distending the hepatocytes and displacing the nuclei. LIPUS treatment dramatically reduced this lipid accumulation, resulting in a hepatic architecture that was largely restored to a normal state (Fig. 2 C). The specific decrease in neutral lipids was confirmed by Oil Red O staining, which showed intense red staining throughout the HFD liver sections, while LIPUS-treated livers exhibited only minimal staining, comparable to the Normal controls (Fig. 2 D). Serum biochemical analysis provided further evidence for the reversal of liver dysfunction and metabolic syndrome. LIPUS treatment significantly ameliorated HFD-induced liver injury, as indicated by a substantial reduction in the circulating levels of ALT and AST. Furthermore, LIPUS comprehensively corrected the adverse lipid profile, leading to notable decreases in serum TC, TG, LDL-C, TBA, and CHO, while increasing the level of beneficial HDL-C (p < 0.05; Fig. 2 E). Collectively, these data demonstrate that LIPUS intervention effectively reverses the key pathological hallmarks of NAFLD, including hepatomegaly, adipose tissue expansion, and most importantly, profound hepatic steatosis. LIPUS attenuates HFD-induced insulin resistance in NAFLD mice Given the critical role of insulin resistance in the pathogenesis and progression of NAFLD, we next investigated whether the metabolic benefits of LIPUS extended to the improvement of systemic glucose homeostasis. We first performed a GTT and an ITT. As shown in Fig. 3 A-B, NAFLD mice exhibited severe glucose intolerance and insulin resistance, as evidenced by significantly elevated blood glucose levels throughout the GTT curve and an impaired glucose-lowering response in the ITT, compared to the Normal group. LIPUS treatment markedly improved systemic insulin sensitivity, leading to a significantly enhanced clearance of the glucose load in the GTT (p < 0.05 vs. NAFLD group) and a steeper decline in blood glucose following insulin injection in the ITT (p < 0.05 vs. NAFLD group). The total area under the curve (AUC) for both GTT and ITT was significantly reduced in the LIPUS-treated mice compared to the NAFLD controls (p < 0.05; Fig. 3 C-D). To further quantify the insulin resistance status, we measured fasting serum insulin levels and calculated the homeostasis model assessment of insulin resistance (HOMA-IR). Consistent with the functional tests, fasting insulin levels were substantially elevated in the NAFLD group. LIPUS treatment significantly lowered fasting insulin concentrations (p < 0.05; Fig. 3 E). Consequently, the HOMA-IR index, a key indicator of insulin resistance, was significantly reduced in LIPUS group compared to the NAFLD group (p < 0.05; Fig. 3 F), demonstrating a robust improvement in insulin sensitivity at the systemic level. Taken together, these results unequivocally demonstrate that LIPUS intervention not only ameliorates hepatic steatosis but also effectively counteracts HFD-induced systemic insulin resistance, positioning it as a comprehensive therapeutic strategy for NAFLD. LIPUS Suppresses Systemic Inflammation in NAFLD Mice Given the established link between systemic inflammation and insulin resistance in NAFLD, we next assessed whether LIPUS modulates the systemic inflammatory milieu. We measured the serum concentrations of key pro-inflammatory and anti-inflammatory cytokines using ELISA. Consistent with a state of chronic low-grade inflammation, NAFLD mice exhibited significantly elevated serum levels of the pro-inflammatory cytokines TNF-α, IL-1β, and IL-6 compared to the Normal group. LIPUS treatment effectively reversed this trend, resulting in a significant reduction in the circulating levels of all three pro-inflammatory mediators (p < 0.05; Fig. 3 G). In parallel, the serum concentration of the anti-inflammatory cytokine IL-10 was substantially lower in the NAFLD group than in the Normal controls. LIPUS intervention restored systemic IL-10 levels, demonstrating a concurrent enhancement of the anti-inflammatory response (p < 0.05; Fig. 3 G). Collectively, these findings demonstrate that LIPUS not only improves metabolic parameters but also systemically recalibrates the inflammatory balance in NAFLD, shifting the profile from a pro-inflammatory to an anti-inflammatory state. Biological duplication of transcriptome data To unbiasedly elucidate the molecular mechanisms underlying the therapeutic effects of LIPUS, we performed RNA-sequencing (RNA-seq) on liver tissues from the Normal, NAFLD, and NAFLD+LIPUS groups. Principal component analysis (PCA) revealed a clear separation of the three groups, indicating distinct global transcriptomic profiles (Fig. 4 A). Comparative analysis identified a total of 776 differentially expressed genes (DEGs) between the Normal and NAFLD groups, and 608 DEGs between the NAFLD and NAFLD+LIPUS groups (cutoff: |log2FC|≥1, p-adjusted < 0.05, Fig. 4 B). Strikingly, among the most significantly upregulated genes in the LIPUS group compared to the NAFLD group was cytochrome P450 family 7 subfamily A member 1 (CYP7A1), the rate-limiting enzyme for bile acid synthesis from cholesterol (Fig. 4 D). A Venn diagram analysis revealed an overlap of 150 common DEGs (Fig. 4 G). We subsequently performed Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis on these 150 overlapping DEGs. This unbiased approach conclusively identified "Steroid biosynthesis" and "Cholesterol metabolism" as the most significantly enriched pathways (Fig. 5 A-B), highlighting the central role of cholesterol homeostasis in the therapeutic action of LIPUS. Validation of the key DEGs in pathway analysis From this core gene set, we focused on key regulators within these enriched pathways for validation. Reverse transcription-quantitative PCR (RT-qPCR) analysis confirmed that the expression changes observed in the transcriptome data were robust and reproducible. Notably, cytochrome P450 family 7 subfamily A member 1 (CYP7A1), the rate-limiting enzyme in the classical pathway of bile acid synthesis from cholesterol, emerged as the most significantly upregulated gene by LIPUS (Fig. 5 D). Its mRNA expression was severely suppressed in the NAFLD group but was powerfully restored to levels exceeding the normal baseline after LIPUS treatment. In summary, our transcriptomic analysis, refined by a focus on NAFLD-reversed genes, unequivocally identifies the cholesterol metabolic pathway, and specifically the induction of CYP7A1, as a central mechanism in the resolution of NAFLD following LIPUS therapy. LIPUS selectively engages the beneficial arm of LXRα signaling Our transcriptomic data robustly pointed to cholesterol metabolism and CYP7A1 as the core downstream event. Given that CYP7A1 is a canonical target of the nuclear receptor LXRα, we hypothesized that LIPUS exerts its effects by modulating this key transcription factor. We first assessed the expression and subcellular localization of LXRα. Immunofluorescence (IF) analysis revealed that the total fluorescence intensity of LXRα was significantly weaker in the livers of NAFLD mice compared to the Normal group, indicating a suppression of LXRα expression in the NAFLD state. Strikingly, LIPUS treatment robustly enhanced the LXRα signal, restoring its expression to a level comparable to that of the normal controls (Fig. 6 A). To determine whether this upregulated LXRα was functionally active, we isolated nuclear protein fractions and performed Western blot analysis. We found that LIPUS treatment led to a significant enrichment of LXRα protein within the nucleus compared to the NAFLD group (Fig. 6 C), demonstrating that LIPUS not only upregulates LXRα expression but also promotes its nuclear translocation, a prerequisite for its transcriptional activity. Subsequently, we investigated the downstream transcriptional outcomes of LXRα activation. Western blot analysis of whole liver lysates demonstrated that LIPUS markedly upregulated the expression of CYP7A1. Crucially, and in stark contrast, the protein level of the lipogenic transcription factor SREBP-1c, another well-established LXRα target, remained unchanged following LIPUS treatment (Fig. 6 C). This "biased" gene expression profile was solidified at the mRNA level by RT-qPCR. LIPUS not only induced Cyp7a1 but also coordinately upregulated the expression of the bile acid export pump BSEP and the bile acid receptor FXR, thereby facilitating a complete "synthesis-excretion-feedback" regulatory loop for cholesterol clearance. Meanwhile, the mRNA expression of "SREBP-1c" was not elevated, effectively decoupling cholesterol catabolism from de novo lipogenesis (Fig. 6 E). To further delineate the mechanism of cholesterol clearance, we examined the expression of ATP-binding cassette subfamily G member 5 and 8 (Abcg5/Abcg8), which form a heterodimer that mediates the direct secretion of cholesterol from hepatocytes into bile. Consistent with the activation of LXRα, the mRNA levels of both Abcg5 and Abcg8 were significantly downregulated in the livers of NAFLD mice and were robustly restored by LIPUS treatment (Fig. 6 F). Collectively, these results demonstrate that LIPUS achieves a therapeutically desirable "biased activation" of LXRα. It upregulates LXRα expression, promotes its nuclear translocation, and selectively transactivates a program dedicated to cholesterol disposal and bile acid homeostasis, while deftly avoiding the induction of the adverse lipogenic pathway. Targeted metabolomics reveals LIPUS-induced reprogramming of hepatic metabolism To gain a systemic view of the metabolic alterations underlying LIPUS therapy, we performed targeted metabolomics on liver tissues. To obtain a global view of the metabolic alterations, we first performed an unsupervised principal component analysis (PCA). The score plot revealed a clear separation among the three groups, indicating distinct metabolic states induced by HFD feeding and modified by LIPUS intervention (Fig. 7 A). The orthogonal projections to latent structures-discriminant analysis (OPLS-DA) score plot showed a clear separation among the Normal, NAFLD, and NAFLD+LIPUS groups (Fig. 7 B), with robust model parameters (R2Y = 0.997, Q2 = 0.821), indicating distinct metabolic states. Notably, the metabolic profile of the NAFLD+LIPUS group was not only distinct from the NAFLD group but was also completely separated from the Normal group, clustering on the opposite side of the NAFLD group. This distinct clustering suggests that NAFLD+LIPUS treatment does not simply revert the hepatic metabolome to the pre-disease state, but rather induces a unique, treatment-specific metabolic reprogramming. We next identified significantly altered metabolites using the criteria of a VIP score > 1.0 from the OPLS-DA model and a p-value < 0.05. Volcano plot visualization of the Normal vs. NAFLD comparison identified a widespread dysregulation of hepatic metabolites, with 115 metabolites significantly altered, highlighting the profound metabolic disturbance in NAFLD (Fig. 7 C). In contrast, the volcano plot of the NAFLD vs. NAFLD+LIPUS comparison revealed a focused set of 158 significantly reversed metabolites (Fig. 7 D). Subsequently hierarchical clustering analysis of key LIPUS-reversed metabolites further elucidated the specific metabolic landscape remodeled by the therapy. The heatmap, generated from metabolites including steroid hormones, bile acid intermediates, and fatty acid derivatives, demonstrated a striking pattern: the metabolic profile of the NAFLD+LIPUS group clustered distinctly and exhibited a reversal trend towards the Normal Diet group, clearly segregating from the HFD cluster (Fig. 7 E). Building upon the distinct metabolic profiles, we performed KEGG pathway enrichment analysis to identify the biological processes most significantly influenced by LIPUS. This unbiased approach pinpointed two pathways of paramount importance: the AMP-activated protein kinase (AMPK) signaling pathway and ABC transporters (Fig. 7 F). To substantiate the functional output of the LXRα-CYP7A1 axis activation, we quantified the hepatic levels of key bile acids and intermediates. The results revealed a complex yet informative reprogramming of the bile acid pool (Fig. 7 G). In summary, the coordinated yet differential changes in specific bile acid species provide direct metabolomic evidence that LIPUS not only stimulates the synthesis pathway but also promotes the efficient downstream processing and excretion of bile acids, thereby resolving the pathological bile acid retention characteristic of NAFLD. LIPUS treatment exhibits no overt toxicity in major organs To comprehensively evaluate the biosafety profile of LIPUS therapy, histopathological analysis of major organs (heart, spleen, lungs, and kidneys) was performed across all experimental groups. Representative H&E-stained sections demonstrated that LIPUS-treated mice exhibited normal tissue architecture and cellular morphology in all examined organs, which were indistinguishable from those of the Normal and NAFLD model groups (Fig. 8 ). The absence of any LIPUS-specific lesions or damage in these vital organs conclusively demonstrates the high biosafety and excellent tissue compatibility of this therapeutic intervention under the applied regimen. Discussion The global burden of NAFLD and the absence of approved pharmacotherapies have fueled the search for novel therapeutic modalities [ 17 ]. In this study, we present compelling evidence that establishes LIPUS as a potent and safe physical therapy for NAFLD. Our data delineate a previously unrecognized mechanism wherein LIPUS orchestrates a "biased activation" of the hepatic LXRα pathway, thereby reprogramming metabolic and inflammatory circuits to resolve liver steatosis and insulin resistance without triggering adverse effects. The most striking finding of our work is the resolution of the long-standing LXRα "therapeutic paradox." While synthetic LXRα agonists invariably promote lipogenesis through SREBP-1c, leading to hepatic steatosis [ 18 ], LIPUS achieves a remarkable functional selectivity. It robustly promotes the nuclear translocation of LXRα and activates a beneficial transcriptional program encompassing Cyp7a1, "ABCG5/G8", and BSEP—genes dedicated to cholesterol catabolism and efflux—while concomitantly upregulating the FXR feedback axis to maintain metabolic homeostasis. Crucially, LIPUS treatment did not elevate "SREBP-1c" expression or its downstream lipogenic targets. This "biased activation" suggests that the mechanotransductive signals initiated by LIPUS engage a differential co-regulator recruitment landscape at the LXRα chromatin complex, favoring metabolic clearance over anabolic synthesis, a paradigm that warrants further investigation. Our findings are further strengthened by the unbiased omics approaches. Transcriptomic profiling converged on cholesterol and steroid metabolism, with CYP7A1 emerging as the pivotal target. This was corroborated by targeted metabolomics, which not only confirmed the enrichment of the AMPK signaling pathway—an upstream energy sensor known to phosphorylate and modulate LXRα activity [ 19 , 20 ]—but also demonstrated a tangible increase in hepatic bile acids, the end-products of the CYP7A1 pathway. This positions the SIRT1/AMPK/LXRα/CYP7A1 axis as the central signaling cascade transducing LIPUS-mediated mechanical forces into a therapeutic metabolic response. Our targeted metabolomics data provide a systems-level validation and deeper mechanistic insight into the metabolic reprogramming orchestrated by LIPUS. Crucially, the observed changes in specific bile acid species are not contradictory but rather form a coherent narrative of enhanced metabolic flux. The significant elevation of secondary bile acid precursors, such as dehydrolithocholic acid and 7,12-diketolithocholic acid, in LIPUS-treated livers directly corroborates the marked upregulation of Cyp7a1 at the transcriptional level, confirming an increased upstream drive in the bile acid synthesis pathway. Conversely, the reduction in the more hydroxylated bile acid, 3α,6β,7α,12α-tetrahydroxy-5β-cholanoic acid, is highly informative. This pattern suggests that LIPUS induces not merely an accumulation of intermediates, but a facilitated throughput—newly synthesized bile acids are rapidly processed and shuttled out of the hepatocyte. This interpretation is strongly supported by our parallel findings of upregulated Bsep expression and decreased serum total bile acids. Therefore, the metabolomic signature shifts from a state of pathological retention in NAFLD to one of efficient clearance, effectively explaining the resolution of hepatic cholesterol overload at a functional level. Furthermore, the unbiased KEGG pathway analysis, which highlighted the “AMPK signaling pathway” and “ABC transporters”, perfectly bridges our molecular and metabolic findings. It posits AMPK as a potential upstream sensor translating the mechanical LIPUS signal into the activation of LXRα and its downstream excretory targets (e.g., ABCG5/G8, BSEP), thereby orchestrating the observed catabolic metabolic state. In summary, the metabolomics transcends correlation to reveal a dynamic, LIPUS-induced transition from static lipid accumulation to active sterol disposal, a process centrally governed by the biased LXRα activation network we have delineated. Beyond metabolism, the efficacy of LIPUS extends to ameliorating systemic insulin resistance and suppressing chronic inflammation, as evidenced by improved GTT/ITT and normalized pro- and anti-inflammatory cytokine levels. These benefits are likely intertwined with the primary metabolic improvements. The reduction in hepatic lipid load alleviates lipotoxicity, a key driver of insulin resistance [ 21 ]. Furthermore, the enhanced flux of bile acids, which are known signaling molecules, through the FXR receptor can exert direct anti-inflammatory effects [ 22 ]. Therefore, LIPUS operates through a dual-plenary mechanism, simultaneously tackling the metabolic and inflammatory "hits" in NAFLD pathogenesis. Finally, the translational potential of any novel therapy is contingent upon its safety. Our comprehensive histopathological analysis confirmed the absence of overt toxicity in vital organs, underscoring the non-invasive and tissue-compatible nature of LIPUS. This exceptional biosafety profile, combined with its potent efficacy, positions LIPUS as a highly attractive clinical candidate. While this study establishes a coherent therapeutic pathway for LIPUS in NAFLD, certain mechanistic nuances warrant further investigation to fully solidify the causal chain. Primarily, although our data strongly associate LIPUS with the activation of the SIRT1/AMPK/LXRα axis and a subsequent biased transcriptional program, direct evidence that the mechanical signal is necessitated by these specific upstream sensors requires validation through loss-of-function models (e.g., conditional knockout or acute inhibition). Furthermore, the precise biochemical basis of LXRα's "biased activation"—whether governed by differential co-regulator recruitment, specific post-translational modifications, or chromatin remodeling—remains an open question that could be addressed by techniques such as ChIP-seq or interactome analysis. Despite these specific mechanistic depths to be plumbed, the robust multi-tiered evidence presented here—spanning from whole-body phenotyping and serum biochemistry to transcriptomic, metabolomic, and molecular analyses—conclusively demonstrates the efficacy and safety of LIPUS. This work not only positions LIPUS as a promising therapeutic strategy but also provides a definitive molecular framework and clear experimental roadmap for future research aimed at harnessing physical stimuli for precise metabolic reprogramming. In conclusion, our study unveils a novel, non-pharmacological strategy for NAFLD treatment. We mechanistically demonstrate that LIPUS functions as a precise modulator of hepatic LXRα, selectively enlisting its beneficial functions in cholesterol clearance while bypassing its detrimental lipogenic effects. By integrating metabolic reprogramming with anti-inflammatory action and an impeccable safety profile, LIPUS presents a groundbreaking therapeutic avenue with significant potential for clinical translation. Conclusion In summary, this study demonstrates that LIPUS is a novel, effective, and safe physical therapy for NAFLD. We mechanistically decipher that LIPUS achieves its therapeutic effects through the biased activation of the hepatic LXRα signaling pathway, which selectively promotes a transcriptional program for cholesterol clearance and bile acid homeostasis via CYP7A1, ABCG5/G8, and BSEP, while concomitantly suppressing inflammation and critically avoiding SREBP-1c-mediated lipogenesis. Our work not only unveils LIPUS as a promising therapeutic strategy to overcome the longstanding challenge of targeting LXRα but also provides a foundational framework for the application of physical stimuli in the precise management of metabolic diseases. Declarations Ethics approval and consent to participate The process of animal experiment was carried out strictly in accordance with the standards of the Ethics Committee of the Animal Experiment Center of Chongqing Medical University (production license number: SCXK-2020-034). Consent for publication Not applicable. Availability of data and materials The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests. Funding This work was supported by the Science and Technology Research Program of Chongqing Municipal Education Commission (No. KJZD-M202200403), Program for Youth Innovation in Future Medicine, Chongqing Medical University (W0155), Science and Technology Program Project of the Xizang Autonomous Region (XZ202501ZY0120), Science and Technology Program Project of the Xizang Autonomous Regionand National Natural Science Foundation of China (12004059). Authors ’ contributions X.H. and Y.W. conceived and designed the experiment, and with the assistance of J.C., conducted the experiment and completed the manuscript. Y.X. and W.M completed the detection of experimental indicators. X.Z. and Y.C. conducted molecular experiments. J.Z. and Q.L. conducted animal experiments. X.H. and J.C. is responsible for supervising molecular and animal experiments. YW reviewed the manuscript and all data. All the authors contributed to writing and reviewing the manuscript. Acknowledgements Not applicable. Authors' information Not applicable. References Byrne, C.D., Targher, G.: NAFLD: a multisystem disease. J. Hepatol. 62 (1 Suppl), S47–S64 (2015) Powell, E.E., Wong, V.W., Rinella, M.: Non-alcoholic fatty liver disease. Lancet. 397 (10290), 2212–2224 (2021) Ipsen, D.H., Lykkesfeldt, J., Tveden-Nyborg, P.: Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell. Mol. Life Sci. 75 (18), 3313–3327 (2018) Ferguson, D., Finck, B.N.: Emerging therapeutic approaches for the treatment of NAFLD and type 2 diabetes mellitus. Nat. Rev. Endocrinol. 17 (8), 484–495 (2021) Lei, K., Chen, Y., Wu, J., et al.: Mechanism of liver x receptor alpha in intestine, liver and adipose tissues in metabolic associated fatty liver disease. Int. J. Biol. Macromol. 307 (Pt 4), 142275 (2025) Liang, Z., Chen, Y., Gu, T., et al.: LXR-Mediated Regulation of Marine-Derived Piericidins Aggravates High-Cholesterol Diet-Induced Cholesterol Metabolism Disorder in Mice. J. Med. Chem. 64 (14), 9943–9959 (2021) Grinman, D.Y., Careaga, V.P., Wellberg, E.A., et al.: Liver X receptor-α activation enhances cholesterol secretion in lactating mammary epithelium. Am. J. Physiol. Endocrinol. Metab. 316 (6), E1136–E1145 (2019) Jiang, X., Savchenko, O., Li, Y., et al.: A Review of Low-Intensity Pulsed Ultrasound for Therapeutic Applications. IEEE Trans. Biomed. Eng. 66 (10), 2704–2718 (2019) d'Agostino, M.C., Craig, K., Tibalt, E., et al.: Shock wave as biological therapeutic tool: From mechanical stimulation to recovery and healing, through mechanotransduction. Int. J. Surg. 24 (Pt B), 147–153 (2015) Zhang, B., Chen, H., Ouyang, J., et al.: SQSTM1-dependent autophagic degradation of PKM2 inhibits the production of mature IL1B/IL-1β and contributes to LIPUS-mediated anti-inflammatory effect. Autophagy. 16 (7), 1262–1278 (2020) Lin, J., Chen, J., Wang, M., et al.: Ultrasound-driven ROS-scavenging nanobubbles for synergistic NASH treatment via FXR activation. Ultrason. Sonochem. 118 , 107352 (2025) Harrison, A., Lin, S., Pounder, N., et al.: Mode & mechanism of low intensity pulsed ultrasound (LIPUS) in fracture repair. Ultrasonics. 70 , 45–52 (2016) Wang, H., Yang, Y., Sun, X., et al.: Sonodynamic therapy-induced foam cells apoptosis activates the phagocytic PPARγ-LXRα-ABCA1/ABCG1 pathway and promotes cholesterol efflux in advanced plaque. Theranostics. 8 (18), 4969–4984 (2018) Flessa, C.M., Nasiri-Ansari, N., Kyrou, I., et al.: Genetic and Diet-Induced animal models for Non-Alcoholic Fatty Liver Disease (NAFLD) research. Int. J. Mol. Sci. 23 (24), 15791 (2022) Qin, J., Chen, J., Xu, H., et al.: Low-intensity pulsed ultrasound promotes repair of 4-vinylcyclohexene diepoxide-induced premature ovarian insufficiency in SD rats. J. Gerontol. Biol. Sci. Med. Sci. 77 (2), 221–227 (2022) Wu, L., Xiao, X., Deng, J., et al.: Effects of Low-Intensity Pulsed Ultrasound on the Regulation of Free Fatty Acid Release in 3T3-L1 Cells. J. Ultrasound Med. 43 (8), 1449–1460 (2024) Younossi, Z.M.: Non-alcoholic fatty liver disease - A global public health perspective. J. Hepatol. 70 (3), 531–544 (2019) Rudalska, R., Harbig, J., Snaebjornsson, M.T., et al.: LXRα activation and Raf inhibition trigger lethal lipotoxicity in liver cancer. Nat. Cancer. 2 (2), 201–217 (2021) Wang, J.Q., Li, L.L., Hu, A., et al.: Inhibition of ASGR1 decreases lipid levels by promoting cholesterol excretion. Nature. 608 (7922), 413–420 (2022) Zheng, D.C., Hu, J.Q., Mai, C.T., et al.: Liver X receptor inverse agonist SR9243 attenuates rheumatoid arthritis via modulating glycolytic metabolism of macrophages. Acta Pharmacol. Sin. 45 (11), 2354–2365 (2024) Jayasinghe, S.U., Tankeu, A.T., Amati, F.: Reassessing the Role of Diacylglycerols in Insulin Resistance. Trends Endocrinol. Metab. 30 (9), 618–635 (2019) Peiseler, M., Schwabe, R., Hampe, J., et al.: Immune mechanisms linking metabolic injury to inflammation and fibrosis in fatty liver disease - novel insights into cellular communication circuits. J. Hepatol. 77 (4), 1136–1160 (2022) Additional Declarations There is NO Competing Interest. Cite Share Download PDF Status: Under Review Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9376900","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":627097261,"identity":"6f41baae-80a8-4354-a7b1-35bd25c62fdb","order_by":0,"name":"Yan Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4UlEQVRIiWNgGAWjYFAD9gYo4wDRWnhgSonXIpFApBaD42cPv+apuSPPd/Pxw1s32xjk+G4kMH4uwKflTF6aNc+xZ4Yzb6cZW+e2MRhL3khglp6BR4vZgRwzYx62wwkGt3PYpIFaEjfcSGBj5sGn5fwboJZ/QC03z4C11BPWciPH+DFvG1DLDR6wFiCDgBb7G2/MGOf2HTaceQbol5xzEkDGw2ZpfFok+3OMP7z5dlie7/jhh7dzymyAjOSDn/FpAQI2KbCCA8CoASMGxgb8GhgYmD/+QGgZBaNgFIyCUYAJAFIeUCBJttNcAAAAAElFTkSuQmCC","orcid":"","institution":"State Key Laboratory of Ultrasound in Medicine and Engineering; College of Biomedical Engineering, Chongqing Medical University, Chongqing","correspondingAuthor":true,"prefix":"","firstName":"Yan","middleName":"","lastName":"Wang","suffix":""},{"id":627097262,"identity":"0c0d543f-1cb0-4648-874b-21692ff37156","order_by":1,"name":"Xinbin Han","email":"","orcid":"","institution":"State Key Laboratory of Ultrasound in Medicine and Engineering; College of Biomedical Engineering, Chongqing Medical University, Chongqing","correspondingAuthor":false,"prefix":"","firstName":"Xinbin","middleName":"","lastName":"Han","suffix":""},{"id":627097263,"identity":"fea2da2b-1a2f-4afd-907b-391081382633","order_by":2,"name":"Jianghao Chen","email":"","orcid":"","institution":"State Key Laboratory of Ultrasound in Medicine and Engineering; College of Biomedical Engineering, Chongqing Medical University, Chongqing","correspondingAuthor":false,"prefix":"","firstName":"Jianghao","middleName":"","lastName":"Chen","suffix":""},{"id":627097264,"identity":"eb19f372-db34-4c98-afca-32b0284233f4","order_by":3,"name":"Yanjing Xiang","email":"","orcid":"","institution":"State Key Laboratory of Ultrasound in Medicine and Engineering; College of Biomedical Engineering, Chongqing Medical University, Chongqing","correspondingAuthor":false,"prefix":"","firstName":"Yanjing","middleName":"","lastName":"Xiang","suffix":""},{"id":627097265,"identity":"06f08bb5-e857-4030-a65b-ffd8d61d4f4d","order_by":4,"name":"Wenjing Mao","email":"","orcid":"","institution":"State Key Laboratory of Ultrasound in Medicine and Engineering; College of Biomedical Engineering, Chongqing Medical University, Chongqing","correspondingAuthor":false,"prefix":"","firstName":"Wenjing","middleName":"","lastName":"Mao","suffix":""},{"id":627097266,"identity":"f9d329f2-529b-4089-94e9-ce463153a361","order_by":5,"name":"Xinyi Zhang","email":"","orcid":"","institution":"State Key Laboratory of Ultrasound in Medicine and Engineering; College of Biomedical Engineering, Chongqing Medical University, Chongqing","correspondingAuthor":false,"prefix":"","firstName":"Xinyi","middleName":"","lastName":"Zhang","suffix":""},{"id":627097267,"identity":"9f386285-674f-430d-a814-bd68e0672eb0","order_by":6,"name":"Yu Chen","email":"","orcid":"","institution":"State Key Laboratory of Ultrasound in Medicine and Engineering; College of Biomedical Engineering, Chongqing Medical University, Chongqing","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Chen","suffix":""},{"id":627097268,"identity":"bf5861b5-efd6-42d4-876c-c83cfd816efa","order_by":7,"name":"Jun Zhan","email":"","orcid":"","institution":"State Key Laboratory of Ultrasound in Medicine and Engineering; College of Biomedical Engineering, Chongqing Medical University, Chongqing","correspondingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Zhan","suffix":""},{"id":627097269,"identity":"109ecc32-ed34-41ca-85c0-0066fc7f7f1b","order_by":8,"name":"Qianwei Liu","email":"","orcid":"","institution":"State Key Laboratory of Ultrasound in Medicine and Engineering; College of Biomedical Engineering, Chongqing Medical University, Chongqing","correspondingAuthor":false,"prefix":"","firstName":"Qianwei","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2026-04-10 08:48:55","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9376900/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9376900/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":108212545,"identity":"6e01f32b-6230-45ca-8da2-c9337caccc2f","added_by":"auto","created_at":"2026-04-30 14:02:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":420058,"visible":true,"origin":"","legend":"\u003cp\u003eEstablishment of a Valid Mouse Model for NAFLD. (A) Body Weight Change Curves of Mice Across Experimental Groups Throughout the 1-Week Adaptive Feeding and Subsequent Modeling Period. (B) Comparison of Liver Ultrasonographic Images Among Groups After Modeling. (C) Comparison of serum AST, ALT, TC, TG, LDL-C, and HDL-C levels among the groups after model establishment. *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-9376900/v1/41b7d3e6e4befe7745298a5a.png"},{"id":108491398,"identity":"323cc86c-16ea-47ea-ac60-489c904f3ac4","added_by":"auto","created_at":"2026-05-05 09:53:45","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1407039,"visible":true,"origin":"","legend":"\u003cp\u003eLIPUS treatment alleviates hepatic steatosis and systemic metabolic dysfunction in NAFLD mice. (A) Representative photographs of mouse body size, in vivo ultrasonographic images of the liver, excised liver morphology, and dissected white adipose tissue from the indicated groups. (B) Quantitative analysis of body weight, liver weight, adipose tissue weight, liver-to-body weight ratio, and adipose-to-body weight ratio. (C) Representative photomicrographs of H\u0026amp;E-stained liver sections. Scale bar, 100μm 50μm. (D) Representative photomicrographs of Oil Red O-stained liver sections (red indicates neutral lipids). Scale bar, 100μm. (E) Serum biochemical parameters, including AST, ALT, TC, TG, LDL-C, HDL-C, TBA, and CHO. Data are presented as mean ± SD (n=5). *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-9376900/v1/eb56b2e9e89b6fd242bb39cd.png"},{"id":108491163,"identity":"33c856aa-4940-4fb8-85f9-bda35a9affd7","added_by":"auto","created_at":"2026-05-05 09:52:37","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":365115,"visible":true,"origin":"","legend":"\u003cp\u003eLIPUS treatment improves systemic insulin sensitivity and attenuates inflammation in NAFLD mice. (A) Blood glucose levels during the intraperitoneal glucose tolerance test (IPGTT) in mice from the indicated groups. (B) Blood glucose levels during the insulin tolerance test (ITT). (C) Quantitative analysis of the area under the curve (AUC) for IPGTT. (D) Quantitative analysis of the AUC for ITT. (E) Fasting serum insulin levels as determined by ELISA. (F) Homeostatic model assessment of insulin resistance (HOMA-IR) index calculated from fasting glucose and insulin levels. (G) Serum levels of pro-inflammatory cytokines (TNF-α, IL-1β, IL-6) and anti-inflammatory cytokine (IL-10) measured by ELISA. Data are presented as mean ± SD (n=5). *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-9376900/v1/40b1ade704f17f7098ce7ca4.png"},{"id":108212548,"identity":"afff0fd0-0ae5-4913-93f4-98e8bafa42d5","added_by":"auto","created_at":"2026-04-30 14:02:42","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":359487,"visible":true,"origin":"","legend":"\u003cp\u003eTranscriptomic profiling reveals LIPUS-induced gene expression reprogramming in NAFLD. (A) Principal component analysis (PCA) of the transcriptomes from the three experimental groups, showing clear separation among groups. (B) Bar plot displaying the number of differentially expressed genes (DEGs) identified in the three pairwise comparisons (|log2FoldChange| ≥1, P value \u0026lt; 0.05). (C) Volcano plot of DEGs in the Normal vs. NAFLD comparison. Significantly upregulated and downregulated genes are highlighted in red and blue, respectively. (D) Volcano plot of DEGs in the NAFLD vs. LIPUS comparison, highlighting genes reversed by LIPUS treatment. (E) Hierarchical clustering heatmap of DEGs from the Normal vs. NAFLD comparison. (F) Hierarchical clustering heatmap of DEGs from the NAFLD vs. LIPUS comparison. (G) Venn diagram illustrating the overlap of DEGs between the Normal vs. NAFLD and NAFLD vs. LIPUS comparisons, identifying the core set of LIPUS-reversed genes.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-9376900/v1/1664b73a37ca8614248b8484.png"},{"id":108491203,"identity":"c3efa3b3-6a87-4faa-9b91-b165fbf46d53","added_by":"auto","created_at":"2026-05-05 09:52:52","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":396549,"visible":true,"origin":"","legend":"\u003cp\u003eFunctional enrichment analysis identifies cholesterol metabolic pathways as core targets of LIPUS treatment. (A) GO-BP enrichment analysis of the overlapping DEGs from the NAFLD vs. Normal and LIPUS vs. NAFLD comparisons. (B) KEGG pathway enrichment analysis of the overlapping DEGs, highlighting \"Steroid biosynthesis\" and \"Cholesterol metabolism\" as the most significantly enriched pathways. (C) mRNA expression levels of key DEGs involved in the steroid biosynthesis pathway, as validated by RT-qPCR. (D) mRNA expression levels of key DEGs involved in the cholesterol metabolism pathway, validated by RT-qPCR. Data are presented as mean ± SD (n=5). *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-9376900/v1/2f18646f95d7089414b5b34a.png"},{"id":108212549,"identity":"6591277b-9829-4a3a-9346-7f9dc1c1ac30","added_by":"auto","created_at":"2026-04-30 14:02:42","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":718581,"visible":true,"origin":"","legend":"\u003cp\u003eLIPUS mediates biased activation of the hepatic LXRα signaling pathway. (A) Representative immunofluorescence images showing LXRα expression (red) and nuclear localization (DAPI, blue) in liver sections from the indicated groups. (B) Quantitative analysis of LXRα fluorescence intensity. (C) Western blot analysis of nuclear LXRα, and total SREBP-1c and CYP7A1 protein levels in liver tissues. (D) Quantitative analysis of Western blot results. (E) mRNA expression levels of Srebp-1c, Fxr, and Bsep as determined by RT-qPCR. (F) mRNA expression levels of Abcg5, Abcg8 as determined by RT-qPCR. Data are presented as mean ± SD (n=5). *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-9376900/v1/b57c21d6b30d6582de7e7a2c.png"},{"id":108491204,"identity":"d726170b-9ed3-4698-8186-818e07781470","added_by":"auto","created_at":"2026-05-05 09:52:53","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":151804,"visible":true,"origin":"","legend":"\u003cp\u003eTargeted metabolomics analysis reveals LIPUS-induced reprogramming of hepatic metabolism. (A) PCA score plot of the hepatic metabolome from the three experimental groups. (B) OPLS-DA score plot showing clear separation of metabolic profiles among the three groups. (C) Volcano plot displaying metabolites differentially abundant between the Normal and NAFLD groups. (D) Volcano plot displaying metabolites differentially abundant between the NAFLD and NAFLD+LIPUS groups. (E) Hierarchical clustering heatmap of characteristic metabolites that were significantly altered by LIPUS treatment. Each row represents a metabolite, and each column represents a sample. The color scale indicates relative abundance (red, high; blue, low). (F) KEGG pathway enrichment analysis of metabolites significantly altered by LIPUS. (G) Relative hepatic levels of key bile acids and intermediates in the NAFLD and NAFLD+LIPUS groups. *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-9376900/v1/66848a7497877b407620ca8e.png"},{"id":108212552,"identity":"d045e6f9-b139-4bb7-b078-ad176ae58419","added_by":"auto","created_at":"2026-04-30 14:02:42","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":808558,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative hematoxylin and eosin (H\u0026amp;E)-stained sections of the heart, spleen, lung, and kidney from mice in the Normal group, NAFLD group, and NAFLD + LIPUS groups. Histological examination reveals normal tissue architecture and cellular morphology in all examined organs across treatment groups, with no evidence of LIPUS-associated pathological alterations such as inflammation, necrosis, or fibrosis. Scale bars: 100μm.\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-9376900/v1/efea0f88b6689f39caed67c5.png"},{"id":108977173,"identity":"9eb84b06-4be8-470d-ae93-81d800898702","added_by":"auto","created_at":"2026-05-11 11:30:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5273067,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9376900/v1/a21faf64-b6b7-4a30-a6b2-46e0473ab13b.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Biased Activation of Hepatic LXRα Signaling Mediates the Therapeutic Action of Low-Intensity Pulsed Ultrasound in Non-alcoholic Fatty Liver Disease","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNon-alcoholic fatty liver disease (NAFLD) has emerged as a predominant chronic liver condition worldwide, intricately linked to the escalating epidemics of obesity and type 2 diabetes [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Its pathological spectrum ranges from simple hepatic steatosis to non-alcoholic steatohepatitis (NASH), which can progress to fibrosis, cirrhosis, and ultimately hepatocellular carcinoma [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The multifaceted pathogenesis of NAFLD is often conceptualized by a \"multiple-hit\" model, where hepatic lipid accumulation (the \"first hit\") creates a permissive environment for subsequent \"hits\" including oxidative stress, mitochondrial dysfunction, and chronic inflammation, leading to progressive liver injury [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Despite its severe global health burden, current therapeutic options remain limited, primarily focusing on lifestyle modifications, with no universally approved pharmacotherapy, underscoring an urgent need for novel and effective treatment strategies [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eA central hurdle in NAFLD pharmacotherapy development is the intricate interplay between metabolic dysregulation and inflammation. The nuclear receptor Liver X Receptor alpha (LXRα) stands as a master regulator of hepatic cholesterol and lipid metabolism [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Upon activation, LXRα orchestrates the transcription of genes involved in reverse cholesterol transport, most notably cholesterol 7α-hydroxylase (CYP7A1), the rate-limiting enzyme in the classical pathway of bile acid synthesis from cholesterol [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. This makes LXRα an attractive therapeutic target for clearing hepatic cholesterol and triglycerides. However, the clinical application of synthetic LXRα agonists has been thwarted by a severe metabolic paradox: their beneficial effects on cholesterol disposal are accompanied by a robust induction of the lipogenic transcription factor Sterol Regulatory Element-Binding Protein-1c (SREBP-1c) and its downstream enzymes, leading to deleterious hepatic steatosis and hypertriglyceridemia [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. This conundrum has fueled the quest for strategies that can selectively harness the beneficial arm of LXRα signaling while circumventing its adverse effects\u0026mdash;a concept known as \"biased activation\" or \"differential modulation\".\u003c/p\u003e \u003cp\u003eLow-intensity pulsed ultrasound (LIPUS) is a non-invasive physical modality that has garnered attention beyond its traditional diagnostic and orthopedic applications [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Emerging evidence suggests that LIPUS can exert precise modulatory effects on cellular functions, including proliferation, differentiation, and inflammation, through mechanotransduction pathways [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Its ability to influence key signaling molecules and transcription factors positions LIPUS as a potential therapeutic tool for complex diseases like NAFLD [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Critically, the mechanical energy of LIPUS is postulated to be converted into intracellular biochemical signals through upstream sensors, potentially allowing for a modulation of pathways that is distinct from that of chemical agonists [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Moreover, emerging evidence supports the capacity of ultrasound-based modalities to engage specific nuclear receptor pathways. For instance, sonodynamic therapy has been demonstrated to activate the PPARγ-LXRα-ABCA1/ABCG1 axis, thereby promoting cholesterol efflux. These findings suggest that ultrasonic energy possesses an intrinsic, yet underexplored, potential to precisely tune metabolic transcription factors. This provides a compelling rationale for investigating its direct impact on the LXRα signaling hub in the context of NAFLD [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. We therefore sought to determine whether the therapeutic effect of LIPUS in NAFLD is mediated through the modulation of hepatic LXRα signaling.\u003c/p\u003e \u003cp\u003eIn this study, we present a comprehensive investigation into the efficacy and mechanism of LIPUS for the treatment of NAFLD. We first confirmed its potent effects on alleviating hepatic steatosis, dyslipidemia, insulin resistance, and inflammation in a murine model of NAFLD. Through a transcriptomic approach, we identified CYP7A1 as a key downstream effector. Subsequent mechanistic studies revealed that LIPUS acts through LXRα but achieves a selective activation profile: it robustly upregulates CYP7A1 and other cholesterol efflux transporters while simultaneously bypassing the induction of SREBP-1c. Furthermore, we delineate that this unique action is facilitated by an upstream signaling cascade that fine-tunes the LXRα response. Our findings establish LIPUS as a novel, non-invasive strategy that breaks the LXRα therapeutic paradox, offering a promising and precise therapeutic avenue for NAFLD.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eFor this experiment, 30 SPF male C57BL/6J mice, aged 4 to 5 weeks and weighing (18\u0026thinsp;\u0026plusmn;\u0026thinsp;2) g, were purchased from GemPharmatech (Nanjing, China). All animals were housed under stringent management and monitoring protocols to ensure their maintenance in a controlled environment with a temperature maintained at 22\u0026ndash;25\u0026deg;C, humidity at 45%\u0026plusmn;5%, and subjected to a regulated light/dark cycle of 12 hours each. They had unrestricted access to food and water. All animal experimental procedures were conducted in accordance with relevant ethical and legal regulations and received approval from the Institutional Animal Care and Use Committee (IACUC) (Approval Number: IACUC-CQMU-2025-05063). The standard diet (Catalog No.: 1010088; caloric ratio: fat\u0026thinsp;\u0026minus;\u0026thinsp;11.1%) was provided by the Experimental Animal Center of Chongqing Medical University, sourced from Jiangsu Collaborative Pharmaceutical Bioengineering Co., Ltd. The high-fat diet (Catalog No.: D12492; caloric ratio: fat\u0026thinsp;\u0026minus;\u0026thinsp;60%) was procured from Rexarch Diets.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eModeling and Grouping\u003c/h3\u003e\n\u003cp\u003eFollowing a one-week acclimatization period, the mice were randomly assigned to receive either a standard normal diet (Normal group, n\u0026thinsp;=\u0026thinsp;10) or a high-fat diet for 16 weeks. The high-fat diet (HFD)-fed mice were further divided into two groups: the NAFLD model group (n\u0026thinsp;=\u0026thinsp;10) and the NAFLD+LIPUS group (n\u0026thinsp;=\u0026thinsp;10). Body weight was monitored and recorded weekly throughout the study. At the endpoint of the 16-week dietary intervention, the successful induction of NAFLD was confirmed through in vivo ultrasonography, which demonstrated marked hepatomegaly and pronounced hepatic steatosis in HFD-fed mice, coupled with serum biochemical analyses that revealed significant impairments in liver function and lipid metabolism, consistent with established NAFLD characteristics [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eLow Intensity Pulsed Ultrasound Treatment\u003c/h3\u003e\n\u003cp\u003eThe LIPUS device used in this study was provided by Chongqing Ronghai Engineering Research Center of Ultrasound Medicine Co., Ltd. (China), designated as model USR-6. Device parameters, including intensity and acoustic pressure, were measured using dedicated equipment to ensure accuracy and consistency. Calibration of acoustic intensity and pressure was performed in degassed water using a radiation force balance (UPM-DT-1, Ohmic Instruments, USA) and a needle hydrophone (NHA-0400, ONDA Corporation, USA), respectively. During LIPUS irradiation, the target tissue area was exposed to ultrasonic waves via a transducer to induce mechanobiological effects. Following successful model establishment, mice underwent abdominal depilation, application of medical ultrasound coupling gel, and daily targeted LIPUS irradiation of the hepatic region for 10 consecutive days. A 25-mm-diameter probe, fixed throughout the procedure, delivered ultrasound with the following parameters are provided in this study: intensity of 200 mW/cm\u0026sup2;, duration of 20 minutes, fundamental frequency of 0.37 MHz, pulse repetition frequency of 1 kHz, and duty cycle of 20%. These parameters were optimized based on prior preclinical studies to ensure safety and efficacy [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Both NAFLD and Normal groups received daily sham treatments with the ultrasound probe disengaged from energy output.\u003c/p\u003e\n\u003ch3\u003eSerum biochemical indexes analysis\u003c/h3\u003e\n\u003cp\u003eAfter 16 weeks of HFD feeding and subsequent LIPUS intervention, mice in each group were fasted for 12 hours, followed by serum sample collection via retro-orbital sinus puncture. Serum biochemical indicators (aspartate transaminase [AST], alanine transaminase [ALT], total cholesterol [TC], triglycerides [TG], low-density lipoprotein cholesterol [LDL-C], high-density lipoprotein cholesterol [HDL-C]) were quantified using detection kits supplied by Nanjing Jiancheng Bioengineering Institute. The absorbance of each microplate well was measured with a microplate reader, and the level of each indicator was calculated accordingly.\u003c/p\u003e\n\u003ch3\u003eHistopathological staining\u003c/h3\u003e\n\u003cp\u003eLiver and other organ tissues were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned at 5\u0026micro;m thickness. For morphological assessment, sections were stained with Hematoxylin and Eosin (H\u0026amp;E). To visualize neutral lipids, frozen liver sections were prepared and stained with Oil Red O. All stained sections were examined and imaged under a light microscope.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eInsulin tolerance test (ITT) and Glucose tolerance test (GTT)\u003c/h2\u003e \u003cp\u003eFor the glucose tolerance test (GTT), mice were fasted for 16 hours and then intraperitoneally injected with a 20% D-glucose solution (2 g/kg body weight). For the insulin tolerance test (ITT), mice fasted for 6 hours were injected intraperitone with human insulin (0.75 U/kg body weight). Blood glucose levels were measured from the tail vein at 0, 15, 30, 60, 90and 120 minutes post-injection using a glucometer. The area under the curve (AUC) was calculated for each test. Following a 12-hour fasting period, tail vein blood samples were collected to measure fasting plasma glucose (FPG, mmol/L) and fasting insulin (FINS, \u0026micro;U/mL). Insulin resistance was evaluated using the homeostasis model assessment of insulin resistance (HOMA-IR) index, calculated as HOMA-IR= (FPG \u0026times; FINS)/22.5, with higher values indicating increased insulin resistance severity.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/h3\u003e\n\u003cp\u003e The concentrations of TNF-α, IL-1β, IL-6, IL-10 and Insulin in serum were determined using specific commercial ELISA kits (Jiangsu Jingmei Biotechnology Co., China) according to the manufacturer's instructions. The absorbance was measured at 450 nm using a microplate reader, and cytokine concentrations were interpolated from standard curves.\u003c/p\u003e\n\u003ch3\u003eRNA extraction and RNAseq analyses of liver tissue\u003c/h3\u003e\n\u003cp\u003eTotal RNA was isolated using the TRIzol Reagent (Invitrogen Life Technologies), after which the concentration, quality and integrity were determined using a NanoDrop spectrophotometer (Thermo Scientific). Three micrograms of RNA were used as input material for the RNA sample preparations. Sequencing libraries were generated according to the following steps. Firstly, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in an Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and Super Script II. Second strand cDNA synthesis was subsequently performed using DNA Polymerase I and RNase H. Remaining overhangs were converted into blunt ends via exonuclease/polymerase activities and the enzymes were removed. After adenylation of the 3\u0026prime; ends of the DNA fragments, Illumina PE adapter oligonucleotides were ligated to prepare for hybridization. To select cDNA fragments of the preferred 400\u0026ndash;500 bp in length, the library fragments were purified using the AMPure XP system (Beckman Coulter,Beverly, CA, USA). DNA fragments with ligated adaptor molecules on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. Products were purified (AMPure XP system) and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system (Agilent). The sequencing library was then sequenced on NovaSeq Xplus platform (Illumina).\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eRNA-Seq data analysis\u003c/h2\u003e \u003cp\u003eSamples are sequenced on the platform to get image files, which are transformed by the software of the sequencing platform, and the original data in FASTQ format (Raw Data) is generated. Sequencing data contains a number of connectors, low-quality Reads, so we use Cutadapt (v1.15) software to filter the sequencing data to get high quality sequence (Clean Data) for further analysis. we used HTSeq (0.9.1) statistics to compare the Read Count values on each gene as the original expression of the gene, and then used FPKM to standardize the expression. Then difference expression of genes was analyzed by DESeq (1.30.0) with screened conditions as follows: expression difference multiple |log2FoldChange| \u0026gt; 1, significant P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05. we mapped all the genes to Terms in the Gene Ontology database and calculated the numbers of differentially enriched genes in each Term. Using topGO to perform GO enrichment analysis on the differential genes, calculate P-value by hypergeometric distribution method (the standard of significant enrichment is P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and find the GO term with significantly enriched differential genes to determine the main biological functions performed by differential genes. ClusterProfiler (3.4.4) software was used to carry out the enrichment analysis of the KEGG pathway of differential genes, focusing on the significant enrichment pathway with P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eReal-time quantitative polymerase chain reaction (RT-qPCR)\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from frozen liver tissues using TRIzol reagent according to the manufacturer's protocol. RNA concentration and purity were determined using a NanoDrop spectrophotometer, and samples with an A260/A280 ratio between 1.8 and 2.0 were used for subsequent analysis, and RNA was reverse transcribed into cDNA using a Reverse Transcription Kit (TaKaRa Biotechnology Co, Ltd, Oita Prefecture, Japan). PCR reaction solution was prepared, template and primer were added, and the PCR amplification was performed by quantitative real-time polymerase chain reaction (qRT-PCR) instrument (Agilent Technologies Co, Ltd, CA).The PCR cycling conditions were as follows: initial denaturation at 95\u0026deg;C for 30 seconds, followed by 40 cycles of 95\u0026deg;C for 5 seconds and 60\u0026deg;C for 30 seconds. Gene expression levels were normalized to the housekeeping gene 18S and calculated using the comparative 2^(-ΔΔCt) method. All primer sequences used in this study are provided in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eRT-qPCR primer sequence\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence (5'\u0026rarr;3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003e18S\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: CGCCGCTAGAGGTGAAATTCT\u003c/p\u003e \u003cp\u003eReverse: CATTCTTGGCAAATGCTTTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCyp51\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TTGGTCGACTATGCTTCGTT\u003c/p\u003e \u003cp\u003eReverse: ACACTGGCTTCTTGTTCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFdft1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: AGTGTGCCAACTCAATGGGTCTGT\u003c/p\u003e \u003cp\u003eReverse: TGTATCTGCCCCACACCTCCTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSqle\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GTGGCTACCTCCTACCCATC\u003c/p\u003e \u003cp\u003eReverse: AAGGTCGCTGTCATGTCTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eNsdhl\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TGCAGGAGAGAGCAGTACTGGATGC\u003c/p\u003e \u003cp\u003eReverse: AGGATTGGGACCAACTGGGGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMsmo1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TCATTGAGGACACCTGGCAT\u003c/p\u003e \u003cp\u003eReverse: CCAAGGGATGTGCGTATTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eNceh1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: AAGGTCTTCTCCGAAAGTGAAGG\u003c/p\u003e \u003cp\u003eReverse: CCTCCGTGGATATAGATGACGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCyp7a1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TTGAAGCACAAGAACCTG\u003c/p\u003e \u003cp\u003eReverse: TTAGCCTTCTCCATGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ePcsk9\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TTGCCCCATGTGGAGTACATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: GGGAGCGGTCTTCCTCTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLipg\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: CCAAACCAAAAACCTGCTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: CGCCGGGAAGTAACAATAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eSrebp-1c\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TGACCCGGCTATTCCGTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: CTGGGCTGAGCAATACAGTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eFxr\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: CAGAAATGGCAACCAGTCATGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: AAATCTCCGCCGAACGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eBsep\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: AACTGAACTTGGAAAGGGGTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: AGCAGAGAAGGCCCTACAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eAbcg5\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TGGATCCAACACCTCTATGCTAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: GGCAGGTTTTCTCGATGAACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eAbcg8\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TGCCCACCTTCCACATGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: ATGAAGCCGGCAGTAAGGTAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence (IF)\u003c/h2\u003e \u003cp\u003eFollowing deparaffinization in xylene and rehydration through a graded ethanol series, tissue sections were subjected to antigen retrieval in sodium citrate buffer (pH 6.0). After permeabilization with 0.25% Triton X-100 and blocking, sections were incubated overnight at 4\u0026deg;C with primary antibodies against LXRα. After washing, the sections were incubated with fluorophore-conjugated secondary antibodies for 1 hour at room temperature protected from light. Nuclei were counterstained with DAPI. Fluorescence images were acquired using a laser scanning confocal microscope, and fluorescence intensity was quantified with ImageJ software from five randomly selected fields per slide.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eWestern Blotting (WB)\u003c/h2\u003e \u003cp\u003eTotal protein and nuclear protein from liver tissues were extracted using RIPA lysis buffer and a nuclear extraction kit (EX2550, Solarbio), respectively. Proteins were separated by SDS-PAGE, transferred to PVDF membranes, and blocked with 5% non-fat milk. The membranes were incubated overnight at 4\u0026deg;C with primary antibodies against LXRα, CYP7A1, SREBP-1c, Lamin B1, and β-Actin, followed by incubation with an HRP-conjugated secondary antibody. Protein bands were visualized using an ECL detection system and quantified with ImageJ software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Statistical analyses were performed using GraphPad Prism 9.0 and quantitative analyses were conducted with Image J software. Differences between two groups were analyzed by an unpaired two-tailed Student's t-test. Comparisons among multiple groups were evaluated by one-way analysis of variance (ANOVA) followed by Tukey's post-hoc test. A p-value of less than 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eSuccessful Establishment of a Mouse Model of NAFLD\u003c/h2\u003e \u003cp\u003eThe HFD feeding successfully induced a progressive and significant increase in body weight compared to the Normal group. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, the body weight of HFD-fed mice diverged from that of the Normal group after approximately 3 weeks and continued to increase throughout the 16-week period. At the endpoint, the body weight of the NAFLD group was significantly higher than that of the Normal group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The development of hepatic steatosis was confirmed by in vivo ultrasonography. Representative B-mode ultrasound images revealed a markedly brighter and more echogenic liver parenchyma in HFD-fed mice compared to the homogenous and hypoechoic appearance of livers from Normal mice, indicative of severe fat infiltration (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Serum biochemical analysis provided further evidence of liver dysfunction and metabolic disorder. As summarized in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, HFD-fed mice exhibited a substantial elevation in liver injury markers, with serum alanine AST and ALT levels being higher than those in the Normal group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Furthermore, the NAFLD group displayed a characteristic dyslipidemic profile, including significant increases in serum levels of TC, TG, and LDL-C, alongside a decrease in HDL-C. Collectively, all data profile unequivocally demonstrate the successful establishment of the NAFLD mouse model.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eLIPUS ameliorates HFD-induced liver injury and metabolic phenotypes\u003c/h2\u003e \u003cp\u003eThe therapeutic impact was first evident at the macroscopic level. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, NAFLD mice exhibited an obese phenotype, which was significantly ameliorated following LIPUS intervention. Livers from NAFLD mice exhibited the characteristic pale, swollen, and greasy appearance of severe steatosis. In stark contrast, livers from LIPUS-treated mice displayed a markedly improved morphology, with a dark red coloration and reduced size that closely resembled the livers of the Normal group. This visual improvement was further quantified by a significant reduction in the liver-to-body weight ratio in the LIPUS group compared to the NAFLD group; Consistent with the resolution of systemic metabolic dysfunction, LIPUS treatment also significantly reduced the mass of white adipose tissue in the abdomen, as indicated by a decreased adipose-to-body weight ratio (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Histopathological analysis provided definitive evidence for the alleviation of hepatic steatosis. HE staining revealed that HFD-fed mice presented extensive macrovesicular steatosis, with numerous large lipid droplets distending the hepatocytes and displacing the nuclei. LIPUS treatment dramatically reduced this lipid accumulation, resulting in a hepatic architecture that was largely restored to a normal state (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). The specific decrease in neutral lipids was confirmed by Oil Red O staining, which showed intense red staining throughout the HFD liver sections, while LIPUS-treated livers exhibited only minimal staining, comparable to the Normal controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Serum biochemical analysis provided further evidence for the reversal of liver dysfunction and metabolic syndrome. LIPUS treatment significantly ameliorated HFD-induced liver injury, as indicated by a substantial reduction in the circulating levels of ALT and AST. Furthermore, LIPUS comprehensively corrected the adverse lipid profile, leading to notable decreases in serum TC, TG, LDL-C, TBA, and CHO, while increasing the level of beneficial HDL-C (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Collectively, these data demonstrate that LIPUS intervention effectively reverses the key pathological hallmarks of NAFLD, including hepatomegaly, adipose tissue expansion, and most importantly, profound hepatic steatosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eLIPUS attenuates HFD-induced insulin resistance in NAFLD mice\u003c/h2\u003e \u003cp\u003eGiven the critical role of insulin resistance in the pathogenesis and progression of NAFLD, we next investigated whether the metabolic benefits of LIPUS extended to the improvement of systemic glucose homeostasis. We first performed a GTT and an ITT. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B, NAFLD mice exhibited severe glucose intolerance and insulin resistance, as evidenced by significantly elevated blood glucose levels throughout the GTT curve and an impaired glucose-lowering response in the ITT, compared to the Normal group. LIPUS treatment markedly improved systemic insulin sensitivity, leading to a significantly enhanced clearance of the glucose load in the GTT (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 vs. NAFLD group) and a steeper decline in blood glucose following insulin injection in the ITT (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 vs. NAFLD group). The total area under the curve (AUC) for both GTT and ITT was significantly reduced in the LIPUS-treated mice compared to the NAFLD controls (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-D). To further quantify the insulin resistance status, we measured fasting serum insulin levels and calculated the homeostasis model assessment of insulin resistance (HOMA-IR). Consistent with the functional tests, fasting insulin levels were substantially elevated in the NAFLD group. LIPUS treatment significantly lowered fasting insulin concentrations (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Consequently, the HOMA-IR index, a key indicator of insulin resistance, was significantly reduced in LIPUS group compared to the NAFLD group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF), demonstrating a robust improvement in insulin sensitivity at the systemic level. Taken together, these results unequivocally demonstrate that LIPUS intervention not only ameliorates hepatic steatosis but also effectively counteracts HFD-induced systemic insulin resistance, positioning it as a comprehensive therapeutic strategy for NAFLD.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eLIPUS Suppresses Systemic Inflammation in NAFLD Mice\u003c/h2\u003e \u003cp\u003eGiven the established link between systemic inflammation and insulin resistance in NAFLD, we next assessed whether LIPUS modulates the systemic inflammatory milieu. We measured the serum concentrations of key pro-inflammatory and anti-inflammatory cytokines using ELISA. Consistent with a state of chronic low-grade inflammation, NAFLD mice exhibited significantly elevated serum levels of the pro-inflammatory cytokines TNF-α, IL-1β, and IL-6 compared to the Normal group. LIPUS treatment effectively reversed this trend, resulting in a significant reduction in the circulating levels of all three pro-inflammatory mediators (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). In parallel, the serum concentration of the anti-inflammatory cytokine IL-10 was substantially lower in the NAFLD group than in the Normal controls. LIPUS intervention restored systemic IL-10 levels, demonstrating a concurrent enhancement of the anti-inflammatory response (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). Collectively, these findings demonstrate that LIPUS not only improves metabolic parameters but also systemically recalibrates the inflammatory balance in NAFLD, shifting the profile from a pro-inflammatory to an anti-inflammatory state.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eBiological duplication of transcriptome data\u003c/h2\u003e \u003cp\u003eTo unbiasedly elucidate the molecular mechanisms underlying the therapeutic effects of LIPUS, we performed RNA-sequencing (RNA-seq) on liver tissues from the Normal, NAFLD, and NAFLD+LIPUS groups. Principal component analysis (PCA) revealed a clear separation of the three groups, indicating distinct global transcriptomic profiles (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Comparative analysis identified a total of 776 differentially expressed genes (DEGs) between the Normal and NAFLD groups, and 608 DEGs between the NAFLD and NAFLD+LIPUS groups (cutoff: |log2FC|\u0026ge;1, p-adjusted\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Strikingly, among the most significantly upregulated genes in the LIPUS group compared to the NAFLD group was cytochrome P450 family 7 subfamily A member 1 (CYP7A1), the rate-limiting enzyme for bile acid synthesis from cholesterol (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). A Venn diagram analysis revealed an overlap of 150 common DEGs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). We subsequently performed Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis on these 150 overlapping DEGs. This unbiased approach conclusively identified \"Steroid biosynthesis\" and \"Cholesterol metabolism\" as the most significantly enriched pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-B), highlighting the central role of cholesterol homeostasis in the therapeutic action of LIPUS.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eValidation of the key DEGs in pathway analysis\u003c/h2\u003e \u003cp\u003eFrom this core gene set, we focused on key regulators within these enriched pathways for validation. Reverse transcription-quantitative PCR (RT-qPCR) analysis confirmed that the expression changes observed in the transcriptome data were robust and reproducible. Notably, cytochrome P450 family 7 subfamily A member 1 (CYP7A1), the rate-limiting enzyme in the classical pathway of bile acid synthesis from cholesterol, emerged as the most significantly upregulated gene by LIPUS (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Its mRNA expression was severely suppressed in the NAFLD group but was powerfully restored to levels exceeding the normal baseline after LIPUS treatment. In summary, our transcriptomic analysis, refined by a focus on NAFLD-reversed genes, unequivocally identifies the cholesterol metabolic pathway, and specifically the induction of CYP7A1, as a central mechanism in the resolution of NAFLD following LIPUS therapy.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eLIPUS selectively engages the beneficial arm of LXRα signaling\u003c/h2\u003e \u003cp\u003eOur transcriptomic data robustly pointed to cholesterol metabolism and CYP7A1 as the core downstream event. Given that CYP7A1 is a canonical target of the nuclear receptor LXRα, we hypothesized that LIPUS exerts its effects by modulating this key transcription factor. We first assessed the expression and subcellular localization of LXRα. Immunofluorescence (IF) analysis revealed that the total fluorescence intensity of LXRα was significantly weaker in the livers of NAFLD mice compared to the Normal group, indicating a suppression of LXRα expression in the NAFLD state. Strikingly, LIPUS treatment robustly enhanced the LXRα signal, restoring its expression to a level comparable to that of the normal controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). To determine whether this upregulated LXRα was functionally active, we isolated nuclear protein fractions and performed Western blot analysis. We found that LIPUS treatment led to a significant enrichment of LXRα protein within the nucleus compared to the NAFLD group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC), demonstrating that LIPUS not only upregulates LXRα expression but also promotes its nuclear translocation, a prerequisite for its transcriptional activity. Subsequently, we investigated the downstream transcriptional outcomes of LXRα activation. Western blot analysis of whole liver lysates demonstrated that LIPUS markedly upregulated the expression of CYP7A1. Crucially, and in stark contrast, the protein level of the lipogenic transcription factor SREBP-1c, another well-established LXRα target, remained unchanged following LIPUS treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). This \"biased\" gene expression profile was solidified at the mRNA level by RT-qPCR. LIPUS not only induced Cyp7a1 but also coordinately upregulated the expression of the bile acid export pump BSEP and the bile acid receptor FXR, thereby facilitating a complete \"synthesis-excretion-feedback\" regulatory loop for cholesterol clearance. Meanwhile, the mRNA expression of \"SREBP-1c\" was not elevated, effectively decoupling cholesterol catabolism from de novo lipogenesis (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). To further delineate the mechanism of cholesterol clearance, we examined the expression of ATP-binding cassette subfamily G member 5 and 8 (Abcg5/Abcg8), which form a heterodimer that mediates the direct secretion of cholesterol from hepatocytes into bile. Consistent with the activation of LXRα, the mRNA levels of both Abcg5 and Abcg8 were significantly downregulated in the livers of NAFLD mice and were robustly restored by LIPUS treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). Collectively, these results demonstrate that LIPUS achieves a therapeutically desirable \"biased activation\" of LXRα. It upregulates LXRα expression, promotes its nuclear translocation, and selectively transactivates a program dedicated to cholesterol disposal and bile acid homeostasis, while deftly avoiding the induction of the adverse lipogenic pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eTargeted metabolomics reveals LIPUS-induced reprogramming of hepatic metabolism\u003c/h2\u003e \u003cp\u003eTo gain a systemic view of the metabolic alterations underlying LIPUS therapy, we performed targeted metabolomics on liver tissues. To obtain a global view of the metabolic alterations, we first performed an unsupervised principal component analysis (PCA). The score plot revealed a clear separation among the three groups, indicating distinct metabolic states induced by HFD feeding and modified by LIPUS intervention (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). The orthogonal projections to latent structures-discriminant analysis (OPLS-DA) score plot showed a clear separation among the Normal, NAFLD, and NAFLD+LIPUS groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB), with robust model parameters (R2Y\u0026thinsp;=\u0026thinsp;0.997, Q2\u0026thinsp;=\u0026thinsp;0.821), indicating distinct metabolic states. Notably, the metabolic profile of the NAFLD+LIPUS group was not only distinct from the NAFLD group but was also completely separated from the Normal group, clustering on the opposite side of the NAFLD group. This distinct clustering suggests that NAFLD+LIPUS treatment does not simply revert the hepatic metabolome to the pre-disease state, but rather induces a unique, treatment-specific metabolic reprogramming. We next identified significantly altered metabolites using the criteria of a VIP score\u0026thinsp;\u0026gt;\u0026thinsp;1.0 from the OPLS-DA model and a p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Volcano plot visualization of the Normal vs. NAFLD comparison identified a widespread dysregulation of hepatic metabolites, with 115 metabolites significantly altered, highlighting the profound metabolic disturbance in NAFLD (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). In contrast, the volcano plot of the NAFLD vs. NAFLD+LIPUS comparison revealed a focused set of 158 significantly reversed metabolites (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD). Subsequently hierarchical clustering analysis of key LIPUS-reversed metabolites further elucidated the specific metabolic landscape remodeled by the therapy. The heatmap, generated from metabolites including steroid hormones, bile acid intermediates, and fatty acid derivatives, demonstrated a striking pattern: the metabolic profile of the NAFLD+LIPUS group clustered distinctly and exhibited a reversal trend towards the Normal Diet group, clearly segregating from the HFD cluster (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). Building upon the distinct metabolic profiles, we performed KEGG pathway enrichment analysis to identify the biological processes most significantly influenced by LIPUS. This unbiased approach pinpointed two pathways of paramount importance: the AMP-activated protein kinase (AMPK) signaling pathway and ABC transporters (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF). To substantiate the functional output of the LXRα-CYP7A1 axis activation, we quantified the hepatic levels of key bile acids and intermediates. The results revealed a complex yet informative reprogramming of the bile acid pool (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG). In summary, the coordinated yet differential changes in specific bile acid species provide direct metabolomic evidence that LIPUS not only stimulates the synthesis pathway but also promotes the efficient downstream processing and excretion of bile acids, thereby resolving the pathological bile acid retention characteristic of NAFLD.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eLIPUS treatment exhibits no overt toxicity in major organs\u003c/h2\u003e \u003cp\u003eTo comprehensively evaluate the biosafety profile of LIPUS therapy, histopathological analysis of major organs (heart, spleen, lungs, and kidneys) was performed across all experimental groups. Representative H\u0026amp;E-stained sections demonstrated that LIPUS-treated mice exhibited normal tissue architecture and cellular morphology in all examined organs, which were indistinguishable from those of the Normal and NAFLD model groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). The absence of any LIPUS-specific lesions or damage in these vital organs conclusively demonstrates the high biosafety and excellent tissue compatibility of this therapeutic intervention under the applied regimen.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe global burden of NAFLD and the absence of approved pharmacotherapies have fueled the search for novel therapeutic modalities [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. In this study, we present compelling evidence that establishes LIPUS as a potent and safe physical therapy for NAFLD. Our data delineate a previously unrecognized mechanism wherein LIPUS orchestrates a \"biased activation\" of the hepatic LXRα pathway, thereby reprogramming metabolic and inflammatory circuits to resolve liver steatosis and insulin resistance without triggering adverse effects.\u003c/p\u003e \u003cp\u003eThe most striking finding of our work is the resolution of the long-standing LXRα \"therapeutic paradox.\" While synthetic LXRα agonists invariably promote lipogenesis through SREBP-1c, leading to hepatic steatosis [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], LIPUS achieves a remarkable functional selectivity. It robustly promotes the nuclear translocation of LXRα and activates a beneficial transcriptional program encompassing Cyp7a1, \"ABCG5/G8\", and BSEP\u0026mdash;genes dedicated to cholesterol catabolism and efflux\u0026mdash;while concomitantly upregulating the FXR feedback axis to maintain metabolic homeostasis. Crucially, LIPUS treatment did not elevate \"SREBP-1c\" expression or its downstream lipogenic targets. This \"biased activation\" suggests that the mechanotransductive signals initiated by LIPUS engage a differential co-regulator recruitment landscape at the LXRα chromatin complex, favoring metabolic clearance over anabolic synthesis, a paradigm that warrants further investigation.\u003c/p\u003e \u003cp\u003eOur findings are further strengthened by the unbiased omics approaches. Transcriptomic profiling converged on cholesterol and steroid metabolism, with CYP7A1 emerging as the pivotal target. This was corroborated by targeted metabolomics, which not only confirmed the enrichment of the AMPK signaling pathway\u0026mdash;an upstream energy sensor known to phosphorylate and modulate LXRα activity [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u0026mdash;but also demonstrated a tangible increase in hepatic bile acids, the end-products of the CYP7A1 pathway. This positions the SIRT1/AMPK/LXRα/CYP7A1 axis as the central signaling cascade transducing LIPUS-mediated mechanical forces into a therapeutic metabolic response.\u003c/p\u003e \u003cp\u003eOur targeted metabolomics data provide a systems-level validation and deeper mechanistic insight into the metabolic reprogramming orchestrated by LIPUS. Crucially, the observed changes in specific bile acid species are not contradictory but rather form a coherent narrative of enhanced metabolic flux. The significant elevation of secondary bile acid precursors, such as dehydrolithocholic acid and 7,12-diketolithocholic acid, in LIPUS-treated livers directly corroborates the marked upregulation of Cyp7a1 at the transcriptional level, confirming an increased upstream drive in the bile acid synthesis pathway. Conversely, the reduction in the more hydroxylated bile acid, 3α,6β,7α,12α-tetrahydroxy-5β-cholanoic acid, is highly informative. This pattern suggests that LIPUS induces not merely an accumulation of intermediates, but a facilitated throughput\u0026mdash;newly synthesized bile acids are rapidly processed and shuttled out of the hepatocyte. This interpretation is strongly supported by our parallel findings of upregulated Bsep expression and decreased serum total bile acids. Therefore, the metabolomic signature shifts from a state of pathological retention in NAFLD to one of efficient clearance, effectively explaining the resolution of hepatic cholesterol overload at a functional level. Furthermore, the unbiased KEGG pathway analysis, which highlighted the \u0026ldquo;AMPK signaling pathway\u0026rdquo; and \u0026ldquo;ABC transporters\u0026rdquo;, perfectly bridges our molecular and metabolic findings. It posits AMPK as a potential upstream sensor translating the mechanical LIPUS signal into the activation of LXRα and its downstream excretory targets (e.g., ABCG5/G8, BSEP), thereby orchestrating the observed catabolic metabolic state. In summary, the metabolomics transcends correlation to reveal a dynamic, LIPUS-induced transition from static lipid accumulation to active sterol disposal, a process centrally governed by the biased LXRα activation network we have delineated.\u003c/p\u003e \u003cp\u003eBeyond metabolism, the efficacy of LIPUS extends to ameliorating systemic insulin resistance and suppressing chronic inflammation, as evidenced by improved GTT/ITT and normalized pro- and anti-inflammatory cytokine levels. These benefits are likely intertwined with the primary metabolic improvements. The reduction in hepatic lipid load alleviates lipotoxicity, a key driver of insulin resistance [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Furthermore, the enhanced flux of bile acids, which are known signaling molecules, through the FXR receptor can exert direct anti-inflammatory effects [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Therefore, LIPUS operates through a dual-plenary mechanism, simultaneously tackling the metabolic and inflammatory \"hits\" in NAFLD pathogenesis.\u003c/p\u003e \u003cp\u003eFinally, the translational potential of any novel therapy is contingent upon its safety. Our comprehensive histopathological analysis confirmed the absence of overt toxicity in vital organs, underscoring the non-invasive and tissue-compatible nature of LIPUS. This exceptional biosafety profile, combined with its potent efficacy, positions LIPUS as a highly attractive clinical candidate.\u003c/p\u003e \u003cp\u003eWhile this study establishes a coherent therapeutic pathway for LIPUS in NAFLD, certain mechanistic nuances warrant further investigation to fully solidify the causal chain. Primarily, although our data strongly associate LIPUS with the activation of the SIRT1/AMPK/LXRα axis and a subsequent biased transcriptional program, direct evidence that the mechanical signal is necessitated by these specific upstream sensors requires validation through loss-of-function models (e.g., conditional knockout or acute inhibition). Furthermore, the precise biochemical basis of LXRα's \"biased activation\"\u0026mdash;whether governed by differential co-regulator recruitment, specific post-translational modifications, or chromatin remodeling\u0026mdash;remains an open question that could be addressed by techniques such as ChIP-seq or interactome analysis. Despite these specific mechanistic depths to be plumbed, the robust multi-tiered evidence presented here\u0026mdash;spanning from whole-body phenotyping and serum biochemistry to transcriptomic, metabolomic, and molecular analyses\u0026mdash;conclusively demonstrates the efficacy and safety of LIPUS. This work not only positions LIPUS as a promising therapeutic strategy but also provides a definitive molecular framework and clear experimental roadmap for future research aimed at harnessing physical stimuli for precise metabolic reprogramming.\u003c/p\u003e \u003cp\u003eIn conclusion, our study unveils a novel, non-pharmacological strategy for NAFLD treatment. We mechanistically demonstrate that LIPUS functions as a precise modulator of hepatic LXRα, selectively enlisting its beneficial functions in cholesterol clearance while bypassing its detrimental lipogenic effects. By integrating metabolic reprogramming with anti-inflammatory action and an impeccable safety profile, LIPUS presents a groundbreaking therapeutic avenue with significant potential for clinical translation.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, this study demonstrates that LIPUS is a novel, effective, and safe physical therapy for NAFLD. We mechanistically decipher that LIPUS achieves its therapeutic effects through the biased activation of the hepatic LXRα signaling pathway, which selectively promotes a transcriptional program for cholesterol clearance and bile acid homeostasis via CYP7A1, ABCG5/G8, and BSEP, while concomitantly suppressing inflammation and critically avoiding SREBP-1c-mediated lipogenesis. Our work not only unveils LIPUS as a promising therapeutic strategy to overcome the longstanding challenge of targeting LXRα but also provides a foundational framework for the application of physical stimuli in the precise management of metabolic diseases.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe process of animal experiment was carried out strictly in accordance with the standards of the Ethics Committee of the Animal Experiment Center of Chongqing Medical University (production license number: SCXK-2020-034).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Science and Technology Research Program of Chongqing Municipal Education Commission (No. KJZD-M202200403), Program for Youth Innovation in Future Medicine, Chongqing Medical University (W0155), Science and Technology Program Project of the Xizang Autonomous Region (XZ202501ZY0120), Science and Technology Program Project of the Xizang Autonomous Regionand National Natural Science Foundation of China (12004059).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u003c/strong\u003e\u003cstrong\u003e\u0026rsquo;\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003econtributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eX.H. and Y.W. conceived and designed the experiment, and with the assistance of J.C., conducted the experiment and completed the manuscript. Y.X. and W.M completed the detection of experimental indicators. X.Z. and Y.C. conducted molecular experiments. J.Z. and Q.L. conducted animal experiments. X.H. and J.C. is responsible for supervising molecular and animal experiments. YW reviewed the manuscript and all data. All the authors contributed to writing and reviewing the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eByrne, C.D., Targher, G.: NAFLD: a multisystem disease. J. Hepatol. \u003cb\u003e62\u003c/b\u003e(1 Suppl), S47\u0026ndash;S64 (2015)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePowell, E.E., Wong, V.W., Rinella, M.: Non-alcoholic fatty liver disease. Lancet. \u003cb\u003e397\u003c/b\u003e(10290), 2212\u0026ndash;2224 (2021)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIpsen, D.H., Lykkesfeldt, J., Tveden-Nyborg, P.: Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell. Mol. Life Sci. \u003cb\u003e75\u003c/b\u003e(18), 3313\u0026ndash;3327 (2018)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerguson, D., Finck, B.N.: Emerging therapeutic approaches for the treatment of NAFLD and type 2 diabetes mellitus. Nat. Rev. Endocrinol. \u003cb\u003e17\u003c/b\u003e(8), 484\u0026ndash;495 (2021)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLei, K., Chen, Y., Wu, J., et al.: Mechanism of liver x receptor alpha in intestine, liver and adipose tissues in metabolic associated fatty liver disease. Int. J. Biol. Macromol. \u003cb\u003e307\u003c/b\u003e(Pt 4), 142275 (2025)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang, Z., Chen, Y., Gu, T., et al.: LXR-Mediated Regulation of Marine-Derived Piericidins Aggravates High-Cholesterol Diet-Induced Cholesterol Metabolism Disorder in Mice. J. Med. Chem. \u003cb\u003e64\u003c/b\u003e(14), 9943\u0026ndash;9959 (2021)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrinman, D.Y., Careaga, V.P., Wellberg, E.A., et al.: Liver X receptor-α activation enhances cholesterol secretion in lactating mammary epithelium. Am. J. Physiol. Endocrinol. Metab. \u003cb\u003e316\u003c/b\u003e(6), E1136\u0026ndash;E1145 (2019)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang, X., Savchenko, O., Li, Y., et al.: A Review of Low-Intensity Pulsed Ultrasound for Therapeutic Applications. IEEE Trans. Biomed. Eng. \u003cb\u003e66\u003c/b\u003e(10), 2704\u0026ndash;2718 (2019)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ed'Agostino, M.C., Craig, K., Tibalt, E., et al.: Shock wave as biological therapeutic tool: From mechanical stimulation to recovery and healing, through mechanotransduction. Int. J. Surg. \u003cb\u003e24\u003c/b\u003e(Pt B), 147\u0026ndash;153 (2015)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, B., Chen, H., Ouyang, J., et al.: SQSTM1-dependent autophagic degradation of PKM2 inhibits the production of mature IL1B/IL-1β and contributes to LIPUS-mediated anti-inflammatory effect. Autophagy. \u003cb\u003e16\u003c/b\u003e(7), 1262\u0026ndash;1278 (2020)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin, J., Chen, J., Wang, M., et al.: Ultrasound-driven ROS-scavenging nanobubbles for synergistic NASH treatment via FXR activation. Ultrason. Sonochem. \u003cb\u003e118\u003c/b\u003e, 107352 (2025)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarrison, A., Lin, S., Pounder, N., et al.: Mode \u0026amp; mechanism of low intensity pulsed ultrasound (LIPUS) in fracture repair. Ultrasonics. \u003cb\u003e70\u003c/b\u003e, 45\u0026ndash;52 (2016)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, H., Yang, Y., Sun, X., et al.: Sonodynamic therapy-induced foam cells apoptosis activates the phagocytic PPARγ-LXRα-ABCA1/ABCG1 pathway and promotes cholesterol efflux in advanced plaque. Theranostics. \u003cb\u003e8\u003c/b\u003e(18), 4969\u0026ndash;4984 (2018)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFlessa, C.M., Nasiri-Ansari, N., Kyrou, I., et al.: Genetic and Diet-Induced animal models for Non-Alcoholic Fatty Liver Disease (NAFLD) research. Int. J. Mol. Sci. \u003cb\u003e23\u003c/b\u003e(24), 15791 (2022)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQin, J., Chen, J., Xu, H., et al.: Low-intensity pulsed ultrasound promotes repair of 4-vinylcyclohexene diepoxide-induced premature ovarian insufficiency in SD rats. J. Gerontol. Biol. Sci. Med. Sci. \u003cb\u003e77\u003c/b\u003e(2), 221\u0026ndash;227 (2022)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, L., Xiao, X., Deng, J., et al.: Effects of Low-Intensity Pulsed Ultrasound on the Regulation of Free Fatty Acid Release in 3T3-L1 Cells. J. Ultrasound Med. \u003cb\u003e43\u003c/b\u003e(8), 1449\u0026ndash;1460 (2024)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYounossi, Z.M.: Non-alcoholic fatty liver disease - A global public health perspective. J. Hepatol. \u003cb\u003e70\u003c/b\u003e(3), 531\u0026ndash;544 (2019)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRudalska, R., Harbig, J., Snaebjornsson, M.T., et al.: LXRα activation and Raf inhibition trigger lethal lipotoxicity in liver cancer. Nat. Cancer. \u003cb\u003e2\u003c/b\u003e(2), 201\u0026ndash;217 (2021)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, J.Q., Li, L.L., Hu, A., et al.: Inhibition of ASGR1 decreases lipid levels by promoting cholesterol excretion. Nature. \u003cb\u003e608\u003c/b\u003e(7922), 413\u0026ndash;420 (2022)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng, D.C., Hu, J.Q., Mai, C.T., et al.: Liver X receptor inverse agonist SR9243 attenuates rheumatoid arthritis via modulating glycolytic metabolism of macrophages. Acta Pharmacol. Sin. \u003cb\u003e45\u003c/b\u003e(11), 2354\u0026ndash;2365 (2024)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJayasinghe, S.U., Tankeu, A.T., Amati, F.: Reassessing the Role of Diacylglycerols in Insulin Resistance. Trends Endocrinol. Metab. \u003cb\u003e30\u003c/b\u003e(9), 618\u0026ndash;635 (2019)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeiseler, M., Schwabe, R., Hampe, J., et al.: Immune mechanisms linking metabolic injury to inflammation and fibrosis in fatty liver disease - novel insights into cellular communication circuits. J. Hepatol. \u003cb\u003e77\u003c/b\u003e(4), 1136\u0026ndash;1160 (2022)\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Non-alcoholic fatty liver disease, Low-intensity pulsed ultrasound, Metabolic reprogramming","lastPublishedDoi":"10.21203/rs.3.rs-9376900/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9376900/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003eBackground\u003c/b\u003e\u003c/p\u003e \u003cp\u003eNon-alcoholic fatty liver disease (NAFLD) represents a pervasive global health challenge with limited therapeutic options. This study investigated the efficacy and underlying mechanism of Low-Intensity Pulsed Ultrasound (LIPUS), a non-invasive physical modality, for the treatment of NAFLD.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMethods\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA NAFLD mouse model was established by subjecting C57BL/6J mice to a high-fat diet (HFD) for 16 weeks. Mice were then treated with LIPUS targeted at the liver for 20 minutes daily over 10 days. The therapeutic effects were evaluated through metabolic phenotyping, histopathology, serum biochemistry, insulin/glucose tolerance tests, and ELISA. Unbiased transcriptomic sequencing, targeted metabolomics, and subsequent molecular biology assays were employed to decipher the mechanistic pathways.\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e\u003c/p\u003e \u003cp\u003eLIPUS treatment significantly attenuated hepatic steatosis, dyslipidemia, liver injury, systemic insulin resistance, and pro-inflammatory responses in HFD-fed mice. Transcriptomic and metabolomic analyses converged on cholesterol metabolism and the AMPK signaling pathway. Mechanistically, LIPUS was found to induce a \"biased activation\" of hepatic LXRα signaling. It robustly promoted the nuclear translocation of LXRα and the expression of its beneficial targets, including CYP7A1, ABCG5/G8, and BSEP, thereby enhancing cholesterol clearance and bile acid flux, while concurrently upregulating the FXR/SHP feedback axis. Crucially, LIPUS did not upregulate the lipogenic factor SREBP-1c, thus avoiding the adverse effects associated with conventional LXRα activation.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusion\u003c/b\u003e\u003c/p\u003e \u003cp\u003eLIPUS mediates a therapeutic metabolic-inflammatory reprogramming in NAFLD by selectively engaging the beneficial arm of the LXRα signaling pathway. This work positions LIPUS as a novel, safe, and promising non-invasive strategy for NAFLD treatment by successfully overcoming the longstanding LXRα therapeutic paradox.\u003c/p\u003e","manuscriptTitle":"Biased Activation of Hepatic LXRα Signaling Mediates the Therapeutic Action of Low-Intensity Pulsed Ultrasound in Non-alcoholic Fatty Liver Disease","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-30 14:02:37","doi":"10.21203/rs.3.rs-9376900/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"communications-biology","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"commsbio","sideBox":"Learn more about [Communications Biology](http://www.nature.com/commsbio/)","snPcode":"","submissionUrl":"","title":"Communications Biology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Communications Series","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"9207d4ff-53b3-4d7f-bf1b-bb4852fb2fb9","owner":[],"postedDate":"April 30th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":66742851,"name":"Health sciences/Endocrinology/Endocrine system and metabolic diseases/Obesity"},{"id":66742852,"name":"Biological sciences/Biochemistry/Metabolomics"}],"tags":[],"updatedAt":"2026-04-30T14:02:37+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-30 14:02:37","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9376900","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9376900","identity":"rs-9376900","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}