SIN3A/MIR22HG/Beclin1 Axis Regulates Both Autophagy and Ferroptosis in Lung Adenocarcinoma

SIN3A/MIR22HG/Beclin1 Axis Regulates Both Autophagy and Ferroptosis in Lung Adenocarcinoma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article SIN3A/MIR22HG/Beclin1 Axis Regulates Both Autophagy and Ferroptosis in Lung Adenocarcinoma Yongyang Chen, Miao Yin, Xiaobi Huang, Chang Liu, Yuexin Zheng, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4534782/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 10 You are reading this latest preprint version Abstract Through comprehensive analysis of long non-coding RNA expression profiles from RNA-Seq data, we identified that MIR22HG was significantly downregulated in lung adenocarcinoma and associated with poor patient prognosis. Subsequent animal studies confirmed its tumor-suppressive effects. We elucidated the mechanism by which MIR22HG exerts oncogenic suppression in lung adenocarcinoma, revealing that it mediates Beclin1 to activate signaling pathways for both autophagy and ferroptosis, thereby producing a combined oncogenic suppressive effect. Additionally, we demonstrated that SIN3A directly binds to MIR22HG, leading to its downregulation. This interaction inhibits both autophagy and ferroptosis via the MIR22HG network, contributing to a pro-oncogenic effect. These findings propose MIR22HG as a novel diagnostic, prognostic, and therapeutic marker for lung cancer. Furthermore, targeting the repressive effects of SIN3A on MIR22HG expression may enhance dual-targeted therapy approaches in clinical settings. Biological sciences/Cancer Biological sciences/Cell biology MIR22HG Beclin1 SIN3A Autophagy Ferroptosis Lung Adenocarcinoma Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 1. Introduction Lung cancer remains one of the malignancies with the highest incidence and mortality rates globally [ 1 ], with non-small cell lung cancer (NSCLC) comprising 80% of all cases [ 2 ]. The dismal prognostic outlook (15.7–18%, 5-year survival) is influenced by complex cellular, molecular, and tumour microenvironmental factors that provide a unique biological context for each case [ 3 ]. Recent studies increasingly highlight the crucial role of long non-coding RNAs (lncRNAs) in tumourigenesis and progression. We have previously established that the lncRNA MIR22HG [ 4 ] is expressed at low levels in lung adenocarcinoma tissues, whereas its high expression correlates significantly with improved clinical survival. Furthermore, MIR22HG has been shown to bind and stabilize the YBX1 protein, thereby activating cell survival and death pathways, which underscores its role as a tumor suppressor. These findings position MIR22HG as a promising diagnostic and prognostic marker for lung cancer, as well as a potential therapeutic target. However, the mechanisms underlying MIR22HG dysregulation and its precise role in regulating cell death signaling are not fully understood. Enhanced exploration of MIR22HG-regulated cell death pathways could provide deeper insights into the pathogenesis of lung cancer. SIN3A is a member of the SIN3 family of transcription-regulating proteins [ 5 ]. It features multiple structural domains that facilitate protein interactions, enabling it to promote or inhibit gene transcription. SIN3A suppresses transcription by forming a repressive complex with histone deacetylase (HDAC) [ 6 ]. This Sin3A/HDAC complex is involved in various biological functions including cell survival, cell cycle regulation, protein stabilization, and tumor suppression, while also maintaining cellular homeostasis. Research suggests that SIN3A expression levels may fluctuate in certain tumours, affecting tumor progression. In thoracic tumours, SIN3A serves as a key component of the co-repressor complex, engaging with protein targets to inhibit tumor growth. Nonetheless, findings regarding SIN3A's specific role across different tumor types are inconsistent, which complicates its potential as a therapeutic target. According to the GENECARDS database, SIN3A is capable of binding with MIR22HG. This interaction suggests a complex network involving SIN3A, MIR22HG, and Beclin1, which are pivotal in the pathogenesis of lung cancer (Scheme 1 ). Understanding these signalling pathways and regulators is essential for developing targeted therapeutic strategies and identifying new drug targets. 2. Materials and Methods Ethical statement This project was approved by the Research Ethics Committee of the Affiliated Hospital of Guangdong Medical University. Written informed consent was provided by each individual participant in the trial. The design and conduct of our study concerning human samples are compliant with our ethical permits and the Declaration of Helsinki. We confirming that all experiments were performed in accordance with relevant guidelines and regulations. All animal experiments were conducted in accordance with the ARRIVE guidelines. Cell lines and transfection H1299 and H1975 human NSCLC cell lines, which possess different metastatic potentials, were acquired from Kobio Biology (Nanjing, China). These cell lines were routinely tested for mycoplasma contamination and cultured in RPMI-1640 medium (Gibco) supplemented with 10% fetal bovine serum (Invitrogen) at 37°C in a 5% CO 2 humidified atmosphere. Cell transfections were carried out using using Lipofectamine® RNAiMAX Reagent (Invitrogen) following the manufacture’s instructions. Patient tissue samples and cell lines siRNA-mediated knockdown and Lentivirus-mediated overexpression. Lentiviral packaging and infection Recombinant lentiviral vectors for overexpressing MIR22HG and corresponding negative controls were designed and constructed by GenePharma Technology (Shanghai, China). H1299 and H1975 cells were seeded in six-well microtitre plates at 1×10 5 cells/well. At 30-40% confluence, cells were transfected with recombinant lentiviruses at a multiplicity of infection of 5. After 24 h, the medium was replaced with fresh medium. Cells were selected with 2 μg/mL puromycin 72 h post-transfection. Transfection efficiency was verified by inverted fluorescence microscopy (Mshot, Guangzhou, China), and RT-qPCR was employed to measure the expression levels of the target genes. Knockdown by siRNA For siRNA-mediated knockdown, cells were seeded at the appropriate density and incubated for 12 to 24 h. Subsequently, they were transfected with gene-specific siRNA or non-targeting siRNA at a final concentration of 10 μM using Lipofectamine® RNAiMax Reagent (Invitrogen) in OptiMEM medium, following the manufacturer's instructions. The sequences of the siRNAs used are provided in Table 1. Table 1. ThesiRNA sequences used in the experiments. siCtrl 5’-UUCUCCGAACGUGUCACGUTT-3’ 5’-ACGUGACACGUUCGGAGAATT-3 siMIR22HG-1 5’-GGGAGCGGACGCAGUGAUUTT-3’ 5’-AAUCACUGCGUCCGCUCCCTT-3 siMIR22HG-2 5’-GGAGUAGAAGGCUCAAACATT-3’ 5’-UGUUUGAGCCUUCUACUCCTT-3 siSIN3A-1 5’GCAGUCAGCUACGGGAAUUTT-3’ 5’AUUCCCGUAGCUGACUGCTT-3 siSIN3A-2 5’CCUCAGGUCUACAAUGAUUTT-3’ 5’AAUCAUUGUAGACCUGAGGTT-3 siBeclin1-1 5’CUGGACACGAGUUUCAAGATT-3’ 5’UCUUGAAACUCGUGUCCAGTT-3 siBeclin1-2 5’-GCUGCCGUUAUACUGUUCUTT-3’ 5’-AGAACAGUAUAACGGCAGCTT-3’ Tumor xenograft in vivo A total of 10 female BALB/c nude mice, 6 weeks old, were acquired from Guangdong Yaokang Biotechnology (Foshan, China). The mice were housed individually and had free access to food and water. H1975 cells (100 μl, 2 × 10 6 ), transfected with LV-NC or LV-MIR22HG, were injected subcutaneously into the dorsal flanks of the mice. The mice were randomly divided into two groups (5 mice/group): LV-NC group and LV-MIR22HG group. Xenografts were examined every 3 days using a digital caliper and tumour volumes were calculated using the formula (length x width 2 )/2. After 27 days, the mice were euthanized. Hold the root of the tail of the rat with the right hand and lift it, put it on the lid of the rat cage or other rough surface, press the head and neck of the animal with the left thumb and index finger, and hold the root of the tail of the rat with the right hand and pull it backward and upward, resulting in the dislocation of the cervical vertebra and the severed spinal cord and brain stemand. Tumor samples were collected and embedded in paraffin. The samples underwent immunohistochemical staining for Ki-67, followed by haematoxylin and eosin staining. mRFP-GFP-LC3 adenovirus transfection Autophagy flux was assessed in cells transfected with the autophagy tandem sensor mRFP-GFP-LC3. The mRFP-GFP-LC3 adenovirus (MOI = 70; genepharma, Shanghai, China) was introduced into the cells using 50% of the culture medium volume for a duration of 4 h. After the initial transfection period, cells stably expressing the virus were selected using puromycin at a concentration of 2ug/ml, and the cell population was expanded. Twenty-four hours post-siRNA transfection, autophagy was visualized under a fluorescence microscope in both the NC (negative control) group and the experimental groups (MIR22HG and SIN3A). Autophagy flux was quantitatively analyzed by counting the number of GFP and mRFP puncta, with at least 15 cells assessed per group. Western blotting LUAD cells were lysed to extract total proteins. Approximately 20 µg of protein extracts were separated using 12% SDS-PAGE under electrophoresis conditions of 80 V for 40 minutes followed by 120 V for 50 minutes. The separated proteins were then transferred onto PVDF membranes at 90 V for 50 min. The membranes were blocked using 3% BSA for 30 min and subsequently incubated overnight at 4°C with primary antibodies against Beclin1, LC3B, p62, SLC7A11, GPX4, and SIN3A (all diluted 1:1000, CST, Shanghai, China). Following several washes with TBST, the membranes were incubated with secondary antibodies for 2 h, protein bands were visualized using Luminata Western HRP substrates (Millipore) and detected with a Tanon 5200 chemiluminescence imaging system (Shanghai, China). Reverse transcription and quantitative PCR (RT-qPCR) Total RNAs were extracted from LUAD cells using TRIzol reagent (TaKaRa, Dalian, China), following the manufacturer's instructions. Cytoplasmic and nuclear RNAs were isolated using the RNA Subcellular Isolation Kit (Active Motif) according to previously described methods. Reverse transcription was performed on 500 ng of total RNA using the PrimeScript RT reagent Kit (TaKaRa, Dalian, China) with random primers. Quantitative PCR (qPCR) was conducted on the Roche LightCycler® 480 System using SYBR Premix Ex Taq (TaKaRa, Dalian, China) and gene-specific primers. The sequences of these primers are provided in Table 2. Table 2. The primer sequences used in the experiments. Primer Sequences GAPDH-F 5’- GTCAAGGCTGAGAACGGGAA -3’ GAPDH-R 5’- AAATGAGCCCCAGCCTTCTC -3’ MIR22HG-F 5’- AACTGAGAAGGGCGTAGGCG -3’ MIR22HG-R 5’- AAGTTGGAGAGCCTTTGCCC -3’ SIN3A-F 5’- CAGCTACGTCTCAAAGAACCTA -3’ SIN3A-R 5’- GCATGAATGGTGAACATCTCTC -3’ Beclin1-F 5’- GACACTCAGCTCAACGTCAC -3’ Beclin1-R 5’- CTGCCACTATCTTGCGGTTC -3’ Dual-luciferase reporter gene assay The promoter region of MIR22HG was analysed and predicted to interact with SIN3A using data from GENECARDS (https://www.genecards.org/). Plasmids containing MIR22HG wild-type, SIN3A, pRL-TK, PGL3-basic, and PGL3-control were constructed and separately transfected into H1299 cells. Detection of firefly luciferase and detection of sea cucumber luciferase activity using the Dual-Luciferase® reporter assay system. RNA immunoprecipitation (RIP) assay The EZ-Magna RIP™ RNA-binding protein immunoprecipitation kit (Millipore)was used for this assay. Cells were lysed in 100 µL of RIP lysis buffer, which included a protease inhibitor cocktail and DNase inhibitor. RNA-protein complexes were immunoprecipitated using a SIN3A antibody (5 µg) or control IgG at 4°C overnight. Magnetic beads were washed 6 times with washing buffer, and proteins were digested with protease K at 55°C. The Precipitated RNA was then reverse transcribed using random primers and analyzed by qPCR. Cell proliferation, transwell migration, and invasion assays The cell proliferation assay was conducted using the WST-1 kit (Beyotime Biotechnology, Shanghai, China). NSCLC cells were seeded at a density of 1,000 cells per well in 96-well plates and incubated for 24 h. Following this, the cells were transfected with siRNA and cultured for an additional 96 h. Optical density was measured at 450 nm after the addition of 10 μl WST-1 solution to 100 μl RPMI-1640 medium. Cell migration and invasion were assessed using transwell migration and Matrigel invasion assay (BD Falcon, San Jose, CA, USA), respectively, according to the manufacturer's instructions. For the transwell migration assay, 5 x 10 4 cells were suspended in 200 µl of serum-free RPMI-1640 medium and placed in a cell culture insert with an 8 µm pore size, over a plate filled with pre-warmed RPMI-1640 medium supplemented with 20% fetal bovine serum. After 12 h of incubation, cells were fixed with 4% paraformaldehyde. In the Matrigel invasion assay, 1 x 10 5 cells were added to a Matrigel-precoated insert and covered with pre-warmed RPMI-1640 medium containing 20% fetal bovine serum. Following a 24-h incubation, cells were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and imaged using a light microscope in randomly selected areas. Flow cytometry assays of ROS H2DCFDA (DCFH-DA) Reactive Oxygen Species Assay Kit (ROS Assay Kit) was used to detect ROS levels. Following 48 h post-transfection, cells were harvested and washed with PBS. DCFH-DA was diluted 1:1000 in serum-free culture medium to achieve a final concentration of 10 μmol/L. Cells were then resuspended in the diluted DCFH-DA at a concentration of one to twenty million cells/ml and incubated for 20 minutes at 37°C in a cell culture incubator. The mixture was inverted every 3-5 minutes to ensure complete contact between the probe and the cells. Subsequently, cells were washed three times with serum-free medium to remove excess DCFH-DA effectively. The cells were then analyzed by flow cytometry using BD FACSDiva6.1 software (BD Biosciences). Statistical analysis Data were derived from three independent experiments and expressed as mean ± SD. Survival curves were plotted using the Kaplan-Meier method and compared with the log-rank test. Statistical significance was assessed using Student’s t-test, unless otherwise specified, with a P-value of < 0.05 considered statistically significant. 3. Results 2.1. In vivo experiments to validate the inhibitory effect of MIR22HG in lung adenocarcinoma Firstly, we developed cell models with siRNA knockdown and lentivirus-mediated overexpression of MIR22HG (Figure 1A), confirmed by RT-qPCR analysis (Figure 1B). To evaluate the oncogenic impact of MIR22HG, we transfected H1975 lung adenocarcinoma cells with lentivirus that overexpressed MIR22HG (LV-MIR22HG group) and Ctrl lentivirus (LV-Ctrl group). Subsequently, we injected these cells subcutaneously (1,000,000 cells/100ul) into 4 to 6-week-old female nude mice and monitored tumor growth and final sizes. After 18 days, the LV-MIR22HG group exhibited a significantly smaller final tumour size compared to the LV-Ctrl group (Figure 1C-E). Additionally, the tumor growth rate analysis indicated that the LV-MIR22HG group's tumor growth was significantly slower than that of the LV-Ctrl group (Figure 1D). Upon euthanizing the mice, we performed immunohistochemistry on the collected subcutaneous tumors and noted a significant reduction in Ki67 expression in the LV-MIR22HG group compared to the control group (Figure 1F). 2.2. MIR22HG enhances proliferation, invasion and migration of lung adenocarcinoma cell by triggers autophagy Building on previous evidence of MIR22HG's tumor-suppressive role in ex vivo trials, we investigated its impact on autophagy within lung adenocarcinoma cells. Confocal microscopy following GFP-RFP-LC3 lentiviral labeling revealed reduced autophagic fluorescence in the MIR22HG knockdown group (Figure 2A). Western blot analysis confirmed that silencing MIR22HG decreased LC3B and Beclin1 expression, while increasing p62 levels (Figure 2B). Conversely, overexpressing MIR22HG elevated LC3B and Beclin1 levels and reduced p62 accumulation (Figure 2C), suggesting that MIR22HG positively regulates autophagy in these cells. Numerous studies have noted autophagy's role in supporting tumor growth [7]. To examine the effect of MIR22HG-driven autophagy on lung adenocarcinoma cell proliferation, we initially treated cells with chloroquine—an autophagy inhibitor that disrupts autophagosome-lysosome fusion. This treatment suppressed cell proliferation (Figure 2D). Furthermore, when chloroquine was administered to cells with lentiviral-induced overexpression of MIR22HG, both proliferation and invasive migration were notably inhibited (Figure 2E-F), underscoring that MIR22HG-mediated autophagy facilitates lung adenocarcinoma cell proliferation. 2.3. MIR22HG inhibits proliferation, invasion and migration of lung adenocarcinoma cells by activating ferroptosis LncRNAs are increasingly recognised as crucial regulators of ferroptosis and iron metabolism [8], associated with elevated ROS levels [9] and the downregulation of ferroptosis-related proteins (GPX4 and SLC7A11) [10]. Using the DCFH-DA kit, we measured ROS levels through flow cytometry, revealing that silencing MIR22HG decreased ROS accumulation in both H1975 and H1299 cells (Figure 3C). Western blot analysis indicated that MIR22HG silencing increased the expression of ferroptosis inhibitors such as SLC7A11 and GPX4 (Figure 3A), whereas MIR22HG overexpression decreased their expression. To explore the interplay between autophagy and ferroptosis, we tested the effects of chloroquine, which inhibits autophagosome-lysosome fusion, on cells overexpressing MIR22HG. Immunoblot results showed no significant changes in ferroptosis markers between the drug-treated and overexpression groups (Figure 3B), suggesting that blocking autophagosome-lysosome fusion does not significantly impact ferroptosis. This implies that MIR22HG may activate a signal pathway influencing both processes simultaneously, warranting further investigation. Ultimately, we assessed whether MIR22HG impacts lung adenocarcinoma proliferation via the ferroptosis pathway by introducing erastin, a ferroptosis inducer. We observed that erastin significantly inhibited cell proliferation in the treated groups (Figure 3D). Moreover, when erastin was applied to lung adenocarcinoma cells with silenced MIR22HG, it reversed the enhanced proliferation and migration observed (Figure 3E-F), confirming that MIR22HG-mediated ferroptosis suppresses lung adenocarcinoma cell proliferation. 2.4. MIR22HG facilitates both autophagy and ferroptosis in lung adenocarcinoma through Beclin1. Beclin1 is recognized as a crucial molecule in cellular autophagy [11], and its role in regulating ferroptosis warrants further exploration. Initially, we conducted experiments to genetically knock down Beclin1 in lung adenocarcinoma cells that overexpressed MIR22HG. Protein blotting analysis indicated that MIR22HG overexpression led to decreased expression of SLC7A11 and GPX4, while Beclin1 silencing reversed these effects (Figure 4A). Flow cytometry showed that ROS accumulation decreased in H1975 and H1299 cells following Beclin1 knockdown (Figure 4B-C), suggesting that Beclin1 positively influences ferroptosis in these cells. Additionally, to determine how MIR22HG interacts with Beclin1 and to assess potential binding, we conducted RIP experiments. The results revealed no significant increase in RNA associated with Beclin1 compared to the IgG control group, as detected by RT-qPCR of MIR22HG, indicating a lack of a direct binding relationship (Figure 4D). Collectively, these findings suggest that MIR22HG activates autophagy and ferroptosis via Beclin1 mediation. 2.5. SIN3A binds to MIR22HG as an RNA-binding protein and plays a pro-carcinogenic role in lung cancer To elucidate the molecular mechanism behind the downregulation of MIR22HG in lung adenocarcinoma, we identified its potential binding protein, SIN3A, using the GENECARDS database. The the relationship between MIR22HG and SIN3A was further explored using the Prediction of RNA-Protein Interactions platform at Iowa State University, USA. Although the dual-luciferase reporter assay suggested that SIN3A does not directly bind to the MIR22HG promoter (Figure 5A), RIP-qPCR results confirmed a significant enrichment of MIR22HG transcripts by the SIN3A-specific antibody (Figure 5B), indicating a complex formation between the two. We investigated the function of SIN3A in cell proliferation using siRNA gene silencing. Analysis of H1975 and H1299 cells using WST and Transwell assays demonstrated that silencing SIN3A significantly reduced cell proliferation, invasion, and migration compared to control siRNA (Figure 5E, 5H). These findings suggest that SIN3A may play a pro-carcinogenic role in lung adenocarcinoma cells. To explore the interaction between SIN3A and MIR22HG, we conducted a series of experiments in lung adenocarcinoma cells (H1975, H1299). RT-qPCR analysis post-SIN3A silencing showed an increase in MIR22HG expression (Figure 5D), while silencing MIR22HG resulted in decreased RNA and protein levels of SIN3A (Figure 5C-D). These results, along with their conflicting roles in autophagy and ferroptosis regulation, suggest that SIN3A acts as an upstream regulator of MIR22HG. Specifically, SIN3A binds to and inhibits MIR22HG, leading to its downregulation, which suppresses autophagy and ferroptosis, thereby promoting the proliferation of lung adenocarcinoma cells. Conversely, MIR22HG appears to positively regulate SIN3A.The results showed that siSIN3A proliferation capacity decreased, siMIR22HG proliferation capacity increased, and siSIN3A + siMIR22HG proliferation capacity reached an intermediate reversible state compared with the siCtrl group (Figure 5F-G ). Western blot analysis confirmed that levels of autophagy and ferroptosis-related proteins also reached an intermediate state following co-transfection of siSIN3A + siMIR22HG (Figure 5F). This supports the hypothesis that SIN3A's binding and inhibition of MIR22HG enhances lung adenocarcinoma proliferation by mediating critical cellular pathways. 2.6. Silencing of SIN3A enhances autophagy and ferroptosis in lung adenocarcinoma Functional experiments indicated that unlike MIR22HG, which suppresses oncogenic activity, SIN3A exerts a pro-oncogenic effect. Given that MIR22HG regulates autophagy and interacts with SIN3A, we investigated the impact of SIN3A silencing on autophagy. The efficacy of siRNA-mediated SIN3A silencing was verified by RT-qPCR, showing significant decreases in expression levels compared to the control group (siCtrl), thus successfully establishing the cell model (Figure 6C). In lung adenocarcinoma cells (H1975, H1299), transfected with GFP-RFP-LC3 fluorescent lentivirus, confocal microscopy revealed increased autophagic fluorescence in SIN3A-silenced cells (Figure 6A). Western blot analysis confirmed that SIN3A silencing upregulated autophagy markers LC3B-II and Beclin1 and reduced p62 levels, suggesting that SIN3A inhibition promotes autophagy in these cells (Figure 6B). We also investigated the impact of SIN3A downregulation on ferroptosis. Western blot analysis revealed that SIN3A knockdown decreased the expression of SLC7A11 and GPX4, proteins implicated in ferroptosis (Figure 6D). Additionally, we measured ROS levels using flow cytometry with the DCFH-DA kit, which indicated that silencing SIN3A resulted in increased ROS accumulation in H1975 and H1299 cells (Figure 6E). These findings demonstrate that SIN3A silencing promotes ferroptosis in lung adenocarcinoma cells. In conclusion, our data suggest that SIN3A may influence lung adenocarcinoma proliferation by modulating both autophagy and ferroptosis, mediated through the down-regulation of MIR22HG expression. 4. Discussion Lung cancer remains the deadliest cancer globally, characterized by its insidious onset and the current limitations of diagnostic technologies, which hinder early detection [12]. Groundbreaking targeted drug therapies have significantly advanced the treatment of patients with advanced lung cancer that test positive for driver genes [13]. Furthermore, our understanding of the genetic alterations that propel non-small cell lung cancer (NSCLC) is continually evolving. Many molecularly defined subtypes of NSCLC are potentially actionable, prompting ongoing exploration of new molecular diagnostic techniques and targeted therapies to detect and manage these subtypes [14]. LncRNAs have been identified as pivotal players in cancer physiopathology, functioning as oncogenes or tumor suppressors. However, only a small fraction of lncRNAs have been thoroughly characterized [15]. Previous research concluded that MIR22HG acts as an oncogene in lung adenocarcinoma. This study further corroborates its oncogenic role through in vivo experiments, thereby highlighting the need for a comprehensive exploration of MIR22HG's potential mechanisms that counteract tumor proliferation. Notably, the cell death pathways of autophagy and ferroptosis are integral to tumor development and progression. In this study, MIR22HG is investigated as a research target to unravel the mechanisms underlying these cell death pathways, providing critical foundational experimental evidence for its potential as a novel clinical tumor biomarker and therapeutic target. Autophagy exhibits a dual regulatory role in tumour development [16]. Protein blotting revealed that autophagy-related proteins LC3B and Beclin1 were downregulated [17], while p62 expression increased following MIR22HG silencing. LC3B, Beclin1, and p62 are commonly used markers in autophagy research (Figure 7). A decrease in p62 and an increase in the LC3-II/LC3-I ratio are indicative of autophagy activation [18]; at the onset of autophagy, LC3-I is converted to LC3-II through lipidation, accumulating in the double-membrane structure of the autophagic vesicle, which serves as a crucial marker for monitoring autophagy [19,20]. Using siRNA gene silencing and lentiviral overexpression for Western blot analysis, we demonstrated that MIR22HG silencing inhibits autophagy in lung adenocarcinoma cells. This was evidenced by a significant reduction in LC3-II protein levels and fewer green fluorescent spots from GFP-LC3, suggesting decreased autophagosome formation. Conversely, MIR22HG overexpression enhanced autophagy, as indicated by increased LC3-II protein levels due to MIR22HG upregulation. The overexpression was not verified by immunofluorescence because of the false positive results under laser confocal microscopy due to the lentiviral green fluorescence; Furthermore, an increase in Beclin1, a central protein in mammalian autophagy, suggests that autophagy is being activated [21]. Coincidentally, silencing MIR22HG resulted in a decrease in Beclin1, indicative of autophagy inhibition; conversely, overexpressing MIR22HG increased Beclin1 levels, suggesting autophagy activation. Therefore, the experiment showed that MIR22HG positively regulates autophagy in lung adenocarcinoma. We further explored how MIR22HG-induced autophagy affects lung adenocarcinoma proliferation. Compared with the Ctrl group, the addition of chloroquine alone blocked autophagy, which decreased the proliferation ability of lung adenocarcinoma, suggesting that the blockade of autophagy may have an inhibitory effect on the proliferation ability of lung adenocarcinoma cells. In addition, we observed that overexpression of MIR22HG decreased the proliferation of lung adenocarcinoma cells while enhancing autophagy. To determine if blocking autophagy would reverse this effect, we treated MIR22HG-overexpressing cells with chloroquine. The results showed a further decrease in proliferation, suggesting that MIR22HG-induced autophagy facilitates lung adenocarcinoma proliferation. This finding was corroborated by the invasive migration assay, which also concluded that MIR22HG-promoted autophagy enhances invasive migration. In conclusion, the activation of autophagy by MIR22HG does not play an oncogenic role. Therefore, we propose that MIR22HG may simultaneously activate another pathway to resist autophagy-promoted cell proliferation, thereby exerting a comprehensive oncogenic effect, and we further understand the molecular mechanism of MIR22HG oncogenic effect in lung cancer. Ferroptosis is a new type of iron-dependent programmed cell death that is distinct from apoptosis, necrosis and autophagy [22]. This process is primarily attributed to the deficiency of intracellular oxidoreductases, especially glutathione peroxidase 4 (GPX4) [23], coupled with increased accumulation of reactive oxygen species (ROS), factors implicated in various human diseases, including cancer [24]. Our findings indicate a decrease in intracellular ROS accumulation following MIR22HG silencing, suggesting a positive correlation between MIR22HG and the regulation of ferroptosis. In addition, GPX4 is now considered to be a major inhibitor of ferroptosis by scavenging ROS under oxidative stress, and its activity depends on glutathione production through activation of the cystine-glutamate counter transporter protein SLC7A11 [25]; a reduction in either leads to elevated ROS levels, thereby activating the ferroptosis pathway [26] In our experiments, silencing MIR22HG significantly upregulated the expression of ferroptosis-inhibitory proteins GPX4 and SLC7A11 in lung adenocarcinoma cells, while concurrently reducing ROS accumulation. This suggests that MIR22HG may suppress SLC7A11 and GPX4 activity (Figure 8A-B), resulting in increased ROS accumulation and potentially promoting oncogenesis. Most studies have shown that ferroptosis inhibits the proliferation, invasion and migration of malignant tumours [27]. We further explored the role of MIR22HG and ferroptosis in regulating lung adenocarcinoma proliferation. Proliferation was reduced by the addition of erastin, which induces ferroptosis, compared to the control group. Additionally, in the MIR22HG-silenced group where ferroptosis was inhibited, a reversible decrease in proliferation was noted upon the introduction of erastin-induced ferroptosis. The same outcome was confirmed in assays testing invasion and migration: ferroptosis induced by MIR22HG curtailed both invasion and migration of lung adenocarcinoma cells. MIR22HG activated both autophagy and ferroptosis, and both in vitro and ex vivo experiments have demonstrated its oncogenic effects. However, a review in oncology literature indicates that while apoptosis and autophagy can detrimentally impact tumor progression—depending on the tumor microenvironment—ferroptosis plays a pivotal role in either promoting or inhibiting tumour growth [28]. We therefore demonstrated that MIR22HG simultaneously activates the ferroptosis pathway and resists autophagy-driven cell proliferation, thereby exerting a comprehensive anti-cancer effect. Studies have reported that autophagy and ferroptosis can be induced and promoted by each other, and that these two processes can occur simultaneously and are co-regulated [29]. From our findings, it is clear that MIR22HG can activate both autophagy and ferroptosis,thereby inhibiting the proliferation of lung adenocarcinoma cells. When we added the autophagy inhibitor CQ to cells in which autophagy was promoted by MIR22HG overexpression, we found that the expression of GPX4 and SLC7A11, proteins associated with ferroptosis, was not significantly different from that of the former, suggesting that ferroptosis and autophagy might be activated by the same underlying mechanisms rather than being interdependent (Figure 8C-D). Research has shown that certain autophagy regulators also influence the ferroptosis pathway. Beclin1, a central molecule in autophagy [30], is implicated in the initial stages of autophagy involving LC3-related proteins, crucial for tumor development and progression [31]. Notably, AMPK-mediated phosphorylation of Beclin1 has been reported to promote ferroptosis [32], and USP11 has been found to regulate autophagy-dependent ferroptosis in spinal cord ischaemia/reperfusion injuries by deubiquitinating Beclin1 [33]. Another report suggested that Beclin1 may regulate ferroptosis by inhibiting the glutamate exchange activity of the xc (-) system [34]. A more direct view confirms BECN1 as a new driver of ferroptosis [35]. In our experiments, silencing Beclin1 not only suppressed ferroptosis and reduced ROS accumulation in lung adenocarcinoma cells but also reversed the effects of MIR22HG on GPX4 and SLC7A11 expression. These findings support the hypothesis that Beclin1 regulates MIR22HG in the co-regulation of autophagy and ferroptosis in lung adenocarcinoma. Furthermore, we expanded our research to explore the detailed mechanism by which MIR22HG regulates Beclin1, and to determine if there is a direct binding interaction between them. Results from RNA immunoprecipitation (RIP) experiments were negative, suggesting no direct binding between MIR22HG and Beclin1. In previous research, we confirmed that MIR22HG binds and stabilizes YBX1, which is involved in regulating cell survival and death signaling. Notably, a related study demonstrated that YBX1 influences autophagy via the p110β/Vps34/Beclin1 signalling pathway [36]. This implies that MIR22HG might indirectly regulate Beclin1 through its stabilization of YBX1, a hypothesis that requires further exploration to elucidate the connection between Beclin1 and YBX1. In addition, we investigated the oncogenic protein SIN3A as a potential cause for the low expression of MIR22HG in lung adenocarcinoma tissues. SIN3A was predicted to be the binding protein of MIR22HG by the GENECARDS website, and the relationship between MIR22HG and SIN3A binding was examined in the Prediction of RNA-Protein Interactions from Iowa State University, which indicated a binding factor of 0.89 (a value greater than 0.5 suggests a likely interaction). Functional experiments revealed that silencing the SIN3A gene reduced lung adenocarcinoma cell proliferation and invasive migration, while autophagy and ferroptosis-related proteins were upregulated, indicating that SIN3A promotes tumor proliferation via these pathways and is negatively associated with Beclin1, in contrast to MIR22HG (Figure 9). Given that SIN3A is known to act as a significant transcriptional repressor [37], we explored whether it could affect MIR22HG expression by modulating its transcription. This was assessed using a dual luciferase reporter assay, which yielded negative results, thus indicating no transcriptional regulation between SIN3A and MIR22HG. Further RNA immunoprecipitation (RIP) experiments demonstrated a significant increase in MIR22HG enriched by SIN3A, confirming a direct binding relationship between them. Additionally, the co-transfection recovery assay indicated that cell proliferation, along with autophagy and ferroptosis protein levels, exhibited an intermediate recovery state. Coupled with the RT-qPCR results, these findings suggest that SIN3A inhibits MIR22HG (Figure 10). Consequently, we conclude that SIN3A binds to and suppresses MIR22HG, thereby downregulating autophagy and ferroptosis, which in turn promotes the proliferation of lung adenocarcinoma cells. These results elucidate the regulatory impact of MIR22HG on the progression of lung adenocarcinoma. Currently, our studies confirm the direct binding and repression of MIR22HG by SIN3A; however, the precise mechanisms, potentially involving RNA modifications, remain to be detailed in further sequencing studies. In conclusion, our functional analysis revealed that silencing SIN3A inhibits the proliferation of lung adenocarcinoma cells. Mechanistic investigations have demonstrated that SIN3A interacts with and reduces MIR22HG expression, thereby modulating Beclin1-mediated autophagy and ferroptosis, which enhances tumor cell proliferation. The present study provides new ideas and directions for the potential mechanism of MIR22HG in the development of lung adenocarcinoma. Future work will focus on enhancing in vivo experiments to examine the effects of SIN3A on lung adenocarcinoma development more comprehensively and to further investigate the interplay between autophagy, ferroptosis, and their roles in cancer. 5. Conclusion Our previous study established that MIR22HG was significantly downregulated in both clinical LUAD tissues and cultured NSCLC cell lines, and its oncogenic effects were further confirmed through in vivo experiments. MIR22HG restricts the proliferation, invasion, and migration of NSCLC cells by modulating Beclin1 and simultaneously activating autophagy and ferroptosis. Furthermore, we elucidated the mechanism behind MIR22HG’s downregulation, demonstrating that the transcriptional repressor SIN3A binds to and downregulates MIR22HG. This interaction inhibits autophagy and ferroptosis, consequently promoting lung adenocarcinoma proliferation. These findings illuminate MIR22HG’s role as a regulator of cell survival in LUAD and position it as a novel potential predictive molecular marker for this cancer type. The direct binding and suppression of MIR22HG by SIN3A highlight SIN3A’s significant role in the regulation of MIR22HG. This research may pave the way for the development of new diagnostic and dual therapeutic targets in lung cancer treatment. Declarations Author Contributions: Conceptualization, W.S. and Y.C.; methodology, Y.C., M.Y., X.H., Y.Z., X.L., Y.J., and Y.L.; formal analysis, Y.C., X.H., and X.L. writing—original draft preparation, Y.C., H.Z., and X.X.; writing—review and editing, W.S. and C.L.; funding acquisition, W.S and F.N. All authors have read and agreed to the published version of the manuscript. Funding: This work was supported by the National Natural Science Foundation of China (82073388); The Affiliated Hospital of Guangdong Medical University Clinical Research Program (LCYJ2020B005); the Natural Outstanding Youth Fund of Guangdong Province (2022B1515020090); Guangdong Provincial Key Laboratory of Autophagy and Major Chronic Non-communicable Diseases (2022B1212030003). Guangzhou Science and Technology Plan Project (Grant No. 202102021238) Institutional Review Board Statement: All experimental procedures involving animals were approved by Guangdong Medical University and used in compliance with a local ethics committee (Permit Number: AHGDMU-LAC-Ⅰ(1)-2207-B007). Data Availability Statement: All the data obtained and/or analyzed during the current study are available from the corresponding authors on reasonable request. Conflicts of Interest: The authors declare no conflicts of interest. References Zhang, Y.; Luo, G.; Etxeberria, J.; Hao, Y. Global Patterns and Trends in Lung Cancer Incidence: A Population-Based Study. Journal of thoracic oncology: official publication of the International Association for the Study of Lung Cancer 2021, 16 , 933–944, doi: 10.1016/j.jtho.2021.01.1626 . Ye, Z.; Huang, Y.; Ke, J.; Zhu, X.; Leng, S.; Luo, H. Breakthrough in targeted therapy for non-small cell lung cancer. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 2021, 133 , 111079, doi: 10.1016/j.biopha.2020.111079 . Masi, I.; Caprara, V.; Bagnato, A.; Rosanò, L. Tumor Cellular and Microenvironmental Cues Controlling Invadopodia Formation. Frontiers in cell and developmental biology 2020, 8 , 584181, doi: 10.3389/fcell.2020.584181 . Su, W.; Feng, S.; Chen, X.; Yang, X.; Mao, R.; Guo, C.; Wang, Z.; Thomas, D.G.; Lin, J.; Reddy, R.M.; et al. Silencing of Long Noncoding RNA MIR22HG Triggers Cell Survival/Death Signaling via Oncogenes YBX1, MET, and p21 in Lung Cancer. Cancer research 2018, 78 , 3207–3219, doi: 10.1158/0008-5472.Can-18-0222 . Das, T.K.; Sangodkar, J.; Negre, N.; Narla, G.; Cagan, R.L. Sin3a acts through a multi-gene module to regulate invasion in Drosophila and human tumors. Oncogene 2013, 32 , 3184–3197, doi: 10.1038/onc.2012.326 . Kadamb, R.; Mittal, S.; Bansal, N.; Batra, H.; Saluja, D. Sin3: insight into its transcription regulatory functions. European journal of cell biology 2013, 92 , 237–246, doi: 10.1016/j.ejcb.2013.09.001 . Kimmelman, A.C.; White, E. Autophagy and Tumor Metabolism. Cell metabolism 2017, 25 , 1037–1043, doi: 10.1016/j.cmet.2017.04.004 . Yao, J.; Chen, X.; Liu, X.; Li, R.; Zhou, X.; Qu, Y. Characterization of a ferroptosis and iron-metabolism related lncRNA signature in lung adenocarcinoma. Cancer cell international 2021, 21 , 340, doi: 10.1186/s12935-021-02027-2 . Li, S.; He, Y.; Chen, K.; Sun, J.; Zhang, L.; He, Y.; Yu, H.; Li, Q. RSL3 Drives Ferroptosis through NF-κB Pathway Activation and GPX4 Depletion in Glioblastoma. Oxidative medicine and cellular longevity 2021, 2021 , 2915019, doi: 10.1155/2021/2915019 . Zheng, D.; Liu, J.; Piao, H.; Zhu, Z.; Wei, R.; Liu, K. ROS-triggered endothelial cell death mechanisms: Focus on pyroptosis, parthanatos, and ferroptosis. Frontiers in immunology 2022, 13 , 1039241, doi: 10.3389/fimmu.2022.1039241 . Li, X.; Yang, K.B.; Chen, W.; Mai, J.; Wu, X.Q.; Sun, T.; Wu, R.Y.; Jiao, L.; Li, D.D.; Ji, J.; et al. CUL3 (cullin 3)-mediated ubiquitination and degradation of BECN1 (beclin 1) inhibit autophagy and promote tumor progression. Autophagy 2021, 17 , 4323–4340, doi: 10.1080/15548627.2021.1912270 . Duma, N.; Santana-Davila, R.; Molina, J.R. Non-Small Cell Lung Cancer: Epidemiology, Screening, Diagnosis, and Treatment. Mayo Clinic proceedings 2019, 94 , 1623–1640, doi: 10.1016/j.mayocp.2019.01.013 . König, D.; Savic Prince, S.; Rothschild, S.I. Targeted Therapy in Advanced and Metastatic Non-Small Cell Lung Cancer. An Update on Treatment of the Most Important Actionable Oncogenic Driver Alterations. Cancers 2021, 13 , doi: 10.3390/cancers13040804 . Jonna, S.; Subramaniam, D.S. Molecular diagnostics and targeted therapies in non-small cell lung cancer (NSCLC): an update. Discovery medicine 2019, 27 , 167–170. Qi, P.; Du, X. The long non-coding RNAs, a new cancer diagnostic and therapeutic gold mine. Modern pathology: an official journal of the United States and Canadian Academy of Pathology, Inc 2013, 26 , 155–165, doi: 10.1038/modpathol.2012.160 . Onorati, A.V.; Dyczynski, M.; Ojha, R.; Amaravadi, R.K. Targeting autophagy in cancer. Cancer 2018, 124 , 3307–3318, doi: 10.1002/cncr.31335 . He, Y.; Zhao, X.; Subahan, N.R.; Fan, L.; Gao, J.; Chen, H. The prognostic value of autophagy-related markers beclin-1 and microtubule-associated protein light chain 3B in cancers: a systematic review and meta-analysis. Tumour biology: the journal of the International Society for Oncodevelopmental Biology and Medicine 2014, 35 , 7317–7326, doi: 10.1007/s13277-014-2060-4 . Alnafakh, R.A.A.; Adishesh, M.; Button, L.; Saretzki, G.; Hapangama, D.K. Telomerase and Telomeres in Endometrial Cancer. Frontiers in oncology 2019, 9 , 344, doi: 10.3389/fonc.2019.00344 . Nuta, G.C.; Gilad, Y.; Gershoni, M.; Sznajderman, A.; Schlesinger, T.; Bialik, S.; Eisenstein, M.; Pietrokovski, S.; Kimchi, A. A cancer associated somatic mutation in LC3B attenuates its binding to E1-like ATG7 protein and subsequent lipidation. Autophagy 2019, 15 , 438–452, doi: 10.1080/15548627.2018.1525476 . Agrotis, A.; Pengo, N.; Burden, J.J.; Ketteler, R. Redundancy of human ATG4 protease isoforms in autophagy and LC3/GABARAP processing revealed in cells. Autophagy 2019, 15 , 976–997, doi: 10.1080/15548627.2019.1569925 . Liang, N.; Liu, X.; Zhang, S.; Sun, H. The role of Beclin 1 in IR-induced crosstalk between autophagy and G2/M cell cycle arrest. Cellular signalling 2019, 62 , 109353, doi: 10.1016/j.cellsig.2019.109353 . Wang, H.H.; Ma, J.N.; Zhan, X.R. Circular RNA Circ_0067934 Attenuates Ferroptosis of Thyroid Cancer Cells by miR-545-3p/SLC7A11 Signaling. Frontiers in endocrinology 2021, 12 , 670031, doi: 10.3389/fendo.2021.670031 . Sha, W.; Hu, F.; Xi, Y.; Chu, Y.; Bu, S. Mechanism of Ferroptosis and Its Role in Type 2 Diabetes Mellitus. Journal of diabetes research 2021, 2021 , 9999612, doi: 10.1155/2021/9999612 . Sui, X.; Zhang, R.; Liu, S.; Duan, T.; Zhai, L.; Zhang, M.; Han, X.; Xiang, Y.; Huang, X.; Lin, H.; et al. RSL3 Drives Ferroptosis Through GPX4 Inactivation and ROS Production in Colorectal Cancer. Frontiers in pharmacology 2018, 9 , 1371, doi: 10.3389/fphar.2018.01371 . Chen, X.; Li, J.; Kang, R.; Klionsky, D.J.; Tang, D. Ferroptosis: machinery and regulation. Autophagy 2021, 17 , 2054–2081, doi: 10.1080/15548627.2020.1810918 . Yang, W.S.; SriRamaratnam, R.; Welsch, M.E.; Shimada, K.; Skouta, R.; Viswanathan, V.S.; Cheah, J.H.; Clemons, P.A.; Shamji, A.F.; Clish, C.B.; et al. Regulation of ferroptotic cancer cell death by GPX4. Cell 2014, 156 , 317–331, doi: 10.1016/j.cell.2013.12.010 . Zhang, Q.; Yi, H.; Yao, H.; Lu, L.; He, G.; Wu, M.; Zheng, C.; Li, Y.; Chen, S.; Li, L.; et al. Artemisinin Derivatives Inhibit Non-small Cell Lung Cancer Cells Through Induction of ROS-dependent Apoptosis/Ferroptosis. Journal of Cancer 2021, 12 , 4075–4085, doi: 10.7150/jca.57054 . Rabitha, R.; Shivani, S.; Showket, Y.; Sudhandiran, G. Ferroptosis regulates key signaling pathways in gastrointestinal tumors: Underlying mechanisms and therapeutic strategies. World journal of gastroenterology 2023, 29 , 2433–2451, doi: 10.3748/wjg.v29.i16.2433 . Liu, J.; Kuang, F.; Kroemer, G.; Klionsky, D.J.; Kang, R.; Tang, D. Autophagy-Dependent Ferroptosis: Machinery and Regulation. Cell chemical biology 2020, 27 , 420–435, doi: 10.1016/j.chembiol.2020.02.005 . Shi, B.; Ma, M.; Zheng, Y.; Pan, Y.; Lin, X. mTOR and Beclin1: Two key autophagy-related molecules and their roles in myocardial ischemia/reperfusion injury. Journal of cellular physiology 2019, 234 , 12562–12568, doi: 10.1002/jcp.28125 . Chen, X.; Sun, Y.; Wang, B.; Wang, H. Prognostic significance of autophagy-related genes Beclin1 and LC3 in ovarian cancer: a meta-analysis. The Journal of international medical research 2020, 48 , 300060520968299, doi: 10.1177/0300060520968299 . Song, X.; Zhu, S.; Chen, P.; Hou, W.; Wen, Q.; Liu, J.; Xie, Y.; Liu, J.; Klionsky, D.J.; Kroemer, G.; et al. AMPK-Mediated BECN1 Phosphorylation Promotes Ferroptosis by Directly Blocking System X(c)(-) Activity. Current biology: CB 2018, 28 , 2388–2399.e2385, doi: 10.1016/j.cub.2018.05.094 . Rong, Y.; Fan, J.; Ji, C.; Wang, Z.; Ge, X.; Wang, J.; Ye, W.; Yin, G.; Cai, W.; Liu, W. USP11 regulates autophagy-dependent ferroptosis after spinal cord ischemia-reperfusion injury by deubiquitinating Beclin 1. Cell death and differentiation 2022, 29 , 1164–1175, doi: 10.1038/s41418-021-00907-8 . Liu, R.; Li, X.; Zhao, G. Beclin1-mediated ferroptosis activation is associated with isoflurane-induced toxicity in SH-SY5Y neuroblastoma cells. Acta biochimica et biophysica Sinica 2019, 51 , 1134–1141, doi: 10.1093/abbs/gmz104 . Kang, R.; Zhu, S.; Zeh, H.J.; Klionsky, D.J.; Tang, D. BECN1 is a new driver of ferroptosis. Autophagy 2018, 14 , 2173–2175, doi: 10.1080/15548627.2018.1513758 . Cui, Y.; Li, F.; Xie, Q.; Zhao, S.; Guo, T.; Guo, P.; Hu, S.; Hao, J.; Tian, C.; Yu, W.; et al. YBX1 mediates autophagy by targeting p110β and decreasing the sensitivity to cisplatin in NSCLC. Cell death & disease 2020, 11 , 476, doi: 10.1038/s41419-020-2555-4 . Srivas, S.; Thakur, M.K. Transcriptional co-repressor SIN3A silencing rescues decline in memory consolidation during scopolamine-induced amnesia. Journal of neurochemistry 2018, 145 , 204–216, doi: 10.1111/jnc.14320 . Scheme 1 Scheme 1 is available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Scheme1.png Scheme 1. SIN3A binds and down-regulates MIR22G expression and mediates autophagy and ferroptosis pathways to inhibit lung cancer proliferation. Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 31 Mar, 2025 Reviews received at journal 30 Mar, 2025 Reviewers agreed at journal 04 Mar, 2025 Reviews received at journal 21 Nov, 2024 Reviewers agreed at journal 14 Nov, 2024 Reviewers invited by journal 16 Jul, 2024 Editor assigned by journal 16 Jul, 2024 Editor invited by journal 12 Jun, 2024 Submission checks completed at journal 10 Jun, 2024 First submitted to journal 05 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4534782","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":318075670,"identity":"91b37820-7bfb-4c65-8958-1d64b7cc90b0","order_by":0,"name":"Yongyang Chen","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yongyang","middleName":"","lastName":"Chen","suffix":""},{"id":318075671,"identity":"ef563757-2895-4929-8ddc-763aa2fa78e9","order_by":1,"name":"Miao Yin","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University","correspondingAuthor":false,"prefix":"","firstName":"Miao","middleName":"","lastName":"Yin","suffix":""},{"id":318075672,"identity":"6333f6d7-c656-452b-95d0-2865f5f1339a","order_by":2,"name":"Xiaobi Huang","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiaobi","middleName":"","lastName":"Huang","suffix":""},{"id":318075673,"identity":"5ab4f0fa-675a-4607-8786-9c85af0f60eb","order_by":3,"name":"Chang Liu","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University","correspondingAuthor":false,"prefix":"","firstName":"Chang","middleName":"","lastName":"Liu","suffix":""},{"id":318075674,"identity":"515ee36f-8623-4b1b-869c-13d239b0a2c8","order_by":4,"name":"Yuexin Zheng","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yuexin","middleName":"","lastName":"Zheng","suffix":""},{"id":318075675,"identity":"b5f9df37-51f4-421d-8c42-448bebb1e784","order_by":5,"name":"Honglian Zhou","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University","correspondingAuthor":false,"prefix":"","firstName":"Honglian","middleName":"","lastName":"Zhou","suffix":""},{"id":318075676,"identity":"e8bdd199-843b-4223-af2f-945d50387914","order_by":6,"name":"Xiao Lei","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"","lastName":"Lei","suffix":""},{"id":318075677,"identity":"a646508e-be19-489c-a499-a00e87b7d423","order_by":7,"name":"Yuetong Jiang","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yuetong","middleName":"","lastName":"Jiang","suffix":""},{"id":318075678,"identity":"749a458d-1163-4aea-b469-50583ac1fc13","order_by":8,"name":"Yanfeng Liang","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yanfeng","middleName":"","lastName":"Liang","suffix":""},{"id":318075679,"identity":"d53e5623-6bb3-4154-9a21-2f6c97a0eea6","order_by":9,"name":"Xiaoqing Xu","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoqing","middleName":"","lastName":"Xu","suffix":""},{"id":318075680,"identity":"949f7cf3-6b74-4f00-a7a9-4cfdcdf0679f","order_by":10,"name":"Feiyu Niu","email":"","orcid":"","institution":"Affiliated Cancer Hospital and Institute of Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Feiyu","middleName":"","lastName":"Niu","suffix":""},{"id":318075681,"identity":"cc385512-6762-4689-8f5b-71aa55d1e474","order_by":11,"name":"Zhixiong yang","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhixiong","middleName":"","lastName":"yang","suffix":""},{"id":318075682,"identity":"9220484e-ed88-423f-9adc-3263fb334959","order_by":12,"name":"Wenmei Su","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9UlEQVRIiWNgGAWjYBADHjb29oOPwUxm5gbitPDxnEk2ZmAwAGphJE4Lg5xEgpk0WAsDAS3yM3IMHxfm2MiwMSSkVRdU/Inmbwdq+VGxDacWgxs5xsYzt6XxsDEcPHZ7xhmD3BmHGRsYe87cxq1FInebNO+2wzxsjA1pt3nbDHIbgFqYGdtwa5Gfkbv9N++2/zxszAxmxSAt8wlpYbiRu42Zd9sBHjY2BjNmkJYNhLQYnHn/GeiwZB42Hp5kaZ4zxrkbgVoO4vOLfHta4mfebXb28vOfH/zMUyGXO+/84YMPflTgcRhWcIBE9aNgFIyCUTAK0AAA6atSULxHUaEAAAAASUVORK5CYII=","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University","correspondingAuthor":true,"prefix":"","firstName":"Wenmei","middleName":"","lastName":"Su","suffix":""}],"badges":[],"createdAt":"2024-06-05 14:24:45","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4534782/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4534782/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":59523951,"identity":"1f0468f2-bb78-46f5-9c88-5c43a2688196","added_by":"auto","created_at":"2024-07-02 20:42:48","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2245491,"visible":true,"origin":"","legend":"\u003cp\u003eIn vivo experiments confirming the tumor-suppressive effect of MIR22HG overexpression in xenografts. A: Inverted fluorescence microscope view of lentivirus-infected cells. B: RT-qPCR analysis of MIR22HG expression in the LV-MIR22HG and LV-Ctrl groups. C: Final tumor volume in the LV-MIR22HG and LV-Ctrl groups. D: Tumour growth rate over time in the LV-MIR22HG and LV-Ctrl groups. E: Extracted tumour volume in the LV-MIR22HG and LV-Ctrl groups. F: Ki67 expression in the LV-MIR22HG and LV-Ctrl groups.\u003c/p\u003e","description":"","filename":"1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4534782/v1/94310bf8cfdb996b3944297c.jpeg"},{"id":59525894,"identity":"156df062-8bae-44b1-869c-78af396b13cb","added_by":"auto","created_at":"2024-07-02 20:58:48","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1536493,"visible":true,"origin":"","legend":"\u003cp\u003eMIR22HG induces autophagy in lung adenocarcinoma cells and promotes tumor proliferation. A: Confocal microscopy of lung adenocarcinoma cells labeled with GFP-RFP-LC3 fluorescent lentivirus. B: Western blot analysis of MIR22HG silencing. C: Western blotting analysis of MIR22HG overexpression. D: Effects of chloroquine on lung adenocarcinoma cells. E: Effects of chloroquine on lung adenocarcinoma cells with lentiviral overexpression of MIR22HG. F: Cell invasion and migration following chloroquine treatment in lung adenocarcinoma cells overexpressing MIR22HG via lentivirus.\u003c/p\u003e","description":"","filename":"2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4534782/v1/93650fd4edbd948922ec56d7.jpeg"},{"id":59525144,"identity":"305b3bb4-0430-4767-ad9c-bdf1280a707b","added_by":"auto","created_at":"2024-07-02 20:50:48","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1721055,"visible":true,"origin":"","legend":"\u003cp\u003eMIR22HG induces ferroptosis in lung adenocarcinoma, inhibiting proliferation. A: ROS detection via Western blot in MIR22HG-silenced cells. B: ROS detection via Western blot in MIR22HG-overexpressed cells. C: ROS detection via flow cytometry in MIR22HG-silenced cells. D: Treatment of lung adenocarcinoma cells with erastin (ferroptosis inducer). E: Erastin treatment in lung adenocarcinoma cells with silenced MIR22HG gene. F: Impact of erastin on cell proliferation and invasive migration.\u003c/p\u003e","description":"","filename":"3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4534782/v1/7e6dcb9aa2c17410190a2958.jpeg"},{"id":59523953,"identity":"b2874a5f-91bf-4103-bcfa-2e8678782e8e","added_by":"auto","created_at":"2024-07-02 20:42:48","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":979177,"visible":true,"origin":"","legend":"\u003cp\u003eMIR22HG activates both autophagy and ferroptosis by mediating Beclin1. A: Western blot analysis showing MIR22HG activation of both autophagy and ferroptosis via Beclin1. B-C: ROS levels in H1975 and H1299 cells measured by flow cytometry following Beclin1 gene silencing. D: RIP experiments investigating the regulatory relationship between MIR22HG and Beclin1.\u003c/p\u003e","description":"","filename":"4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4534782/v1/e887cb6c945849d36fed02aa.jpeg"},{"id":59523955,"identity":"b9fb438a-cc6c-491d-9c57-acdb2b79e68b","added_by":"auto","created_at":"2024-07-02 20:42:48","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1682578,"visible":true,"origin":"","legend":"\u003cp\u003eSIN3A binds and down-regulates MIR22HG expression, exert a pro-cancer effect. A: Dual luciferase assay investigating whether SIN3A regulates MIR22HG. B: RIP-qPCR confirmation of the molecular interaction between MIR22HG and SIN3A. C: MIR22HG expression analyzed by RT-qPCR post-SIN3A silencing. D: SIN3A expression analyzed by RT-qPCR post-MIR22HG silencing. E: Modulation of cell proliferation, invasion, and migration by SIN3A following MIR22HG silencing. F-G: SIN3A binding and inhibition of MIR22HG expression mediates autophagy and ferroptosis, promoting lung adenocarcinoma proliferation. H: Pro-cancer effects of SIN3A in lung adenocarcinoma cells.\u003c/p\u003e","description":"","filename":"5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4534782/v1/8d94f1d891d0ee0097e4abe3.jpeg"},{"id":59523958,"identity":"ef577091-e469-4fcb-957f-d7601bef367f","added_by":"auto","created_at":"2024-07-02 20:42:48","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1092826,"visible":true,"origin":"","legend":"\u003cp\u003eSilencing SIN3A promotes autophagy and ferroptosis in lung adenocarcinoma. Dual luciferase (A) and western blotting (B) illustrates silencing of SIN3A to promote autophagy. Western blotting (C) and flow cytometry (D) illustrate silencing of SIN3A promotes ferroptosis. E: SIN3A silencing led to increased accumulation of ROS.\u003c/p\u003e","description":"","filename":"6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4534782/v1/7b12a74ef3a563dd41ef0477.jpeg"},{"id":59525895,"identity":"caf683d8-2cfa-44f3-a723-5e4a65ab5271","added_by":"auto","created_at":"2024-07-02 20:58:48","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":106092,"visible":true,"origin":"","legend":"\u003cp\u003eThe RNA and key proteins expression of autophagy regulated by MIR22HG. A: RNA expression of MIR22HG assessed by RT-qPCR following siRNA-mediated silencing. B-D：Statistically significant increases in Beclin1 and LC3B protein expression levels and decreases in p62 protein expression levels after overexpression of MIR22HG. E-G：Statistically significant decrease in Beclin1 and LC3B protein expression, and an increase in p62 protein expression after MIR22HG silencing. Data are presented as mean ± SD (*,P \u0026lt; 0.05; **, P \u0026lt; 0.01).\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4534782/v1/70ec16bf83cad41fe39210ea.png"},{"id":59525148,"identity":"b1b558f2-da4f-4c5a-8d6e-94ac7c3d581e","added_by":"auto","created_at":"2024-07-02 20:50:48","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":86515,"visible":true,"origin":"","legend":"\u003cp\u003eStatistical analysis of ferroptosis-related proteins overexpression and silencing by MIR22HG. A-B：Western blot analysis indicated that the expression levels of SLC7A11 and GPX4 proteins were significantly higher following MIR22HG silencing compared to the control group, with statistically significant differences. C-D：Western blot analysis demonstrated that the expression levels of SLC7A11 and GPX4 proteins were significantly reduced following MIR22HG overexpression, with statistically significant differences. Data are mean ± SD (*,P \u0026lt; 0.05; **, P \u0026lt; 0.01).\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-4534782/v1/e906d0874223c8e8a6adf2da.png"},{"id":59523961,"identity":"eb3d8f5f-a59d-4010-bd2d-1e893d29a45c","added_by":"auto","created_at":"2024-07-02 20:42:48","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":116666,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown of sin3a activates autophagy and ferroptosis. A: RNA expression of SIN3A assessed via RT-qPCR post-siRNA silencing. B-C: Western blot results show a statistically significant decrease in the protein expression levels of SLC7A11 and GPX4 after SIN3A silencing. D-F: Post-SIN3A silencing, there was a significant increase in the expression levels of the autophagy markers Beclin1 and LC3B, and a decrease in the p62 protein level, as confirmed by statistical analysis. Data are mean ± SD (*,P \u0026lt; 0.05; **, P \u0026lt; 0.01).\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-4534782/v1/a40c73b005a3939730aad787.png"},{"id":59523957,"identity":"ccb214d1-8871-45d6-b321-936872cf2f39","added_by":"auto","created_at":"2024-07-02 20:42:48","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":53557,"visible":true,"origin":"","legend":"\u003cp\u003eRescue experiments confirmed that SIN3A suppresses MIR22HG expression upstream. A: Rescue experiments demonstrated that the expression of proteins related to autophagy and ferroptosis reached an intermediate state following co-transfection of lung adenocarcinoma cells with siSIN3A and siMIR22HG. B: Western blot analysis showed a reduction in SIN3A protein levels following MIR22HG silencing compared to the control group.\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-4534782/v1/84191ec51204e6e06db2bf8b.png"},{"id":59526232,"identity":"61ac1cd9-e33d-49fe-94bb-b1cc977201a0","added_by":"auto","created_at":"2024-07-02 21:06:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":10074758,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4534782/v1/fa978b45-2d04-4308-8c9d-060ddf93d0fd.pdf"},{"id":59525147,"identity":"44d5533c-de87-4b4d-9a1e-a0e51a21bec9","added_by":"auto","created_at":"2024-07-02 20:50:48","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":166878,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eScheme 1. \u003c/strong\u003eSIN3A binds and down-regulates MIR22G expression and mediates autophagy and ferroptosis pathways to inhibit lung cancer proliferation.\u003c/p\u003e","description":"","filename":"Scheme1.png","url":"https://assets-eu.researchsquare.com/files/rs-4534782/v1/733e1203bc57d02d4c1e12f2.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"SIN3A/MIR22HG/Beclin1 Axis Regulates Both Autophagy and Ferroptosis in Lung Adenocarcinoma","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eLung cancer remains one of the malignancies with the highest incidence and mortality rates globally [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], with non-small cell lung cancer (NSCLC) comprising 80% of all cases [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The dismal prognostic outlook (15.7\u0026ndash;18%, 5-year survival) is influenced by complex cellular, molecular, and tumour microenvironmental factors that provide a unique biological context for each case [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Recent studies increasingly highlight the crucial role of long non-coding RNAs (lncRNAs) in tumourigenesis and progression.\u003c/p\u003e \u003cp\u003eWe have previously established that the lncRNA MIR22HG [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] is expressed at low levels in lung adenocarcinoma tissues, whereas its high expression correlates significantly with improved clinical survival. Furthermore, MIR22HG has been shown to bind and stabilize the YBX1 protein, thereby activating cell survival and death pathways, which underscores its role as a tumor suppressor. These findings position MIR22HG as a promising diagnostic and prognostic marker for lung cancer, as well as a potential therapeutic target. However, the mechanisms underlying MIR22HG dysregulation and its precise role in regulating cell death signaling are not fully understood. Enhanced exploration of MIR22HG-regulated cell death pathways could provide deeper insights into the pathogenesis of lung cancer.\u003c/p\u003e \u003cp\u003eSIN3A is a member of the SIN3 family of transcription-regulating proteins [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. It features multiple structural domains that facilitate protein interactions, enabling it to promote or inhibit gene transcription. SIN3A suppresses transcription by forming a repressive complex with histone deacetylase (HDAC) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. This Sin3A/HDAC complex is involved in various biological functions including cell survival, cell cycle regulation, protein stabilization, and tumor suppression, while also maintaining cellular homeostasis. Research suggests that SIN3A expression levels may fluctuate in certain tumours, affecting tumor progression. In thoracic tumours, SIN3A serves as a key component of the co-repressor complex, engaging with protein targets to inhibit tumor growth. Nonetheless, findings regarding SIN3A's specific role across different tumor types are inconsistent, which complicates its potential as a therapeutic target. According to the GENECARDS database, SIN3A is capable of binding with MIR22HG. This interaction suggests a complex network involving SIN3A, MIR22HG, and Beclin1, which are pivotal in the pathogenesis of lung cancer (Scheme \u003cspan refid=\"Sch1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Understanding these signalling pathways and regulators is essential for developing targeted therapeutic strategies and identifying new drug targets.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eEthical statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis project was approved by the Research Ethics Committee of the Affiliated Hospital of Guangdong Medical University.\u0026nbsp;Written informed consent was provided by each individual participant in the trial. The design and conduct of our study concerning human samples are compliant with our ethical permits and the Declaration of Helsinki. We\u0026nbsp;confirming that all experiments were performed in accordance with relevant guidelines and regulations.\u0026nbsp;All animal experiments were conducted in accordance with the ARRIVE guidelines.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell lines and transfection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eH1299 and H1975 human NSCLC cell lines, which possess different metastatic potentials, were acquired from Kobio Biology (Nanjing, China). These cell lines were routinely tested for mycoplasma contamination and cultured in RPMI-1640 medium (Gibco) supplemented with 10% fetal bovine serum (Invitrogen) at 37\u0026deg;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e humidified atmosphere. Cell transfections were carried out using using Lipofectamine\u0026reg; RNAiMAX Reagent (Invitrogen) following the manufacture\u0026rsquo;s instructions. Patient tissue samples and cell lines siRNA-mediated knockdown and Lentivirus-mediated overexpression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLentiviral packaging and infection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRecombinant lentiviral vectors for overexpressing MIR22HG and corresponding negative controls were designed and constructed by GenePharma Technology (Shanghai, China). H1299 and H1975 cells were seeded in six-well microtitre plates at 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/well. At 30-40% confluence, cells were transfected with recombinant lentiviruses at a multiplicity of infection of 5. After 24 h, the medium was replaced with fresh medium. Cells were selected with 2 \u0026mu;g/mL puromycin 72 h post-transfection. Transfection efficiency was verified by inverted fluorescence microscopy (Mshot, Guangzhou, China), and RT-qPCR was employed to measure the expression levels of the target genes.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eKnockdown by siRNA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor siRNA-mediated knockdown, cells were seeded at the appropriate density and incubated for 12 to 24 h. Subsequently, they were transfected with gene-specific siRNA or non-targeting siRNA at a final concentration of 10 \u0026mu;M using Lipofectamine\u0026reg; RNAiMax Reagent (Invitrogen) in OptiMEM medium, following the manufacturer\u0026apos;s instructions. The sequences of the siRNAs used are provided in Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1.\u0026nbsp;\u003c/strong\u003eThesiRNA sequences used in the experiments.\u003c/p\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"528\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"34.09090909090909%\" valign=\"top\"\u003e\n \u003cp\u003esiCtrl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"65.9090909090909%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;-UUCUCCGAACGUGUCACGUTT-3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003e5\u0026rsquo;-ACGUGACACGUUCGGAGAATT-3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"34.09090909090909%\" valign=\"top\"\u003e\n \u003cp\u003esiMIR22HG-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"65.9090909090909%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;-GGGAGCGGACGCAGUGAUUTT-3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003e5\u0026rsquo;-AAUCACUGCGUCCGCUCCCTT-3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"34.09090909090909%\" valign=\"top\"\u003e\n \u003cp\u003esiMIR22HG-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"65.9090909090909%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;-GGAGUAGAAGGCUCAAACATT-3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003e5\u0026rsquo;-UGUUUGAGCCUUCUACUCCTT-3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"34.09090909090909%\" valign=\"top\"\u003e\n \u003cp\u003esiSIN3A-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"65.9090909090909%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;GCAGUCAGCUACGGGAAUUTT-3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003e5\u0026rsquo;AUUCCCGUAGCUGACUGCTT-3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"34.09090909090909%\" valign=\"top\"\u003e\n \u003cp\u003esiSIN3A-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"65.9090909090909%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;CCUCAGGUCUACAAUGAUUTT-3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003e5\u0026rsquo;AAUCAUUGUAGACCUGAGGTT-3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"34.09090909090909%\" valign=\"top\"\u003e\n \u003cp\u003esiBeclin1-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"65.9090909090909%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;CUGGACACGAGUUUCAAGATT-3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003e5\u0026rsquo;UCUUGAAACUCGUGUCCAGTT-3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"34.09090909090909%\" valign=\"top\"\u003e\n \u003cp\u003esiBeclin1-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"65.9090909090909%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;-GCUGCCGUUAUACUGUUCUTT-3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003e5\u0026rsquo;-AGAACAGUAUAACGGCAGCTT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eTumor xenograft in vivo\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 10 female BALB/c nude mice, 6 weeks old, were acquired from Guangdong Yaokang Biotechnology (Foshan, China). The mice were housed individually and had free access to food and water. H1975 cells (100 \u0026mu;l, 2 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e), transfected with LV-NC or LV-MIR22HG, were injected subcutaneously into the dorsal flanks of the mice. The mice were randomly divided into two groups (5 mice/group): LV-NC group and LV-MIR22HG group. Xenografts were examined every 3 days using a digital caliper and tumour volumes were calculated using the formula (length x width\u003csup\u003e2\u003c/sup\u003e)/2. After 27 days, the mice were euthanized.\u0026nbsp;\u0026nbsp;Hold the root of the tail of the rat with the right hand and lift it, put it on the lid of the rat cage or other rough surface, press the head and neck of the animal with the left thumb and index finger, and hold the root of the tail of the rat with the right hand and pull it backward and upward, resulting in the dislocation of the cervical vertebra and the severed spinal cord and brain stemand. Tumor samples were collected and embedded in paraffin. The samples underwent immunohistochemical staining for Ki-67, followed by haematoxylin and eosin staining.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003emRFP-GFP-LC3 adenovirus transfection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAutophagy flux was assessed in cells transfected with the autophagy tandem sensor mRFP-GFP-LC3. The mRFP-GFP-LC3 adenovirus (MOI = 70; genepharma, Shanghai, China) was introduced into the cells using 50% of the culture medium volume for a duration of 4 h. After the initial transfection period, cells stably expressing the virus were selected using puromycin at a concentration of 2ug/ml, and the cell population was expanded. Twenty-four hours post-siRNA transfection, autophagy was visualized under a fluorescence microscope in both the NC (negative control) group and the experimental groups (MIR22HG and SIN3A). Autophagy flux was quantitatively analyzed by counting the number of GFP and mRFP puncta, with at least 15 cells assessed per group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLUAD cells were lysed to extract total proteins. Approximately 20 \u0026micro;g of protein extracts were separated using 12% SDS-PAGE under electrophoresis conditions of 80 V for 40 minutes followed by 120 V for 50 minutes. The separated proteins were then transferred onto PVDF membranes at 90 V for 50 min. The membranes were blocked using 3% BSA for 30 min and subsequently incubated overnight at 4\u0026deg;C with primary antibodies against Beclin1, LC3B, p62, SLC7A11, GPX4, and SIN3A (all diluted 1:1000, CST, Shanghai, China). Following several washes with TBST, the membranes were incubated with secondary antibodies for 2 h, protein bands were visualized using Luminata Western HRP substrates (Millipore) and detected with a Tanon 5200 chemiluminescence imaging system (Shanghai, China). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReverse transcription and quantitative PCR (RT-qPCR)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNAs were extracted from LUAD cells using TRIzol reagent (TaKaRa, Dalian, China), following the manufacturer\u0026apos;s instructions. Cytoplasmic and nuclear RNAs were isolated using the RNA Subcellular Isolation Kit (Active Motif) according to previously described methods. Reverse transcription was performed on 500 ng of total RNA using the PrimeScript RT reagent Kit (TaKaRa, Dalian, China) with random primers. Quantitative PCR (qPCR) was conducted on the Roche LightCycler\u0026reg; 480 System using SYBR Premix Ex Taq (TaKaRa, Dalian, China) and gene-specific primers. The sequences of these primers are provided in Table 2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u003c/strong\u003e The primer sequences used in the experiments.\u003c/p\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"528\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer Sequences\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.272727272727273%\" valign=\"top\"\u003e\n \u003cp\u003eGAPDH-F\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"72.72727272727273%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- GTCAAGGCTGAGAACGGGAA -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.272727272727273%\" valign=\"top\"\u003e\n \u003cp\u003eGAPDH-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"72.72727272727273%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- AAATGAGCCCCAGCCTTCTC -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.272727272727273%\" valign=\"top\"\u003e\n \u003cp\u003eMIR22HG-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"72.72727272727273%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- AACTGAGAAGGGCGTAGGCG -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.272727272727273%\" valign=\"top\"\u003e\n \u003cp\u003eMIR22HG-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"72.72727272727273%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- AAGTTGGAGAGCCTTTGCCC -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.272727272727273%\" valign=\"top\"\u003e\n \u003cp\u003eSIN3A-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"72.72727272727273%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- CAGCTACGTCTCAAAGAACCTA -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.272727272727273%\" valign=\"top\"\u003e\n \u003cp\u003eSIN3A-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"72.72727272727273%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- GCATGAATGGTGAACATCTCTC -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.272727272727273%\" valign=\"top\"\u003e\n \u003cp\u003eBeclin1-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"72.72727272727273%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- GACACTCAGCTCAACGTCAC -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.272727272727273%\" valign=\"top\"\u003e\n \u003cp\u003eBeclin1-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"72.72727272727273%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- CTGCCACTATCTTGCGGTTC -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eDual-luciferase reporter gene assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe promoter region of MIR22HG was analysed and predicted to interact with SIN3A using data from GENECARDS (https://www.genecards.org/). Plasmids containing MIR22HG wild-type, SIN3A, pRL-TK, PGL3-basic, and PGL3-control were constructed and separately transfected into H1299 cells. Detection of firefly luciferase and detection of sea cucumber luciferase activity using the Dual-Luciferase\u0026reg; reporter assay system.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA immunoprecipitation (RIP) assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe EZ-Magna RIP\u0026trade; RNA-binding protein immunoprecipitation kit (Millipore)was used for this assay. Cells were lysed in 100 \u0026micro;L of RIP lysis buffer, which included a protease inhibitor cocktail and DNase inhibitor. RNA-protein complexes were immunoprecipitated using a SIN3A antibody (5 \u0026micro;g) or control IgG at 4\u0026deg;C overnight. Magnetic beads were washed 6 times with washing buffer, and proteins were digested with protease K at 55\u0026deg;C. The Precipitated RNA was then reverse transcribed using random primers and analyzed by qPCR.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell proliferation, transwell migration, and invasion assays\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cell proliferation assay was conducted using the WST-1 kit (Beyotime Biotechnology, Shanghai, China). NSCLC cells were seeded at a density of 1,000 cells per well in 96-well plates and incubated for 24 h. Following this, the cells were transfected with siRNA and cultured for an additional 96 h. Optical density was measured at 450 nm after the addition of 10 \u0026mu;l WST-1 solution to 100 \u0026mu;l RPMI-1640 medium. Cell migration and invasion were assessed using transwell migration and Matrigel invasion assay (BD Falcon, San Jose, CA, USA), respectively, according to the manufacturer\u0026apos;s instructions. For the transwell migration assay, 5 x 10\u003csup\u003e4\u003c/sup\u003e cells were suspended in 200 \u0026micro;l of serum-free RPMI-1640 medium and placed in a cell culture insert with an 8 \u0026micro;m pore size, over a plate filled with pre-warmed RPMI-1640 medium supplemented with 20% fetal bovine serum. After 12 h of incubation, cells were fixed with 4% paraformaldehyde. In the Matrigel invasion assay, 1 x 10\u003csup\u003e5\u003c/sup\u003e cells were added to a Matrigel-precoated insert and covered with pre-warmed RPMI-1640 medium containing 20% fetal bovine serum. Following a 24-h incubation, cells were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and imaged using a light microscope in randomly selected areas.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometry assays of ROS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eH2DCFDA (DCFH-DA) Reactive Oxygen Species Assay Kit (ROS Assay Kit) was used to detect ROS levels. Following 48 h post-transfection, cells were harvested and washed with PBS. DCFH-DA was diluted 1:1000 in serum-free culture medium to achieve a final concentration of 10 \u0026mu;mol/L. Cells were then resuspended in the diluted DCFH-DA at a concentration of one to twenty million cells/ml and incubated for 20 minutes at 37\u0026deg;C in a cell culture incubator. The mixture was inverted every 3-5 minutes to ensure complete contact between the probe and the cells. Subsequently, cells were washed three times with serum-free medium to remove excess DCFH-DA effectively. The cells were then analyzed by flow cytometry using BD FACSDiva6.1 software (BD Biosciences).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData were derived from three independent experiments and expressed as mean \u0026plusmn; SD. Survival curves were plotted using the Kaplan-Meier method and compared with the log-rank test. Statistical significance was assessed using Student\u0026rsquo;s t-test, unless otherwise specified, with a P-value of \u0026lt; 0.05 considered statistically significant.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e2.1. In vivo experiments to validate the inhibitory effect of MIR22HG in lung adenocarcinoma\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFirstly, we developed cell models with siRNA knockdown and lentivirus-mediated overexpression of MIR22HG (Figure 1A), confirmed by RT-qPCR analysis (Figure 1B). To evaluate the oncogenic impact of MIR22HG, we transfected H1975 lung adenocarcinoma cells with lentivirus that overexpressed MIR22HG (LV-MIR22HG group) and Ctrl lentivirus (LV-Ctrl group). Subsequently, we injected these cells subcutaneously (1,000,000 cells/100ul) into 4 to 6-week-old female nude mice and monitored tumor growth and final sizes. After 18 days, the LV-MIR22HG group exhibited a significantly smaller final tumour size compared to the LV-Ctrl group (Figure 1C-E). Additionally, the tumor growth rate analysis indicated that the LV-MIR22HG group's tumor growth was significantly slower than that of the LV-Ctrl group (Figure 1D). Upon euthanizing the mice, we performed immunohistochemistry on the collected subcutaneous tumors and noted a significant reduction in Ki67 expression in the LV-MIR22HG group compared to the control group (Figure 1F).\u003c/p\u003e\n\u003cp\u003e2.2. MIR22HG enhances proliferation, invasion and migration of lung adenocarcinoma cell by triggers autophagy\u003c/p\u003e\n\u003cp\u003eBuilding on previous evidence of MIR22HG's tumor-suppressive role in ex vivo trials, we investigated its impact on autophagy within lung adenocarcinoma cells. Confocal microscopy following GFP-RFP-LC3 lentiviral labeling revealed reduced autophagic fluorescence in the MIR22HG knockdown group (Figure 2A). Western blot analysis confirmed that silencing MIR22HG decreased LC3B and Beclin1 expression, while increasing p62 levels (Figure 2B). Conversely, overexpressing MIR22HG elevated LC3B and Beclin1 levels and reduced p62 accumulation (Figure 2C), suggesting that MIR22HG positively regulates autophagy in these cells. Numerous studies have noted autophagy's role in supporting tumor growth [7]. To examine the effect of MIR22HG-driven autophagy on lung adenocarcinoma cell proliferation, we initially treated cells with chloroquine\u0026mdash;an autophagy inhibitor that disrupts autophagosome-lysosome fusion. This treatment suppressed cell proliferation (Figure 2D). Furthermore, when chloroquine was administered to cells with lentiviral-induced overexpression of MIR22HG, both proliferation and invasive migration were notably inhibited (Figure 2E-F), underscoring that MIR22HG-mediated autophagy facilitates lung adenocarcinoma cell proliferation.\u003c/p\u003e\n\u003cp\u003e2.3. MIR22HG inhibits proliferation, invasion and migration of lung adenocarcinoma cells by activating ferroptosis\u003c/p\u003e\n\u003cp\u003eLncRNAs are increasingly recognised as crucial regulators of ferroptosis and iron metabolism [8], associated with elevated ROS levels [9] and the downregulation of ferroptosis-related proteins (GPX4 and SLC7A11) [10]. Using the DCFH-DA kit, we measured ROS levels through flow cytometry, revealing that silencing MIR22HG decreased ROS accumulation in both H1975 and H1299 cells (Figure 3C). Western blot analysis indicated that MIR22HG silencing increased the expression of ferroptosis inhibitors such as SLC7A11 and GPX4 (Figure 3A), whereas MIR22HG overexpression decreased their expression. To explore the interplay between autophagy and ferroptosis, we tested the effects of chloroquine, which inhibits autophagosome-lysosome fusion, on cells overexpressing MIR22HG. Immunoblot results showed no significant changes in ferroptosis markers between the drug-treated and overexpression groups (Figure 3B), suggesting that blocking autophagosome-lysosome fusion does not significantly impact ferroptosis. This implies that MIR22HG may activate a signal pathway influencing both processes simultaneously, warranting further investigation. Ultimately, we assessed whether MIR22HG impacts lung adenocarcinoma proliferation via the ferroptosis pathway by introducing erastin, a ferroptosis inducer. We observed that erastin significantly inhibited cell proliferation in the treated groups (Figure 3D). Moreover, when erastin was applied to lung adenocarcinoma cells with silenced MIR22HG, it reversed the enhanced proliferation and migration observed (Figure 3E-F), confirming that MIR22HG-mediated ferroptosis suppresses lung adenocarcinoma cell proliferation.\u003c/p\u003e\n\u003cp\u003e2.4. MIR22HG facilitates both autophagy and ferroptosis in lung adenocarcinoma through Beclin1.\u003c/p\u003e\n\u003cp\u003eBeclin1 is recognized as a crucial molecule in cellular autophagy [11], and its role in regulating ferroptosis warrants further exploration. Initially, we conducted experiments to genetically knock down Beclin1 in lung adenocarcinoma cells that overexpressed MIR22HG. Protein blotting analysis indicated that MIR22HG overexpression led to decreased expression of SLC7A11 and GPX4, while Beclin1 silencing reversed these effects (Figure 4A). Flow cytometry showed that ROS accumulation decreased in H1975 and H1299 cells\u0026nbsp; following Beclin1 knockdown (Figure 4B-C), suggesting that Beclin1 positively influences ferroptosis in these cells. Additionally, to determine how MIR22HG interacts with Beclin1 and to assess potential binding, we conducted RIP experiments. The results revealed no significant increase in RNA associated with Beclin1 compared to the IgG control group, as detected by RT-qPCR of MIR22HG, indicating a lack of a direct binding relationship (Figure 4D). Collectively, these findings suggest that MIR22HG activates autophagy and ferroptosis via Beclin1 mediation.\u003c/p\u003e\n\u003cp\u003e2.5. SIN3A binds to MIR22HG as an RNA-binding protein and plays a pro-carcinogenic role in lung cancer\u003c/p\u003e\n\u003cp\u003eTo elucidate the molecular mechanism behind the downregulation of MIR22HG in lung adenocarcinoma, we identified its potential binding protein, SIN3A, using the GENECARDS database. The the relationship between MIR22HG and SIN3A was further explored using the Prediction of RNA-Protein Interactions platform at Iowa State University, USA. Although the dual-luciferase reporter assay suggested that SIN3A does not directly bind to the MIR22HG promoter (Figure 5A), RIP-qPCR results confirmed a significant enrichment of MIR22HG transcripts by the SIN3A-specific antibody (Figure 5B), indicating a complex formation between the two. We investigated the function of SIN3A in cell proliferation using siRNA gene silencing. Analysis of H1975 and H1299 cells using WST and Transwell assays demonstrated that silencing SIN3A significantly reduced cell proliferation, invasion, and migration compared to control siRNA (Figure 5E, 5H). These findings suggest that SIN3A may play a pro-carcinogenic role in lung adenocarcinoma cells. To explore the interaction between SIN3A and MIR22HG, we conducted a series of experiments in lung adenocarcinoma cells (H1975, H1299). RT-qPCR analysis post-SIN3A silencing showed an increase in MIR22HG expression (Figure 5D), while silencing MIR22HG resulted in decreased RNA and protein levels of SIN3A (Figure 5C-D). These results, along with their conflicting roles in autophagy and ferroptosis regulation, suggest that SIN3A acts as an upstream regulator of MIR22HG. Specifically, SIN3A binds to and inhibits MIR22HG, leading to its downregulation, which suppresses autophagy and ferroptosis, thereby promoting the proliferation of lung adenocarcinoma cells. Conversely, MIR22HG appears to positively regulate SIN3A.The results showed that siSIN3A proliferation capacity decreased, siMIR22HG proliferation capacity increased, and siSIN3A + siMIR22HG proliferation capacity reached an intermediate reversible state compared with the siCtrl group (Figure 5F-G ). Western blot analysis confirmed that levels of autophagy and ferroptosis-related proteins also reached an intermediate state following co-transfection of siSIN3A + siMIR22HG (Figure 5F). This supports the hypothesis that SIN3A's binding and inhibition of MIR22HG enhances lung adenocarcinoma proliferation by mediating critical cellular pathways.\u003c/p\u003e\n\u003cp\u003e2.6. Silencing of SIN3A enhances autophagy and ferroptosis in lung adenocarcinoma\u003c/p\u003e\n\u003cp\u003eFunctional experiments indicated that unlike MIR22HG, which suppresses oncogenic activity, SIN3A exerts a pro-oncogenic effect. Given that MIR22HG regulates autophagy and interacts with SIN3A, we investigated the impact of SIN3A silencing on autophagy. The efficacy of siRNA-mediated SIN3A silencing was verified by RT-qPCR, showing significant decreases in expression levels compared to the control group (siCtrl), thus successfully establishing the cell model (Figure 6C). In lung adenocarcinoma cells (H1975, H1299), transfected with GFP-RFP-LC3 fluorescent lentivirus, confocal microscopy revealed increased autophagic fluorescence in SIN3A-silenced cells (Figure 6A). Western blot analysis confirmed that SIN3A silencing upregulated autophagy markers LC3B-II and Beclin1 and reduced p62 levels, suggesting that SIN3A inhibition promotes autophagy in these cells (Figure 6B). We also investigated the impact of SIN3A downregulation on ferroptosis. Western blot analysis revealed that SIN3A knockdown decreased the expression of SLC7A11 and GPX4, proteins implicated in ferroptosis (Figure 6D). Additionally, we measured ROS levels using flow cytometry with the DCFH-DA kit, which indicated that silencing SIN3A resulted in increased ROS accumulation in H1975 and H1299 cells (Figure 6E). These findings demonstrate that SIN3A silencing promotes ferroptosis in lung adenocarcinoma cells. In conclusion, our data suggest that SIN3A may influence lung adenocarcinoma proliferation by modulating both autophagy and ferroptosis, mediated through the down-regulation of MIR22HG expression.\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eLung cancer remains the deadliest cancer globally, characterized by its insidious onset and the current limitations of diagnostic technologies, which hinder early detection [12]. Groundbreaking targeted drug therapies have significantly advanced the treatment of patients with advanced lung cancer that test positive for driver genes [13]. Furthermore, our understanding of the genetic alterations that propel non-small cell lung cancer (NSCLC) is continually evolving. Many molecularly defined subtypes of NSCLC are potentially actionable, prompting ongoing exploration of new molecular diagnostic techniques and targeted therapies to detect and manage these subtypes [14]. LncRNAs have been identified as pivotal players in cancer physiopathology, functioning as oncogenes or tumor suppressors. However, only a small fraction of lncRNAs have been thoroughly characterized [15]. Previous research concluded that MIR22HG acts as an oncogene in lung adenocarcinoma. This study further corroborates its oncogenic role through in vivo experiments, thereby highlighting the need for a comprehensive exploration of MIR22HG's potential mechanisms that counteract tumor proliferation. Notably, the cell death pathways of autophagy and ferroptosis are integral to tumor development and progression. In this study, MIR22HG is investigated as a research target to unravel the mechanisms underlying these cell death pathways, providing critical foundational experimental evidence for its potential as a novel clinical tumor biomarker and therapeutic target.\u003c/p\u003e\n\u003cp\u003eAutophagy exhibits a dual regulatory role in tumour development [16]. Protein blotting revealed that autophagy-related proteins LC3B and Beclin1 were downregulated [17], while p62 expression increased following MIR22HG silencing. LC3B, Beclin1, and p62 are commonly used markers in autophagy research (Figure 7). A decrease in p62 and an increase in the LC3-II/LC3-I ratio are indicative of autophagy activation [18]; at the onset of autophagy, LC3-I is converted to LC3-II through lipidation, accumulating in the double-membrane structure of the autophagic vesicle, which serves as a crucial marker for monitoring autophagy [19,20]. Using siRNA gene silencing and lentiviral overexpression for Western blot analysis, we demonstrated that MIR22HG silencing inhibits autophagy in lung adenocarcinoma cells. This was evidenced by a significant reduction in LC3-II protein levels and fewer green fluorescent spots from GFP-LC3, suggesting decreased autophagosome formation. Conversely, MIR22HG overexpression enhanced autophagy, as indicated by increased LC3-II protein levels due to MIR22HG upregulation. The overexpression was not verified by immunofluorescence because of the false positive results under laser confocal microscopy due to the lentiviral green fluorescence; Furthermore, an increase in Beclin1, a central protein in mammalian autophagy, suggests that autophagy is being activated [21]. Coincidentally, silencing MIR22HG resulted in a decrease in Beclin1, indicative of autophagy inhibition; conversely, overexpressing MIR22HG increased Beclin1 levels, suggesting autophagy activation. Therefore, the experiment showed that MIR22HG positively regulates autophagy in lung adenocarcinoma. We further explored how MIR22HG-induced autophagy affects lung adenocarcinoma proliferation. Compared with the Ctrl group, the addition of chloroquine alone blocked autophagy, which decreased the proliferation ability of lung adenocarcinoma, suggesting that the blockade of autophagy may have an inhibitory effect on the proliferation ability of lung adenocarcinoma cells. In addition, we observed that overexpression of MIR22HG decreased the proliferation of lung adenocarcinoma cells while enhancing autophagy. To determine if blocking autophagy would reverse this effect, we treated MIR22HG-overexpressing cells with chloroquine. The results showed a further decrease in proliferation, suggesting that MIR22HG-induced autophagy facilitates lung adenocarcinoma proliferation. This finding was corroborated by the invasive migration assay, which also concluded that MIR22HG-promoted autophagy enhances invasive migration. In conclusion, the activation of autophagy by MIR22HG does not play an oncogenic role. Therefore, we propose that MIR22HG may simultaneously activate another pathway to resist autophagy-promoted cell proliferation, thereby exerting a comprehensive oncogenic effect, and we further understand the molecular mechanism of MIR22HG oncogenic effect in lung cancer.\u003c/p\u003e\n\u003cp\u003eFerroptosis is a new type of iron-dependent programmed cell death that is distinct from apoptosis, necrosis and autophagy [22]. This process is primarily attributed to the deficiency of intracellular oxidoreductases, especially glutathione peroxidase 4 (GPX4) [23], coupled with increased accumulation of reactive oxygen species (ROS), factors implicated in various human diseases, including cancer [24]. Our findings indicate a decrease in intracellular ROS accumulation following MIR22HG silencing, suggesting a positive correlation between MIR22HG and the regulation of ferroptosis. In addition, GPX4 is now considered to be a major inhibitor of ferroptosis by scavenging ROS under oxidative stress, and its activity depends on glutathione production through activation of the cystine-glutamate counter transporter protein SLC7A11 [25]; a reduction in either leads to elevated ROS levels, thereby activating the ferroptosis pathway [26] In our experiments, silencing MIR22HG significantly upregulated the expression of ferroptosis-inhibitory proteins GPX4 and SLC7A11 in lung adenocarcinoma cells, while concurrently reducing ROS accumulation. This suggests that MIR22HG may suppress SLC7A11 and GPX4 activity (Figure 8A-B), resulting in increased ROS accumulation and potentially promoting oncogenesis. Most studies have shown that ferroptosis inhibits the proliferation, invasion and migration of malignant tumours [27]. We further explored the role of MIR22HG and ferroptosis in regulating lung adenocarcinoma proliferation. Proliferation was reduced by the addition of erastin, which induces ferroptosis, compared to the control group. Additionally, in the MIR22HG-silenced group where ferroptosis was inhibited, a reversible decrease in proliferation was noted upon the introduction of erastin-induced ferroptosis. The same outcome was confirmed in assays testing invasion and migration: ferroptosis induced by MIR22HG curtailed both invasion and migration of lung adenocarcinoma cells. MIR22HG activated both autophagy and ferroptosis, and both in vitro and ex vivo experiments have demonstrated its oncogenic effects. However, a review in oncology literature indicates that while apoptosis and autophagy can detrimentally impact tumor progression\u0026mdash;depending on the tumor microenvironment\u0026mdash;ferroptosis plays a pivotal role in either promoting or inhibiting tumour growth [28]. We therefore demonstrated that MIR22HG simultaneously activates the ferroptosis pathway and resists autophagy-driven cell proliferation, thereby exerting a comprehensive anti-cancer effect.\u003c/p\u003e\n\u003cp\u003eStudies have reported that autophagy and ferroptosis can be induced and promoted by each other, and that these two processes can occur simultaneously and are co-regulated [29]. From our findings, it is clear that MIR22HG can activate both autophagy and ferroptosis,thereby inhibiting the proliferation of lung adenocarcinoma cells. When we added the autophagy inhibitor CQ to cells in which autophagy was promoted by MIR22HG overexpression, we found that the expression of GPX4 and SLC7A11, proteins associated with ferroptosis, was not significantly different from that of the former, suggesting that ferroptosis and autophagy might be activated by the same underlying mechanisms rather than being interdependent (Figure 8C-D). Research has shown that certain autophagy regulators also influence the ferroptosis pathway. Beclin1, a central molecule in autophagy [30], is implicated in the initial stages of autophagy involving LC3-related proteins, crucial for tumor development and progression [31]. Notably, AMPK-mediated phosphorylation of Beclin1 has been reported to promote ferroptosis [32], and USP11 has been found to regulate autophagy-dependent ferroptosis in spinal cord ischaemia/reperfusion injuries by deubiquitinating Beclin1 [33]. Another report suggested that Beclin1 may regulate ferroptosis by inhibiting the glutamate exchange activity of the xc (-) system [34]. A more direct view confirms BECN1 as a new driver of ferroptosis [35]. In our experiments, silencing Beclin1 not only suppressed ferroptosis and reduced ROS accumulation in lung adenocarcinoma cells but also reversed the effects of MIR22HG on GPX4 and SLC7A11 expression. These findings support the hypothesis that Beclin1 regulates MIR22HG in the co-regulation of autophagy and ferroptosis in lung adenocarcinoma.\u003c/p\u003e\n\u003cp\u003eFurthermore, we expanded our research to explore the detailed mechanism by which MIR22HG regulates Beclin1, and to determine if there is a direct binding interaction between them. Results from RNA immunoprecipitation (RIP) experiments were negative, suggesting no direct binding between MIR22HG and Beclin1. In previous research, we confirmed that MIR22HG binds and stabilizes YBX1, which is involved in regulating cell survival and death signaling. Notably, a related study demonstrated that YBX1 influences autophagy via the p110\u0026beta;/Vps34/Beclin1 signalling pathway [36]. This implies that MIR22HG might indirectly regulate Beclin1 through its stabilization of YBX1, a hypothesis that requires further exploration to elucidate the connection between Beclin1 and YBX1.\u003c/p\u003e\n\u003cp\u003eIn addition, we investigated the oncogenic protein SIN3A as a potential cause for the low expression of MIR22HG in lung adenocarcinoma tissues. SIN3A was predicted to be the binding protein of MIR22HG by the GENECARDS website, and the relationship between MIR22HG and SIN3A binding was examined in the Prediction of RNA-Protein Interactions from Iowa State University, which indicated a binding factor of 0.89 (a value greater than 0.5 suggests a likely interaction). Functional experiments revealed that silencing the SIN3A gene reduced lung adenocarcinoma cell proliferation and invasive migration, while autophagy and ferroptosis-related proteins were upregulated, indicating that SIN3A promotes tumor proliferation via these pathways and is negatively associated with Beclin1, in contrast to MIR22HG (Figure 9). Given that SIN3A is known to act as a significant transcriptional repressor [37], we explored whether it could affect MIR22HG expression by modulating its transcription. This was assessed using a dual luciferase reporter assay, which yielded negative results, thus indicating no transcriptional regulation between SIN3A and MIR22HG. Further RNA immunoprecipitation (RIP) experiments demonstrated a significant increase in MIR22HG enriched by SIN3A, confirming a direct binding relationship between them.\u003c/p\u003e\n\u003cp\u003eAdditionally, the co-transfection recovery assay indicated that cell proliferation, along with autophagy and ferroptosis protein levels, exhibited an intermediate recovery state. Coupled with the RT-qPCR results, these findings suggest that SIN3A inhibits MIR22HG (Figure 10). Consequently, we conclude that SIN3A binds to and suppresses MIR22HG, thereby downregulating autophagy and ferroptosis, which in turn promotes the proliferation of lung adenocarcinoma cells. These results elucidate the regulatory impact of MIR22HG on the progression of lung adenocarcinoma. Currently, our studies confirm the direct binding and repression of MIR22HG by SIN3A; however, the precise mechanisms, potentially involving RNA modifications, remain to be detailed in further sequencing studies.\u003c/p\u003e\n\u003cp\u003eIn conclusion, our functional analysis revealed that silencing SIN3A inhibits the proliferation of lung adenocarcinoma cells. Mechanistic investigations have demonstrated that SIN3A interacts with and reduces MIR22HG expression, thereby modulating Beclin1-mediated autophagy and ferroptosis, which enhances tumor cell proliferation. The present study provides new ideas and directions for the potential mechanism of MIR22HG in the development of lung adenocarcinoma. Future work will focus on enhancing in vivo experiments to examine the effects of SIN3A on lung adenocarcinoma development more comprehensively and to further investigate the interplay between autophagy, ferroptosis, and their roles in cancer.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eOur previous study established that MIR22HG was significantly downregulated in both clinical LUAD tissues and cultured NSCLC cell lines, and its oncogenic effects were further confirmed through in vivo experiments. MIR22HG restricts the proliferation, invasion, and migration of NSCLC cells by modulating Beclin1 and simultaneously activating autophagy and ferroptosis. Furthermore, we elucidated the mechanism behind MIR22HG\u0026rsquo;s downregulation, demonstrating that the transcriptional repressor SIN3A binds to and downregulates MIR22HG. This interaction inhibits autophagy and ferroptosis, consequently promoting lung adenocarcinoma proliferation. These findings illuminate MIR22HG\u0026rsquo;s role as a regulator of cell survival in LUAD and position it as a novel potential predictive molecular marker for this cancer type. The direct binding and suppression of MIR22HG by SIN3A highlight SIN3A\u0026rsquo;s significant role in the regulation of MIR22HG. This research may pave the way for the development of new diagnostic and dual therapeutic targets in lung cancer treatment.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u003c/strong\u003e Conceptualization, W.S. and Y.C.; methodology, Y.C., M.Y., X.H., Y.Z., X.L., Y.J., and Y.L.; formal analysis, Y.C., X.H., and X.L. writing\u0026mdash;original draft preparation, Y.C., H.Z., and X.X.; writing\u0026mdash;review and editing, W.S. and C.L.; funding acquisition, W.S and F.N. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e This work was supported by the National Natural Science Foundation of China (82073388); The Affiliated Hospital of Guangdong Medical University Clinical Research Program (LCYJ2020B005); the Natural Outstanding Youth Fund of Guangdong Province (2022B1515020090); Guangdong Provincial Key Laboratory of Autophagy and Major Chronic Non-communicable Diseases (2022B1212030003). Guangzhou Science and Technology Plan Project (Grant No. 202102021238)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInstitutional Review Board Statement: \u003c/strong\u003eAll experimental procedures involving animals were approved by Guangdong Medical University and used in compliance with a local ethics committee (Permit Number: AHGDMU-LAC-Ⅰ(1)-2207-B007).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement:\u003c/strong\u003e All the data obtained and/or analyzed during the current study are available from the corresponding authors on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest:\u003c/strong\u003e The authors declare no conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eZhang, Y.; Luo, G.; Etxeberria, J.; Hao, Y. Global Patterns and Trends in Lung Cancer Incidence: A Population-Based Study. Journal of thoracic oncology: official publication of the International Association for the Study of Lung Cancer 2021, \u003cem\u003e16\u003c/em\u003e, 933\u0026ndash;944, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jtho.2021.01.1626\u003c/span\u003e\u003cspan address=\"10.1016/j.jtho.2021.01.1626\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe, Z.; Huang, Y.; Ke, J.; Zhu, X.; Leng, S.; Luo, H. Breakthrough in targeted therapy for non-small cell lung cancer. Biomedicine \u0026amp; pharmacotherapy\u0026thinsp;=\u0026thinsp;Biomedecine \u0026amp; pharmacotherapie 2021, \u003cem\u003e133\u003c/em\u003e, 111079, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biopha.2020.111079\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2020.111079\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMasi, I.; Caprara, V.; Bagnato, A.; Rosan\u0026ograve;, L. Tumor Cellular and Microenvironmental Cues Controlling Invadopodia Formation. Frontiers in cell and developmental biology 2020, \u003cem\u003e8\u003c/em\u003e, 584181, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcell.2020.584181\u003c/span\u003e\u003cspan address=\"10.3389/fcell.2020.584181\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu, W.; Feng, S.; Chen, X.; Yang, X.; Mao, R.; Guo, C.; Wang, Z.; Thomas, D.G.; Lin, J.; Reddy, R.M.; et al. Silencing of Long Noncoding RNA MIR22HG Triggers Cell Survival/Death Signaling via Oncogenes YBX1, MET, and p21 in Lung Cancer. Cancer research 2018, \u003cem\u003e78\u003c/em\u003e, 3207\u0026ndash;3219, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/0008-5472.Can-18-0222\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.Can-18-0222\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDas, T.K.; Sangodkar, J.; Negre, N.; Narla, G.; Cagan, R.L. Sin3a acts through a multi-gene module to regulate invasion in Drosophila and human tumors. Oncogene 2013, \u003cem\u003e32\u003c/em\u003e, 3184\u0026ndash;3197, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/onc.2012.326\u003c/span\u003e\u003cspan address=\"10.1038/onc.2012.326\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKadamb, R.; Mittal, S.; Bansal, N.; Batra, H.; Saluja, D. Sin3: insight into its transcription regulatory functions. European journal of cell biology 2013, \u003cem\u003e92\u003c/em\u003e, 237\u0026ndash;246, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ejcb.2013.09.001\u003c/span\u003e\u003cspan address=\"10.1016/j.ejcb.2013.09.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKimmelman, A.C.; White, E. Autophagy and Tumor Metabolism. Cell metabolism 2017, \u003cem\u003e25\u003c/em\u003e, 1037\u0026ndash;1043, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cmet.2017.04.004\u003c/span\u003e\u003cspan address=\"10.1016/j.cmet.2017.04.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao, J.; Chen, X.; Liu, X.; Li, R.; Zhou, X.; Qu, Y. Characterization of a ferroptosis and iron-metabolism related lncRNA signature in lung adenocarcinoma. Cancer cell international 2021, \u003cem\u003e21\u003c/em\u003e, 340, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12935-021-02027-2\u003c/span\u003e\u003cspan address=\"10.1186/s12935-021-02027-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, S.; He, Y.; Chen, K.; Sun, J.; Zhang, L.; He, Y.; Yu, H.; Li, Q. RSL3 Drives Ferroptosis through NF-κB Pathway Activation and GPX4 Depletion in Glioblastoma. \u003cem\u003eOxidative medicine and cellular longevity\u003c/em\u003e 2021, \u003cem\u003e2021\u003c/em\u003e, 2915019, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2021/2915019\u003c/span\u003e\u003cspan address=\"10.1155/2021/2915019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng, D.; Liu, J.; Piao, H.; Zhu, Z.; Wei, R.; Liu, K. ROS-triggered endothelial cell death mechanisms: Focus on pyroptosis, parthanatos, and ferroptosis. Frontiers in immunology 2022, \u003cem\u003e13\u003c/em\u003e, 1039241, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2022.1039241\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2022.1039241\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, X.; Yang, K.B.; Chen, W.; Mai, J.; Wu, X.Q.; Sun, T.; Wu, R.Y.; Jiao, L.; Li, D.D.; Ji, J.; et al. CUL3 (cullin 3)-mediated ubiquitination and degradation of BECN1 (beclin 1) inhibit autophagy and promote tumor progression. Autophagy 2021, \u003cem\u003e17\u003c/em\u003e, 4323\u0026ndash;4340, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/15548627.2021.1912270\u003c/span\u003e\u003cspan address=\"10.1080/15548627.2021.1912270\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuma, N.; Santana-Davila, R.; Molina, J.R. Non-Small Cell Lung Cancer: Epidemiology, Screening, Diagnosis, and Treatment. \u003cem\u003eMayo Clinic proceedings\u003c/em\u003e 2019, \u003cem\u003e94\u003c/em\u003e, 1623\u0026ndash;1640, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.mayocp.2019.01.013\u003c/span\u003e\u003cspan address=\"10.1016/j.mayocp.2019.01.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK\u0026ouml;nig, D.; Savic Prince, S.; Rothschild, S.I. Targeted Therapy in Advanced and Metastatic Non-Small Cell Lung Cancer. An Update on Treatment of the Most Important Actionable Oncogenic Driver Alterations. Cancers 2021, \u003cem\u003e13\u003c/em\u003e, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cancers13040804\u003c/span\u003e\u003cspan address=\"10.3390/cancers13040804\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJonna, S.; Subramaniam, D.S. Molecular diagnostics and targeted therapies in non-small cell lung cancer (NSCLC): an update. Discovery medicine 2019, \u003cem\u003e27\u003c/em\u003e, 167\u0026ndash;170.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQi, P.; Du, X. The long non-coding RNAs, a new cancer diagnostic and therapeutic gold mine. Modern pathology: an official journal of the United States and Canadian Academy of Pathology, Inc 2013, \u003cem\u003e26\u003c/em\u003e, 155\u0026ndash;165, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/modpathol.2012.160\u003c/span\u003e\u003cspan address=\"10.1038/modpathol.2012.160\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOnorati, A.V.; Dyczynski, M.; Ojha, R.; Amaravadi, R.K. Targeting autophagy in cancer. Cancer 2018, \u003cem\u003e124\u003c/em\u003e, 3307\u0026ndash;3318, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/cncr.31335\u003c/span\u003e\u003cspan address=\"10.1002/cncr.31335\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe, Y.; Zhao, X.; Subahan, N.R.; Fan, L.; Gao, J.; Chen, H. The prognostic value of autophagy-related markers beclin-1 and microtubule-associated protein light chain 3B in cancers: a systematic review and meta-analysis. Tumour biology: the journal of the International Society for Oncodevelopmental Biology and Medicine 2014, \u003cem\u003e35\u003c/em\u003e, 7317\u0026ndash;7326, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s13277-014-2060-4\u003c/span\u003e\u003cspan address=\"10.1007/s13277-014-2060-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlnafakh, R.A.A.; Adishesh, M.; Button, L.; Saretzki, G.; Hapangama, D.K. Telomerase and Telomeres in Endometrial Cancer. Frontiers in oncology 2019, \u003cem\u003e9\u003c/em\u003e, 344, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fonc.2019.00344\u003c/span\u003e\u003cspan address=\"10.3389/fonc.2019.00344\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNuta, G.C.; Gilad, Y.; Gershoni, M.; Sznajderman, A.; Schlesinger, T.; Bialik, S.; Eisenstein, M.; Pietrokovski, S.; Kimchi, A. A cancer associated somatic mutation in LC3B attenuates its binding to E1-like ATG7 protein and subsequent lipidation. Autophagy 2019, \u003cem\u003e15\u003c/em\u003e, 438\u0026ndash;452, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/15548627.2018.1525476\u003c/span\u003e\u003cspan address=\"10.1080/15548627.2018.1525476\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgrotis, A.; Pengo, N.; Burden, J.J.; Ketteler, R. Redundancy of human ATG4 protease isoforms in autophagy and LC3/GABARAP processing revealed in cells. Autophagy 2019, \u003cem\u003e15\u003c/em\u003e, 976\u0026ndash;997, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/15548627.2019.1569925\u003c/span\u003e\u003cspan address=\"10.1080/15548627.2019.1569925\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang, N.; Liu, X.; Zhang, S.; Sun, H. The role of Beclin 1 in IR-induced crosstalk between autophagy and G2/M cell cycle arrest. Cellular signalling 2019, \u003cem\u003e62\u003c/em\u003e, 109353, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cellsig.2019.109353\u003c/span\u003e\u003cspan address=\"10.1016/j.cellsig.2019.109353\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, H.H.; Ma, J.N.; Zhan, X.R. Circular RNA Circ_0067934 Attenuates Ferroptosis of Thyroid Cancer Cells by miR-545-3p/SLC7A11 Signaling. Frontiers in endocrinology 2021, \u003cem\u003e12\u003c/em\u003e, 670031, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fendo.2021.670031\u003c/span\u003e\u003cspan address=\"10.3389/fendo.2021.670031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSha, W.; Hu, F.; Xi, Y.; Chu, Y.; Bu, S. Mechanism of Ferroptosis and Its Role in Type 2 Diabetes Mellitus. \u003cem\u003eJournal of diabetes research\u003c/em\u003e 2021, \u003cem\u003e2021\u003c/em\u003e, 9999612, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2021/9999612\u003c/span\u003e\u003cspan address=\"10.1155/2021/9999612\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSui, X.; Zhang, R.; Liu, S.; Duan, T.; Zhai, L.; Zhang, M.; Han, X.; Xiang, Y.; Huang, X.; Lin, H.; et al. RSL3 Drives Ferroptosis Through GPX4 Inactivation and ROS Production in Colorectal Cancer. Frontiers in pharmacology 2018, \u003cem\u003e9\u003c/em\u003e, 1371, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphar.2018.01371\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2018.01371\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, X.; Li, J.; Kang, R.; Klionsky, D.J.; Tang, D. Ferroptosis: machinery and regulation. Autophagy 2021, \u003cem\u003e17\u003c/em\u003e, 2054\u0026ndash;2081, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/15548627.2020.1810918\u003c/span\u003e\u003cspan address=\"10.1080/15548627.2020.1810918\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, W.S.; SriRamaratnam, R.; Welsch, M.E.; Shimada, K.; Skouta, R.; Viswanathan, V.S.; Cheah, J.H.; Clemons, P.A.; Shamji, A.F.; Clish, C.B.; et al. Regulation of ferroptotic cancer cell death by GPX4. \u003cem\u003eCell\u003c/em\u003e 2014, \u003cem\u003e156\u003c/em\u003e, 317\u0026ndash;331, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2013.12.010\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2013.12.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, Q.; Yi, H.; Yao, H.; Lu, L.; He, G.; Wu, M.; Zheng, C.; Li, Y.; Chen, S.; Li, L.; et al. Artemisinin Derivatives Inhibit Non-small Cell Lung Cancer Cells Through Induction of ROS-dependent Apoptosis/Ferroptosis. Journal of Cancer 2021, \u003cem\u003e12\u003c/em\u003e, 4075\u0026ndash;4085, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7150/jca.57054\u003c/span\u003e\u003cspan address=\"10.7150/jca.57054\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRabitha, R.; Shivani, S.; Showket, Y.; Sudhandiran, G. Ferroptosis regulates key signaling pathways in gastrointestinal tumors: Underlying mechanisms and therapeutic strategies. World journal of gastroenterology 2023, \u003cem\u003e29\u003c/em\u003e, 2433\u0026ndash;2451, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3748/wjg.v29.i16.2433\u003c/span\u003e\u003cspan address=\"10.3748/wjg.v29.i16.2433\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, J.; Kuang, F.; Kroemer, G.; Klionsky, D.J.; Kang, R.; Tang, D. Autophagy-Dependent Ferroptosis: Machinery and Regulation. Cell chemical biology 2020, \u003cem\u003e27\u003c/em\u003e, 420\u0026ndash;435, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.chembiol.2020.02.005\u003c/span\u003e\u003cspan address=\"10.1016/j.chembiol.2020.02.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi, B.; Ma, M.; Zheng, Y.; Pan, Y.; Lin, X. mTOR and Beclin1: Two key autophagy-related molecules and their roles in myocardial ischemia/reperfusion injury. Journal of cellular physiology 2019, \u003cem\u003e234\u003c/em\u003e, 12562\u0026ndash;12568, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jcp.28125\u003c/span\u003e\u003cspan address=\"10.1002/jcp.28125\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, X.; Sun, Y.; Wang, B.; Wang, H. Prognostic significance of autophagy-related genes Beclin1 and LC3 in ovarian cancer: a meta-analysis. The Journal of international medical research 2020, \u003cem\u003e48\u003c/em\u003e, 300060520968299, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1177/0300060520968299\u003c/span\u003e\u003cspan address=\"10.1177/0300060520968299\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong, X.; Zhu, S.; Chen, P.; Hou, W.; Wen, Q.; Liu, J.; Xie, Y.; Liu, J.; Klionsky, D.J.; Kroemer, G.; et al. AMPK-Mediated BECN1 Phosphorylation Promotes Ferroptosis by Directly Blocking System X(c)(-) Activity. Current biology: CB 2018, \u003cem\u003e28\u003c/em\u003e, 2388\u0026ndash;2399.e2385, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cub.2018.05.094\u003c/span\u003e\u003cspan address=\"10.1016/j.cub.2018.05.094\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRong, Y.; Fan, J.; Ji, C.; Wang, Z.; Ge, X.; Wang, J.; Ye, W.; Yin, G.; Cai, W.; Liu, W. USP11 regulates autophagy-dependent ferroptosis after spinal cord ischemia-reperfusion injury by deubiquitinating Beclin 1. Cell death and differentiation 2022, \u003cem\u003e29\u003c/em\u003e, 1164\u0026ndash;1175, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41418-021-00907-8\u003c/span\u003e\u003cspan address=\"10.1038/s41418-021-00907-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, R.; Li, X.; Zhao, G. Beclin1-mediated ferroptosis activation is associated with isoflurane-induced toxicity in SH-SY5Y neuroblastoma cells. Acta biochimica et biophysica Sinica 2019, \u003cem\u003e51\u003c/em\u003e, 1134\u0026ndash;1141, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/abbs/gmz104\u003c/span\u003e\u003cspan address=\"10.1093/abbs/gmz104\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang, R.; Zhu, S.; Zeh, H.J.; Klionsky, D.J.; Tang, D. BECN1 is a new driver of ferroptosis. Autophagy 2018, \u003cem\u003e14\u003c/em\u003e, 2173\u0026ndash;2175, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/15548627.2018.1513758\u003c/span\u003e\u003cspan address=\"10.1080/15548627.2018.1513758\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui, Y.; Li, F.; Xie, Q.; Zhao, S.; Guo, T.; Guo, P.; Hu, S.; Hao, J.; Tian, C.; Yu, W.; et al. YBX1 mediates autophagy by targeting p110β and decreasing the sensitivity to cisplatin in NSCLC. Cell death \u0026amp; disease 2020, \u003cem\u003e11\u003c/em\u003e, 476, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41419-020-2555-4\u003c/span\u003e\u003cspan address=\"10.1038/s41419-020-2555-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSrivas, S.; Thakur, M.K. Transcriptional co-repressor SIN3A silencing rescues decline in memory consolidation during scopolamine-induced amnesia. Journal of neurochemistry 2018, \u003cem\u003e145\u003c/em\u003e, 204\u0026ndash;216, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/jnc.14320\u003c/span\u003e\u003cspan address=\"10.1111/jnc.14320\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Scheme 1","content":"\u003cp\u003eScheme 1 is available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"MIR22HG, Beclin1, SIN3A, Autophagy, Ferroptosis, Lung Adenocarcinoma","lastPublishedDoi":"10.21203/rs.3.rs-4534782/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4534782/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThrough comprehensive analysis of long non-coding RNA expression profiles from RNA-Seq data, we identified that MIR22HG was significantly downregulated in lung adenocarcinoma and associated with poor patient prognosis. Subsequent animal studies confirmed its tumor-suppressive effects. We elucidated the mechanism by which MIR22HG exerts oncogenic suppression in lung adenocarcinoma, revealing that it mediates Beclin1 to activate signaling pathways for both autophagy and ferroptosis, thereby producing a combined oncogenic suppressive effect. Additionally, we demonstrated that SIN3A directly binds to MIR22HG, leading to its downregulation. This interaction inhibits both autophagy and ferroptosis via the MIR22HG network, contributing to a pro-oncogenic effect. These findings propose MIR22HG as a novel diagnostic, prognostic, and therapeutic marker for lung cancer. Furthermore, targeting the repressive effects of SIN3A on MIR22HG expression may enhance dual-targeted therapy approaches in clinical settings.\u003c/p\u003e","manuscriptTitle":"SIN3A/MIR22HG/Beclin1 Axis Regulates Both Autophagy and Ferroptosis in Lung Adenocarcinoma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-02 20:42:43","doi":"10.21203/rs.3.rs-4534782/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-03-31T13:40:34+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-03-30T16:48:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"215972921427933563386520937937109562342","date":"2025-03-04T15:15:42+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-21T12:24:07+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"207043768767316254331299769481218691696","date":"2024-11-14T09:06:52+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-16T07:00:28+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-07-16T06:49:04+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-06-12T14:12:04+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-10T12:24:39+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-06-05T14:23:26+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"81aca280-3264-43c8-9da1-15d2d4962b94","owner":[],"postedDate":"July 2nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[{"id":33628376,"name":"Biological sciences/Cancer"},{"id":33628377,"name":"Biological sciences/Cell biology"}],"tags":[],"updatedAt":"2025-06-25T05:08:28+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-02 20:42:43","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4534782","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4534782","identity":"rs-4534782","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}