Junction-mediating and regulatory protein (JMY) is a promoting protein for radial migration of cortical neurons | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Junction-mediating and regulatory protein (JMY) is a promoting protein for radial migration of cortical neurons Guo-he Tan, Xiang-ren Chen, Shu-ya Qi, Qing-yun Huang, Ming-yue Chen, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7054125/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Feb, 2026 Read the published version in Cell Death Discovery → Version 1 posted 9 You are reading this latest preprint version Abstract Radial migration of neurons is a critical process in the formation of the cerebral cortical layers. Transcriptional regulators are implicated in neuronal migration, while the molecular mechanisms remain incompletely understood. Junction-mediating and regulatory protein (JMY), a p53 coactivator with established roles in embryonic development, has an unclear role in neurodevelopment. Here we found that JMY is highly expressed in the developing brain, particularly in the ventricular zone and subventricular zone, areas known for neurogenesis. Knockdown of Jmy led to delayed radial migration of cortical neurons, disrupted cell cycle exit, and impaired neuronal differentiation. Behavioral studies revealeddeficits in spatial learning and memory in JMY-deficient mice. Proteomicanalysis using Jmy -mutant mice suggested that knocking out JMY in the mouse brain affects cell cycle-related pathways. Our findings indicate an important role of JMY in neurogenesis and cognitive function in the mouse developing brain, providing novel insights into the molecular mechanisms underlying neuronal migration during corticogenesis. Biological sciences/Neuroscience/Development of the nervous system/Neuronal development Biological sciences/Developmental biology/Neurogenesis/Developmental neurogenesis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Cerebral cortical development is the basis for brain structure and function, and it relies on tightly regulated processes such as neural stem cell proliferation, differentiation, and migration and neuronal localization 1,2 . Neuronal migration is a fundamental of cerebral cortical development, ensuring that postmitotic neurons move from their proliferative zones to their designated cortical layers, thereby establishing the six-layered neocortical structure that is vital for higher-order cognitive functions 3 . Disruptions in this process can lead to severe developmental abnormalities and cognitive dysfunctions, including intellectual disabilities, epilepsy, severe learning disabilities and autism spectrum disorders, underscoring the importance of understanding the molecular pathways that regulate neuronal migration 4,5 . The migration of neural progenitor cells and their differentiation into specific neuronal subtypes is a critical process for normal brain development. These processes are orchestrated by a wide array of signaling molecules and pathways that regulate cell cycle progression, cytoskeletal reorganization, and cell fate determination 6 . Among these, the Wiskott‒Aldrich Syndrome Protein (WASP) family of proteins is critical for regulating various cellular processes, such as actin polymerization, cell migration, and differentiation 7,8 . WASP family proteins mediate the reorganization of the actin cytoskeleton, which is essential for neuronal migration and synapse formation. These processes are crucial for proper brain function and cognitive ability 7,8 . Recent studies have demonstrated that defects in WASP family proteins lead to cognitive dysfunctions, including impairments in learning and memory 7,8 . Junction-mediating and regulatory protein (JMY) is a member of the WASP family 9 . JMY was first identified as a transcriptional coactivator of p53 10 . Studies have shown that JMY acts as a coactivator of p53, thereby incresing the transcriptional activity of p53 target genes involved in cell cycle regulation and apoptosis 9,11 . P53 activation is crucial for maintaining neurogenesis and can influence the balance between self-renewal and differentiation of neural progenitor cells. P53 activates several downstream target genes that are involved in cell cycle arrest, DNA repair, and apoptosis, such as p21, Bcl2, and Gadd45α 12,13 . These proteins play essential roles in regulating cell cycle checkpoints and maintaining genomic integrity during neurogenesis. Given the importance of p53 in regulating neurogenesis , JMY likely plays an important role in cortical neuron development and cognitive functions. It has been reported that JMY plays crucial roles in mammalian oocyte maturation in both mice and pigs 14,15 . Knockdown of JMY in porcine embryos caused developmental abnormalities in porcine and mouse embryos 16 . Thus, these studies suggest that JMY may also play an important role in neuronal development and function. However, the expression and function of JMY in the nervous system have not been systematically investigated. In this study, we found that Jmy is expressed at high levels in the brain during the early stage of development and is expressed in both immature and mature neurons. Reducing Jmy expression can impair the migration of cortical neurons. Moreover, JMY can cause progenitor cells to shift from proliferative cell division to differentiative cell division. In behavior tests, conditional Jmy knockout mice exhibited impaired learning and memory behavior. We obtained several findings that clarified the function of JMY in brain development for the first time and revealed a new mechanism for the development and regulation of cortical neurons. Materials and methods Animals C57BL/6 mice were obtained from the animal breeding colony of the Animal Centre of Guangxi Medical University, China. Owing to the critical role of Jmy in embryonic development, global knockout of Jmy results in substantial embryonic lethality, thereby limiting the generation of Jmy global knockout mice. In this study, we utilized LoxP- flanked Jmy mice, which were generated by inserting LoxP sequences flanking exon 3 of the Jmy gene via homologous recombination. This approach resulted in the creation of Jmy loxP/loxP mice, which were then used to generate Jmy conditional knockout (cKO) mice using Cre/ loxP technology. The construction of Jmy loxP/loxP mice was performed by Shanghai Biomodel Organism Science and Technology Development Co., Ltd. (Animal Experimentation License No. SCXK (Shanghai) 2017-0010). Following the generation of Jmy loxP/loxP mice, the animals were crossed with two distinct Cre recombinase transgenic mouse lines: Nestin-Cre and Emx1-Cre. Nestin-Cre mice, obtained from Shanghai Biomodel Organism Science and Technology Development Co., Ltd., express Cre recombinase under the control of the Nestin promoter, which is predominantly active in neural progenitor cells throughout the developing central nervous system. By crossing Jmy loxP/loxP mice with Nestin-Cre mice, Jmy was specifically deleted in neural progenitor cells, generating Nestin-Cre;Jmy −/− mice. In contrast, Emx1-Cre mice, which were sourced from The Jackson Laboratory (Stock No: 005628), express Cre recombinase under the control of the Emx1 promoter, which is expressed in early forebrain progenitors and has strong activity in the cortex and hippocampus. Crossing Jmy loxP/loxP mice with Emx1-Cre mice resulted in the conditional deletion of Jmy in the cortex and hippocampus, generating Emx1-Cre;Jmy −/− mice. The resulting Nestin-Cre;Jmy −/− and Emx1-Cre;Jmy −/− mice were utilized to investigate the role of Jmy in neural development. Specifically, Nestin-Cre;Jmy −/− mice enabled the assessment of Jmy function in the entire nervous system, whereas Emx1-Cre;Jmy −/− mice enabled the investigation of Jmy function specifically within the cortical and hippocampal regions. All the mice were housed in temperature-controlled rooms under a 12 h light/12 h dark cycle and were given food and water ad libitum . All the studies were approved by the Institutional Animal Care and Use Committee of Guangxi Medical University and were performed in compliance with the U.S. National Institutes of Health Guide for the Care and Use of Laboratory Animals. RNA extraction and real-time PCR Forebrain tissues from embryonic or postnatal mice (C57BL/6) at different developmental stages (E14, E16, E18, P0, P3, P7, P14, and adult), tissues from different organs (P7), and hippocampal tissues from Nestin-Cre;Jmy −/− mice and the corresponding controls, were used for RNA extraction. The brain tissues were homogenized with TRIzol Reagent (Invitrogen) at 4°C. RNA was extracted according to the manufacturer’s instructions. The final RNA pellet was suspended in diethylpyrocarbonate (DEPC)-treated water, and 2 μg of total mRNA was then subjected to reverse transcription using oligo (dT) primers and Moloney murine leukemia virus (M-MLV) transcriptase (Invitrogen). Real-time PCR was performed with a LightCycler 480 Real-Time PCR System (Roche) according to the manufacturer’s instructions. Starting RNA levels were quantified by using Gapdh as the external standard. The primer sets were chosen from PrimerBank, and the gene sequences are available in the GenBank database. The sequences of the primers used to evaluate the mRNA expression of mouse genes were as follows: Jmy: forward, 5′- CAGAAGGGCTATGAAGAGG -3′; reverse, 5′- CGGAATGGCTGAAGTAAAT -3′; Gapdh : forward, 5′- CCCCAATGTATCCGTTGTG -3′; reverse, 5′- CTCAGTGTAGCCCAGGATGC -3′. Cdkn1a (p21): forward, 5’-AATCCTGGTGATGTCCGACC-3’; reverse, 5’-GACCAATCTGCGCTTGGAGT-3’; Gadd45α : forward, 5’-CTGGCTGCGGATGAAGATGACGAC-3’, reverse, 5′-TTATCCATGTAGCGACTTTCCCGG-3′; Puma: forward, 5’-TCCTCAGCCCTCCCTGTCAC-3’, reverse 5’-CCATTTCTGGGGCTCCAGGA-3′; Bax: forward, 5’-TGAAGACAGGGGCCTTTTTC-3’, reverse, 5’-AATTCGCCGGAGACACTCG-3’; and Bcl-2: forward, 5’-GTCGCTACCGTCGTGACTTC-3’, reverse, 5’-CAGACATGCACCTACCCAGC-3’. The primers used were synthesized by Sunny Biotech. Western blot analysis To analyze expression of JMY in the developing mouse cortex, cortices were dissected and homogenized as previously described 17 . All protein samples were separated via 10% SDS‒polyacrylamide gel electrophoresis (Bio-Rad) and blotted onto PVDF membranes (Millipore). The membranes were blocked with 5% nonfat milk in 0.05% Tween 20 at room temperature for 1 h and probed with goat anti-JMY (Santa Cruz Biotechnology) and HRP-coupled mouse anti-GAPDH (Aksomics) antibodies. The secondary antibody used for JMY was anti-goat IgG coupled to HRP (Aksomics). The bands were visualized by enhanced chemiluminescence (TIANGEN). Band intensities were measured with ImageJ software. Immunohistochemistry Forebrain sections from mice at different developmental stages were postfixed in 4% paraformaldehyde (PFA) in blocking buffer (5% (wt/vol) bovine serum albumin (BSA), 10% (vol/vol) normal goat serum (NGS), 0.25% (vol/vol) Triton X-100) for 1 h to block nonspecific background staining. The sections were further incubated with primary antibodies against JMY (1:500, Santa Cruz), MAP2 (1:2,000, Sigma), GFP (1:2,000, Invitrogen), GFAP (1:1,000, Millipore), NeuN (1:1,000, Millipore), and Nestin (1:500, Sigma) overnight at 4°C. After being washed, the sections were incubated with their respective secondary antibodies at room temperature for 2 h and then counterstained with Hoechst 33342 for 10 min at room temperature before being covered with coverslips. Cultured neurons were fixed with 4% PFA and then immunostained with primary antibodies against JMY (1:500, Santa Cruz), MAP2 (1:2,000, Sigma), GFP (1:2,000, Invitrogen), GFAP (1:1,000, Millipore), and NeuN (1:1,000, Millipore) overnight at 4 °C. After washing, the sections were incubated with their respective secondary antibodies at room temperature for 2 h and then counterstained with Hoechst 33342 and phalloidin for 10 min at room temperature. For DAB staining, brain sections (30 μm) were incubated in 0.01 M phosphate-buffered saline (PBS) supplemented with 3% hydrogen peroxide for 10 min to block endogenous peroxidase activity and then in blocking buffer containing 5% BSA/10% normal goat serum/0.25% Triton X-100 for 60 min at room temperature to prevent nonspecific staining. IHC was subsequently conducted on these free-floating sections, and staining was visualized with a standard ABC Elite kit (Vector Labs). In situ hybridization In situ hybridization of the brain sections was performed with digoxigenin-labeled antisense riboprobes. The full-length cDNA of Jmy was amplified with specific PCR primers and subsequently cloned and inserted into the pGEM-T easy vector (Promega) to generate an antisense probe for Jmy . The digoxigenin-labeled antisense riboprobes were synthesized by in vitro transcription via the SP6 Riboprobe System (Promega). The mice were perfused with 4% paraformaldehyde (PFA) and fixed in 4% PFA at 4°C. Fixed brains were cryoprotected overnight in 15%–30% sucrose/PBS at 4°C, mounted in optimal cutting temperature (OCT) compound and sectioned coronally (20 μm) with a cryostat (Leica). The brain sections were hybridized for 18 h at 60 °C. The hybridization signal was detected with anti-DIG–alkaline phosphatase Fab fragments (Roche) and nitro blue tetrazolium chloride (NBT) plus 5-bromo-4-chlor-indolyl-phosphate (BCIP) as substrates for the color reaction. In utero electroporation In utero electroporation was performed as described previously 18 , with minor modifications. Briefly, pregnant mice at E14.5 were anesthetized with pentobarbital sodium. Midline laprotomy was performed after the abdomen was cleaned, and the uterus was removed. DNA plasmids (1 μL) at a high concentration were injected into the lateral ventricle with 0.05% Fast Green (Sigma) through a polished micropipette. Square electric pulses were delivered to the embryos through the uterus at a rate of one pulse per second by holding the embryos with forceps-type electrodes while the uterus was kept wet by dropping saline (prewarmed at 37°C) between the electrodes. Five electrical pulses (50 V, 50 ms, 1 s interval) were applied across the uterine wall using an ECM-830 BTX square wave electroporator. The uterine horns were then returned to the abdominal cavity, and the abdomen wall and skin were sutured using a surgical needle and thread. BrdU labeling For bromodeoxyuridine (BrdU) incorporation, E15.5 mice were intraperitoneally injected with 100 mg/kg BrdU (Sigma) and sacrificed at birth. ThCryostat sections of the brains were incubated in 1 N HCl for 30 min at 37°C to denature the DNA and then neutralized in 0.1 M borate buffer (pH 8.0). The sections were then incubated with rat anti-BrdU (1:100, Sigma), Ki67 (1:400, Invitrogen) and rabbit anti-GFP (1:2,000, Invitrogen) antibodies after being washed with 0.01 M PBS (pH 7.4). A slice from the same plane was selected as the observation object for each mouse, and the numbers of BrdU-positive cells and BrdU and GFP double-positive cells were counted. Behavior tests Morris water maze test The standard procedure of the Morris water maze test was used 19 . Adult male mice (10–12 weeks old) of each genotype were trained to find the visible platform with four trials a day for the first day and were tested to find the hidden platform for 5 to 6 consecutive days. In each trial, the mice were allowed to swim until they found the hidden platform when they started from different, random locations around the perimeter of the tank. The mice were then allowed to sit on the platform for 10 s before being picked up. On the probe trial day, the platform was removed from the tank. The escape latency and the time spent in each quadrant were recorded by a video camera. The experimenter was blinded to the genotypes and ages of the mice. Y maze The Y-maze design was based on published protocols, with modifications to adapt the system to mice 20,21 . Briefly, the mice were placed into one of the arms of the maze (start arm) and allowed to explore the maze with one of the arms closed for 15 min (training trial). After a 1-h intertrial interval, the mice were returned to the Y maze by placing them in the start arm. The mice were subsequently allowed to explore all three arms of the maze freely for 5 min (test trial). The number of entries into and the time spent in each arm and the first choice of entry were determined from video recordings by an observer blinded to the genotype of the mice. Proteomic analysis Proteins from hippocampi of the wild-type and Nestin-Cre;Jmy -/- mice (n=3 per group) were extracted with SDT buffer, quantified, digested by trypsin, and labeled using TMT reagents. Peptides were fractionated by SCX chromatography, desalted, and analyzed by LC-MS/MS (Q Exactive coupled with Easy nLC). Raw MS data were identified and quantified with Mascot in Proteome Discoverer software against the UniProt mouse database, using the false discovery rate (FDR) <1%. Differentially expressed proteins were defined by fold-change ≥1.10 and p <0.05. Proteomic analysis was performed by Shanghai Applied Protein Technology Co., Ltd. (Shanghai, China).To determine the functional classifications and biological properties of the differentially abundant proteins, the identified protein sequences were mapped using Gene Ontology (GO) terms. The functional annotation tools DAVID and Metascape were used for GO functional annotation and functional enrichment of proteins. Finally, the results of enrichment analysis were visualized and displayed in graphical form (such as in bar charts, Sankey charts, etc.) to further understand the biological significance of each protein. Quantification and Statistical Analysis For all statistical analyses, experimenters were blinded for genotypes of mice and the treatments of the animals or cells. Data are presented as mean ± SEM. Appropriate statistical methods were selected based on the data type. The paired or unpaired Student’s t test, Fisher’s exact test, one-way ANOVA with Dunnett’s post hoc tests or Bonferroni’s tests were used for data analyses by SPSS 26.0 software. Statistical significance was defined as p < 0.05. Results 1. JMY is highly expressed in the developing mouse brain JMY is widely expressed in mammalian tissues and cell lines 22 , and the function of JMY in peripheral organs and tissues has been preliminarily studied. However, the expression of JMY in the nervous system and during nervous system development has not been studied. By using RT‒PCR, we found that Jmy mRNA was expressed in every tissue examined from P7 mice, and its expression was greater in the brain, heart, spleen, lung and kidney and lower in the spinal cord, muscle, liver and skin, which is consistent with previous findings 22 (Fig.1A). Moreover, we performed immunohistochemistry on whole mouse embryos at E16 with an anti-JMY antibody, which is commercially available. We found that JMY is abundant in the cerebral cortex, basal ganglia, midbrain and cerebellum and that its expression level is much higher in these tissues than in other tissues (Fig.1B). Considering the high expression of JMY in the nervous system of developing mice, we speculated that JMY may exhibit a specific temporal expression pattern in the developing mouse brain. Thus, we investigated the expression pattern of Jmy in the mouse brain at different developmental stages and found that Jmy mRNA was expressed in the mouse cerebral cortex throughout development, from as early as embryonic day 14 (E14) to adulthood, with peak expression observed around E18. After birth , the expression of JMY gradually decreased , especially after P14, and was weak in adulthood (Fig.1C). The results of real-time PCR also confirmed this expression pattern (Fig.1D).To confirm our mRNA expression data, we detected the expression of the JMY protein in the mouse brain at different developmental stages by immunoblotting with a commercial JMY antibody. The results revealed that the expression level of JMY was the highest in the mouse brain from E16–E18, with a peak level approximately 20–25 times greater than the level in the adult brain (Fig.1E). As the age of the mice increased, the protein expression level gradually decreased to its lowest level in adulthood, which is consistent with previous RT‒PCR results. The above results revealed transient high expression of JMY in the brain during the early stage of development, suggesting that JMY may play a specific role in brain development. To further investigate the spatial expression pattern of Jmy in the brain, we designed and cloned an mRNA probe for Jmy in situ hybridization via a coating method with mouse brain sections at different developmental stages. We observed that JMY is expressed mainly in neurogenic regions, such as the ventricular zone (VZ) and subventricular zone (SVZ), at E16 (Fig.1F), suggesting the possible role of JMY in the proliferation and differentiation of neurons. In addition, JMY began to be expressed in mature regions of the cortex at E18, such as the cortical plate (CP), which was more obvious during the early postnatal period (P3–P7), suggesting that JMY is also expressed at high levels in differentiated neurons. The low layer (Ⅴ, Ⅵ) cells in the brain had migrated to their final positions by around P0, and the cells in layers II to IV still migrating. Jmy was expressed at high levels in the cortical plate, was evenly distributed in each layer, with its expression gradually decreasing after P7, when the neurons in the six layers of the brain had migrated to their final positions (Fig.1G). These results suggest that JMY may play a specific role in the division and differentiation of neural precursor cells, as well as in the early development of differentiated neurons. Moreover, we investigated the expression and subcellular localization of Jmy in neurons. We cultured cortical neurons at different time points in vitro and then used JMY antibodies for immunocytochemical staining. To investigate the distribution of JMY in immature neurons, we labeled microtubules with a microtubule-associated protein 2 (MAP2) antibody and labeled microfilaments with phalloidin in the neurons cultured for 2 days in vitro (DIV2). The multilabeling results revealed that JMY colocalized with MAP-2 in the soma and dendrites, as well as with F-actin in the growth cone (Fig.2A). These findings indicate that JMY is abundantly expressed in the soma, dendrites and growth cones of cultured neurons. We further investigated the distribution of JMY in mature neurons via the use of MAP2 as a cytosolic marker and NeuN as a marker of neuronal nuclei in neurons cultured for 7 days in vitro (DIV7). We found that JMY localized to both the cytosol and nucleus, similar to previous reports 22 (Fig.2B). In addition, we investigated the expression of JMY in the hippocampus at P14 via the use of NeuN and Glial fibrillary acidic protein (GFAP) as markers for neurons and astrocytes, respectively, and the results revealed that JMY was expressed in neurons but not in astrocytes (Fig.2C). These observations indicate that JMY is widely expressed in various tissues, especially during the early development of the cerebral cortex, and is expressed in both immature and mature neurons, which indicates that it may be related to the proliferation, differentiation and migration of neurons. 2. JMY promotes the radial migration of cortical neurons during early embryonic development We previously reported that JMY is expressed at high levels during the embryonic stage, so we speculated that JMY may play a crucial role in embryonic development and brain development after birth. To test this hypothesis, we designed an RNAi that targeted mouse Jmy and suppressed JMY expression in the mouse brain during the embryonic period via in utero electroporation 23 (Fig.3A). The RNAi and plasmids expressing GFP were coinjected into the lateral ventricles of embryonic mice. Under an appropriate electric field, the plasmid DNA was transfected into the cells close to the ventricle of the cerebral cortex in fetal mice 18 . To examine the impact of altered JMY expression in neurons, we performed in utero electroporation at E14.5 in mice, followed by immunohistochemistry and morphological assessments at E18.5, P0, and P5. In the experimental group, where JMY was knocked down using shRNA-#1, significant retention of GFP-positive cells was observed in the VZ/SVZ. Conversely, only a small number of neurons migrated to the intermediate zone (IZ) and cortical plate (CP) (Fig.3B-C). However, in the control mice (shRNA-Scr), there were relatively few GFP-positive cells in the SVZ, and most of them had migrated to the CP and were well distributed there. Knocking down JMY with shRNA-#3 also caused a significant reduction in migration compared with that in the control group, although to a lesser extent than observed in the shRNA-#1 group (Fig.3B-C). This phenomenon persisted until after birth, and the number of GFP-positive cells that reached the upper CP was comparable between the shRNA construct and scrambled control groups at P5 (Fig.3B-C). These findings indicate that reduced JMY expression in the embryonic brain could cause a delay in the radial migration of cortical neurons during early embryonic development, but this phenotype normalized during postnatal development. To further confirm the role of JMY in neuronal migration in the developing cortex, we also performed an overexpression experiment in which full-length Jmy and GFP plasmids were cotransfected into the developing mouse cortex, and the results revealed that more neurons migrated to the CP and fewer neurons remained in the VZ/SVZ than that in the control group that was transfected with the shRNA-scr plasmid (Fig.3 D-E). These results indicate that JMY can promote the migration of cerebral cortical neurons. 3. JMY promotes neural progenitor cell cycle exit and differentiation in the developing cerebral cortex Previous studies revealed that early JMY is distributed mainly in the VZ/SVZ of the embryonic brain and that JMY is a cofactor of p53 that is enriched in the nucleus in neurons, which suggests that JMY may play an important role in neuronal division and proliferation and that this effect may be one of the factors affecting neuron migration. To verify this, we used BrdU and Ki67 to label the cells in electroporated mouse brains to observe cell proliferation in the VZ/SVZ. BrdU can specifically label proliferating cells via immunohistochemistry. Thus, it is possible to investigate cell division and proliferation by analyzing the localization, distribution, number, and proliferation of BrdU-positive cells 24,25 Mature neurons are not labeled with BrdU because they do not proliferate and divide. After in utero electroporation, the pregnant mice were injected intraperitoneally with BrdU solution, and the embryonic brains were harvested for immunohistochemical analysis after labeling for 2 hours (Fig.4A). Sections of the electroporated brains were costained for BrdU and the proliferation marker Ki67, which labels cells in all phases of the cell cycle (G1, S, G2, and mitos is ) 26 . The cell cycle exit index was calculated using the ratio of BrdU + Ki67 - GFP + cells to the total population of BrdU + GFP + cells to analyze cell cycle kinetics in the VZ of the cerebral cortex (Figure 4B). The results revealed that when the expression of Jmy was knocked down in the cerebral cortex with RNAi, the number of BrdU-positive cells in the VZ was significantly greater than that in the control group, and the effect of RNAi-# 3 was more obvious (Fig.4C); in addition, the cell cycle exit index was lower in JMY-knockdown mice than in control mice (Fig.4D). These findings indicate that the knockdown of JMY promoted proliferation and disrupted cell cycle exit, suggesting that JMY can cause progenitor cells to shift from proliferative cell division to differentiation. To further confirm the ability of JMY to control cell proliferation and differentiation, we performed immunohistochemistry with a nestin antibody in developing mouse brain after cotransfection with the GFP plus shRNA-scr plasmid or the shRNA-#1 plasmid (Fig.4E). Nestin is a neural stem/progenitor cell marker that is expressed in embryonic and adult central nervous system (CNS) cells both in vitro and in vivo 27,28 . Nestin expression is downregulated when CNS stem/progenitor cells differentiate into neurons or glial cells 29,30 . Proliferative division dominates during the early stages of development to support expansion of the stem cell population without losing developmental potential, whereas later in development, differentiative divisions generate differentiated cells at the expense of the progenitor pool. Therefore, it is possible to investigate the rate of proliferation and the fraction of neural progenitor cells that exit the cell cycle by observing the size of the remaining progenitor pool. The results revealed that the percentage of Nestin and GFP double-positive cells among total GFP-positive cells was greater in the VZ/SVZ in the brains of mice subjected to JMY knockdown via RNAi than in those of the control mice treated with shRAN-scr (Fig.4F). These results suggest that JMY promotes differentiative divisions at the expense of proliferative divisions. 4. Spatial learning and memory are impaired in JMY-deficient mice JMY is essential for embryonic development, and whole-body genetic deletion of JMY is difficult to achieve; however, the learning and memory abilities of mice subjected to conditional knockout of JMY via Nestin-Cre were evaluated in both the Morris water maze and Y maze tests (Fig.5A-B). First, the Morris water maze results revealed that, compared with control littermate mice, Nestin-Cre;Jmy -/- mice exhibited an increased escape latency during the training process (Fig.5 C). To further assess the retention of spatial memory in Nestin-Cre;Jmy -/- mice, we evaluated their performance in the probe trials conducted thereafter (Fig.5D). On the 6th day of training in the MWM test, the Nestin-Cre;Jmy -/- mice presented significant decreases in the number of platform crossings and the time spent in the target quadrants in the probe trial phase. Taken together, the above results suggest that Jmy knockout can affect spatial memory retention in Nestin-Cre;Jmy -/- mice. Regarding novel arm exploration in the Y maze test, a deficit in spatial memory of Nestin-Cre;Jmy -/- mice was evident when the arm chosen for the first entry was recorded (Fig.5 E). Moreover, WT mice more frequently entered the novel arm of the maze, which was previously unvisited. In contrast, Nestin-Cre;Jmy -/- mice showed no preference toward the novel arm and entered randomly into the different arms. Specifically, these cKO mice presented lower percentages of time spent in the novel arm, fewer entries into the novel arm, and a decreased duration of stay in the novel arm (Fig.5 E). Spatial memory and recognition memory are influenced by both hippocampal and cortical lesions 31,32 . We proposed that the normal structure and function of the cortex and hippocampus are impaired in JMY-deficient mice, impairing spatial memory and recognition. To further investigate the effects of JMY on learning and memory functions, we employed Emx-Cre to conditionally knock out Jmy in the cortical and hippocampal regions of mice and performed a series of behavioral experiments (Fig.6 A-B). The outcomes were similar to those obtained in experiments in which Nestin-Cre was used. Specifically, Emx-Cre -driven conditional knockout mice exhibited impairments in learning and memory, as assessed by behavioral tests. In the Morris water maze test, these mice exhibited increased escape latencies during the training phase compared with their control littermates, indicating difficulty in learning (Fig.6 C). Additionally, in the probe trials conducted thereafter, the Emx1-Cre;Jmy -/- mice presented a significant reduction in the number of platform crossings and decreased time spent in the target quadrants, suggesting impaired spatial memory retention (Fig.6 D). The Y-maze test further corroborated these findings, as the knockout mice displayed a lack of preference for the novel arm and randomly entered into various arms, unlike the wild-type mice, which predominantly explored the novel, previously unvisited arm (Fig.6 E). These results underscore the critical role of JMY in the structural and functional integrity of the cortex and hippocampus, which are essential for maintaining proper spatial memory and recognition. 5 . JMY deficiency disrupts cell cycle regulation To explore the molecular mechanisms underlying the observed defects and in view of the potential function of JMY in learning and memory, we performed quantitative proteomics analysis of control and Nestin-Cre;Jmy -/- mice. We identified 142 differentially expressed proteins (87 upregulated, 56 downregulated; Fig.7A-B). Notably, TP53RK was the most upregulated protein in the cKO mice (Fig.7B). The differentially expressed proteins between the groups were evaluated by hierarchical clustering analysis (Fig.7C). These differentially expressed proteins were significantly enriched in processes such as oxidative phosphorylation, Nucleotide excision repair, and cell cycle. Among these pathways, the cell cycle pathway involved the largest protein subset, notably including TP53RK (Fig.7D). Sankey diagram-based clustering and enrichment analysis of the cell cycle–related subset revealed the involvement of TP53RK in biological processes related to RNA metabolism and tRNA processing(Fig.7E). As TP53RK is known to regulate p53 transcriptional activity 33 , we investigated mRNA levels changes in key targets downstream of p53, including p21 , Puma , Bcl2 , Bax , and G add45α in the hippocampi of Nestin-Cre;Jmy −/− mice. Subsequent validation experiments revealed elevated expression of Gadd45α (Fig.7F-G), a key target downstream of p53 that is involved in DNA repair and cell cycle checkpoint control 34 . These results indicate that JMY deficiency disrupts hippocampal cell cycle dynamics via increased TP53RK-mediated p53 signaling and increased Gadd45 α expression, potentially contributing to abnormal neuronal processes affecting learning and memory. DISCUSSION During cerebral cortex formation, neurons develop from progenitor cells, which undergo proliferation, migration and morphogenesis in a nonoverlapping chronological order 2 , 35 . The diverse population of projection neurons in the cortex are generated from the neural progenitors present in the VZ and the SVZ 36 . There are a considerable number of neural progenitor cells and neural precursor cells with multidirectional differentiation abilities in the VZ/SVZ during the early development of the cerebral cortex 2 , 36 . In this study, we found that JMY is abundantly expressed in the brain, begins to be expressed in the cortex in the early embryo, is distributed mainly in the VZ/SVZ, and shows transient high expression during the later stages of embryo development (Fig. 3 ). The specific spatiotemporal expression pattern of JMY suggests that it is important for the regulation of neuronal development. Moreover, JMY, as a co-factor of p53, is abundantly expressed in the nucleus of neurons (Fig. 4 ). Previous studies have revealed that p53-deficient mouse embryos exhibit severe malformations during cortical development, such as cortical stratification disorders, local hyperplasia, and exencephaly 37 . p53 can inhibit the proliferation and renewal ability of neural stem cells by regulating the cell cycle 38 , and it regulates the neuronal differentiation kinetics and maturity of neurons 39 . These findings suggest that JMY plays an important role in the proliferation and differentiation of neurons. To verify this, we used a BrdU-Ki67 cell cycle profiling assay and showed that knockdown of JMY promoted proliferation and suppressed terminal mitosis and differentiation of neural progenitor cells, suggesting that JMY can cause progenitor cells to shift from proliferative cell division to differentiative cell division. This finding was further supported by an increase in the abundance of proliferating neural progenitor cells (nestin-positive cells) with the knockdown of JMY. The size of the neural progenitor cell pool is regulated by proliferative divisions that expand the pool and differentiative divisions that reduce the pool 35 , 40 . These findings indicate that the expense of the neural progenitor cells in the pool is reduced. In the developing mammalian brain, neural progenitor cells in the VZ/SVZ have the ability to actively proliferate and differentiate, and their cell cycle status affects subsequent neuron migration and localization to different layers of the cerebral cortex 41 . If G2/M phase arrest fails to effectively promote cell cycle termination, progenitor cells may remain in a proliferative state, making it difficult to transition into migrating neurons, thereby affecting normal neuronal migration and the establishment of cortical laminar structures 42 . Moreover, as an actin nucleation factor 9 , JMY has the potential to regulate cell dynamics and affect cell morphogenesis. In the present study, we used RNAi to knock down the expression of JMY in the embryonic stage and found that the migration of neurons in the lower layer was significantly impaired, whereas the overexpression of JMY promoted the migration of cerebral cortical neurons (Fig. 6 ). These findings suggest that JMY plays an important role in the migration of neurons in the developing brain by promoting differentiative cell divisions. Therefore, we speculate that JMY regulates neuronal migration by affecting the ability of p53 to regulate proliferation and differentiation, inhibiting the proliferative division of neural progenitor cells, promoting exit from the cell cycle, and activating the migration process. Notably, our proteomic analysis revealed upregulation of TP53RK (also known as PRPK), a kinase known to phosphorylate p53 at Ser15, thereby modulating its transcriptional activity 33 . This modification enhances the ability of p53 to regulate its downstream targets, including genes involved in cell cycle arrest and apoptosis 33 , 43 , 44 . Among these targets, Gadd45α was found to be significantly upregulated in the hippocampi of Nestin-Cre;Jmy −/− mice. Gadd45α is a direct downstream target of p53 and plays a crucial role in DNA repair and cell cycle checkpoint control 34 . Gadd45α interacts with various cell cycle regulators, including cyclin-dependent kinases, to enforce G2/M checkpoint control 45 , 46 . In the nervous system, Gadd45α has been implicated in neurodevelopmental processes and memory consolidation 47 . However, this Gadd45α-mediated arrest may depend on an intact p53 pathway and the cooperative regulation of p21. In the absence of effective upregulation of p21 expression 48 , 49 , even increased Gadd45α levels may not fully execute its cell cycle inhibitory function. In this study, the p21 mRNA levels did not show significant changes, suggesting that cells failed to effectively initiate the G1 phase regulatory mechanism 50 . Although Gadd45α upregulation can mediate G2/M phase arrest, some cells may still continue into the S phase (as evidenced by increased BrdU + proportion) and may undergo DNA replication without completing normal cell division, leading to the abnormal accumulation of Nestin-positive progenitor cells in the proliferative zone 51 . These cells are unable to exit the cycle smoothly and enter the differentiation pathway, resulting in an overall decline in functional proliferative efficiency 52 .Previous studies have shown that Nestin expression is closely related to cell cycle status and differentiation, typically downregulated when cells exit the cycle and enter differentiation; conversely, it is highly expressed in continuously proliferating progenitor cells 53 . Therefore, the observed increase in Nestin-positive cells in this study may reflect a state of undifferentiated and continuous proliferation, consistent with the observed decrease in the Normalized cell cycle exit index and the increase in BrdU incorporation ratio 54 .This paradoxical phenotype suggests the presence of complex signal network interactions in the JMY-deficient model, and that TP53RK's activation of p53 activity may also be selective. Future research should further focus on the functional diversity of TP53RK and its dynamic regulatory relationship with the p53/Gadd45α axis. Additionally, experimental validation is needed to determine whether p21 has post-translational regulatory mechanism impairments and to identify the specific targets of TP53RK, thereby improving the causal chain in this regulatory network and advancing our understanding of the mechanisms underlying neurodevelopmental abnormalities. Previous investigations have shown that JMY significantly influences neural stem cell proliferation, differentiation, and migration, which are fundamental processes in brain development. Disruptions in these processes can lead to cognitive impairments and neurodevelopmental disorders 1 , 2 . In our study, We found via the Morris water maze and Y maze that Jmy conditional knockout mice presented abnormal spatial learning and memory behavior.We suggest that the impaired learning and memory of the JMY-deficient mice could be attributed to delayed neuronal differentiation and migration, which may reduce the number of fully developed and functional neurons and disrupt the establishment of neural circuits. Other members of the WASP family have also been implicated in learning and memory functions. For instance, Soderling et al. demonstrated that mice lacking WAVE-1 exhibited sensorimotor retardation and deficits in hippocampal-dependent learning and memory, underscoring the critical role of WAVE-1 in these cognitive processes 55 . Furthermore, mutations in components of the WAVE complex have been identified in patients with intellectual disabilities, epilepsy, schizophrenia, and autism spectrum disorders 56 , further supporting the importance of WASP family proteins in neurodevelopment and cognitive functions. Therefore, the spatial learning and memory deficits observed due to JMY deletion are consistent with findings related to other WASP family members, emphasizing the pivotal role of these proteins in maintaining normal cognitive functions. In-depth investigation of JMY's role in NSC regulation could enhance our understanding of the pathogenesis of neurological disorders such as neurodevelopmental and neurodegenerative diseases, potentially offering novel therapeutic targets. The tight coupling of multiple cellular processes is a striking feature of the neurogenesis program. Although progress has been made in characterizing the molecular pathways that regulate individual cellular events during neurogenesis, how these various processes are coordinately regulated in a coherent developmental program remains poorly understood 57 . Here, we provide evidence that JMY plays an important role in the coordination of multiple aspects of neurogenesis in the cortex, particularly in regulating the cell cycle exit of neural progenitor cells and radial migration of neurons. Knockdown of Jmy resulted in delayed cortical neuron migration and impaired cell cycle exit, leading to disrupted neuronal differentiation. These abnormalities ultimately led to significant deficits in spatial learning and memory function. These findings underscore the critical regulatory role of JMY in neurogenesis, deepening our understanding of cortical development and providing insights into potential therapeutic targets for neurodevelopmental disorders. Declarations Acknowledgments We thank Dr. Yiqiang Ouyang for animal care. This work was supported by grants from the National Science Foundation of China (31800865, 82171200), the Guangxi Natural Science Foundation Program(2017GXNSFAA198054). Author contributions G.T. and Y.L. contributed to conception and design of the study. G.T., Y.L., S.Q, Q.H and X.C., conducted experiments and performed the statistical analysis. X.C. wrote the draft of the manuscript. X.C., M.C., W.L., H.L. and N.H. provided technical support in genotyping, WB and RT-PCR. G.T., Y.L., Q.H. and S.Q. conducted in situ hybridization in utero electroporation technology combined with immune-fluorescence staining. Y.K. provided technical support in NSCs culture and immunostaining. X.C., Z.G, J.G. and X.J. provided technical support in animals behavior tests. All authors contributed to manuscript revision, read, and approved the submitted version. Conflicts of interest The authors declare that this research was performed in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. References Andrews, M. G., Subramanian, L., Salma, J. & Kriegstein, A. R. How mechanisms of stem cell polarity shape the human cerebral cortex. Nat. Rev. Neurosci. 23 , 711-724 (2022). Gotz, M. & Huttner, W. B. The cell biology of neurogenesis. Nat Rev Mol Cell Biol . 6 , 777-788 (2005). Buchsbaum, I. Y. & Cappello, S. Neuronal migration in the CNS during development and disease: insights from in vivo and in vitro models. Development . 146 , (2019). Marin, O. & Rubenstein, J. L. Cell migration in the forebrain. Annu. Rev. Neurosci. 26 , 441-483 (2003). Ayala, R., Shu, T. & Tsai, L. H. Trekking across the brain: the journey of neuronal migration. Cell . 128 , 29-43 (2007). Takahashi, M., Kojima, M., Nakajima, K., Suzuki-Migishima, R. & Takeuchi, T. Functions of a jumonji-cyclin D1 pathway in the coordination of cell cycle exit and migration during neurogenesis in the mouse hindbrain. Dev. Biol. 303 , 549-560 (2007). A, K. D., K, P. H. & Chen, B. Corrigendum to "WASP Family Proteins: Molecular Mechanisms and Implications in Human Disease" [Eur. J. Cell Biol. Vol. 101, Issue 3, (2022) 151244]. Eur. J. Cell Biol. 102 , 151287 (2023). Kramer, D. A., Piper, H. K. & Chen, B. WASP family proteins: Molecular mechanisms and implications in human disease. Eur. J. Cell Biol. 101 , 151244 (2022). Zuchero, J. B., Coutts, A. S., Quinlan, M. E., Thangue, N. B. & Mullins, R. D. p53-cofactor JMY is a multifunctional actin nucleation factor. Nat. Cell Biol. 11 , 451-459 (2009). Shikama, N. et al. A novel cofactor for p300 that regulates the p53 response. Mol. Cell . 4 , 365-376 (1999). Coutts, A. S., Boulahbel, H., Graham, A. & La Thangue, N. B. Mdm2 targets the p53 transcription cofactor JMY for degradation. EMBO Rep. 8 , 84-90 (2007). Fischer, M. Census and evaluation of p53 target genes. Oncogene . 36 , 3943-3956 (2017). Dai, C. & Gu, W. p53 post-translational modification: deregulated in tumorigenesis. Trends Mol. Med. 16 , 528-536 (2010). Sun, S. C., Sun, Q. Y. & Kim, N. H. JMY is required for asymmetric division and cytokinesis in mouse oocytes. Mol. Hum. Reprod. 17 , 296-304 (2011). Lin, Z., Xu, Y. N., Namgoong, S. & Kim, N. H. JMY functions as actin nucleation-promoting factor and mediator for p53-mediated DNA damage in porcine oocytes. PLoS One . 9 , e109385 (2014). Lin, Z. L., Cui, X. S., Namgoong, S. & Kim, N. H. Junction-mediating and regulatory protein (JMY) is essential for early porcine embryonic development. J Reprod Dev . 61 , 361-367 (2015). Li, S., Zhang, C., Takemori, H., Zhou, Y. & Xiong, Z. Q. TORC1 regulates activity-dependent CREB-target gene transcription and dendritic growth of developing cortical neurons. J. Neurosci. 29 , 2334-2343 (2009). Saito, T. In vivo electroporation in the embryonic mouse central nervous system. Nat. Protoc. 1 , 1552-1558 (2006). Vorhees, C. V. & Williams, M. T. Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat. Protoc. 1 , 848-858 (2006). Sarnyai, Z. et al. Impaired hippocampal-dependent learning and functional abnormalities in the hippocampus in mice lacking serotonin(1A) receptors. Proc Natl Acad Sci U S A . 97 , 14731-14736 (2000). Lalonde, R. The neurobiological basis of spontaneous alternation. Neurosci Biobehav Rev . 26 , 91-104 (2002). Firat-Karalar, E. N., Hsiue, P. P. & Welch, M. D. The actin nucleation factor JMY is a negative regulator of neuritogenesis. Mol. Biol. Cell . 22 , 4563-4574 (2011). Saito, T. & Nakatsuji, N. Efficient gene transfer into the embryonic mouse brain using in vivo electroporation. Dev. Biol. 240 , 237-246 (2001). Nakamura, S. et al. Application of bromodeoxyuridine (BrdU) and anti-BrdU monoclonal antibody for the in vivo analysis of proliferative characteristics of human leukemia cells in bone marrows. Oncology . 48 , 285-289 (1991). Sugihara, H., Hattori, T. & Fukuda, M. Immunohistochemical detection of bromodeoxyuridine in formalin-fixed tissues. Histochemistry . 85 , 193-195 (1986). Gerdes, J. et al. Cell cycle analysis of a cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67. J. Immunol. 133 , 1710-1715 (1984). Reynolds, B. A. & Weiss, S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science . 255 , 1707-1710 (1992). Morshead, C. M. et al. Neural stem cells in the adult mammalian forebrain: a relatively quiescent subpopulation of subependymal cells. Neuron . 13 , 1071-1082 (1994). Frederiksen, K. & McKay, R. D. Proliferation and differentiation of rat neuroepithelial precursor cells in vivo. J. Neurosci. 8 , 1144-1151 (1988). Dahlstrand, J., Zimmerman, L. B., McKay, R. D. & Lendahl, U. Characterization of the human nestin gene reveals a close evolutionary relationship to neurofilaments. J. Cell Sci. 103 ( Pt 2) , 589-597 (1992). Buckmaster, C. A., Eichenbaum, H., Amaral, D. G., Suzuki, W. A. & Rapp, P. R. Entorhinal cortex lesions disrupt the relational organization of memory in monkeys. J. Neurosci. 24 , 9811-9825 (2004). Shrager, Y., Bayley, P. J., Bontempi, B., Hopkins, R. O. & Squire, L. R. Spatial memory and the human hippocampus. Proc Natl Acad Sci U S A . 104 , 2961-2966 (2007). Abe, Y. et al. Cloning and characterization of a p53-related protein kinase expressed in interleukin-2-activated cytotoxic T-cells, epithelial tumor cell lines, and the testes. J. Biol. Chem. 276 , 44003-44011 (2001). Jin, S. et al. Gadd45a contributes to p53 stabilization in response to DNA damage. Oncogene . 22 , 8536-8540 (2003). Noctor, S. C., Martinez-Cerdeno, V., Ivic, L. & Kriegstein, A. R. Cortical neurons arise in symmetric and asymmetric division zones and migrate through specific phases. Nat. Neurosci. 7 , 136-144 (2004). Leone, D. P., Srinivasan, K., Chen, B., Alcamo, E. & McConnell, S. K. The determination of projection neuron identity in the developing cerebral cortex. Curr. Opin. Neurobiol. 18 , 28-35 (2008). Sah, V. P. et al. A subset of p53-deficient embryos exhibit exencephaly. Nat. Genet. 10 , 175-180 (1995). Meletis, K. et al. p53 suppresses the self-renewal of adult neural stem cells. Development . 133 , 363-369 (2006). Marin, N. A. et al. p53 controls genomic stability and temporal differentiation of human neural stem cells and affects neural organization in human brain organoids. Cell Death Dis. 11 , 52 (2020). Casas, G. G. & Paridaen, J. The Symmetry of Neural Stem Cell and Progenitor Divisions in the Vertebrate Brain. Front Cell Dev Biol . 10 , 885269 (2022). Wu, S. X. et al. Pyramidal neurons of upper cortical layers generated by NEX-positive progenitor cells in the subventricular zone. Proc Natl Acad Sci U S A . 102 , 17172-17177 (2005). Wu, S. et al. Cell cycle during neuronal migration and neocortical lamination. Int. J. Dev. Neurosci. 81 , 209-219 (2021). Abe, Y. et al. A Small Ras-like protein Ray/Rab1c modulates the p53-regulating activity of PRPK. Biochem Biophys Res Commun . 344 , 377-385 (2006). Molina, E., Cataldo, V. F., Eggers, C., Munoz-Madrid, V. & Glavic, A. p53 Related Protein Kinase is Required for Arp2/3-Dependent Actin Dynamics of Hemocytes in Drosophila melanogaster. Front Cell Dev Biol . 10 , 859105 (2022). Sax, J. K. & El-Deiry, W. S. p53 downstream targets and chemosensitivity. Cell Death Differ. 10 , 413-417 (2003). Kastan, M. B. et al. A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell . 71 , 587-597 (1992). Zhang, L. et al. Gadd45g, A Novel Antidepressant Target, Mediates Metformin-Induced Neuronal Differentiation of Neural Stem Cells Via DNA Demethylation. Stem Cells . 40 , 59-73 (2022). Zhao, H. et al. The central region of Gadd45 is required for its interaction with p21/WAF1. Exp. Cell Res. 258 , 92-100 (2000). Tamura, R. E. et al. GADD45 proteins: central players in tumorigenesis. Curr. Mol. Med. 12 , 634-651 (2012). Harper, J. W., Adami, G. R., Wei, N., Keyomarsi, K. & Elledge, S. J. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell . 75 , 805-816 (1993). Bartek, J., Lukas, C. & Lukas, J. Checking on DNA damage in S phase. Nat Rev Mol Cell Biol . 5 , 792-804 (2004). Ohnuma, S., Philpott, A. & Harris, W. A. Cell cycle and cell fate in the nervous system. Curr. Opin. Neurobiol. 11 , 66-73 (2001). Mignone, J. L., Kukekov, V., Chiang, A. S., Steindler, D. & Enikolopov, G. Neural stem and progenitor cells in nestin-GFP transgenic mice. J. Comp. Neurol. 469 , 311-324 (2004). Calegari, F., Haubensak, W., Haffner, C. & Huttner, W. B. Selective lengthening of the cell cycle in the neurogenic subpopulation of neural progenitor cells during mouse brain development. J. Neurosci. 25 , 6533-6538 (2005). Soderling, S. H. et al. Loss of WAVE-1 causes sensorimotor retardation and reduced learning and memory in mice. Proc Natl Acad Sci U S A . 100 , 1723-1728 (2003). Pathania, M. et al. The autism and schizophrenia associated gene CYFIP1 is critical for the maintenance of dendritic complexity and the stabilization of mature spines. Transl Psychiatry . 4 , e374 (2014). Nguyen, L. et al. p27kip1 independently promotes neuronal differentiation and migration in the cerebral cortex. Genes Dev . 20 , 1511-1524 (2006). Additional Declarations There is no conflict of interest Cite Share Download PDF Status: Published Journal Publication published 26 Feb, 2026 Read the published version in Cell Death Discovery → Version 1 posted Editorial decision: revise 11 Aug, 2025 Review # 2 received at journal 30 Jul, 2025 Review # 1 received at journal 24 Jul, 2025 Reviewer # 2 agreed at journal 15 Jul, 2025 Reviewer # 1 agreed at journal 15 Jul, 2025 Reviewers invited by journal 15 Jul, 2025 Submission checks completed at journal 07 Jul, 2025 Editor assigned by journal 05 Jul, 2025 First submitted to journal 05 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7054125","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":485823506,"identity":"9cb258b6-723f-4d46-8bdc-1be1339591fb","order_by":0,"name":"Guo-he Tan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA30lEQVRIiWNgGAWjYPCCAwz8UBZjAyG1PDAtkg0kazE4QKwWe/azh1/zVNyRMz6/xnQzD4ON7IYDzM8e4LWFJy/NmufMM2OzG8/SbvMwpBlvOMBmboDfYTlmxrxthxO33Th8DKjlcOKGAzxsEni18L8Ba6nfPONgG1DLfyK0SOQYPwZqSTDgbwbZcoAILTfemDHOOXPYcMYNtrSbcwySjWceZjPDq4W9P8f4w5uKw/L8/WfMbrypsJPtO978DK8WIIA6QyIBSICCipmAepCSD2CK/wBhpaNgFIyCUTAyAQBTGEx1wMTpQQAAAABJRU5ErkJggg==","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":true,"prefix":"","firstName":"Guo-he","middleName":"","lastName":"Tan","suffix":""},{"id":485823507,"identity":"bcbe157c-4527-4386-b044-e6ad45989cfa","order_by":1,"name":"Xiang-ren Chen","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiang-ren","middleName":"","lastName":"Chen","suffix":""},{"id":485823508,"identity":"af68fa9c-fee2-492f-be9c-54a4d5d08e79","order_by":2,"name":"Shu-ya Qi","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shu-ya","middleName":"","lastName":"Qi","suffix":""},{"id":485823509,"identity":"08811dd1-92f8-4b29-a998-34bccdc4fc26","order_by":3,"name":"Qing-yun Huang","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Qing-yun","middleName":"","lastName":"Huang","suffix":""},{"id":485823510,"identity":"6eb358a5-10cb-42fc-a38b-237627a6b110","order_by":4,"name":"Ming-yue Chen","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ming-yue","middleName":"","lastName":"Chen","suffix":""},{"id":485823511,"identity":"fd7c0b5b-8392-4d96-bfb8-e98b4a3a8621","order_by":5,"name":"Li-hang Wei","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Li-hang","middleName":"","lastName":"Wei","suffix":""},{"id":485823512,"identity":"ee1ffb82-ca81-48a9-accd-c6c873c7315b","order_by":6,"name":"Hao Li","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Hao","middleName":"","lastName":"Li","suffix":""},{"id":485823513,"identity":"07d70cac-7453-4cdc-8eb4-91ee16070383","order_by":7,"name":"Na Huang","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Huang","suffix":""},{"id":485823514,"identity":"11ece38f-bafe-4b6d-83bb-38f4b02be4dd","order_by":8,"name":"Yong-xin Kang","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yong-xin","middleName":"","lastName":"Kang","suffix":""},{"id":485823515,"identity":"605086b4-2f96-4383-923a-34e2592236f3","order_by":9,"name":"Zhong-xin Guo","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhong-xin","middleName":"","lastName":"Guo","suffix":""},{"id":485823516,"identity":"b1a79174-188d-4c51-baad-ef08bb388400","order_by":10,"name":"Jian-gu Gong","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jian-gu","middleName":"","lastName":"Gong","suffix":""},{"id":485823517,"identity":"3e4fe09a-3d59-4d7e-b17e-66da7c7b1bfb","order_by":11,"name":"Xue-chao Jing","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xue-chao","middleName":"","lastName":"Jing","suffix":""},{"id":485823518,"identity":"13ef4ad8-29d7-4b1a-a665-ac27cc37c1f7","order_by":12,"name":"Yuan-yuan Liu","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yuan-yuan","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2025-07-05 16:10:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7054125/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7054125/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41420-026-02974-7","type":"published","date":"2026-02-26T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":87053460,"identity":"5d771ef2-92a3-4523-b2d9-8e1436d0b7f2","added_by":"auto","created_at":"2025-07-18 15:12:58","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":344984,"visible":true,"origin":"","legend":"\u003cp\u003eJMY is expressed at high levels in the developing mouse brain. \u003cstrong\u003eA\u003c/strong\u003e RT‒PCR analysis of \u003cem\u003eJmy\u003c/em\u003e mRNA levels in the indicated mouse tissues. GAPDH was used as an internal control.\u003cstrong\u003e B\u003c/strong\u003e DAB staining showing the expression of the JMY protein in a sagittal section of an E16 mouse embryo. Scale bar, 300 μm. \u003cstrong\u003eC\u003c/strong\u003e RT‒PCR assays showing the spatial distribution of \u003cem\u003eJmy\u003c/em\u003e expression in whole-brain lysates from mice at the indicated stages of development. GAPDH was used as an internal control. \u003cstrong\u003eD\u003c/strong\u003eQuantification of \u003cem\u003eJmy\u003c/em\u003e mRNA levels in brain lysates (\u003cem\u003en \u003c/em\u003e= 6 for each timepoint, * \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, ** \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, mean ± SEM) via quantitative real-time PCR, with normalization to the expression levels in the adult brain. \u003cstrong\u003eE\u003c/strong\u003e Western blot showing the protein expression of JMY in the mouse brain at the indicated developmental stages. The results of the statistical analysis are shown at the bottom. The data were normalized to the expression levels in the adult brain. \u003cem\u003en \u003c/em\u003e= 3, * \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, ** \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01; the data represent the means ± SEMs. \u003cstrong\u003eF\u003c/strong\u003e \u003cem\u003eIn situ\u003c/em\u003e hybridization showing the temporal expression of \u003cem\u003eJmy\u003c/em\u003e mRNA in the mouse brain at different developmental stages. A high-magnification image of the cortex area is shown in (\u003cstrong\u003eG\u003c/strong\u003e). Scale bars, 2 mm (\u003cstrong\u003eF\u003c/strong\u003e) and 50 μm.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7054125/v1/d38907548e6580b19fd3c8e4.png"},{"id":87051588,"identity":"f54b589a-f3ca-4fab-a88b-335d6b31371a","added_by":"auto","created_at":"2025-07-18 15:04:57","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":427656,"visible":true,"origin":"","legend":"\u003cp\u003eExpression pattern of JMY protein in developing neurons\u003cem\u003e in vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e.\u003cstrong\u003e A\u003c/strong\u003e Representative images of cultured cortical neurons costained with JMY and MAP2 antibodies. The subcellular location of endogenous JMY is shown in green. The lower panel shows a magnified growth cone from the upper panel. F-actin and the nucleus were visualized by phalloidin (red) and Hoechst (gray) staining, respectively. Scale bars, 10 µm (upper panel) and 2 µm (lower panel).\u003cstrong\u003e B\u003c/strong\u003e JMY immunocytochemistry in DIV7 cultured cortical neurons. MAP2 and NeuN were used as markers for the cytosol and nucleus, respectively. Scale bar, 15 µm.\u003cstrong\u003e C\u003c/strong\u003e Immunostaining of brain slices from mice at P14 ; NeuN and GFAP were used as markers of the nucleus and astrocytes, respectively. Scale bar, 60 µm.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7054125/v1/fa55dd893de76d959c2743c5.png"},{"id":87051591,"identity":"a4768bc9-534e-4f9a-a035-7c8506e1d6c5","added_by":"auto","created_at":"2025-07-18 15:04:57","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":377624,"visible":true,"origin":"","legend":"\u003cp\u003eDownregulation of \u003cem\u003eJmy\u003c/em\u003e expression impairs the radial migration of cortical neurons \u003cem\u003ein vivo\u003c/em\u003e.\u003cstrong\u003e A\u003c/strong\u003e The efficacy of three types of JMY shRNAs was validated in 293T cells and in vitro-cultured neurons.\u003cstrong\u003e B\u003c/strong\u003e Coronal sections of brains from E18.5–P5 mice electroporated at E14.5 with EGFP plus the shRNA-Scr (left panel), shRNAi-#1 (left-middle panel), and shRNAi-#3 (right-middle panel) constructs, respectively. Cells derived from transfected cortical progenitor cells are shown in green. Sections were counterstained with Hoechst 33324 (blue; right panel), showing stained neighboring sections of the corresponding cortex. The cortical layers are indicated on the right. CP, cortical plate; WM, white matter; VZ, ventricular zone; SVZ, subventricular zone. Scale bar, 60 μm.\u003cstrong\u003e C\u003c/strong\u003e Analysis of the distribution of transfected cortical neurons in electroporated brains across different cortical zones at the indicated developmental stages. The results are presented as the means ± SEM.\u003cstrong\u003e D\u003c/strong\u003e Coronal sections of brains from E18.5 mice electroporated at E14.5 with EGFP plus shRNA-Scr (left panel) or full-length \u003cem\u003eJmy\u003c/em\u003e (middle panel), respectively. Cells derived from transfected cortical progenitor cells are shown in green. Sections were counterstained with Hoechst (blue; right panel), showing stained neighboring sections of the corresponding cortex. The cortical layers are indicated on the right. CP, cortical plate; WM, white matter; VZ, ventricular zone; SVZ, subventricular zone. Scale bar, 60 μm. \u003cstrong\u003eE\u003c/strong\u003eAnalysis of the distribution of transfected cortical neurons in electroporated brains across different cortical zones at the indicated developmental stages. The results are presented as the means ± SEM.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7054125/v1/c5308d05ac572799302792c0.png"},{"id":87051587,"identity":"72d781a6-4219-470d-8a51-29914150fca6","added_by":"auto","created_at":"2025-07-18 15:04:57","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":417355,"visible":true,"origin":"","legend":"\u003cp\u003eJMY regulates progenitor cell proliferation differentiation \u003cem\u003ein utero\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eSchematic diagram of the strategies used for\u003cem\u003e in utero\u003c/em\u003e electroporation and BrdU labeling.\u003cstrong\u003e B\u003c/strong\u003e Representative images showing that BrdU and Ki67 incorporation is increased in mouse brain subjected to JMY knockdown. The mouse brain electroporated at E13.5 were pulse labeled with BrdU for 2 hr before the mice were sacrificed at E15.5.\u003cstrong\u003e C\u003c/strong\u003e Quantitative analysis of BrdU-labeled cells in electroporated mouse brains. The bar graph shows the percentage of BrdU and GFP double-positive cells among total GFP-positive cells in the VZ/SVZ. \u003cstrong\u003eD\u003c/strong\u003e The cell cycle exit index was calculated as the ratio of BrdU\u003csup\u003e+\u003c/sup\u003eKi67\u003csup\u003e-\u003c/sup\u003e GFP\u003csup\u003e+\u003c/sup\u003e cells to the total population of BrdU\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e+\u003c/sup\u003e cells (\u003cem\u003en\u003c/em\u003e = 3, * \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, ** \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01). Scale bar: 20 μm.\u003cstrong\u003e E\u003c/strong\u003e Representative images showing that Nestin-positive cell numbers are increased in brains subjected to JMY knockdown.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e Quantitative analysis of Nestin-positive cells among GFP-positive neurons. The bar graph shows the percentage of Nestin and GFP double-positive cells among total GFP-positive cells in the VZ/SVZ (\u003cem\u003en\u003c/em\u003e = 3, * \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05). Scale bar: 20 μm. All the data are presented as the means ± SEM.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7054125/v1/b38b1e75dd224a3ad5304c25.png"},{"id":87053457,"identity":"a798c751-4189-4159-8469-17e989dc2001","added_by":"auto","created_at":"2025-07-18 15:12:57","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":113751,"visible":true,"origin":"","legend":"\u003cp\u003eSpatial learning and memory are impaired in\u003cem\u003e Nestin-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice.\u003cstrong\u003e A\u003c/strong\u003e Western blot results showing the protein expression levels of JMY in the hippocampal tissues of \u003cem\u003eNestin-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e (cKO), wild-type (WT), \u003cem\u003eJmy\u003c/em\u003e\u003csup\u003e\u003cem\u003eloxp/loxp\u003c/em\u003e\u003c/sup\u003e (Flox), and \u003cem\u003eNestin-Cre\u003c/em\u003e mice. \u003cstrong\u003eB\u003c/strong\u003e The results of the Morris water maze test revealed that the escape latency of \u003cem\u003eNestin-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice (\u003cem\u003en\u003c/em\u003e = 14) was prolonged during the 5-day training period compared with that of their control littermates (\u003cem\u003en\u003c/em\u003e = 13). The swimming speed of \u003cem\u003eNestin-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice did not appear to change during the 5-day training period.\u003cstrong\u003e C\u003c/strong\u003e Representative search paths for mice of each group in the probe trial. The spatial memory of the control littermate and \u003cem\u003eNestin-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice is indicated by the number of platform crossings after training and the time spent in the quadrant with the hidden platform removed. The swimming speed of \u003cem\u003eNestin-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice did not appear to change on the 6th day when the hidden platform was removed.\u003cstrong\u003e D\u003c/strong\u003e Impaired learning and memory in \u003cem\u003eNestin-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice, as measured with the Y maze. The percentage of animals selecting the novel arm as the first choice is shown (left), and the number of arm entries (middle) and dwelling time (right) of \u003cem\u003eNestin-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e (\u003cem\u003en\u003c/em\u003e = 12) mice and their control littermates (\u003cem\u003en\u003c/em\u003e = 12) in the Y maze 1 h after the first encounter with the partially opened maze are shown.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7054125/v1/3e68e8701e9c039de273e556.png"},{"id":87051594,"identity":"034c81e4-fcc3-42b6-a4eb-4023f1be4b0a","added_by":"auto","created_at":"2025-07-18 15:04:57","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":144683,"visible":true,"origin":"","legend":"\u003cp\u003eSpatial learning and memory are impaired in\u003cem\u003e Emx1-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice.\u003cstrong\u003e A\u003c/strong\u003e Western blot analysis of JMY protein expression in \u003cem\u003eEmx1-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mouse brain. WT, wild-type; Flox, \u003cem\u003eJmy\u003c/em\u003e\u003csup\u003e\u003cem\u003eloxp/loxp\u003c/em\u003e\u003c/sup\u003e mice; cKO, conditional knockout; Cor, cortex; Hip, hippocampus; Cb, cerebellum. GAPDH was used as an internal loading control. \u003cstrong\u003eB\u003c/strong\u003e The Morris water maze test revealed that the escape latency of \u003cem\u003eEmx1-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice (\u003cem\u003en\u003c/em\u003e = 18) was prolonged during the 5-day training period compared with that of their control littermates (\u003cem\u003en\u003c/em\u003e = 18). The swimming speed of \u003cem\u003eEmx1-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice did not appear to change during the 5-day training period. \u003cstrong\u003eC\u003c/strong\u003e Representative search paths for mice of each group in the probe trial. The spatial memory of the control littermate and \u003cem\u003eEmx1-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice is indicated by the number of platform crossings after training and the time spent in the quadrant with the hidden platform removed. The swimming speed of \u003cem\u003eEmx1-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice did not appear to change on the 6th day when the hidden platform was removed.\u003cstrong\u003eD\u003c/strong\u003e Impaired learning and memory in \u003cem\u003eEmx1-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice, as measured with the Y maze. The percentage of animals selecting the novel arm as the first choice is shown (Left), and the number of arm entries (middle) and the dwelling time (right) of \u003cem\u003eEmx1-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e (\u003cem\u003en\u003c/em\u003e = 12) mice and their control littermates (\u003cem\u003en\u003c/em\u003e = 12) in the Y maze 1 h after the first encounter with the partially opened maze are shown.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7054125/v1/ec863382b166dff6efef021f.png"},{"id":87053465,"identity":"d1e32c21-f4fe-4fe6-8ac0-82dba0ff5228","added_by":"auto","created_at":"2025-07-18 15:12:58","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":334693,"visible":true,"origin":"","legend":"\u003cp\u003eChange of p53 downstream target genes in \u003cem\u003eNestin-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mouse brain.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u0026nbsp;\u003c/strong\u003eWorkflow diagram. Proteins from brain tissue were subjected to TMT labeling followed by mass spectrometric analysis. \u003cstrong\u003eB\u003c/strong\u003e\u0026nbsp;Volcano plot showing the distribution of proteins identified from \u003cem\u003eNestin-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e and control mice quantified by proteomic analysis. Protein with significant differential expression are highlighted. Black, no significant change; Green, downregulated expression; Red, upregulated expression.\u003cstrong\u003e C\u0026nbsp;\u003c/strong\u003eHeatmap of the differentially expressed proteins between \u003cem\u003eNestin-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice and control mice. The color intensity indicates the protein expression level, as follows: red, highest expression; green, lowest expression. \u003cstrong\u003eD\u003c/strong\u003e Functional enrichment analysis of differentially expressed proteins was performed with Metascape. The −log10 adjusted \u003cem\u003ep\u003c/em\u003e value reflects the statistical significance of enrichment. \u003cstrong\u003eE\u003c/strong\u003e Functional analysis Sankey diagram: This diagram shows the relationships and influences among different functional categories of differentially expressed proteins. Circle size correlates with the number of proteins in each category. \u003cstrong\u003eF\u003c/strong\u003e RT‒PCR analysis of the mRNA levels of target genes downstream of p53 in the indicated mouse tissues. GAPDH was used as an internal control. \u003cstrong\u003eG\u003c/strong\u003e Quantification of the mRNA levels of target genes downstream of p53 in brain lysates (\u003cem\u003en\u003c/em\u003e = 3 for each group, * \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, mean ± SEM) via quantitative real-time PCR, with normalization to control group levels.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7054125/v1/14c50aa6b43d1b8a8b85e53f.png"},{"id":105617781,"identity":"fdaeb606-c182-443c-b61d-31d5f43fc6fa","added_by":"auto","created_at":"2026-03-28 07:07:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2889797,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7054125/v1/aea29d0d-d4b1-499b-ba5d-288ba163fdc5.pdf"}],"financialInterests":"There is no conflict of interest","formattedTitle":"Junction-mediating and regulatory protein (JMY) is a promoting protein for radial migration of cortical neurons","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCerebral cortical development is the basis for brain structure and function, and it relies on tightly regulated processes such as neural stem cell proliferation, differentiation, and migration and neuronal localization\u003csup\u003e1,2\u003c/sup\u003e. Neuronal migration is a fundamental of cerebral cortical development, ensuring that postmitotic neurons move from their proliferative zones to their designated cortical layers, thereby establishing the six-layered neocortical structure that is vital for higher-order cognitive functions\u003csup\u003e3\u003c/sup\u003e. Disruptions in this process can lead to severe developmental abnormalities and cognitive dysfunctions, including intellectual disabilities, epilepsy, severe learning disabilities and autism spectrum disorders, underscoring the importance of understanding the molecular pathways that regulate neuronal migration\u003csup\u003e4,5\u003c/sup\u003e. The migration of neural progenitor cells and their differentiation into specific neuronal subtypes is a critical process for normal brain development. These processes are orchestrated by a wide array of signaling molecules and pathways that regulate cell cycle progression, cytoskeletal reorganization, and cell fate determination\u003csup\u003e6\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAmong these,\u0026nbsp;the Wiskott‒Aldrich Syndrome Protein (WASP) family of proteins is critical for regulating various cellular processes, such as actin polymerization, cell migration, and differentiation\u003csup\u003e7,8\u003c/sup\u003e. WASP family proteins mediate the reorganization of the actin cytoskeleton, which is essential for neuronal migration and synapse formation. These processes are crucial for proper brain function and cognitive ability\u003csup\u003e7,8\u003c/sup\u003e. Recent studies have demonstrated that defects in WASP family proteins lead to cognitive dysfunctions, including impairments in learning and memory\u003csup\u003e7,8\u003c/sup\u003e. Junction-mediating and regulatory protein\u0026nbsp;(JMY) is a member of the WASP family\u003csup\u003e9\u003c/sup\u003e. JMY was first identified as a transcriptional coactivator of p53\u003csup\u003e10\u003c/sup\u003e. Studies have shown that JMY acts as a coactivator of p53, thereby incresing the transcriptional activity of p53 target genes involved in cell cycle regulation and apoptosis\u003csup\u003e9,11\u003c/sup\u003e. P53 activation is crucial for maintaining neurogenesis and can influence the balance between self-renewal and differentiation of neural progenitor cells. P53 activates several downstream target genes that are involved in cell cycle arrest, DNA repair, and apoptosis, such as p21, Bcl2, and Gadd45\u0026alpha;\u003csup\u003e12,13\u003c/sup\u003e. These proteins play essential roles in regulating cell cycle checkpoints and maintaining genomic integrity during neurogenesis.\u003c/p\u003e\n\u003cp\u003eGiven the importance of p53 in regulating neurogenesis , JMY likely plays an important role in cortical neuron development and cognitive functions. It has been reported that JMY plays crucial roles in mammalian oocyte maturation in both mice and pigs\u003csup\u003e14,15\u003c/sup\u003e. Knockdown of JMY in porcine embryos caused developmental abnormalities in porcine and mouse embryos\u003csup\u003e16\u003c/sup\u003e. Thus, these studies suggest that JMY may also play an important role in neuronal development and function. However, the expression and function of JMY in the nervous system have not been systematically investigated.\u003c/p\u003e\n\u003cp\u003eIn this study, we found that \u003cem\u003eJmy\u003c/em\u003e is expressed at high levels in the brain during the early stage of development and is expressed in both immature and mature neurons. Reducing \u003cem\u003eJmy\u003c/em\u003e expression can impair the migration of cortical neurons. Moreover, JMY can cause progenitor cells to shift from proliferative cell division to differentiative cell division. In behavior tests, conditional \u003cem\u003eJmy\u003c/em\u003e knockout mice exhibited impaired learning and memory behavior. We obtained several findings that clarified the function of JMY in brain development for the first time and revealed a new mechanism for the development and regulation of cortical neurons.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eAnimals\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; C57BL/6 mice were obtained from the animal breeding colony of the Animal Centre of Guangxi Medical University, China. Owing to the critical role of \u003cem\u003eJmy\u003c/em\u003e in embryonic development, global knockout of Jmy results in substantial embryonic lethality, thereby limiting the generation of Jmy global knockout mice. In this study, we utilized\u003cem\u003e\u0026nbsp;LoxP-\u003c/em\u003eflanked \u003cem\u003eJmy\u003c/em\u003e mice, which were generated by inserting \u003cem\u003eLoxP\u003c/em\u003e sequences flanking exon 3 of the \u003cem\u003eJmy\u003c/em\u003e gene via homologous recombination. This approach resulted in the creation of \u003cem\u003eJmy\u003csup\u003eloxP/loxP\u003c/sup\u003e\u003c/em\u003e\u003csup\u003e\u0026nbsp;\u003c/sup\u003emice, which were then used to generate \u003cem\u003eJmy\u003c/em\u003e conditional knockout (cKO) mice using Cre/\u003cem\u003eloxP\u003c/em\u003e technology. The construction of \u003cem\u003eJmy\u003csup\u003eloxP/loxP\u003c/sup\u003e\u003c/em\u003e mice was performed by Shanghai Biomodel Organism Science and Technology Development Co., Ltd. (Animal Experimentation License No. SCXK (Shanghai) 2017-0010).\u003c/p\u003e\n\u003cp\u003eFollowing the generation of \u003cem\u003eJmy\u003csup\u003eloxP/loxP\u003c/sup\u003e\u003c/em\u003e mice, the animals were crossed with two distinct Cre recombinase transgenic mouse lines: \u003cem\u003eNestin-Cre\u003c/em\u003e and \u003cem\u003eEmx1-Cre.\u003c/em\u003e \u003cem\u003eNestin-Cre\u003c/em\u003e mice, obtained from Shanghai Biomodel Organism Science and Technology Development Co., Ltd., express Cre recombinase under the control of the \u003cem\u003eNestin\u003c/em\u003e promoter, which is predominantly active in neural progenitor cells throughout the developing central nervous system. By crossing \u003cem\u003eJmy\u003csup\u003eloxP/loxP\u003c/sup\u003e\u003c/em\u003e mice with \u003cem\u003eNestin-Cre\u003c/em\u003e mice, \u003cem\u003eJmy\u003c/em\u003e was specifically deleted in neural progenitor cells, generating \u003cem\u003eNestin-Cre;Jmy\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u0026nbsp;\u003c/em\u003emice. In contrast, \u003cem\u003eEmx1-Cre\u0026nbsp;\u003c/em\u003emice, which were sourced from The Jackson Laboratory (Stock No: 005628), express \u003cem\u003eCre\u003c/em\u003e recombinase under the control of the \u003cem\u003eEmx1\u003c/em\u003e promoter, which is expressed in early forebrain progenitors and has strong activity in the cortex and hippocampus. Crossing \u003cem\u003eJmy\u003csup\u003eloxP/loxP\u003c/sup\u003e\u003c/em\u003e mice with \u003cem\u003eEmx1-Cre\u003c/em\u003e mice resulted in the conditional deletion of \u003cem\u003eJmy\u003c/em\u003e in the cortex and hippocampus, generating \u003cem\u003eEmx1-Cre;Jmy\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/em\u003e mice. The resulting \u003cem\u003eNestin-Cre;Jmy\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/em\u003e and \u003cem\u003eEmx1-Cre;Jmy\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/em\u003e mice were utilized to investigate the role of \u003cem\u003eJmy\u003c/em\u003e in neural development. Specifically, \u003cem\u003eNestin-Cre;Jmy\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/em\u003e mice enabled the assessment of \u003cem\u003eJmy\u003c/em\u003e function in the entire nervous system, whereas \u003cem\u003eEmx1-Cre;Jmy\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/em\u003e mice enabled the investigation of \u003cem\u003eJmy\u003c/em\u003e function specifically within the cortical and hippocampal regions. All the mice were housed in temperature-controlled rooms under a 12 h light/12 h dark cycle and were given food and water \u003cem\u003ead libitum\u003c/em\u003e. All the studies were approved by the Institutional Animal Care and Use Committee of Guangxi Medical University and were performed in compliance with the U.S. National Institutes of Health Guide for the Care and Use of Laboratory Animals.\u003c/p\u003e\n\u003cp\u003eRNA extraction and real-time PCR\u003c/p\u003e\n\u003cp\u003eForebrain tissues from embryonic or postnatal mice (C57BL/6) at different developmental stages (E14, E16, E18, P0, P3, P7, P14, and adult), tissues from different organs (P7), and hippocampal tissues from \u003cem\u003eNestin-Cre;Jmy\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/em\u003e mice and the corresponding controls, were used for RNA extraction. The brain tissues were homogenized with TRIzol Reagent (Invitrogen) at 4\u0026deg;C. RNA was extracted according to the manufacturer\u0026rsquo;s instructions. The final RNA pellet was suspended in diethylpyrocarbonate (DEPC)-treated water, and 2\u0026thinsp;\u0026mu;g of total mRNA was then subjected to reverse transcription using oligo (dT) primers and Moloney murine leukemia virus (M-MLV) transcriptase (Invitrogen). Real-time PCR was performed with a LightCycler 480 Real-Time PCR System (Roche) according to the manufacturer\u0026rsquo;s instructions. Starting RNA levels were quantified by using \u003cem\u003eGapdh\u003c/em\u003e as the external standard. The primer sets were chosen from PrimerBank, and the gene sequences are available in the GenBank database. The sequences of the primers used to evaluate the mRNA expression of mouse genes were as follows: \u003cem\u003eJmy:\u003c/em\u003e forward, 5\u0026prime;- CAGAAGGGCTATGAAGAGG -3\u0026prime;; reverse, 5\u0026prime;- CGGAATGGCTGAAGTAAAT -3\u0026prime;; \u003cem\u003eGapdh\u003c/em\u003e: forward, 5\u0026prime;- CCCCAATGTATCCGTTGTG -3\u0026prime;; reverse, 5\u0026prime;- CTCAGTGTAGCCCAGGATGC -3\u0026prime;.\u003cem\u003e\u0026nbsp;\u003c/em\u003eCdkn1a (p21): forward, 5\u0026rsquo;-AATCCTGGTGATGTCCGACC-3\u0026rsquo;; reverse, 5\u0026rsquo;-GACCAATCTGCGCTTGGAGT-3\u0026rsquo;; \u003cem\u003eGadd45\u0026alpha;\u003c/em\u003e: forward, 5\u0026rsquo;-CTGGCTGCGGATGAAGATGACGAC-3\u0026rsquo;, reverse, 5\u0026prime;-TTATCCATGTAGCGACTTTCCCGG-3\u0026prime;; \u003cem\u003ePuma:\u003c/em\u003e forward, 5\u0026rsquo;-TCCTCAGCCCTCCCTGTCAC-3\u0026rsquo;, reverse 5\u0026rsquo;-CCATTTCTGGGGCTCCAGGA-3\u0026prime;; \u003cem\u003eBax:\u003c/em\u003e forward, 5\u0026rsquo;-TGAAGACAGGGGCCTTTTTC-3\u0026rsquo;, reverse, 5\u0026rsquo;-AATTCGCCGGAGACACTCG-3\u0026rsquo;; and \u003cem\u003eBcl-2:\u003c/em\u003e forward, 5\u0026rsquo;-GTCGCTACCGTCGTGACTTC-3\u0026rsquo;, reverse, 5\u0026rsquo;-CAGACATGCACCTACCCAGC-3\u0026rsquo;. The primers used were synthesized by Sunny Biotech.\u003c/p\u003e\n\u003cp\u003eWestern blot analysis\u003c/p\u003e\n\u003cp\u003eTo analyze expression of JMY in the developing mouse cortex, cortices were dissected and homogenized as previously described\u003csup\u003e17\u003c/sup\u003e. All protein samples were separated via 10% SDS‒polyacrylamide gel electrophoresis (Bio-Rad) and blotted onto PVDF membranes (Millipore). The membranes were blocked with 5% nonfat milk in 0.05% Tween 20 at room temperature for 1\u0026thinsp;h and probed with goat anti-JMY (Santa Cruz Biotechnology) and HRP-coupled mouse anti-GAPDH (Aksomics) antibodies. The secondary antibody used for JMY was anti-goat IgG coupled to HRP (Aksomics). The bands were visualized by enhanced chemiluminescence (TIANGEN). Band intensities were measured with ImageJ software.\u003c/p\u003e\n\u003cp\u003eImmunohistochemistry\u003c/p\u003e\n\u003cp\u003eForebrain sections from mice at different developmental stages were postfixed in 4% paraformaldehyde (PFA) in blocking buffer (5% (wt/vol) bovine serum albumin (BSA), 10% (vol/vol) normal goat serum (NGS), 0.25% (vol/vol) Triton X-100) for 1 h to block nonspecific background staining. The sections were further incubated with primary antibodies against JMY (1:500, Santa Cruz), MAP2 (1:2,000, Sigma), GFP (1:2,000, Invitrogen), GFAP (1:1,000, Millipore), NeuN (1:1,000, Millipore), and Nestin (1:500, Sigma) overnight at 4\u0026deg;C. After being washed, the sections were incubated with their respective secondary antibodies at room temperature for 2 h and then counterstained with Hoechst 33342 for 10 min at room temperature before being covered with coverslips.\u003c/p\u003e\n\u003cp\u003eCultured neurons were fixed with 4% PFA and then immunostained with primary antibodies against JMY (1:500, Santa Cruz), MAP2 (1:2,000, Sigma), GFP (1:2,000, Invitrogen), GFAP (1:1,000, Millipore), and NeuN (1:1,000, Millipore) overnight at 4\u0026thinsp;\u0026deg;C. After washing, the sections were incubated with their respective secondary antibodies at room temperature for 2 h and then counterstained with Hoechst 33342 and phalloidin for 10 min at room temperature.\u003c/p\u003e\n\u003cp\u003eFor DAB staining, brain sections (30\u0026thinsp;\u0026mu;m) were incubated in 0.01\u0026thinsp;M phosphate-buffered saline (PBS) supplemented with 3% hydrogen peroxide for 10\u0026thinsp;min to block endogenous peroxidase activity and then in blocking buffer containing 5% BSA/10% normal goat serum/0.25% Triton X-100 for 60\u0026thinsp;min at room temperature to prevent nonspecific staining. IHC was subsequently conducted on these free-floating sections, and staining was visualized with a standard ABC Elite kit (Vector Labs).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIn situ\u003c/em\u003e hybridization\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIn situ\u003c/em\u003e hybridization of the brain sections was performed with digoxigenin-labeled antisense riboprobes. The full-length cDNA of \u003cem\u003eJmy\u003c/em\u003e was amplified with specific PCR primers and subsequently cloned and inserted into the pGEM-T easy vector (Promega) to generate an antisense probe for \u003cem\u003eJmy\u003c/em\u003e. The digoxigenin-labeled antisense riboprobes were synthesized by \u003cem\u003ein vitro\u0026nbsp;\u003c/em\u003etranscription via the SP6 Riboprobe System (Promega).\u003c/p\u003e\n\u003cp\u003eThe mice were perfused with 4% paraformaldehyde (PFA) and fixed in 4% PFA at 4\u0026deg;C. Fixed brains were cryoprotected overnight in 15%\u0026ndash;30% sucrose/PBS at 4\u0026deg;C, mounted in optimal cutting temperature (OCT) compound and sectioned coronally (20 \u0026mu;m) with a cryostat (Leica). The brain sections were hybridized for 18\u0026thinsp;h at 60\u0026thinsp;\u0026deg;C. The hybridization signal was detected with anti-DIG\u0026ndash;alkaline phosphatase Fab fragments (Roche) and nitro blue tetrazolium chloride (NBT) plus 5-bromo-4-chlor-indolyl-phosphate (BCIP) as substrates for the color reaction.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIn utero\u003c/em\u003e electroporation\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIn utero\u003c/em\u003e electroporation was performed as described previously\u003csup\u003e18\u003c/sup\u003e, with minor modifications. Briefly, pregnant mice at E14.5 were anesthetized with pentobarbital sodium. Midline laprotomy was performed after the abdomen was cleaned, and the uterus was removed. DNA plasmids (1 \u0026mu;L) at a high concentration were injected into the lateral ventricle with 0.05% Fast Green (Sigma) through a polished micropipette. Square electric pulses were delivered to the embryos through the uterus at a rate of one pulse per second by holding the embryos with forceps-type electrodes while the uterus was kept wet by dropping saline (prewarmed at 37\u0026deg;C) between the electrodes. Five electrical pulses (50 V, 50 ms, 1 s interval) were applied across the uterine wall using an ECM-830 BTX square wave electroporator. The uterine horns were then returned to the abdominal cavity, and the abdomen wall and skin were sutured using a surgical needle and thread.\u003c/p\u003e\n\u003cp\u003eBrdU labeling\u003c/p\u003e\n\u003cp\u003eFor bromodeoxyuridine (BrdU) incorporation, E15.5 mice were intraperitoneally injected with 100 mg/kg BrdU (Sigma) and sacrificed at birth. ThCryostat sections of the brains were incubated in 1 N HCl for 30 min at 37\u0026deg;C to denature the DNA and then neutralized in 0.1 M borate buffer (pH 8.0). The sections were then incubated with rat anti-BrdU (1:100, Sigma), Ki67 (1:400, Invitrogen) and rabbit anti-GFP (1:2,000, Invitrogen) antibodies after being washed with 0.01 M PBS (pH 7.4). A slice from the same plane was selected as the observation object for each mouse, and the numbers of BrdU-positive cells and BrdU and GFP double-positive cells were counted.\u003c/p\u003e\n\u003cp\u003eBehavior tests\u003c/p\u003e\n\u003cp\u003eMorris water maze test\u003c/p\u003e\n\u003cp\u003eThe standard procedure of the Morris water maze test was used\u003csup\u003e19\u003c/sup\u003e. Adult male mice (10\u0026ndash;12 weeks old) of each genotype were trained to find the visible platform with four trials a day for the first day and were tested to find the hidden platform for 5 to 6 consecutive days. In each trial, the mice were allowed to swim until they found the hidden platform when they started from different, random locations around the perimeter of the tank. The mice were then allowed to sit on the platform for 10 s before being picked up. On the probe trial day, the platform was removed from the tank. The escape latency and the time spent in each quadrant were recorded by a video camera. The experimenter was blinded to the genotypes and ages of the mice.\u003c/p\u003e\n\u003cp\u003eY maze\u003c/p\u003e\n\u003cp\u003eThe Y-maze design was based on published protocols, with modifications to adapt the system to mice\u003csup\u003e20,21\u003c/sup\u003e. Briefly, the mice were placed into one of the arms of the maze (start arm) and allowed to explore the maze with one of the arms closed for 15 min (training trial). After a 1-h intertrial interval, the mice were returned to the Y maze by placing them in the start arm. The mice were subsequently allowed to explore all three arms of the maze freely for 5 min (test trial). The number of entries into and the time spent in each arm and the first choice of entry were determined from video recordings by an observer blinded to the genotype of the mice.\u003c/p\u003e\n\u003cp\u003eProteomic analysis\u003c/p\u003e\n\u003cp\u003eProteins from hippocampi of the wild-type and \u003cem\u003eNestin-Cre;Jmy\u003csup\u003e-/-\u003c/sup\u003e\u003c/em\u003e mice (n=3 per group) were extracted with SDT buffer, quantified, digested by trypsin, and labeled using TMT reagents. Peptides were fractionated by SCX chromatography, desalted, and analyzed by LC-MS/MS (Q Exactive coupled with Easy nLC). Raw MS data were identified and quantified with Mascot in Proteome Discoverer software against the UniProt mouse database, using the false discovery rate (FDR) \u0026lt;1%. Differentially expressed proteins were defined by fold-change \u0026ge;1.10 and \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05. Proteomic analysis was performed by Shanghai Applied Protein Technology Co., Ltd. (Shanghai, China).To determine the functional classifications and biological properties of the differentially abundant proteins, the identified protein sequences were mapped using Gene Ontology (GO) terms. The functional annotation tools DAVID and Metascape were used for GO functional annotation and functional enrichment of proteins. Finally, the results of enrichment analysis were visualized and displayed in graphical form (such as in bar charts, Sankey charts, etc.) to further understand the biological significance of each protein.\u003c/p\u003e\n\u003cp\u003eQuantification and Statistical Analysis\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor all statistical analyses, experimenters were blinded for genotypes of mice and the treatments of the animals or cells. Data are presented as mean \u0026plusmn; SEM. Appropriate statistical methods were selected based on the data type. The paired or unpaired Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e test, Fisher\u0026rsquo;s exact test, one-way ANOVA with Dunnett\u0026rsquo;s post hoc tests or Bonferroni\u0026rsquo;s tests were used for data analyses by SPSS 26.0 software. Statistical significance was defined as \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e1. \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eJMY is highly expressed in\u0026nbsp;the developing mouse brain\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJMY is widely expressed in mammalian tissues and cell lines\u003csup\u003e22\u003c/sup\u003e, and the function of JMY in peripheral organs and tissues has been preliminarily studied. However, the expression of JMY in the nervous system and during nervous system development has not been studied. By using RT‒PCR, we found that \u003cem\u003eJmy\u003c/em\u003e mRNA was expressed in every tissue examined from P7 mice, and its expression was greater in the brain, heart, spleen, lung and kidney and lower in the spinal cord, muscle, liver and skin,\u0026nbsp;which is\u0026nbsp;consistent with previous findings\u003csup\u003e22\u003c/sup\u003e (Fig.1A). Moreover, we performed immunohistochemistry on whole mouse embryos at E16 with an anti-JMY antibody, which is commercially available. We found that\u0026nbsp;JMY is abundant in the cerebral cortex, basal ganglia, midbrain and cerebellum and that its expression level is much higher in these tissues than in other tissues\u0026nbsp;(Fig.1B). Considering the high expression of JMY in the nervous system of developing mice, we speculated that JMY may exhibit a specific temporal expression pattern in the developing mouse brain. Thus, we investigated the expression pattern of \u003cem\u003eJmy\u003c/em\u003e in the mouse brain at different developmental stages and found that \u003cem\u003eJmy\u003c/em\u003e mRNA was expressed in the mouse cerebral cortex throughout development, from as early as embryonic day 14 (E14) to adulthood, with peak expression observed around E18.\u003cem\u003eAfter birth\u003c/em\u003e, the \u003cem\u003eexpression\u003c/em\u003e of JMY \u003cem\u003egradually decreased\u003c/em\u003e, especially after P14, and was weak in adulthood (Fig.1C). The results of real-time PCR also confirmed this expression\u0026nbsp;pattern (Fig.1D).To confirm our mRNA expression data,\u0026nbsp;we detected the expression of\u0026nbsp;the\u0026nbsp;JMY protein in the mouse brain at different developmental stages\u0026nbsp;by immunoblotting\u0026nbsp;with\u0026nbsp;a\u0026nbsp;commercial\u0026nbsp;JMY antibody. The results revealed that the expression level of JMY was the highest in the mouse brain from E16–E18, with a peak level approximately 20–25 times greater than the level in the adult brain (Fig.1E). As the age of the mice increased, the protein expression level gradually decreased to its lowest level in adulthood, which is consistent with previous RT‒PCR results. The above results revealed transient high expression\u0026nbsp;of JMY in the brain during the early stage of development,\u0026nbsp;suggesting that JMY may play a specific role in brain development.\u003c/p\u003e\n\u003cp\u003eTo further investigate the spatial expression pattern of \u003cem\u003eJmy\u0026nbsp;\u003c/em\u003ein the brain, we designed and cloned an mRNA probe for \u003cem\u003eJmy\u003c/em\u003e \u003cem\u003ein situ\u003c/em\u003e hybridization via a coating method with mouse brain sections at different developmental stages. We observed that JMY is expressed mainly in neurogenic regions, such as the ventricular zone (VZ) and subventricular zone (SVZ), at E16 (Fig.1F),\u0026nbsp;suggesting the possible role of JMY in\u0026nbsp;the\u0026nbsp;proliferation and differentiation of neurons. In addition, JMY began to be expressed in mature regions of the cortex at E18, such as the cortical plate (CP),\u0026nbsp;which was\u0026nbsp;more obvious during the early postnatal period (P3–P7), suggesting that JMY is also expressed at high levels in differentiated neurons.\u0026nbsp;The\u0026nbsp;low layer (Ⅴ,\u0026nbsp;Ⅵ) cells in the brain had migrated to their final positions by around P0,\u0026nbsp;and the cells in layers\u0026nbsp;II to IV still migrating. \u003cem\u003eJmy\u003c/em\u003e was expressed at high levels in the cortical plate, was evenly distributed in each layer, with its expression gradually decreasing after P7, when the neurons in the six layers of the brain had migrated to their final positions (Fig.1G). These results suggest that JMY may play a specific role in the\u0026nbsp;division and differentiation of neural precursor\u0026nbsp;cells, as well as in the early development of differentiated neurons.\u003c/p\u003e\n\u003cp\u003eMoreover, we investigated the expression and subcellular localization of \u003cem\u003eJmy\u003c/em\u003e in neurons. We cultured cortical neurons at different time points\u003cem\u003e\u0026nbsp;in vitro\u0026nbsp;\u003c/em\u003eand then used JMY antibodies for immunocytochemical staining. To investigate the distribution of JMY in immature neurons, we labeled microtubules with a microtubule-associated protein 2 (MAP2) antibody and labeled microfilaments with phalloidin in the neurons cultured for 2 days \u003cem\u003ein vitro\u0026nbsp;\u003c/em\u003e(DIV2). The multilabeling results revealed that JMY colocalized with MAP-2 in the soma and dendrites, as well as with F-actin in the growth cone (Fig.2A).\u0026nbsp;These findings indicate that JMY is abundantly expressed in the soma,\u0026nbsp;dendrites and growth cones of cultured neurons. We further investigated the distribution of JMY in mature neurons via the use of MAP2 as a cytosolic marker and NeuN as a marker of neuronal \u003cem\u003enuclei\u003c/em\u003e in neurons cultured for 7 days \u003cem\u003ein vitro\u003c/em\u003e (DIV7). We found that JMY localized to both the cytosol and nucleus, similar to previous reports\u003csup\u003e22\u003c/sup\u003e (Fig.2B). In addition, we investigated the expression of JMY in the hippocampus at P14 via the use of NeuN and \u003cem\u003eGlial fibrillary acidic protein\u003c/em\u003e (GFAP) as markers for neurons and astrocytes, respectively, and the results revealed that JMY was expressed in neurons but not in astrocytes (Fig.2C). These observations indicate that JMY is widely expressed in various tissues, especially during the early development of the cerebral cortex, and is expressed in both immature and mature neurons, which indicates that it may be related to the proliferation, differentiation and migration of neurons.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.\u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eJMY promotes the radial migration of cortical neurons during early embryonic development\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe\u0026nbsp;previously reported that JMY is expressed at high levels during the embryonic stage, so we speculated that JMY may play a crucial role in embryonic development\u0026nbsp;and brain development after birth.\u0026nbsp;To test this hypothesis, we designed an\u0026nbsp;RNAi\u0026nbsp;that targeted\u0026nbsp;mouse \u003cem\u003eJmy\u003c/em\u003e and suppressed JMY expression in the mouse brain during the embryonic period\u0026nbsp;via\u0026nbsp;\u003cem\u003ein utero\u003c/em\u003e electroporation\u003csup\u003e23\u003c/sup\u003e (Fig.3A). The RNAi and plasmids expressing GFP were coinjected into the lateral ventricles of embryonic mice. Under an\u0026nbsp;appropriate electric field, the plasmid\u0026nbsp;DNA\u0026nbsp;was transfected into the cells close to the ventricle of the cerebral cortex in fetal mice\u003csup\u003e18\u003c/sup\u003e. To examine the impact of altered JMY expression in neurons, we performed \u003cem\u003ein utero\u003c/em\u003e electroporation at E14.5 in mice, followed by immunohistochemistry and morphological assessments at E18.5, P0, and P5. In the experimental group, where JMY was knocked down using shRNA-#1, significant retention of GFP-positive cells was observed in the VZ/SVZ. Conversely, only a small number of neurons migrated to the intermediate zone (IZ) and cortical plate (CP) (Fig.3B-C). However, in the control mice (shRNA-Scr), there were relatively few GFP-positive cells in the SVZ, and most of them had migrated to the CP and were well distributed there. Knocking down JMY with shRNA-#3 also caused a significant reduction in migration compared with that in the control group, although to a lesser extent than observed in the shRNA-#1 group (Fig.3B-C).\u0026nbsp;This phenomenon persisted until after birth, and the number of GFP-positive cells that reached the upper CP was comparable between the shRNA construct and scrambled control groups at P5 (Fig.3B-C). These findings indicate that reduced JMY expression in the embryonic brain could cause a delay in\u0026nbsp;the\u0026nbsp;radial migration of cortical neurons during early embryonic development, but this phenotype normalized during postnatal development. To further confirm the role of JMY in neuronal migration in the developing cortex, we also performed an overexpression experiment\u0026nbsp;in which\u0026nbsp;full-length \u003cem\u003eJmy\u003c/em\u003e and GFP plasmids\u0026nbsp;were cotransfected\u0026nbsp;into the developing mouse cortex, and\u0026nbsp;the results revealed\u0026nbsp;that more neurons migrated to the CP and fewer neurons remained in\u0026nbsp;the\u0026nbsp;VZ/SVZ\u0026nbsp;than that in\u0026nbsp;the control group that\u0026nbsp;was transfected with the\u0026nbsp;shRNA-scr plasmid\u0026nbsp;(Fig.3\u0026nbsp;D-E).\u0026nbsp;These\u0026nbsp;results\u0026nbsp;indicate\u0026nbsp;that JMY can promote the migration of cerebral cortical neurons.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.\u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eJMY promotes neural progenitor cell cycle exit and differentiation in the developing cerebral cortex\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrevious studies revealed that early JMY is distributed mainly in the VZ/SVZ of the embryonic brain and that JMY is a cofactor of p53 that is enriched in the nucleus in neurons, which suggests that \u003cem\u003eJMY\u003c/em\u003e may play an important role in neuronal division and proliferation\u0026nbsp;and that this effect may be one of the factors affecting neuron migration. To verify this, we used BrdU and Ki67 to label the cells in electroporated mouse brains to observe cell proliferation in the VZ/SVZ. BrdU can specifically label proliferating cells via immunohistochemistry. Thus, it is possible to investigate cell division and proliferation by analyzing the localization, distribution, number, and proliferation of BrdU-positive cells\u003csup\u003e24,25\u003c/sup\u003e Mature neurons are not labeled with BrdU because they do not proliferate and divide.\u003c/p\u003e\n\u003cp\u003eAfter \u003cem\u003ein utero\u003c/em\u003e electroporation, the pregnant mice were injected intraperitoneally with BrdU solution, and the embryonic brains were harvested for immunohistochemical analysis\u0026nbsp;after labeling for 2 hours (Fig.4A). Sections of the electroporated brains were costained for BrdU and the proliferation marker Ki67, which labels cells in all phases of the cell cycle\u0026nbsp;(G1, S, G2, and\u0026nbsp;mitos\u003cem\u003eis\u003c/em\u003e)\u003csup\u003e26\u003c/sup\u003e.\u0026nbsp;The cell cycle exit index was calculated using the ratio of BrdU\u003csup\u003e+\u003c/sup\u003eKi67\u003csup\u003e-\u003c/sup\u003eGFP\u003csup\u003e+\u003c/sup\u003e cells to the total population of BrdU\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e+\u003c/sup\u003e cells to analyze cell cycle kinetics in the VZ of the cerebral cortex (Figure 4B).\u003c/p\u003e\n\u003cp\u003eThe results revealed that when the expression of \u003cem\u003eJmy\u003c/em\u003e was knocked down in the cerebral cortex with RNAi, the number of BrdU-positive cells in the VZ was significantly greater than that in the control group, and the effect of RNAi-# 3 was more obvious (Fig.4C); in addition, the cell cycle exit index was lower in JMY-knockdown mice than in control mice (Fig.4D). These findings indicate that the knockdown of JMY promoted proliferation and disrupted cell cycle exit, suggesting that JMY can cause progenitor cells to shift from proliferative cell division to differentiation.\u003c/p\u003e\n\u003cp\u003eTo further confirm the ability of JMY to control cell proliferation and differentiation, we performed immunohistochemistry with a nestin antibody in developing mouse brain after cotransfection with the GFP plus shRNA-scr plasmid or the shRNA-#1 plasmid (Fig.4E). Nestin is a neural stem/progenitor cell marker that is expressed in embryonic and adult central nervous system (CNS) cells both \u003cem\u003ein vitro\u0026nbsp;\u003c/em\u003eand \u003cem\u003ein vivo\u003c/em\u003e\u003csup\u003e27,28\u003c/sup\u003e. Nestin expression is downregulated when CNS stem/progenitor cells differentiate into neurons or glial cells\u003csup\u003e29,30\u003c/sup\u003e. Proliferative division dominates during the early stages of development to support expansion of the stem cell population without losing developmental potential, whereas later in development, differentiative divisions generate differentiated cells at the expense of the progenitor pool. Therefore, it is possible to investigate the rate of proliferation and the fraction of\u0026nbsp;neural progenitor cells\u0026nbsp;that exit the cell cycle by observing the size of the remaining progenitor pool.\u003c/p\u003e\n\u003cp\u003eThe results revealed that the percentage of Nestin and GFP double-positive cells among total GFP-positive cells\u0026nbsp;was greater in the VZ/SVZ in the brains of mice subjected to JMY knockdown via RNAi than in those of the control mice treated with shRAN-scr (Fig.4F). These results suggest that JMY promotes differentiative divisions at the expense of proliferative divisions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4.\u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eSpatial learning and memory are impaired in JMY-deficient mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJMY is essential for embryonic development, and whole-body genetic deletion of JMY is difficult to achieve; however, the learning and memory abilities of mice subjected to conditional knockout of JMY via Nestin-Cre were evaluated in both the Morris water maze and Y maze tests\u0026nbsp;(Fig.5A-B). First, the Morris water maze results revealed that, compared with control littermate mice, \u003cem\u003eNestin-Cre;Jmy\u003csup\u003e-/-\u003c/sup\u003e\u0026nbsp;\u003c/em\u003emice exhibited an increased escape latency during the training process (Fig.5 C). To further assess the retention of spatial memory in \u003cem\u003eNestin-Cre;Jmy\u003csup\u003e-/-\u003c/sup\u003e\u0026nbsp;\u003c/em\u003emice, we evaluated their performance in the probe trials conducted thereafter (Fig.5D). On the 6th day of training in the MWM test, the \u003cem\u003eNestin-Cre;Jmy\u003csup\u003e-/-\u003c/sup\u003e\u003c/em\u003e mice presented significant decreases in the number of platform crossings and the time spent in the target quadrants in the probe trial phase. Taken together, the above results suggest that \u003cem\u003eJmy\u003c/em\u003e knockout can affect spatial memory retention in \u003cem\u003eNestin-Cre;Jmy\u003csup\u003e-/-\u003c/sup\u003e\u003c/em\u003e mice. Regarding novel arm exploration in the Y maze test, a deficit in spatial memory of \u003cem\u003eNestin-Cre;Jmy\u003csup\u003e-/-\u003c/sup\u003e\u003c/em\u003e mice was evident when the arm chosen for the first entry was recorded (Fig.5 E). Moreover, WT mice more frequently entered the novel arm of the maze, which was previously unvisited. In contrast, \u003cem\u003eNestin-Cre;Jmy\u003csup\u003e-/-\u003c/sup\u003e\u003c/em\u003e mice showed no preference toward the novel arm and entered randomly into the different arms. Specifically, these cKO mice presented lower percentages of time spent in the novel arm, fewer entries into the novel arm, and a decreased duration of stay in the novel arm (Fig.5 E). Spatial memory and recognition memory are influenced by both hippocampal and cortical lesions\u003csup\u003e31,32\u003c/sup\u003e. We proposed that the normal structure and function of the cortex and hippocampus are impaired in JMY-deficient mice, impairing spatial memory and recognition.\u003c/p\u003e\n\u003cp\u003eTo further investigate the effects of JMY on learning and memory functions, we employed \u003cem\u003eEmx-Cre\u003c/em\u003e to conditionally knock out \u003cem\u003eJmy\u003c/em\u003e in the cortical and hippocampal regions of mice and performed a series of behavioral experiments (Fig.6 A-B). The outcomes were similar to those obtained in experiments in which \u003cem\u003eNestin-Cre\u0026nbsp;\u003c/em\u003ewas used. Specifically, \u003cem\u003eEmx-Cre\u003c/em\u003e-driven conditional knockout mice exhibited impairments in learning and memory, as assessed by behavioral tests. In the Morris water maze test, these mice exhibited increased escape latencies during the training phase compared with their control littermates, indicating difficulty in learning (Fig.6 C). Additionally, in the probe trials conducted thereafter, the \u003cem\u003eEmx1-Cre;Jmy\u003csup\u003e-/-\u003c/sup\u003e\u003c/em\u003emice presented a significant reduction in the number of platform crossings and decreased time spent in the target quadrants, suggesting impaired spatial memory retention (Fig.6 D). The Y-maze test further corroborated these findings, as the knockout mice displayed a lack of preference for the novel arm and randomly entered into various arms, unlike the wild-type mice, which predominantly explored the novel, previously unvisited arm (Fig.6 E). These results underscore the critical role of JMY in the structural and functional integrity of the cortex and hippocampus, which are essential for maintaining proper spatial memory and recognition.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e5\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e \u003cstrong\u003eJMY deficiency disrupts cell cycle regulation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo explore the molecular mechanisms underlying the observed defects and in view of the potential function of JMY in learning and memory, we performed quantitative proteomics analysis of control and \u003cem\u003eNestin-Cre;Jmy\u003csup\u003e-/-\u003c/sup\u003e\u003c/em\u003e mice. We identified 142 differentially expressed proteins (87 upregulated, 56 downregulated; Fig.7A-B). Notably, TP53RK was the most upregulated protein in the cKO mice (Fig.7B). The differentially expressed proteins between the groups were evaluated by hierarchical clustering analysis (Fig.7C). These differentially expressed proteins were significantly enriched in processes such as oxidative phosphorylation, Nucleotide excision repair, and cell cycle. Among these pathways, the cell cycle pathway involved the largest protein subset, notably including TP53RK (Fig.7D). Sankey diagram-based clustering and enrichment analysis of the cell cycle–related subset revealed the involvement of TP53RK in biological processes related to RNA metabolism and tRNA processing(Fig.7E). As TP53RK is known to regulate p53 transcriptional activity\u003csup\u003e33\u003c/sup\u003e, we investigated mRNA levels changes in key targets downstream of p53, including \u003cem\u003ep21\u003c/em\u003e, \u003cem\u003ePuma\u003c/em\u003e, \u003cem\u003eBcl2\u003c/em\u003e, \u003cem\u003eBax\u003c/em\u003e, and \u003cem\u003eG\u003c/em\u003e\u003cem\u003eadd45α\u003c/em\u003e in the hippocampi of \u003cem\u003eNestin-Cre;Jmy\u003csup\u003e−/−\u003c/sup\u003e\u003c/em\u003e mice. Subsequent validation experiments revealed elevated expression of \u003cem\u003eGadd45α\u003c/em\u003e (Fig.7F-G), a key target downstream of p53 that is involved in DNA repair and cell cycle checkpoint control\u003csup\u003e34\u003c/sup\u003e. These results indicate that JMY deficiency disrupts hippocampal cell cycle dynamics via increased TP53RK-mediated p53 signaling and increased \u003cem\u003eGadd45\u003c/em\u003e\u003cem\u003eα\u003c/em\u003e expression, potentially contributing to abnormal neuronal processes affecting learning and memory. \u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eDuring cerebral cortex formation, neurons develop from progenitor cells, which undergo proliferation, migration and morphogenesis in a nonoverlapping chronological order\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. The diverse population of projection neurons in the cortex are generated from the neural progenitors present in the VZ and the SVZ\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. There are a considerable number of neural progenitor cells and neural precursor cells with multidirectional differentiation abilities in the VZ/SVZ during the early development of the cerebral cortex\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. In this study, we found that JMY is abundantly expressed in the brain, begins to be expressed in the cortex in the early embryo, is distributed mainly in the VZ/SVZ, and shows transient high expression during the later stages of embryo development (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The specific spatiotemporal expression pattern of JMY suggests that it is important for the regulation of neuronal development. Moreover, JMY, as a co-factor of p53, is abundantly expressed in the nucleus of neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Previous studies have revealed that p53-deficient mouse embryos exhibit severe malformations during cortical development, such as cortical stratification disorders, local hyperplasia, and exencephaly\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. p53 can inhibit the proliferation and renewal ability of neural stem cells by regulating the cell cycle\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e, and it regulates the neuronal differentiation kinetics and maturity of neurons\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eThese findings suggest that JMY plays an important role in the proliferation and differentiation of neurons. To verify this, we used a BrdU-Ki67 cell cycle profiling assay and showed that knockdown of JMY promoted proliferation and suppressed terminal mitosis and differentiation of neural progenitor cells, suggesting that JMY can cause progenitor cells to shift from proliferative cell division to differentiative cell division. This finding was further supported by an increase in the abundance of proliferating neural progenitor cells (nestin-positive cells) with the knockdown of JMY. The size of the neural progenitor cell pool is regulated by proliferative divisions that expand the pool and differentiative divisions that reduce the pool\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e,\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. These findings indicate that the expense of the neural progenitor cells in the pool is reduced.\u003c/p\u003e\u003cp\u003eIn the developing mammalian brain, neural progenitor cells in the VZ/SVZ have the ability to actively proliferate and differentiate, and their cell cycle status affects subsequent neuron migration and localization to different layers of the cerebral cortex\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. If G2/M phase arrest fails to effectively promote cell cycle termination, progenitor cells may remain in a proliferative state, making it difficult to transition into migrating neurons, thereby affecting normal neuronal migration and the establishment of cortical laminar structures\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Moreover, as an actin nucleation factor\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e, JMY has the potential to regulate cell dynamics and affect cell morphogenesis. In the present study, we used RNAi to knock down the expression of JMY in the embryonic stage and found that the migration of neurons in the lower layer was significantly impaired, whereas the overexpression of JMY promoted the migration of cerebral cortical neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). These findings suggest that JMY plays an important role in the migration of neurons in the developing brain by promoting differentiative cell divisions. Therefore, we speculate that JMY regulates neuronal migration by affecting the ability of p53 to regulate proliferation and differentiation, inhibiting the proliferative division of neural progenitor cells, promoting exit from the cell cycle, and activating the migration process.\u003c/p\u003e\u003cp\u003eNotably, our proteomic analysis revealed upregulation of TP53RK (also known as PRPK), a kinase known to phosphorylate p53 at Ser15, thereby modulating its transcriptional activity\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. This modification enhances the ability of p53 to regulate its downstream targets, including genes involved in cell cycle arrest and apoptosis\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e,\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e,\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. Among these targets, \u003cem\u003eGadd45α\u003c/em\u003e was found to be significantly upregulated in the hippocampi of \u003cem\u003eNestin-Cre;Jmy\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice. \u003cem\u003eGadd45α\u003c/em\u003e is a direct downstream target of p53 and plays a crucial role in DNA repair and cell cycle checkpoint control\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eGadd45α\u003c/em\u003e interacts with various cell cycle regulators, including cyclin-dependent kinases, to enforce G2/M checkpoint control\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e,\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. In the nervous system, \u003cem\u003eGadd45α\u003c/em\u003e has been implicated in neurodevelopmental processes and memory consolidation\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. However, this Gadd45α-mediated arrest may depend on an intact p53 pathway and the cooperative regulation of p21. In the absence of effective upregulation of p21 expression\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e,\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e, even increased Gadd45α levels may not fully execute its cell cycle inhibitory function. In this study, the p21 mRNA levels did not show significant changes, suggesting that cells failed to effectively initiate the G1 phase regulatory mechanism\u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e. Although Gadd45α upregulation can mediate G2/M phase arrest, some cells may still continue into the S phase (as evidenced by increased BrdU\u0026thinsp;+\u0026thinsp;proportion) and may undergo DNA replication without completing normal cell division, leading to the abnormal accumulation of Nestin-positive progenitor cells in the proliferative zone\u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. These cells are unable to exit the cycle smoothly and enter the differentiation pathway, resulting in an overall decline in functional proliferative efficiency\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e.Previous studies have shown that Nestin expression is closely related to cell cycle status and differentiation, typically downregulated when cells exit the cycle and enter differentiation; conversely, it is highly expressed in continuously proliferating progenitor cells\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. Therefore, the observed increase in Nestin-positive cells in this study may reflect a state of undifferentiated and continuous proliferation, consistent with the observed decrease in the Normalized cell cycle exit index and the increase in BrdU incorporation ratio\u003csup\u003e\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u003c/sup\u003e.This paradoxical phenotype suggests the presence of complex signal network interactions in the JMY-deficient model, and that TP53RK's activation of p53 activity may also be selective. Future research should further focus on the functional diversity of TP53RK and its dynamic regulatory relationship with the p53/Gadd45α axis. Additionally, experimental validation is needed to determine whether p21 has post-translational regulatory mechanism impairments and to identify the specific targets of TP53RK, thereby improving the causal chain in this regulatory network and advancing our understanding of the mechanisms underlying neurodevelopmental abnormalities.\u003c/p\u003e\u003cp\u003ePrevious investigations have shown that JMY significantly influences neural stem cell proliferation, differentiation, and migration, which are fundamental processes in brain development. Disruptions in these processes can lead to cognitive impairments and neurodevelopmental disorders\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. In our study, We found via the Morris water maze and Y maze that \u003cem\u003eJmy\u003c/em\u003e conditional knockout mice presented abnormal spatial learning and memory behavior.We suggest that the impaired learning and memory of the JMY-deficient mice could be attributed to delayed neuronal differentiation and migration, which may reduce the number of fully developed and functional neurons and disrupt the establishment of neural circuits. Other members of the WASP family have also been implicated in learning and memory functions. For instance, Soderling et al. demonstrated that mice lacking WAVE-1 exhibited sensorimotor retardation and deficits in hippocampal-dependent learning and memory, underscoring the critical role of WAVE-1 in these cognitive processes\u003csup\u003e\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e. Furthermore, mutations in components of the WAVE complex have been identified in patients with intellectual disabilities, epilepsy, schizophrenia, and autism spectrum disorders\u003csup\u003e\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e, further supporting the importance of WASP family proteins in neurodevelopment and cognitive functions.\u003c/p\u003e\u003cp\u003eTherefore, the spatial learning and memory deficits observed due to JMY deletion are consistent with findings related to other WASP family members, emphasizing the pivotal role of these proteins in maintaining normal cognitive functions. In-depth investigation of JMY's role in NSC regulation could enhance our understanding of the pathogenesis of neurological disorders such as neurodevelopmental and neurodegenerative diseases, potentially offering novel therapeutic targets.\u003c/p\u003e\u003cp\u003eThe tight coupling of multiple cellular processes is a striking feature of the neurogenesis program. Although progress has been made in characterizing the molecular pathways that regulate individual cellular events during neurogenesis, how these various processes are coordinately regulated in a coherent developmental program remains poorly understood\u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. Here, we provide evidence that JMY plays an important role in the coordination of multiple aspects of neurogenesis in the cortex, particularly in regulating the cell cycle exit of neural progenitor cells and radial migration of neurons. Knockdown of \u003cem\u003eJmy\u003c/em\u003e resulted in delayed cortical neuron migration and impaired cell cycle exit, leading to disrupted neuronal differentiation. These abnormalities ultimately led to significant deficits in spatial learning and memory function. These findings underscore the critical regulatory role of JMY in neurogenesis, deepening our understanding of cortical development and providing insights into potential therapeutic targets for neurodevelopmental disorders.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Dr. Yiqiang Ouyang for animal care. This work was supported by grants from the National Science Foundation of China (31800865, 82171200), the Guangxi Natural Science Foundation Program(2017GXNSFAA198054).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eG.T. and Y.L. contributed to conception and design of the study. G.T., Y.L., S.Q, Q.H and X.C., conducted experiments and performed the statistical analysis. X.C. wrote the draft of the manuscript. X.C., M.C., W.L., H.L. and N.H. provided technical support in genotyping, WB and RT-PCR. G.T., Y.L., Q.H. and S.Q. conducted \u003cem\u003ein situ\u0026nbsp;\u003c/em\u003ehybridization\u003cem\u003ein utero\u003c/em\u003e electroporation technology combined with immune-fluorescence staining. Y.K. provided technical support in NSCs culture and immunostaining. X.C., Z.G, J.G. and X.J. provided technical support in animals behavior tests. All authors contributed to manuscript revision, read, and approved the submitted version.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that this research was performed in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAndrews, M. G., Subramanian, L., Salma, J. \u0026amp; Kriegstein, A. R. How mechanisms of stem cell polarity shape the human cerebral cortex. \u003cem\u003eNat. Rev. Neurosci.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 711-724 (2022).\u003c/li\u003e\n \u003cli\u003eGotz, M. \u0026amp; Huttner, W. B. The cell biology of neurogenesis. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e. \u003cstrong\u003e6\u003c/strong\u003e, 777-788 (2005).\u003c/li\u003e\n \u003cli\u003eBuchsbaum, I. Y. \u0026amp; Cappello, S. Neuronal migration in the CNS during development and disease: insights from in vivo and in vitro models. \u003cem\u003eDevelopment\u003c/em\u003e. \u003cstrong\u003e146\u003c/strong\u003e, (2019).\u003c/li\u003e\n \u003cli\u003eMarin, O. \u0026amp; Rubenstein, J. L. Cell migration in the forebrain. \u003cem\u003eAnnu. Rev. Neurosci.\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e, 441-483 (2003).\u003c/li\u003e\n \u003cli\u003eAyala, R., Shu, T. \u0026amp; Tsai, L. H. Trekking across the brain: the journey of neuronal migration. \u003cem\u003eCell\u003c/em\u003e. \u003cstrong\u003e128\u003c/strong\u003e, 29-43 (2007).\u003c/li\u003e\n \u003cli\u003eTakahashi, M., Kojima, M., Nakajima, K., Suzuki-Migishima, R. \u0026amp; Takeuchi, T. Functions of a jumonji-cyclin D1 pathway in the coordination of cell cycle exit and migration during neurogenesis in the mouse hindbrain. \u003cem\u003eDev. Biol.\u003c/em\u003e \u003cstrong\u003e303\u003c/strong\u003e, 549-560 (2007).\u003c/li\u003e\n \u003cli\u003eA, K. D., K, P. H. \u0026amp; Chen, B. Corrigendum to \u0026quot;WASP Family Proteins: Molecular Mechanisms and Implications in Human Disease\u0026quot; [Eur. J. Cell Biol. Vol. 101, Issue 3, (2022) 151244]. \u003cem\u003eEur. J. Cell Biol.\u003c/em\u003e \u003cstrong\u003e102\u003c/strong\u003e, 151287 (2023).\u003c/li\u003e\n \u003cli\u003eKramer, D. A., Piper, H. K. \u0026amp; Chen, B. WASP family proteins: Molecular mechanisms and implications in human disease. \u003cem\u003eEur. J. Cell Biol.\u003c/em\u003e \u003cstrong\u003e101\u003c/strong\u003e, 151244 (2022).\u003c/li\u003e\n \u003cli\u003eZuchero, J. B., Coutts, A. S., Quinlan, M. E., Thangue, N. B. \u0026amp; Mullins, R. D. p53-cofactor JMY is a multifunctional actin nucleation factor. \u003cem\u003eNat. Cell Biol.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 451-459 (2009).\u003c/li\u003e\n \u003cli\u003eShikama, N. et al. A novel cofactor for p300 that regulates the p53 response. \u003cem\u003eMol. Cell\u003c/em\u003e. \u003cstrong\u003e4\u003c/strong\u003e, 365-376 (1999).\u003c/li\u003e\n \u003cli\u003eCoutts, A. S., Boulahbel, H., Graham, A. \u0026amp; La Thangue, N. B. Mdm2 targets the p53 transcription cofactor JMY for degradation. \u003cem\u003eEMBO Rep.\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 84-90 (2007).\u003c/li\u003e\n \u003cli\u003eFischer, M. Census and evaluation of p53 target genes. \u003cem\u003eOncogene\u003c/em\u003e. \u003cstrong\u003e36\u003c/strong\u003e, 3943-3956 (2017).\u003c/li\u003e\n \u003cli\u003eDai, C. \u0026amp; Gu, W. p53 post-translational modification: deregulated in tumorigenesis. \u003cem\u003eTrends Mol. Med.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 528-536 (2010).\u003c/li\u003e\n \u003cli\u003eSun, S. C., Sun, Q. Y. \u0026amp; Kim, N. H. JMY is required for asymmetric division and cytokinesis in mouse oocytes. \u003cem\u003eMol. Hum. Reprod.\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 296-304 (2011).\u003c/li\u003e\n \u003cli\u003eLin, Z., Xu, Y. N., Namgoong, S. \u0026amp; Kim, N. H. JMY functions as actin nucleation-promoting factor and mediator for p53-mediated DNA damage in porcine oocytes. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cstrong\u003e9\u003c/strong\u003e, e109385 (2014).\u003c/li\u003e\n \u003cli\u003eLin, Z. L., Cui, X. S., Namgoong, S. \u0026amp; Kim, N. H. Junction-mediating and regulatory protein (JMY) is essential for early porcine embryonic development. \u003cem\u003eJ Reprod Dev\u003c/em\u003e. \u003cstrong\u003e61\u003c/strong\u003e, 361-367 (2015).\u003c/li\u003e\n \u003cli\u003eLi, S., Zhang, C., Takemori, H., Zhou, Y. \u0026amp; Xiong, Z. Q. TORC1 regulates activity-dependent CREB-target gene transcription and dendritic growth of developing cortical neurons. \u003cem\u003eJ. Neurosci.\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 2334-2343 (2009).\u003c/li\u003e\n \u003cli\u003eSaito, T. In vivo electroporation in the embryonic mouse central nervous system. \u003cem\u003eNat. Protoc.\u003c/em\u003e \u003cstrong\u003e1\u003c/strong\u003e, 1552-1558 (2006).\u003c/li\u003e\n \u003cli\u003eVorhees, C. V. \u0026amp; Williams, M. T. Morris water maze: procedures for assessing spatial and related forms of learning and memory. \u003cem\u003eNat. Protoc.\u003c/em\u003e \u003cstrong\u003e1\u003c/strong\u003e, 848-858 (2006).\u003c/li\u003e\n \u003cli\u003eSarnyai, Z. et al. Impaired hippocampal-dependent learning and functional abnormalities in the hippocampus in mice lacking serotonin(1A) receptors. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e. \u003cstrong\u003e97\u003c/strong\u003e, 14731-14736 (2000).\u003c/li\u003e\n \u003cli\u003eLalonde, R. The neurobiological basis of spontaneous alternation. \u003cem\u003eNeurosci Biobehav Rev\u003c/em\u003e. \u003cstrong\u003e26\u003c/strong\u003e, 91-104 (2002).\u003c/li\u003e\n \u003cli\u003eFirat-Karalar, E. N., Hsiue, P. P. \u0026amp; Welch, M. D. The actin nucleation factor JMY is a negative regulator of neuritogenesis. \u003cem\u003eMol. Biol. Cell\u003c/em\u003e. \u003cstrong\u003e22\u003c/strong\u003e, 4563-4574 (2011).\u003c/li\u003e\n \u003cli\u003eSaito, T. \u0026amp; Nakatsuji, N. Efficient gene transfer into the embryonic mouse brain using in vivo electroporation. \u003cem\u003eDev. Biol.\u003c/em\u003e \u003cstrong\u003e240\u003c/strong\u003e, 237-246 (2001).\u003c/li\u003e\n \u003cli\u003eNakamura, S. et al. Application of bromodeoxyuridine (BrdU) and anti-BrdU monoclonal antibody for the in vivo analysis of proliferative characteristics of human leukemia cells in bone marrows. \u003cem\u003eOncology\u003c/em\u003e. \u003cstrong\u003e48\u003c/strong\u003e, 285-289 (1991).\u003c/li\u003e\n \u003cli\u003eSugihara, H., Hattori, T. \u0026amp; Fukuda, M. Immunohistochemical detection of bromodeoxyuridine in formalin-fixed tissues. \u003cem\u003eHistochemistry\u003c/em\u003e. \u003cstrong\u003e85\u003c/strong\u003e, 193-195 (1986).\u003c/li\u003e\n \u003cli\u003eGerdes, J. et al. Cell cycle analysis of a cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67. \u003cem\u003eJ. Immunol.\u003c/em\u003e \u003cstrong\u003e133\u003c/strong\u003e, 1710-1715 (1984).\u003c/li\u003e\n \u003cli\u003eReynolds, B. A. \u0026amp; Weiss, S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. \u003cem\u003eScience\u003c/em\u003e. \u003cstrong\u003e255\u003c/strong\u003e, 1707-1710 (1992).\u003c/li\u003e\n \u003cli\u003eMorshead, C. M. et al. Neural stem cells in the adult mammalian forebrain: a relatively quiescent subpopulation of subependymal cells. \u003cem\u003eNeuron\u003c/em\u003e. \u003cstrong\u003e13\u003c/strong\u003e, 1071-1082 (1994).\u003c/li\u003e\n \u003cli\u003eFrederiksen, K. \u0026amp; McKay, R. D. Proliferation and differentiation of rat neuroepithelial precursor cells in vivo. \u003cem\u003eJ. Neurosci.\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 1144-1151 (1988).\u003c/li\u003e\n \u003cli\u003eDahlstrand, J., Zimmerman, L. B., McKay, R. D. \u0026amp; Lendahl, U. Characterization of the human nestin gene reveals a close evolutionary relationship to neurofilaments. \u003cem\u003eJ. Cell Sci.\u003c/em\u003e \u003cstrong\u003e103 ( Pt 2)\u003c/strong\u003e, 589-597 (1992).\u003c/li\u003e\n \u003cli\u003eBuckmaster, C. A., Eichenbaum, H., Amaral, D. G., Suzuki, W. A. \u0026amp; Rapp, P. R. Entorhinal cortex lesions disrupt the relational organization of memory in monkeys. \u003cem\u003eJ. Neurosci.\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 9811-9825 (2004).\u003c/li\u003e\n \u003cli\u003eShrager, Y., Bayley, P. J., Bontempi, B., Hopkins, R. O. \u0026amp; Squire, L. R. Spatial memory and the human hippocampus. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e. \u003cstrong\u003e104\u003c/strong\u003e, 2961-2966 (2007).\u003c/li\u003e\n \u003cli\u003eAbe, Y. et al. Cloning and characterization of a p53-related protein kinase expressed in interleukin-2-activated cytotoxic T-cells, epithelial tumor cell lines, and the testes. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cstrong\u003e276\u003c/strong\u003e, 44003-44011 (2001).\u003c/li\u003e\n \u003cli\u003eJin, S. et al. Gadd45a contributes to p53 stabilization in response to DNA damage. \u003cem\u003eOncogene\u003c/em\u003e. \u003cstrong\u003e22\u003c/strong\u003e, 8536-8540 (2003).\u003c/li\u003e\n \u003cli\u003eNoctor, S. C., Martinez-Cerdeno, V., Ivic, L. \u0026amp; Kriegstein, A. R. Cortical neurons arise in symmetric and asymmetric division zones and migrate through specific phases. \u003cem\u003eNat. Neurosci.\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 136-144 (2004).\u003c/li\u003e\n \u003cli\u003eLeone, D. P., Srinivasan, K., Chen, B., Alcamo, E. \u0026amp; McConnell, S. K. The determination of projection neuron identity in the developing cerebral cortex. \u003cem\u003eCurr. Opin. Neurobiol.\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, 28-35 (2008).\u003c/li\u003e\n \u003cli\u003eSah, V. P. et al. A subset of p53-deficient embryos exhibit exencephaly. \u003cem\u003eNat. Genet.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 175-180 (1995).\u003c/li\u003e\n \u003cli\u003eMeletis, K. et al. p53 suppresses the self-renewal of adult neural stem cells. \u003cem\u003eDevelopment\u003c/em\u003e. \u003cstrong\u003e133\u003c/strong\u003e, 363-369 (2006).\u003c/li\u003e\n \u003cli\u003eMarin, N. A. et al. p53 controls genomic stability and temporal differentiation of human neural stem cells and affects neural organization in human brain organoids. \u003cem\u003eCell Death Dis.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 52 (2020).\u003c/li\u003e\n \u003cli\u003eCasas, G. G. \u0026amp; Paridaen, J. The Symmetry of Neural Stem Cell and Progenitor Divisions in the Vertebrate Brain. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e. \u003cstrong\u003e10\u003c/strong\u003e, 885269 (2022).\u003c/li\u003e\n \u003cli\u003eWu, S. X. et al. Pyramidal neurons of upper cortical layers generated by NEX-positive progenitor cells in the subventricular zone. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e. \u003cstrong\u003e102\u003c/strong\u003e, 17172-17177 (2005).\u003c/li\u003e\n \u003cli\u003eWu, S. et al. Cell cycle during neuronal migration and neocortical lamination. \u003cem\u003eInt. J. Dev. Neurosci.\u003c/em\u003e \u003cstrong\u003e81\u003c/strong\u003e, 209-219 (2021).\u003c/li\u003e\n \u003cli\u003eAbe, Y. et al. A Small Ras-like protein Ray/Rab1c modulates the p53-regulating activity of PRPK. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e. \u003cstrong\u003e344\u003c/strong\u003e, 377-385 (2006).\u003c/li\u003e\n \u003cli\u003eMolina, E., Cataldo, V. F., Eggers, C., Munoz-Madrid, V. \u0026amp; Glavic, A. p53 Related Protein Kinase is Required for Arp2/3-Dependent Actin Dynamics of Hemocytes in Drosophila melanogaster. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e. \u003cstrong\u003e10\u003c/strong\u003e, 859105 (2022).\u003c/li\u003e\n \u003cli\u003eSax, J. K. \u0026amp; El-Deiry, W. S. p53 downstream targets and chemosensitivity. \u003cem\u003eCell Death Differ.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 413-417 (2003).\u003c/li\u003e\n \u003cli\u003eKastan, M. B. et al. A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. \u003cem\u003eCell\u003c/em\u003e. \u003cstrong\u003e71\u003c/strong\u003e, 587-597 (1992).\u003c/li\u003e\n \u003cli\u003eZhang, L. et al. Gadd45g, A Novel Antidepressant Target, Mediates Metformin-Induced Neuronal Differentiation of Neural Stem Cells Via DNA Demethylation. \u003cem\u003eStem Cells\u003c/em\u003e. \u003cstrong\u003e40\u003c/strong\u003e, 59-73 (2022).\u003c/li\u003e\n \u003cli\u003eZhao, H. et al. The central region of Gadd45 is required for its interaction with p21/WAF1. \u003cem\u003eExp. Cell Res.\u003c/em\u003e \u003cstrong\u003e258\u003c/strong\u003e, 92-100 (2000).\u003c/li\u003e\n \u003cli\u003eTamura, R. E. et al. GADD45 proteins: central players in tumorigenesis. \u003cem\u003eCurr. Mol. Med.\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 634-651 (2012).\u003c/li\u003e\n \u003cli\u003eHarper, J. W., Adami, G. R., Wei, N., Keyomarsi, K. \u0026amp; Elledge, S. J. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. \u003cem\u003eCell\u003c/em\u003e. \u003cstrong\u003e75\u003c/strong\u003e, 805-816 (1993).\u003c/li\u003e\n \u003cli\u003eBartek, J., Lukas, C. \u0026amp; Lukas, J. Checking on DNA damage in S phase. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e. \u003cstrong\u003e5\u003c/strong\u003e, 792-804 (2004).\u003c/li\u003e\n \u003cli\u003eOhnuma, S., Philpott, A. \u0026amp; Harris, W. A. Cell cycle and cell fate in the nervous system. \u003cem\u003eCurr. Opin. Neurobiol.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 66-73 (2001).\u003c/li\u003e\n \u003cli\u003eMignone, J. L., Kukekov, V., Chiang, A. S., Steindler, D. \u0026amp; Enikolopov, G. Neural stem and progenitor cells in nestin-GFP transgenic mice. \u003cem\u003eJ. Comp. Neurol.\u003c/em\u003e \u003cstrong\u003e469\u003c/strong\u003e, 311-324 (2004).\u003c/li\u003e\n \u003cli\u003eCalegari, F., Haubensak, W., Haffner, C. \u0026amp; Huttner, W. B. Selective lengthening of the cell cycle in the neurogenic subpopulation of neural progenitor cells during mouse brain development. \u003cem\u003eJ. Neurosci.\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 6533-6538 (2005).\u003c/li\u003e\n \u003cli\u003eSoderling, S. H. et al. Loss of WAVE-1 causes sensorimotor retardation and reduced learning and memory in mice. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e. \u003cstrong\u003e100\u003c/strong\u003e, 1723-1728 (2003).\u003c/li\u003e\n \u003cli\u003ePathania, M. et al. The autism and schizophrenia associated gene CYFIP1 is critical for the maintenance of dendritic complexity and the stabilization of mature spines. \u003cem\u003eTransl Psychiatry\u003c/em\u003e. \u003cstrong\u003e4\u003c/strong\u003e, e374 (2014).\u003c/li\u003e\n \u003cli\u003eNguyen, L. et al. p27kip1 independently promotes neuronal differentiation and migration in the cerebral cortex. \u003cem\u003eGenes Dev\u003c/em\u003e. \u003cstrong\u003e20\u003c/strong\u003e, 1511-1524 (2006).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"cell-death-discovery","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddiscovery","sideBox":"Learn more about [Cell Death Discovery](http://www.nature.com/cddiscovery/)","snPcode":"41420","submissionUrl":"https://mts-cddiscovery.nature.com/","title":"Cell Death Discovery","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7054125/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7054125/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRadial migration of neurons is a critical process in the formation of the cerebral cortical layers. Transcriptional regulators are implicated in neuronal migration, while the molecular mechanisms remain incompletely understood. Junction-mediating and regulatory protein (JMY), a p53 coactivator with established roles in embryonic development, has an unclear role in neurodevelopment. Here we found that JMY is highly expressed in the developing brain, particularly in the ventricular zone and subventricular zone, areas known for neurogenesis. Knockdown of \u003cem\u003eJmy\u003c/em\u003e led to delayed radial migration of cortical neurons, disrupted cell cycle exit, and impaired neuronal differentiation. Behavioral studies revealeddeficits in spatial learning and memory in JMY-deficient mice. Proteomicanalysis using \u003cem\u003eJmy\u003c/em\u003e-mutant mice suggested that knocking out JMY in the mouse brain affects cell cycle-related pathways. Our findings indicate an important role of JMY in neurogenesis and cognitive function in the mouse developing brain, providing novel insights into the molecular mechanisms underlying neuronal migration during corticogenesis.\u003c/p\u003e","manuscriptTitle":"Junction-mediating and regulatory protein (JMY) is a promoting protein for radial migration of cortical neurons","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-18 15:04:52","doi":"10.21203/rs.3.rs-7054125/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2025-08-11T09:15:31+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-07-31T03:04:24+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-07-24T10:24:27+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-07-15T14:38:34+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-07-15T14:15:15+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2025-07-15T14:11:23+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-07-07T11:49:18+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-05T16:06:23+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death Discovery","date":"2025-07-05T16:06:22+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"cell-death-discovery","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddiscovery","sideBox":"Learn more about [Cell Death Discovery](http://www.nature.com/cddiscovery/)","snPcode":"41420","submissionUrl":"https://mts-cddiscovery.nature.com/","title":"Cell Death Discovery","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3659bef5-6fad-4a58-aeca-1e5bdd08b5c1","owner":[],"postedDate":"July 18th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":51574823,"name":"Biological sciences/Neuroscience/Development of the nervous system/Neuronal development"},{"id":51574824,"name":"Biological sciences/Developmental biology/Neurogenesis/Developmental neurogenesis"}],"tags":[],"updatedAt":"2026-03-28T07:07:15+00:00","versionOfRecord":{"articleIdentity":"rs-7054125","link":"https://doi.org/10.1038/s41420-026-02974-7","journal":{"identity":"cell-death-discovery","isVorOnly":false,"title":"Cell Death Discovery"},"publishedOn":"2026-02-26 05:00:00","publishedOnDateReadable":"February 26th, 2026"},"versionCreatedAt":"2025-07-18 15:04:52","video":"","vorDoi":"10.1038/s41420-026-02974-7","vorDoiUrl":"https://doi.org/10.1038/s41420-026-02974-7","workflowStages":[]},"version":"v1","identity":"rs-7054125","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7054125","identity":"rs-7054125","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.