Structural characterization and protective effect against myocardial fibrosis of polysaccharide from Stellariae Radix (Stellaria dichotoma L. var. lanceolata Bge.)

Structural characterization and protective effect against myocardial fibrosis of polysaccharide from Stellariae Radix (Stellaria dichotoma L. var. lanceolata Bge.) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Structural characterization and protective effect against myocardial fibrosis of polysaccharide from Stellariae Radix (Stellaria dichotoma L. var. lanceolata Bge.) Hong Wang, Pilian Niu, Haishan Li, Lu Feng, Zhenkai Li, Mingsheng Bai, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4230329/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 12 You are reading this latest preprint version Abstract Cardiovascular disease is characterized by thedevelopment of myocardial fibrosis, Stellariae Radix is a traditional Chinese medicine. A novel polysaccharide named SRP-1 from Stellariae Radix was structurally identified and its effect against myocardial fibrosis was explored. SRP-1 was extracted from Stellariae Radix and purified by DEAE-52 cellulose chromatography. According to physicochemical methods and monosaccharide composition analysis, SRP-1 was found to be mainly composed of galactose, glucose, xylose, fructose, mannose, and rhamnose, and its weight average molecular weight (Mw) was 31,309 Da. Tests of activity against myocardial fibrosis indicated marked downregulation of the expression of Col I, Col III, α-SMA, and proteins related to the TGF-β/Smad signaling pathway, which were induced by TGF-β1, in mouse cardiac fibroblasts pretreated with SRP-1. In addition, SRP-1 restrained the abnormal growth of cardiac fibroblasts cells and the expression of Snail 1 , Snail 2 , Twist 1 , and Slug mRNA in vitro. SRP-1 can reduce the expression of TGF-β/Smad signaling pathway related proteins induced by TGF-β1. Taken together,SRP-1 can protect CFs from myocardial fibrosis induced by TGF-β1 by inhibiting TGF-β/Smad signaling. These results indicate that Stellariae Radix polysaccharide may warrant further analysis as a novel therapeutic agent for cardiovascular diseases. myocardial fibrosis Stellariae Radix polysaccharide extraction TGF-β/Smad signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction There is a pathological course in the process of cardiovascular disease called myocardial fibrosis, which is characterized by the imbalance between the abnormal proliferation of cardiac fibroblasts (CFs) and excessive extracellular matrix (ECM) synthesis and degradation(Lopez et al., 2021 ,Zhang et al., 2023 ). Transforming growth factor-β1 (TGF-β1) not only could promote cell fibrosis, but also has been proved to induce CFs to differentiate into myofibroblasts and ECM deposition༈Liu et al., 2023 ,Yue et al., 2017 ༉. TGF-β1/Smad signal path plays a vital part in myocardial fibrosis.TGF-β1 induces myocardial fibrosis through the TGF-β/Smad signal path, which can induce Smad 2, 3, and 4 expression༈Yu et al., 2022 ,Zhang et al., 2022 ༉. According to traditional Chinese medicine (TCM), the pathogenesis of cardiovascular disease (CVD) is mainly due to various causes of malaise, and CVD-related deficiency syndrome is manifested as qi deficiency and yin deficiency, while CVD-related excess syndrome is mainly qi stagnation, blood stasis, and fire heat( Xia et al., 2022 ). Stellariae Radix is a root medicine commonly used in Chinese traditional medicine. Traditional uses include treating fever and malnutrition༈Committee 2020 ༉. As early as in the Ming Dynasty, Gong Tingxian mentioned in the four hundred herbs in the medicinal song: Stellariae Radix was cold, and it could clear deficient heat, in addition, it could cool blood and is good at treating bone steaming༈Ming Gong Tingxian and Note, 2006༉. More and more evidence show that Stellariae Radix is one of the traditional Chinese medicine prescriptions for the treatment of CVD༈Li et al., 2021༉.In recent years, a large number of plant polysaccharides with pharmacological activities and different characteristics have been found from traditional Chinese medicine. Polysaccharides extracted from plants have been foundto have anti-cardiovascular disease effects༈Jia et al., 2020 ༉. For example, Wang showed that Astragalus polysaccharide had significant antioxidant activity and cardioprotectiveeffects༈Wang et al., 2023 ༉. Additionally, Yang found that polysaccharides from Fructus aurantii could inhibit apoptosis and effectively prevent myocardial injury induced by ISO༈Yang et al., 2020 ༉. As a traditional Chinese medicine, Stellariae Radix has been extensively studied for its active components and pharmacological effects ༈Li et al., 2020 ,Yasukawa et al., 1982 ༉, but so far there have been no reports related to the extraction, structural identification and effects on Cardiovascular disease of polysaccharides from Stellariae Radix(SRP). In this study, we aimed to identify the cardioprotective effect of SRP, and explored the potential molecular mechanism of SRP on TGF-β1-induced myocardial fibrosis injury in vitro, mainly TGF-β/Smadsignaling pathway signal transduction pathway. 2. Materials and methods 2.1 Drugs and agentia The 3-4-year-old artificial cultivated Stellariae Radix, was collected from the standardized planting base of B. chinese in Tongxin County, Ningxia. It was identified as the dried root of Stellariae Radix. by Prof. Peng Li from College of Biological Sciences, Ningxia University. A voucher specimen (no. 2019-1125). Absolute ethanol and chloroform were purchased from Nanjing Reagent. DEAE-52 (C8350) and Sepharose Fast Flow (S8801) were purchased from Solarbio Biotechnology (Beijing, China). fetal calf serum (FBS，10099141C，Gibco), Cell Counting Kit (SC119, SEVEN, Beijing, China), anti-α-Smooth muscle actin (19245, Cell Signaling Technology, Danvers, MA, USA), Smad2/3 (AF6367, Affinity, Changzhou, China), p-Smad2 (AF3449, Affinity, Changzhou, China), Smad4 (AF5247, Affinity, Changzhou, China), p-Smad3 (AF3362, Affinity, Changzhou, China). Goat anti-rabbit IgG (61-9520, Proteintech, Wuhan, China). TGF-β1 (HZ-1011, Proteintech, Wuhan, China). Col Ⅰ ELISA scientificresearch Kit (MM-45905M1, Jiangsu Meimian Industrial Co., Ltd). 2.2 Technological process of extracting SRP-1 The Stellariae Radix was pulverized, sieved (40-mesh) and defatted by critical CO 2 extraction, and extracted twice at the ratio of 1:20 (g/mL) at 45℃ for three hours. Filtered extracts were concentrated, and they were precipitated by 80% (v/v) ethyl alcohol, then their protein were removed by Sevag reagent (The volume ratio of chloroform to butanol was 4∶1). Next, the extracts were freeze-dried, and components were separated (we used the DEAE-Cellulose DE52(2.6 cm×40 cm) column in this process). And then eluted gradually with distilled water and NaCl solutions (0.1 mol/L, 0.3 mol/L and 0.5 mol/L) at 1.0 mL/min rate. The neutral polysaccharide SRP-1 was obtained, and the carbohydrate content was measured with the way of phenol-sulfuric acid. The regression equation is a 482 nm= 0.6938x-0.0193, and R²= 0.9949. (x: carbohydrate content; A482 nm: absorbance at 482 nm). 2.3 Physical and chemical properties analyses 2.3.1 Determination of monosaccharide composition First, the monosaccharide composition of SRP-1 was evaluated by ion chromatography. In brief, take monosaccharide standard in Table 1 and an SRP-1 specimen (5 mg) was hydrolyzed by TFA (3 mol/L) at 121 ℃ for 2 h. Then, the residue was dried and dissolved with sterile water, after which the supernatant was assessed with an ICS 5000 system equipped with an electrochemical detector (Thermo Fisher Scientific, USA) and a Dionex Carbo Opac Pa20 (150×3.0 mm, 10 μm) liquid chromatography column. Other features included a sample volume of 5 μL, column temperature of 30℃, and mobile phase A of 0.1 M NaOH and mobile phase B of 0.1 M NaOH and 0.2 M NaAc. Tab. 1 Different monosaccharide standards number Monosaccharide standard number Monosaccharide standard 1 Gal 8 Man 2 Glu 9 Rib 3 Fuc 10 Man-UA 4 Fru 11 Glc-UA 5 Rha 12 Gul-UA 6 Ara 13 Gal-UA 7 Xyl 2.3.2 Molecular weight determination SRP molecular weight determination was performed usinga high performance gel permeation chromatograph. SRP was dissolve in 0.1 M NaNO 3 aqueous solution to afinal concentration of 1 mg/mL, Analysis after filtration of the aqueous phase filterwith a 0.22 μm. 2.3.3 Fourier-transformed infrared spectroscopy (FT-IR) analysis The 2mg sample was accurately weighed, and the potassium bromide powder was added at a ratio of 1:100 to mix and grind in agate mortar, which was pressed by tablet machine for 20 s and placed in the sample room for test. Then OPUS was used to scan infrared spectrum with 4000-450 cm -1 wave number range. 2.3.4 Determination of specific rotation SRP-1 was weighed and prepared moderately for configuration 2 mg/mL solution for test, which was determined specific rotation by automatic polarimeter at 20 ℃, where sodium lamp was used as light source, and distilled water was used to zero the instrument. 2.4 CFs Culture and Cell Analysis 2.4.1 Cell culture and model establishment Cell rowth contain 10% FBS and 1% double antibodies, and CFs were digested with 0.25 % trypsin when they grew to about 90% of the medium, subcultured or subsequent test. And the experiment was divided into control group and modelgroup (48 h TGF-β1). The specific experiment was performed as reported elsewhere（Niu et al., 2023）. 2.4.3 CCK-8 Assay CFs were plated into a 96 well plate (1×10 4 /mL) and culture for twelve hours, then cultured in groups for 48 h. Add 10 μL CCK-8 per well, and a duration of 3 h. Absorbance was measured at 450 nm and the resulting data was recorded. There were 6 replicates in each experiment. 2.4.4 ELISA After the CFs are cultured in groups (control (cells), TGF-β1 (10 ng/mL), SRP-1 (10 ng/mL TGF-β1+50 μg/mL)), Centrifuge, carrying out each step of operation accordto that instruction of the kit. Absorbance was measured at 450 nm and the resulting data was recorded. There were 6 replicates in each experiment. 2.4.5 Real-time quantitative PCR analysis After the CFs are cultured in groups, wash 2-3 times with PBS, add Trizol（Ambion，Austin，TX，USA）reagent for lysis, and extract Total RNA. RNA concentrations were measured using a Nanodrop 8000 Nucleic Acid Protein Analyzer. And the primers used are shown in Tab. 2. The subsequent experimental steps were carried outaccording to others' reports（Jia et al., 2021）. Tab. 2 RT-qPCR primer Gene Sequence of primers (5’→3’) Twist 1 F： CAGCGGGTCATGGCTAACG R： AGGACCTGGTACAGGAAGTCGA Snail 1 F： GGGCTCTGAAGATGCACAT R： TGGCTTCTCACCAGTGTGGG Snail 2 F： CGCCTCCAAGAAGCCCAA R： CTGGGTAAAGGAGAGTGGAGTGG Acta 2 F： ATGACCCAGATTATGTTTGAGACCT R TCCAGAGTCCAGCACAATACCAG S100A4 F： CAAATACTCAGGCAAAGAGGGTG R： GGCAATGCAGGACAGGAAGAC GAPDH F： AGAGTGTTTCCTCGTCCCGTAG R： CTTGACTGTGCCGTTGAATTTG 2.4.6 Western Blotting The experimental cells were divided into three treatment groups: control (cells), TGF-β1 (10 ng/mL), SRP-1 (10 ng/mL TGF-β1 + 50 μg/mL). Each group was repeated 3 times. Protein extraction kit was used. Total protein was extracted and quantitatively analyzed by BCA method. Proteins were separated by electrophoresis with 8%-12% SDS-PAGE and transferred to nitrocellulose membrane. The cells were blocked with 5% skimmed milk powder at room temperature for 1 h, washed with TBST for 3 times, and then incubated with the corresponding antibody (Note: the antibody dilution ratio is 1:1500), and incubated overnight at 4 °C. On the second day, the primary antibody was recovered, and the nitrocellulose membrane was treated with the secondary antibody (anti-rabbit or anti-mouse, 1:10000) at room temperature for 1 hour, and washed three times with TBST. Luminescent solution A and B were mixed in equal volume, and ECL chemiluminescence solution was used to develop in the chemiluminescence imager. Finally, the grey values of protein bands were analysed with Image J. 2.5 Statistical analyses All data were obtained after at least three independent experiments. One-way analysis of variance in GraphPad Prism 8.0.2 software was used for statistical analysis, and t-test was used for statistical evaluation of differencesbetween the two groups. A value of p < 0.05 was considered statistically significant. Data are presented as mean ± standard deviation (SD). 3. Results and Discussion 3.1 SRP Isolation and purification The crude polysaccharide from Stellariae Radix was purified by DEAE-52 column chromatography, according to the elution profile (Fig. 1 ). The neutral polysaccharide component SRP-I and the acidic polysaccharide component SRP-2 were eluted from the polysaccharides of Stellariae Radix by distilled water and 0.1 mol/L NaCl, respectively. Due to little content of SRP-2, SRP-1 eluted with distilled water was mainly collected in subsequent trials. 3.2 Characterization of SRP-1 3.2.1 Preliminary characterization of SRP-1 The ion chromatograms of SRP-1 derivatives were compared with the mixed standard monosaccharides (Fig. 2 ), and it was found that SRP-1 was mainly composed of galactose, glucose, xylose, fructose, mannose and rhamnose, in addition, the proportion of each component was 61.86%, 32.51%, 4.77%, 0.39%, 0.28%, 0.19% respectively. 3.2.2 Molecular weight of SRP-1 As illustrated in the Table 3 , SRP-1 molecular weight (Mw) was 31309 Da, and Mw/Mn was larger, then the monosaccharide composition analysis result was referenced, suggesting SRP-1 was mainly made up of high degree of polymerization of neutral polysaccharide fragments. Table 3 SRP-1 Molecular Parameter Information Molecular Parameter Parameter Molecular Weight Molecular Weight (Da) Mn 14040 ± 0.131 Mw 31309 ± 0.091 Polydispersity Mw/Mn 2.23 ± 0.02 Mw: molecular weight. Mn: molecular weight. Mean values ± standard deviation (n = 3). 3.2.3 FT-IR spectrum of SRP-1 The Fourier transform infrared spectroscopy(FTIR) of the SRP-1 were as follows : first, 3290 cm − 1 was the strong and wide absorption peak of the hydrogen bond O-H stretching vibration of the intermolecular or intramolecular of the SRP-1(Yang et al., 2018 ), and 2930 cm − 1 was absorption peak of the C-H stretching vibration in CH 2 , so, in general, polysaccharides would show similar absorption peaks in the above two places.Next, 1632 cm − 1 was the absorption peak formed by the C = O stretching vibration, and 1412 cm − 1 was the absorption peak of the deformation vibration of the C-H, moreover, 800–1300 cm − 1 was called ' fingerprint region ' of the FTIR of SRP-1, where absorption peak was dense and highly overlapped, and it was related to the types of sugar residue and on-link mode mostly. In addition, 1400 ~ 1200 cm − 1 was characteristic absorption of the sugar ring that constituted by C-H angular vibration and stretching vibration. Then absorption peak at 1139 cm − 1 was pyranoid ring, indicating that the sugar ring configuration was pyran type. At last, the absorption peak where it was 870 cm − 1 suggested SRP-1 had a β-configuration glycosidic bond, however, the absorption peak at 830 cm − 1 manifested it was an α-configuration glycosidic bond. In summary, it was shown there were pyranoid ring, α and β-configuration glycosidic bonds in SRP-1. 3.3 Determination of the optimum concentration of SRP-1 in CFs Different concentrations of SRP-1 was used to examine their impact on the viability of CFs. CFs were stimulated by TGF-β1 (10 ng/mL), and then dealt with 25 µg/mL, 50 µg/mL, 100 µg/mL, and 200 µg/mL of SRP-1 respectively for 48 hours. Next, proliferation of CFs in the TGF-β1 group exceeded obviously that cells where they were in the control group ( p < 0.01). When the CFs were dealt with SRP-1, it was found that polysaccharide concentrations of 50 µg/mL and 200 µg/mL can effectively restrain CFs proliferation ( p < 0.01). However, due to the greater cytotoxicity of 200 ug/mL, the concentration of SRP-1 was determined to be 50 ug/mL as the optimal concentration, and the concentration was used to succedent experiments. 3.5 Effect of SRP-1 on the Expression of Col I and Col III Proteins To investigate SRP-1 effect on the expression of Col I and III protein which were induced by TGF-β1, ELISA was used to detect Col I and III protein expression. And it was found compared with control group, the content of Col I and III protein increased obviously when they were induced by TGF-β1 ( p < 0.01), however, protein content decreased obviously after SRP-1 intervention ( p < 0.01). Figure 5 ELISA was used to detect Col I(A) and III (B) levels in the cell supernate. (n = 3). Data are expressed as mean ± SEM. ** p < 0.05 vs. TGF-β1, *** p < 0.01 vs. TGF-β1. 3.6 SRP-1 effect on the Expression of α-SMA Protein SRP-1 effect on α-SMA expression in CFs was determined by Western blotting. After induction with TGF-β, α-SMA expression increased distinctly (Fig. 6 A). But, compared with TGF-β1 group, its expression in the SRP-1 group was significantly decreased (Figs. 6 A, B). 3.7 Effect of SRP-1 on the Expression of Fibrosis-related Transcription Factor SRP-1 effect on fibrosis-related transcription factors in CFs was measured by RT-qPCR. The relative mRNA expression of Snail 1 , Snail 2 , Slug , Twist 1 , Acta 2 , and S100A4 significantly increased upon 48 h of TGF-β1 exposure (Fig. 7 ). Upon 48 h of SRP-1 exposure, the mRNA expression levels of Snail1 , Snail2 , Twist1 , Acta2 , Smad4 and fibrosis protein S100A4 were significantly down-regulated ( p < 0.01) (Fig. 7 ). 3.8 SRP-1 altered TGF-β/Smad signal path in CFs The levels of TGF-β/Smad signal path-related proteins in CFs were detected by Western blotting to determine whether SRP-1 could alleviate myocardial fibrosis-induced damage by altering TGF-β/Smad signal path. And expression of Smad2/3, Smad4 (Figs. 8 A, B, C), P-Smad2, P-Smad3 (Figs. 8 D, E, F) proteins in the TGF-β1 group increased obviously ( p < 0.01) compared to control group, however, expression of SRP-1 on related proteins was significantly down-regulated ( p < 0.01). 4. Discussion Cardiac fibrosis is considered to be an aggravating factor for a variety of CVDs, including hypertension, heart disease, and arrhythmia (Hinderer and Schenke-Layland 2019 ,Su et al., 2023 ). At present, the use of conventional treatment can alleviate some clinical symptoms of myocardial fibrosis, but owing to its complex pathogenesis, there is still a lack of drugs to effectively reverse myocardial fibrosis༈Qian et al., 2023 ༉. Therefore, the effective prevention of myocardial fibrosis is key to the treatment of many CVDs ༈Masola et al., 2020 ,Sabe et al., 2023 ༉. Substantial research has suggested that plant polysaccharides have anti-fibrotic activity ༈Li et al., 2019 ,Zhang et al., 2023 ༉. Against this background, this research was established to separate and identify polysaccharides from Stellariae Radix and then explore their mechanism of action on myocardial fibrosis. Polysaccharide is a kind of biological macromolecule with complex structure. Its structural characteristics such as molecular weight, monosaccharide composition and glycosyl order will affect its biological activity (Yang et al., 2020 ). Zhou (Zhou et al.,2020) isolated and purified Cordyceps sinensis polysaccharide (OLP) to obtain a homogeneous polysaccharide with a molecular weight of 3.2×105 Da, mainly composed of galactose, glucose and mannose, and found that (OLP) could reduce the occurrence of pulmonary fibrosis by inhibiting the synthesis of collagen and α-SMA protein and protecting alveolarfunction. Liu (Liu et al.,2019) Found that Bupleurum polysaccharide (BPS), mainly composed of Ara, Gal, Glc, Rha, Man and Xyl, alleviated renal fibrosis in mice by inhibiting the expression of type IV collagen (Col IV), fibronectin (FN) and α-smooth muscle actin (α-SMA). The results showed that the polysaccharide was composed of galactose, glucose, xylose, fructose, mannose and rhamnose. The molecular weight of polysaccharide was 31309 Da, and it was a pyranose with α-glycosidic bondand β-glycosidic bond. Stellaria dichotoma polysaccharide does not contain uronic acid, has a small molecular weight, and has a large proportion of galactose and glucose. Therefore, it is speculated that starwortpolysaccharide has anti-fibrosis effect. The Chinese medicine Stellariae Radix can be used to dispel infantile malnutrition heat and treat bone steaming tuberculosis via a heat effect (Yasukawa et al., 1982 ). With the intensification of modern medical research, the anti-inflammatory, anti-allergic, and anti-cancer effects of Stellariae Radix have been discovered, and its medicinal value has continuously expanded. As an authentic Chinese herb, Stellariae Radix has been widely reported on because of its active ingredients and pharmacological effects༈Bae et al., 2018 ,Li et al., 2020 ,Li et al., 2022 ༉. In this research, SRP-1 was isolated and purified in various ways, such as water extraction, ethanol precipitation, deproteinization, and column chromatography. Then, high-performance gel permeation chromatography was performed to measure the molecular weight of treated polysaccharides. In addition, ion chromatographic analysis was performed and suggested that SRP-1’s main monosaccharide components were Gal, Glu, and Xyl. We then determined the anti-fibrotic effect of SRP-1 in cardiomyocytes through in vitro experiments. In our study, used TGF-β1 established cell model of myocardial fibrosis. Our data show that SRP-1 can inhibited CFs proliferation, it significantly inhibited the production of Col 1, Col 2 and α-SMA proteins in CFs cells, thereby inhibiting the formation of extracellular matrix. Myocardial fibrosis is mediated by multiple signalingpathways and transcriptional regulators(Li et al., 2022 ,Xie et al., 2017 ,Zoppi et al., 2018 ). Therefore, we detected the transcriptional regulators of myocardial fibrosis and found that SRP-1 could inhibit the mRNA expression of Snail 1 , Snail 2 , Slug , Twist 1 and S100A4 in CFs after TGF-β1 treatment. These results together indicate that SRP-1 can improve TGF-β-induced myocardial fibrosis. There is abundant evidence that, TGF-β/Smad signaling pathway plays an important rolein organ fibrosis.(Li et al., 2019 ,Zhou et al., 2019 ). Research shows that TGF-β-induced Smad3 phosphorylation led to resulting in the production of collagen, when the expression of Smad3 in cardiac fibroblastsdecreased, Cardiac fibrosis and ECM protein deposition were alsoreduced ༈Feng et al., 2022 ,Khalil et al., 2017 ,Ku et al., 2021 ༉. Research has also shown that jatrorrhizine could reduce the apoptosis of myocardial cells and cell fibrosis by restraining p53/Bax/Bcl-2 and TGF-β1/Smad2/3 signaling pathways ༈Hao and Jiao 2022 ༉. It has also been shown that pirfenidone reduces myocardial fibrosis and dysfunction induced by pressure overload by restraining activation of the TGF-β1/Smad3 signaling pathway ༈Li et al., 2022 ༉. Our study showed that SRP-1 reduced TGF-β1-induced upregulation of proteins involved in the TGF-β/Smad signaling pathway, indicating that SRP-1 can effectively alleviate TGF-β1-induced myocardial fibrosis. 5. Conclusions In summary, a heteropolysaccharide mainly composed of Gal, Glu and Xyl was found in this study. Pharmacological studies showed that it had a protective effect on TGF-β1-induced myocardial fibrosis by interfering with the TGF-β/Smad signal path. As a new drug or natural supplement, SRP-1 heteropolysaccharide provides a new strategy and experimental theory for clinical treatment of myocardial fibrosis. Abbreviations CFs Cardiac fibroblasts SDL Stellaria dichotoma L. var. lanceolata Bge. TGF-β1 Transforming growth factor-β1 p-Smad2/3 Phosphorylated-Smad2/3 Col I Collagen I Declarations Author statement Hong Wang: Conceptualization, Methodology, Visualization, Writing–original draft, Investigation, Formal analysis, Writing – review & editing. Pilian Niu: Visualization, Formal analysis, Methodology, Formal analysis, Data curation, Writing – original draft. Haishan Li: Data interpretation and manuscript revision. Lu Feng: Performed the study and analyzed the results. Zhenkai Li and Mingsheng Bai: Conceptualization and data interpretation. Li Peng: Designed the study, contributed to the concept generation, and wrote and revised the manuscript. Ethical Approval not applicable Funding This study was supported by the Key Research and Development Program of Ningxia (No. 2021BEG02042) and grants from the National Natural Science Foundation of China (31860583). Availability of data and materials The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding authors. Declaration of competing interest All authors declare that they have no competing interests. Conflict of Interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. References Bae, S.J., Choi, J.W., Park, B.J., Lee, J., Jo, E.K., Lee, Y.H., Kim, S.B., Yuk, J.M., 2018. Protective effects of a traditional herbal extract from Stellaria dichotoma var. lanceolata against Mycobacterium abscessus infections. PLoS One. 13(11), e0207696. Committee, N.P.,(2020).National Pharmacopoeia Committee. Chinese Pharmacopoeia; 2020 ed.Published.: China Pharmaceutical Science and Technology Press. Feng, Y., Bao, Y., Ding, J., Li, H., Liu, W., Wang, X., Guan, H., Chen, Z., 2022. MicroRNA-130a attenuates cardiac fibrosis after myocardial infarction through TGF-beta/Smad signaling by directly targeting TGF-beta receptor 1. Bioengineered. 13(3), 5779-5791. Hao, M., Jiao, K., 2022. Jatrorrhizine reduces myocardial infarction-induced apoptosis and fibrosis through inhibiting p53 and TGF-beta1/Smad2/3 pathways in mice. Acta Cir Bras. 37(7), e370705. Hinderer, S., Schenke-Layland, K., 2019. Cardiac fibrosis - A short review of causes and therapeutic strategies. Adv Drug Deliv Rev. 146(77-82). Jia, F., Zhang, X., Ma, W., Li, X., Zhou, X., 2021. Cytotoxicity and anti-inflammatory effect of a novel diminazene aceturate derivative in bovine mammary epithelial cells. Res Vet Sci. 137(102-110). Jia, Q.J., Wang, L.R., Zhang, X.N., Ding, Y.J., Li, H., Yang, Y.X., Zhang, A., Li, Y.Y., Lv, S.C., Zhang, J.P., 2020. Prevention and treatment of chronic heart failure through traditional Chinese medicine: Role of the gut microbiota. Pharmacol Res. 151. Khalil, H., Kanisicak, O., Prasad, V., Correll, R.N., Fu, X., Schips, T., Vagnozzi, R.J., Liu, R., Huynh, T., Lee, S.J., Karch, J., Molkentin, J.D., 2017. Fibroblast-specific TGF-beta-Smad2/3 signaling underlies cardiac fibrosis. J Clin Invest. 127(10), 3770-3783. Ku, C.W., Day, C.H., Ou, H.C., Ho, T.J., Chen, R.J., Kumar, V.B., Lin, W.Y., Huang, C.Y., 2021. The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats. Open Life Sci. 16(1), 1182-1192. Li, H., Yan, Z., Xiong, Q., Chen, X., Lin, Y., Xu, Y., Bai, L., Jiang, W., Zheng, D., Xing, C., 2019. Renoprotective effect and mechanism of polysaccharide from Polyporus umbellatus sclerotia on renal fibrosis. Carbohydr Polym. 212(1-10). Li, M., 2021. Based on data mining to explore the thinking and medication rules of director Song Ping, an expert of Guoyitang, in the treatment of cardiac neurosis. [Tianjin University of Traditional Chinese Medicine. Li, N., Hang, W., Shu, H., Zhou, N., 2022. Pirfenidone alleviates cardiac fibrosis induced by pressure overload via inhibiting TGF-beta1/Smad3 signalling pathway. J Cell Mol Med. 26(16), 4548-4555. Li, P., Yu, P., Xia, J., 2020. Characterization of the complete chloroplast genome of Stellaria dichotoma var. lanceolata Bunge, a traditional Chinese medicinal plant. Mitochondrial DNA B Resour. 5(4), 3848-3850. Li, P.F., He, R.H., Shi, S.B., Li, R., Wang, Q.T., Rao, G.T., Yang, B., 2019. Modulation of miR-10a-mediated TGF-beta1/Smads signaling affects atrial fibrillation-induced cardiac fibrosis and cardiac fibroblast proliferation. Biosci Rep. 39(2). Li, Z., Wang, H., Feng, L., Song, L., Lu, Y., Li, H., Li, Y., Tian, G., Yang, Y., Li, H., Mei, X., Peng, L., 2022. Comparative metabolomics provides novel insights into correlation between dominant habitat factors and constituents of Stellaria Radix (Stellaria dichotoma L. var. lanceolata Bge.). Front Plant Sci. 13(1035712). Liu, J., Lu, J., Zhang, L., Liu, Y., Zhang, Y., Gao, Y., Yuan, X., Xiang, M., Tang, Q., 2023. The combination of exercise and metformin inhibits TGF-beta1/Smad pathway to attenuate myocardial fibrosis in db/db mice by reducing NF-kappaB-mediated inflammatory response. Biomed Pharmacother. 157(114080). Lopez, B., Ravassa, S., Moreno, M.U., Jose, G.S., Beaumont, J., Gonzalez, A., Diez, J., 2021. Diffuse myocardial fibrosis: mechanisms, diagnosis and therapeutic approaches. Nat Rev Cardiol. 18(7), 479-498. Masola, V., Gambaro, G., Onisto, M., 2020. Impact of Heparanse on Organ Fibrosis. Adv Exp Med Biol. 1221(669-684). Gong Tingxian. (Ming). Medical includes four hundred flavors. Niu, P., Tan, X., Zhou, X., Xu, X., Zhang, G., Peng, L., Bai, M., 2023. Novel polysaccharide identified from Cortinarius purpurascens demonstrated anti-fibrosis effects in cardiac fibroblasts. Food Bioscience. 56. Qian, J., Liang, S., Wang, Q., Xu, J., Huang, W., Wu, G., Liang, G., 2023. Toll-like receptor-2 in cardiomyocytes and macrophages mediates isoproterenol-induced cardiac inflammation and remodeling. FASEB J. 37(2), e22740. Sabe, S.A., Xu, C.M., Sabra, M., Harris, D.D., Malhotra, A., Aboulgheit, A., Stanley, M., Abid, M.R., Sellke, F.W., 2023. Canagliflozin Improves Myocardial Perfusion, Fibrosis, and Function in a Swine Model of Chronic Myocardial Ischemia. J Am Heart Assoc. 12(1), e028623. Su, Y.N., Lu, P.P., Yan, S.Y., Guo, X.T., Ma, J., Guo, C.X., Ma, L.H., 2023. Xinfuli granule alleviates metabolic remodeling through inhibition of endoplasmic reticulum stress and mitochondrial injury in heart failure. J Ethnopharmacol. 303(115782). Wang, S., Peng, Y., Zhuang, Y., Wang, N., Jin, J., Zhan, Z., 2023. Purification, Structural Analysis and Cardio-Protective Activity of Polysaccharides from Radix Astragali. Molecules. 28(10). Xia, M., Cui, X., Si, G., Peng, M., Li, W., 2022. To explore the mechanism of Zhigancao Decoction in the treatment of coronary heart disease based on "four in one". Chinese Journal of Experimental Prescriptions. 28 (01) : 218-225. Xie, J., Tu, T., Zhou, S., Liu, Q., 2017. Transforming growth factor (TGF)-beta1 signal pathway: A promising therapeutic target for attenuating cardiac fibrosis. Int J Cardiol. 239(9). Yang, J.S., Mu, T.H., Ma, M.M., 2018. Extraction, structure, and emulsifying properties of pectin from potato pulp. Food Chem. 244(197-205). Yang, Y., Ding, Z., Zhong, R., Xia, T., Wang, W., Zhao, H., Wang, Y., Shu, Z., 2020. Cardioprotective effects of a Fructus Aurantii polysaccharide in isoproterenol-induced myocardial ischemic rats. International Journal of Biological Macromolecules. 155(995-1002). Yasukawa, K., Yamanouchi, S., Takido, M., 1982. [Studies on the constituents in the water extracts in crude drugs. IV. On the roots of Stellaria dichotoma L. var lanceolata Bge. (2(2)) (author's transl)]. Yakugaku Zasshi. 102(3), 292-294. Yu, Q., Zhu, D., Zou, Y., Wang, K., Rao, P., Shen, Y., 2022. Catalpol Attenuates Pulmonary Fibrosis by Inhibiting Ang II/AT1 and TGF-beta/Smad-Mediated Epithelial Mesenchymal Transition. Front Med (Lausanne). 9(878601). Yue, Y., Meng, K., Pu, Y., Zhang, X., 2017. Transforming growth factor beta (TGF-beta) mediates cardiac fibrosis and induces diabetic cardiomyopathy. Diabetes Res Clin Pract. 133(124-130). Zhang, J.L., Du, C., Poon, C.C., He, M.C., Wong, M.S., Wang, N.N., Zhang, Y., 2023. Structural characterization and protective effect against renal fibrosis of polysaccharide from Ligustrum lucidum Ait. J Ethnopharmacol. 302(Pt A), 115898. Zhang, M., Lu, P., Zhao, F., Sun, X., Ma, W., Tang, J., Zhang, C., Ji, H., Wang, X., 2023. Uncovering the molecular mechanisms of Curcumae Rhizoma against myocardial fibrosis using network pharmacology and experimental validation. J Ethnopharmacol. 300(115751). Zhang, Y., Yuan, B., Xu, Y., Zhou, N., Zhang, R., Lu, L., Feng, Z., 2022. MiR-208b/miR-21 Promotes the Progression of Cardiac Fibrosis Through the Activation of the TGF-beta1/Smad-3 Signaling Pathway: An in vitro and in vivo Study. Front Cardiovasc Med. 9(924629). Zhou, X.L., Fang, Y.H., Wan, L., Xu, Q.R., Huang, H., Zhu, R.R., Wu, Q.C., Liu, J.C., 2019. Notch signaling inhibits cardiac fibroblast to myofibroblast transformation by antagonizing TGF-beta1/Smad3 signaling. J Cell Physiol. 234(6), 8834-8845. Zoppi, N., Chiarelli, N., Binetti, S., Ritelli, M., Colombi, M., 2018. Dermal fibroblast-to-myofibroblast transition sustained by alphavss3 integrin-ILK-Snail1/Slug signaling is a common feature for hypermobile Ehlers-Danlos syndrome and hypermobility spectrum disorders. Biochim Biophys Acta Mol Basis Dis. 1864(4 Pt A), 1010-1023. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 18 Nov, 2024 Reviews received at journal 05 Nov, 2024 Reviewers agreed at journal 29 Oct, 2024 Reviewers agreed at journal 28 Oct, 2024 Reviewers agreed at journal 28 Oct, 2024 Reviews received at journal 22 May, 2024 Reviewers agreed at journal 22 May, 2024 Reviewers agreed at journal 21 May, 2024 Reviewers invited by journal 20 May, 2024 Editor assigned by journal 15 Apr, 2024 Submission checks completed at journal 12 Apr, 2024 First submitted to journal 07 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4230329","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":291405909,"identity":"d164b64b-8e15-4983-9eb2-d5664d2d61ea","order_by":0,"name":"Hong Wang","email":"","orcid":"","institution":"Ningxia Normal University","correspondingAuthor":false,"prefix":"","firstName":"Hong","middleName":"","lastName":"Wang","suffix":""},{"id":291405910,"identity":"6f7d24a6-a5a6-42a4-86b0-da09c5f2c93d","order_by":1,"name":"Pilian Niu","email":"","orcid":"","institution":"Ningxia University","correspondingAuthor":false,"prefix":"","firstName":"Pilian","middleName":"","lastName":"Niu","suffix":""},{"id":291405911,"identity":"23dae491-765c-4c76-a117-69b946a86599","order_by":2,"name":"Haishan Li","email":"","orcid":"","institution":"Ningxia University","correspondingAuthor":false,"prefix":"","firstName":"Haishan","middleName":"","lastName":"Li","suffix":""},{"id":291405912,"identity":"8394a17c-bec1-45f8-8111-67d4bb209518","order_by":3,"name":"Lu Feng","email":"","orcid":"","institution":"Ningxia University","correspondingAuthor":false,"prefix":"","firstName":"Lu","middleName":"","lastName":"Feng","suffix":""},{"id":291405913,"identity":"9af050ed-d259-470e-aa92-946155a204f9","order_by":4,"name":"Zhenkai Li","email":"","orcid":"","institution":"Ningxia University","correspondingAuthor":false,"prefix":"","firstName":"Zhenkai","middleName":"","lastName":"Li","suffix":""},{"id":291405914,"identity":"a0065c3b-a1f0-420a-bb97-caf3747b73bd","order_by":5,"name":"Mingsheng Bai","email":"","orcid":"","institution":"Ningxia University","correspondingAuthor":false,"prefix":"","firstName":"Mingsheng","middleName":"","lastName":"Bai","suffix":""},{"id":291405915,"identity":"77a5bf5c-5d0d-4d4f-ab19-81320741d53c","order_by":6,"name":"Li Peng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIiWNgGAWjYLCCBwYSPPwMhw9AeAeI0ZJgYCEj2XgsgRQtDBU2BofPGBCnxZy99/CLhAIJHoZjZ7495m1jkOO7kcD4uQCPFsuec2kWCUC/MPac3W44s43BWPJGArP0DDxaDG7kmBmAtDBLnN0m8bGNIXHDjQQ2Zh58Wu6/gWhhk3/zTCKxjaGesJYbPMYPQFp4GM6wgWxJMCCkxbInx4wBpEWC4ZiZ5IxzEoYzzzxslsanxZz9jPGHD3/q7O0PHH4mzVNmI893PPngZ7wOY2Bgk0Dig9iMDXg0gLUwf8CrYhSMglEwCkYBANa8SoL4vkoaAAAAAElFTkSuQmCC","orcid":"","institution":"Ningxia University","correspondingAuthor":true,"prefix":"","firstName":"Li","middleName":"","lastName":"Peng","suffix":""}],"badges":[],"createdAt":"2024-04-07 08:14:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4230329/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4230329/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54838061,"identity":"7cca594c-9e0a-45a0-b899-f89816bfde3c","added_by":"auto","created_at":"2024-04-17 13:09:35","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":17572,"visible":true,"origin":"","legend":"\u003cp\u003eEluting curve of the crude SRP purified on the DEAE-52 cellulose column.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4230329/v1/b2f9466a4b12b6ebfa5fc8fd.png"},{"id":54838492,"identity":"8d6bed2b-3dd6-4951-a92a-553708cf52b1","added_by":"auto","created_at":"2024-04-17 13:17:35","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":34561,"visible":true,"origin":"","legend":"\u003cp\u003estandard sample ion chromatogram (Fig.2A) and ion chromatogram (Fig.2B) of SRP-1\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4230329/v1/07ea43b896efc322bf5dcbd4.png"},{"id":54838064,"identity":"9fcb4fad-820e-492e-9c7c-ff1dd21cf0b4","added_by":"auto","created_at":"2024-04-17 13:09:35","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":28859,"visible":true,"origin":"","legend":"\u003cp\u003eFT-IR spectra of SRP-1\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4230329/v1/5b614647a82c02a90aa6fefa.png"},{"id":54838063,"identity":"286a472a-97a0-49a2-8d13-811eeb0f9aed","added_by":"auto","created_at":"2024-04-17 13:09:35","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":9945,"visible":true,"origin":"","legend":"\u003cp\u003eSRP-1 effect on CFs proliferation induced by TGF-β1. Data are expressed as 6 independent experiments mean ±SD. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003e p\u003c/em\u003e \u0026lt; 0.05 vs. TGF-β1, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003e p\u003c/em\u003e \u0026lt; 0.01 vs. TGF-β1.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4230329/v1/29670460440dfaf9bf486440.png"},{"id":54838491,"identity":"bf385b9f-e9e0-4aa6-9dbc-75750a887916","added_by":"auto","created_at":"2024-04-17 13:17:35","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":14783,"visible":true,"origin":"","legend":"\u003cp\u003eELISA was used to detect Col I(A) and III (B) levels in the cell supernate. (n = 3). Data are expressed as mean ±SEM. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003e p\u003c/em\u003e \u0026lt; 0.05 vs. TGF-β1, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003e p\u003c/em\u003e \u0026lt; 0.01 vs. TGF-β1.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4230329/v1/f047431d61d2a2c96cf2811a.png"},{"id":54838066,"identity":"93b915fe-96d2-42a7-9137-a8d9160492fb","added_by":"auto","created_at":"2024-04-17 13:09:36","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":28875,"visible":true,"origin":"","legend":"\u003cp\u003eWestern blotting of the α-SMA protein expressions (A, B). Bar graphs showing the fold changes of α-SMA/β-actin (E) (n = 3). Data are expressed as the mean ±SEM. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003e p\u003c/em\u003e \u0026lt; 0.05 vs. TGF-β1, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003e p\u003c/em\u003e \u0026lt; 0.01 vs. TGF-β1.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4230329/v1/de2f68b143a1bdfa06105fdf.png"},{"id":54838067,"identity":"66d907aa-cd30-4d35-9c5d-c6464014ed4f","added_by":"auto","created_at":"2024-04-17 13:09:36","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":32145,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of SRP-1 on the expression of \u003cem\u003eSnai1\u003c/em\u003e, \u003cem\u003eSnail2\u003c/em\u003e, \u003cem\u003eSlug\u003c/em\u003e, \u003cem\u003eTwist1\u003c/em\u003e, \u003cem\u003eActa 2\u003c/em\u003e, \u003cem\u003eSmad4\u003c/em\u003e and \u003cem\u003eS100A4\u003c/em\u003e mRNA in cardiac fibroblasts (n=3). Data are expressed as the mean±SEM. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003e p\u003c/em\u003e \u0026lt; 0.05 vs. TGF-β1, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003e p\u003c/em\u003e \u0026lt; 0.01 vs. TGF-β1.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4230329/v1/c6184721e3b59295caaecc7b.png"},{"id":54838493,"identity":"eff9ede0-aee0-42cf-84fe-d0b5c54ca69b","added_by":"auto","created_at":"2024-04-17 13:17:36","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":63304,"visible":true,"origin":"","legend":"\u003cp\u003eWestern blotting of SRP-1 regulating the Smad protein expression and phosphorylated Smad 2, 3, 4 and P-Smad2, 3 expression (A-F). Data are expressed as the mean ±SEM. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 vs. TGF-β1, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 vs. TGF-β1.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-4230329/v1/130cf47b1d29eff305b0582f.png"},{"id":54838967,"identity":"cb1ca655-a0d0-428c-b021-79cc82ad7003","added_by":"auto","created_at":"2024-04-17 13:25:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":593857,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4230329/v1/8f80180c-9c3f-4849-b228-9a40151f0355.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Structural characterization and protective effect against myocardial fibrosis of polysaccharide from Stellariae Radix (Stellaria dichotoma L. var. lanceolata Bge.)","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eThere is a pathological course in the process of cardiovascular disease called myocardial fibrosis, which is characterized by the imbalance between the abnormal proliferation of cardiac fibroblasts (CFs) and excessive extracellular matrix (ECM) synthesis and degradation(Lopez et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e,Zhang et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Transforming growth factor-β1 (TGF-β1) not only could promote cell fibrosis, but also has been proved to induce CFs to differentiate into myofibroblasts and ECM deposition༈Liu et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2023\u003c/span\u003e,Yue et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e༉. TGF-β1/Smad signal path plays a vital part in myocardial fibrosis.TGF-β1 induces myocardial fibrosis through the TGF-β/Smad signal path, which can induce Smad 2, 3, and 4 expression༈Yu et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2022\u003c/span\u003e,Zhang et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2022\u003c/span\u003e༉.\u003c/p\u003e \u003cp\u003eAccording to traditional Chinese medicine (TCM), the pathogenesis of cardiovascular disease (CVD) is mainly due to various causes of malaise, and CVD-related deficiency syndrome is manifested as qi deficiency and yin deficiency, while CVD-related excess syndrome is mainly qi stagnation, blood stasis, and fire heat( Xia et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Stellariae Radix is a root medicine commonly used in Chinese traditional medicine. Traditional uses include treating fever and malnutrition༈Committee \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2020\u003c/span\u003e༉. As early as in the Ming Dynasty, Gong Tingxian mentioned in the four hundred herbs in the medicinal song: Stellariae Radix was cold, and it could clear deficient heat, in addition, it could cool blood and is good at treating bone steaming༈Ming Gong Tingxian and Note, 2006༉. More and more evidence show that Stellariae Radix is one of the traditional Chinese medicine prescriptions for the treatment of CVD༈Li et al., 2021༉.In recent years, a large number of plant polysaccharides with pharmacological activities and different characteristics have been found from traditional Chinese medicine. Polysaccharides extracted from plants have been foundto have anti-cardiovascular disease effects༈Jia et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2020\u003c/span\u003e༉. For example, Wang showed that Astragalus polysaccharide had significant antioxidant activity and cardioprotectiveeffects༈Wang et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2023\u003c/span\u003e༉. Additionally, Yang found that polysaccharides from Fructus aurantii could inhibit apoptosis and effectively prevent myocardial injury induced by ISO༈Yang et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e༉. As a traditional Chinese medicine, Stellariae Radix has been extensively studied for its active components and pharmacological effects ༈Li et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e,Yasukawa et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e1982\u003c/span\u003e༉, but so far there have been no reports related to the extraction, structural identification and effects on Cardiovascular disease of polysaccharides from Stellariae Radix(SRP).\u003c/p\u003e \u003cp\u003eIn this study, we aimed to identify the cardioprotective effect of SRP, and explored the potential molecular mechanism of SRP on TGF-β1-induced myocardial fibrosis injury in vitro, mainly TGF-β/Smadsignaling pathway signal transduction pathway.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cp\u003e2.1 Drugs and agentia\u003c/p\u003e\n\u003cp\u003eThe 3-4-year-old artificial cultivated Stellariae Radix, was collected from the standardized planting base of B. chinese in Tongxin County, Ningxia. It was identified as the dried root of Stellariae Radix. by Prof. Peng Li from College of Biological Sciences, Ningxia University.\u0026nbsp;A voucher specimen (no. 2019-1125).\u003c/p\u003e\n\u003cp\u003eAbsolute ethanol and chloroform were purchased from Nanjing Reagent.\u0026nbsp;DEAE-52 (C8350) and Sepharose Fast Flow (S8801) were purchased from Solarbio Biotechnology (Beijing, China). fetal calf serum (FBS，10099141C，Gibco), Cell Counting Kit (SC119, SEVEN, Beijing, China), anti-\u0026alpha;-Smooth muscle actin (19245, Cell Signaling Technology, Danvers, MA, USA), Smad2/3 (AF6367, Affinity, Changzhou, China), p-Smad2 (AF3449, Affinity, Changzhou, China), Smad4 (AF5247, Affinity, Changzhou, China), p-Smad3 (AF3362, Affinity, Changzhou, China). Goat anti-rabbit IgG (61-9520, Proteintech, Wuhan, China). TGF-\u0026beta;1 (HZ-1011, Proteintech, Wuhan, China).\u0026nbsp;Col Ⅰ ELISA scientificresearch Kit (MM-45905M1, Jiangsu Meimian Industrial Co., Ltd).\u003c/p\u003e\n\u003cp\u003e2.2 Technological process of extracting SRP-1\u003c/p\u003e\n\u003cp\u003eThe Stellariae Radix was pulverized, sieved (40-mesh) and defatted by critical CO\u003csub\u003e2\u003c/sub\u003e extraction, and extracted twice at the ratio of 1:20 (g/mL) at 45℃\u0026nbsp;for three hours. Filtered extracts were concentrated, and they were precipitated by 80% (v/v) ethyl alcohol, then their protein were removed by Sevag reagent (The volume ratio of chloroform to butanol was 4∶1). Next, the extracts were freeze-dried, and components were separated (we used the DEAE-Cellulose DE52(2.6 cm\u0026times;40 cm) column in this process). And then eluted gradually with distilled water and NaCl solutions (0.1 mol/L, 0.3 mol/L and 0.5 mol/L) at 1.0 mL/min rate. The neutral polysaccharide SRP-1 was obtained, and the carbohydrate content was measured with the way of phenol-sulfuric acid. The regression equation is a 482 nm= 0.6938x-0.0193, and R\u0026sup2;= 0.9949. (x: carbohydrate content; A482 nm: absorbance at 482 nm).\u003c/p\u003e\n\u003cp\u003e2.3 Physical and chemical properties analyses\u003c/p\u003e\n\u003cp\u003e2.3.1 Determination of monosaccharide composition\u003c/p\u003e\n\u003cp\u003eFirst, the monosaccharide composition of SRP-1 was evaluated by ion chromatography. In brief, take monosaccharide standard in Table 1 and an SRP-1 specimen (5 mg) was hydrolyzed by TFA (3 mol/L) at 121 ℃ for 2 h. Then, the residue was dried and dissolved with sterile water, after which the supernatant was assessed with an ICS 5000 system equipped with an electrochemical detector (Thermo Fisher Scientific, USA) and a Dionex Carbo Opac Pa20 (150\u0026times;3.0 mm, 10 \u0026mu;m) liquid chromatography column. Other features included a sample volume of 5 \u0026mu;L, column temperature of 30℃, and mobile phase A of 0.1 M NaOH and mobile phase B of 0.1 M NaOH and 0.2 M NaAc.\u003c/p\u003e\n\u003cp\u003eTab. 1 Different monosaccharide standards\u003c/p\u003e\n\u003cdiv align=\"Left\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"572\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.832167832167833%\"\u003e\n \u003cp\u003enumber\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003eMonosaccharide standard\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.125874125874127%\"\u003e\n \u003cp\u003enumber\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003eMonosaccharide standard\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.832167832167833%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003eGal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.125874125874127%\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003eMan\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.832167832167833%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003eGlu\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.125874125874127%\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003eRib\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.832167832167833%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003eFuc\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.125874125874127%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003eMan-UA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.832167832167833%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003eFru\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.125874125874127%\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003eGlc-UA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.832167832167833%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003eRha\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.125874125874127%\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003eGul-UA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.832167832167833%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003eAra\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.125874125874127%\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003eGal-UA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.832167832167833%\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003eXyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.125874125874127%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.02097902097902%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e2.3.2 Molecular weight determination\u003c/p\u003e\n\u003cp\u003eSRP molecular weight determination was performed usinga high performance gel permeation chromatograph.\u0026nbsp;SRP was dissolve in 0.1 M NaNO\u003csub\u003e3\u003c/sub\u003e aqueous solution to afinal concentration of 1 mg/mL, Analysis after filtration of the aqueous phase filterwith a 0.22 \u0026mu;m.\u003c/p\u003e\n\u003cp\u003e2.3.3 Fourier-transformed infrared spectroscopy (FT-IR) analysis\u003c/p\u003e\n\u003cp\u003eThe 2mg sample was accurately weighed, and the potassium bromide powder was added at a ratio of 1:100 to mix and grind in agate mortar, which was pressed by tablet machine for 20 s and placed in the sample room for test. Then OPUS was used to scan infrared spectrum with 4000-450 cm\u003csup\u003e-1\u003c/sup\u003e wave number range.\u003c/p\u003e\n\u003cp\u003e2.3.4 Determination of specific rotation\u003c/p\u003e\n\u003cp\u003eSRP-1 was weighed and prepared moderately for configuration 2 mg/mL solution for test, which was determined specific rotation by automatic polarimeter at 20 ℃, where sodium lamp was used as light source, and distilled water was used to zero the instrument.\u003c/p\u003e\n\u003cp\u003e2.4 CFs Culture and Cell Analysis\u003c/p\u003e\n\u003cp\u003e2.4.1 Cell culture and model establishment\u003c/p\u003e\n\u003cp\u003eCell rowth contain 10% FBS and 1% double antibodies, and CFs were digested with 0.25 % trypsin when they grew to about 90% of the medium, subcultured or subsequent test. And the experiment was divided into control group and modelgroup (48 h TGF-\u0026beta;1). The specific experiment was performed as reported elsewhere（Niu et al., 2023）.\u003c/p\u003e\n\u003cp\u003e2.4.3 CCK-8 Assay\u003c/p\u003e\n\u003cp\u003eCFs were plated into a 96 well plate (1\u0026times;10\u003csup\u003e4\u0026nbsp;\u003c/sup\u003e/mL) and culture for twelve hours, then cultured in groups for 48 h. Add 10 \u0026mu;L CCK-8 per well, and a duration of 3 h.\u0026nbsp;Absorbance was measured at 450 nm and the resulting data was recorded. There were 6 replicates in each experiment.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.4.4 ELISA\u003c/p\u003e\n\u003cp\u003eAfter the CFs are cultured in groups (control (cells), TGF-\u0026beta;1 (10 ng/mL), SRP-1 (10 ng/mL TGF-\u0026beta;1+50 \u0026mu;g/mL)),\u0026nbsp;Centrifuge, carrying out each step of operation accordto that instruction of the kit. Absorbance was measured at 450 nm and the resulting data was recorded. There were 6 replicates in each experiment.\u003c/p\u003e\n\u003cp\u003e2.4.5 Real-time quantitative PCR analysis\u003c/p\u003e\n\u003cp\u003eAfter the CFs are cultured in groups, wash 2-3 times with PBS, add Trizol（Ambion，Austin，TX，USA）reagent for lysis, and extract Total RNA. RNA concentrations were measured using a Nanodrop 8000 Nucleic Acid Protein Analyzer. And\u0026nbsp;the primers used are shown in Tab. 2.\u0026nbsp;The subsequent experimental steps were carried outaccording to others\u0026apos; reports（Jia et al., 2021）.\u003c/p\u003e\n\u003cp\u003eTab. 2 RT-qPCR primer\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"567\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.396825396825395%\" valign=\"top\"\u003e\n \u003cp\u003eGene\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.60317460317461%\" valign=\"top\"\u003e\n \u003cp\u003eSequence of primers (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.396825396825395%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eTwist 1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.60317460317461%\" valign=\"top\"\u003e\n \u003cp\u003eF：\u0026nbsp;CAGCGGGTCATGGCTAACG\u003c/p\u003e\n \u003cp\u003eR：\u0026nbsp;AGGACCTGGTACAGGAAGTCGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.396825396825395%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eSnail 1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.60317460317461%\" valign=\"top\"\u003e\n \u003cp\u003eF：\u0026nbsp;GGGCTCTGAAGATGCACAT\u003c/p\u003e\n \u003cp\u003eR：\u0026nbsp;TGGCTTCTCACCAGTGTGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.396825396825395%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eSnail 2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.60317460317461%\" valign=\"top\"\u003e\n \u003cp\u003eF：\u0026nbsp;CGCCTCCAAGAAGCCCAA\u003c/p\u003e\n \u003cp\u003eR：\u0026nbsp;CTGGGTAAAGGAGAGTGGAGTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.396825396825395%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eActa 2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.60317460317461%\" valign=\"top\"\u003e\n \u003cp\u003eF：\u0026nbsp;ATGACCCAGATTATGTTTGAGACCT\u003c/p\u003e\n \u003cp\u003eR \u0026nbsp; TCCAGAGTCCAGCACAATACCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.396825396825395%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eS100A4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.60317460317461%\" valign=\"top\"\u003e\n \u003cp\u003eF：\u0026nbsp;CAAATACTCAGGCAAAGAGGGTG\u003c/p\u003e\n \u003cp\u003eR：\u0026nbsp;GGCAATGCAGGACAGGAAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.396825396825395%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.60317460317461%\" valign=\"top\"\u003e\n \u003cp\u003eF：\u0026nbsp;AGAGTGTTTCCTCGTCCCGTAG\u003c/p\u003e\n \u003cp\u003eR：\u0026nbsp;CTTGACTGTGCCGTTGAATTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e2.4.6 Western Blotting\u003c/p\u003e\n\u003cp\u003eThe experimental cells were divided into three treatment groups: control (cells), TGF-\u0026beta;1 (10 ng/mL), SRP-1 (10 ng/mL TGF-\u0026beta;1 + 50 \u0026mu;g/mL). Each group was repeated 3 times. Protein extraction kit was used. Total protein was extracted and quantitatively analyzed by BCA method. Proteins were separated by electrophoresis with 8%-12% SDS-PAGE and transferred to nitrocellulose membrane. The cells were blocked with 5% skimmed milk powder at room temperature for 1 h, washed with TBST for 3 times, and then incubated with the corresponding antibody (Note: the antibody dilution ratio is 1:1500), and incubated overnight at 4 \u0026deg;C. On the second day, the primary antibody was recovered, and the nitrocellulose membrane was treated with the secondary antibody (anti-rabbit or anti-mouse, 1:10000) at room temperature for 1 hour, and washed three times with TBST. Luminescent solution A and B were mixed in equal volume, and ECL chemiluminescence solution was used to develop in the chemiluminescence imager. Finally, the grey values of protein bands were analysed with Image J.\u003c/p\u003e\n\u003cp\u003e2.5\u0026nbsp;Statistical analyses\u003c/p\u003e\n\u003cp\u003eAll data were obtained after at least three independent experiments. One-way analysis of variance in GraphPad Prism 8.0.2 software was used for statistical analysis, and t-test was used for statistical evaluation of differencesbetween the two groups. A value of \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 was considered statistically significant. Data are presented as mean \u0026plusmn; standard deviation (SD).\u003c/p\u003e"},{"header":"3. Results and Discussion","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.1 SRP Isolation and purification\u003c/h2\u003e \u003cp\u003eThe crude polysaccharide from Stellariae Radix was purified by DEAE-52 column chromatography, according to the elution profile (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The neutral polysaccharide component SRP-I and the acidic polysaccharide component SRP-2 were eluted from the polysaccharides of Stellariae Radix by distilled water and 0.1 mol/L NaCl, respectively. Due to little content of SRP-2, SRP-1 eluted with distilled water was mainly collected in subsequent trials.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Characterization of SRP-1\u003c/h2\u003e \u003cdiv id=\"Sec20\" class=\"Section3\"\u003e \u003ch2\u003e3.2.1 Preliminary characterization of SRP-1\u003c/h2\u003e \u003cp\u003eThe ion chromatograms of SRP-1 derivatives were compared with the mixed standard monosaccharides (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003e), and it was found that SRP-1 was mainly composed of galactose, glucose, xylose, fructose, mannose and rhamnose, in addition, the proportion of each component was 61.86%, 32.51%, 4.77%, 0.39%, 0.28%, 0.19% respectively.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section3\"\u003e \u003ch2\u003e3.2.2 Molecular weight of SRP-1\u003c/h2\u003e \u003cp\u003eAs illustrated in the Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, SRP-1 molecular weight (Mw) was 31309 Da, and Mw/Mn was larger, then the monosaccharide composition analysis result was referenced, suggesting SRP-1 was mainly made up of high degree of polymerization of neutral polysaccharide fragments.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSRP-1 Molecular Parameter Information\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMolecular Parameter\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eParameter\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMolecular Weight\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMolecular Weight (Da)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMn\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e14040\u0026thinsp;\u0026plusmn;\u0026thinsp;0.131\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e31309\u0026thinsp;\u0026plusmn;\u0026thinsp;0.091\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePolydispersity\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMw/Mn\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e2.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eMw: molecular weight. Mn: molecular weight. Mean values\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (n\u0026thinsp;=\u0026thinsp;3).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section3\"\u003e \u003ch2\u003e3.2.3 FT-IR spectrum of SRP-1\u003c/h2\u003e \u003cp\u003eThe Fourier transform infrared spectroscopy(FTIR) of the SRP-1 were as follows : first, 3290 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e was the strong and wide absorption peak of the hydrogen bond O-H stretching vibration of the intermolecular or intramolecular of the SRP-1(Yang et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), and 2930 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e was absorption peak of the C-H stretching vibration in CH\u003csub\u003e2\u003c/sub\u003e, so, in general, polysaccharides would show similar absorption peaks in the above two places.Next, 1632 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e was the absorption peak formed by the C\u0026thinsp;=\u0026thinsp;O stretching vibration, and 1412 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e was the absorption peak of the deformation vibration of the C-H, moreover, 800\u0026ndash;1300 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e was called ' fingerprint region ' of the FTIR of SRP-1, where absorption peak was dense and highly overlapped, and it was related to the types of sugar residue and on-link mode mostly. In addition, 1400\u0026thinsp;~\u0026thinsp;1200 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e was characteristic absorption of the sugar ring that constituted by C-H angular vibration and stretching vibration. Then absorption peak at 1139 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e was pyranoid ring, indicating that the sugar ring configuration was pyran type. At last, the absorption peak where it was 870 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e suggested SRP-1 had a β-configuration glycosidic bond, however, the absorption peak at 830 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e manifested it was an α-configuration glycosidic bond. In summary, it was shown there were pyranoid ring, α and β-configuration glycosidic bonds in SRP-1.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Determination of the optimum concentration of SRP-1 in CFs\u003c/h2\u003e \u003cp\u003eDifferent concentrations of SRP-1 was used to examine their impact on the viability of CFs. CFs were stimulated by TGF-β1 (10 ng/mL), and then dealt with 25 \u0026micro;g/mL, 50 \u0026micro;g/mL, 100 \u0026micro;g/mL, and 200 \u0026micro;g/mL of SRP-1 respectively for 48 hours. Next, proliferation of CFs in the TGF-β1 group exceeded obviously that cells where they were in the control group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). When the CFs were dealt with SRP-1, it was found that polysaccharide concentrations of 50 \u0026micro;g/mL and 200 \u0026micro;g/mL can effectively restrain CFs proliferation (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). However, due to the greater cytotoxicity of 200 ug/mL, the concentration of SRP-1 was determined to be 50 ug/mL as the optimal concentration, and the concentration was used to succedent experiments.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Effect of SRP-1 on the Expression of Col I and Col III Proteins\u003c/h2\u003e \u003cp\u003eTo investigate SRP-1 effect on the expression of Col I and III protein which were induced by TGF-β1, ELISA was used to detect Col I and III protein expression. And it was found compared with control group, the content of Col I and III protein increased obviously when they were induced by TGF-β1 (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), however, protein content decreased obviously after SRP-1 intervention (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e \u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003e ELISA was used to detect Col I(A) and III (B) levels in the cell supernate. (n\u0026thinsp;=\u0026thinsp;3). Data are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. \u003csup\u003e**\u003c/sup\u003e \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 vs. TGF-β1, \u003csup\u003e***\u003c/sup\u003e \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs. TGF-β1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e3.6 SRP-1 effect on the Expression of α-SMA Protein\u003c/h2\u003e \u003cp\u003eSRP-1 effect on α-SMA expression in CFs was determined by Western blotting. After induction with TGF-β, α-SMA expression increased distinctly (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). But, compared with TGF-β1 group, its expression in the SRP-1 group was significantly decreased (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003e3.7 Effect of SRP-1 on the Expression of Fibrosis-related Transcription Factor\u003c/h2\u003e \u003cp\u003eSRP-1 effect on fibrosis-related transcription factors in CFs was measured by RT-qPCR. The relative mRNA expression of \u003cem\u003eSnail 1\u003c/em\u003e, \u003cem\u003eSnail 2\u003c/em\u003e, \u003cem\u003eSlug\u003c/em\u003e, \u003cem\u003eTwist 1\u003c/em\u003e, \u003cem\u003eActa 2\u003c/em\u003e, and \u003cem\u003eS100A4\u003c/em\u003e significantly increased upon 48 h of TGF-β1 exposure (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Upon 48 h of SRP-1 exposure, the mRNA expression levels of \u003cem\u003eSnail1\u003c/em\u003e, \u003cem\u003eSnail2\u003c/em\u003e, \u003cem\u003eTwist1\u003c/em\u003e, \u003cem\u003eActa2\u003c/em\u003e, \u003cem\u003eSmad4\u003c/em\u003e and fibrosis protein \u003cem\u003eS100A4\u003c/em\u003e were significantly down-regulated (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section2\"\u003e \u003ch2\u003e3.8 SRP-1 altered TGF-β/Smad signal path in CFs\u003c/h2\u003e \u003cp\u003eThe levels of TGF-β/Smad signal path-related proteins in CFs were detected by Western blotting to determine whether SRP-1 could alleviate myocardial fibrosis-induced damage by altering TGF-β/Smad signal path. And expression of Smad2/3, Smad4 (Figs.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e8\u003c/span\u003eA, B, C), P-Smad2, P-Smad3 (Figs.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e8\u003c/span\u003eD, E, F) proteins in the TGF-β1 group increased obviously (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) compared to control group, however, expression of SRP-1 on related proteins was significantly down-regulated (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eCardiac fibrosis is considered to be an aggravating factor for a variety of CVDs, including hypertension, heart disease, and arrhythmia (Hinderer and Schenke-Layland \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2019\u003c/span\u003e,Su et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). At present, the use of conventional treatment can alleviate some clinical symptoms of myocardial fibrosis, but owing to its complex pathogenesis, there is still a lack of drugs to effectively reverse myocardial fibrosis༈Qian et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2023\u003c/span\u003e༉. Therefore, the effective prevention of myocardial fibrosis is key to the treatment of many CVDs ༈Masola et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e,Sabe et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e༉. Substantial research has suggested that plant polysaccharides have anti-fibrotic activity ༈Li et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2019\u003c/span\u003e,Zhang et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2023\u003c/span\u003e༉. Against this background, this research was established to separate and identify polysaccharides from Stellariae Radix and then explore their mechanism of action on myocardial fibrosis.\u003c/p\u003e \u003cp\u003ePolysaccharide is a kind of biological macromolecule with complex structure. Its structural characteristics such as molecular weight, monosaccharide composition and glycosyl order will affect its biological activity (Yang et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Zhou (Zhou et al.,2020) isolated and purified Cordyceps sinensis polysaccharide (OLP) to obtain a homogeneous polysaccharide with a molecular weight of 3.2\u0026times;105 Da, mainly composed of galactose, glucose and mannose, and found that (OLP) could reduce the occurrence of pulmonary fibrosis by inhibiting the synthesis of collagen and α-SMA protein and protecting alveolarfunction. Liu (Liu et al.,2019) Found that Bupleurum polysaccharide (BPS), mainly composed of Ara, Gal, Glc, Rha, Man and Xyl, alleviated renal fibrosis in mice by inhibiting the expression of type IV collagen (Col IV), fibronectin (FN) and α-smooth muscle actin (α-SMA). The results showed that the polysaccharide was composed of galactose, glucose, xylose, fructose, mannose and rhamnose. The molecular weight of polysaccharide was 31309 Da, and it was a pyranose with α-glycosidic bondand β-glycosidic bond. Stellaria dichotoma polysaccharide does not contain uronic acid, has a small molecular weight, and has a large proportion of galactose and glucose. Therefore, it is speculated that starwortpolysaccharide has anti-fibrosis effect.\u003c/p\u003e \u003cp\u003eThe Chinese medicine Stellariae Radix can be used to dispel infantile malnutrition heat and treat bone steaming tuberculosis via a heat effect (Yasukawa et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e1982\u003c/span\u003e). With the intensification of modern medical research, the anti-inflammatory, anti-allergic, and anti-cancer effects of Stellariae Radix have been discovered, and its medicinal value has continuously expanded. As an authentic Chinese herb, Stellariae Radix has been widely reported on because of its active ingredients and pharmacological effects༈Bae et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e,Li et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e,Li et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e༉. In this research, SRP-1 was isolated and purified in various ways, such as water extraction, ethanol precipitation, deproteinization, and column chromatography. Then, high-performance gel permeation chromatography was performed to measure the molecular weight of treated polysaccharides. In addition, ion chromatographic analysis was performed and suggested that SRP-1\u0026rsquo;s main monosaccharide components were Gal, Glu, and Xyl. We then determined the anti-fibrotic effect of SRP-1 in cardiomyocytes through in vitro experiments.\u003c/p\u003e \u003cp\u003eIn our study, used TGF-β1 established cell model of myocardial fibrosis. Our data show that SRP-1 can inhibited CFs proliferation, it significantly inhibited the production of Col 1, Col 2 and α-SMA proteins in CFs cells, thereby inhibiting the formation of extracellular matrix. Myocardial fibrosis is mediated by multiple signalingpathways and transcriptional regulators(Li et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e,Xie et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e,Zoppi et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Therefore, we detected the transcriptional regulators of myocardial fibrosis and found that SRP-1 could inhibit the mRNA expression of \u003cem\u003eSnail 1\u003c/em\u003e, \u003cem\u003eSnail 2\u003c/em\u003e, \u003cem\u003eSlug\u003c/em\u003e, \u003cem\u003eTwist 1\u003c/em\u003e and \u003cem\u003eS100A4\u003c/em\u003e in CFs after TGF-β1 treatment. These results together indicate that SRP-1 can improve TGF-β-induced myocardial fibrosis.\u003c/p\u003e \u003cp\u003eThere is abundant evidence that, TGF-β/Smad signaling pathway plays an important rolein organ fibrosis.(Li et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2019\u003c/span\u003e,Zhou et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Research shows that TGF-β-induced Smad3 phosphorylation led to resulting in the production of collagen, when the expression of Smad3 in cardiac fibroblastsdecreased, Cardiac fibrosis and ECM protein deposition were alsoreduced ༈Feng et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e,Khalil et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2017\u003c/span\u003e,Ku et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e༉. Research has also shown that jatrorrhizine could reduce the apoptosis of myocardial cells and cell fibrosis by restraining p53/Bax/Bcl-2 and TGF-β1/Smad2/3 signaling pathways ༈Hao and Jiao \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e༉. It has also been shown that pirfenidone reduces myocardial fibrosis and dysfunction induced by pressure overload by restraining activation of the TGF-β1/Smad3 signaling pathway ༈Li et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e༉. Our study showed that SRP-1 reduced TGF-β1-induced upregulation of proteins involved in the TGF-β/Smad signaling pathway, indicating that SRP-1 can effectively alleviate TGF-β1-induced myocardial fibrosis.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eIn summary, a heteropolysaccharide mainly composed of Gal, Glu and Xyl was found in this study. Pharmacological studies showed that it had a protective effect on TGF-\u0026beta;1-induced myocardial fibrosis by interfering with the TGF-\u0026beta;/Smad signal path. As a new drug or natural supplement, SRP-1 heteropolysaccharide provides a new strategy and experimental theory for clinical treatment of myocardial fibrosis.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eCFs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eCardiac fibroblasts\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eSDL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eStellaria dichotoma\u003c/em\u003e L. var. lanceolata Bge.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eTGF-\u0026beta;1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eTransforming growth factor-\u0026beta;1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003ep-Smad2/3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003ePhosphorylated-Smad2/3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eCol I\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eCollagen I\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHong Wang: Conceptualization, Methodology, Visualization, Writing\u0026ndash;original draft, Investigation, Formal analysis, Writing \u0026ndash; review \u0026amp; editing.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePilian Niu: Visualization, Formal analysis, Methodology, Formal analysis, Data curation, Writing \u0026ndash; original draft.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHaishan Li: Data interpretation and manuscript revision.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLu Feng: Performed the study and analyzed the results.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eZhenkai Li and Mingsheng Bai: Conceptualization and data interpretation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLi Peng: Designed the study, contributed to the concept generation, and wrote and revised the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003enot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Key Research and Development Program of Ningxia (No. 2021BEG02042) and grants from the National Natural Science Foundation of China (31860583).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eBae, S.J., Choi, J.W., Park, B.J., Lee, J., Jo, E.K., Lee, Y.H., Kim, S.B., Yuk, J.M., 2018. Protective effects of a traditional herbal extract from Stellaria dichotoma var. lanceolata against Mycobacterium abscessus infections. PLoS One. 13(11), e0207696.\u003c/li\u003e\n \u003cli\u003eCommittee, N.P.,(2020).National Pharmacopoeia Committee. Chinese Pharmacopoeia; 2020 ed.Published.: China Pharmaceutical Science and Technology Press.\u003c/li\u003e\n \u003cli\u003eFeng, Y., Bao, Y., Ding, J., Li, H., Liu, W., Wang, X., Guan, H., Chen, Z., 2022. MicroRNA-130a attenuates cardiac fibrosis after myocardial infarction through TGF-beta/Smad signaling by directly targeting TGF-beta receptor 1. Bioengineered. 13(3), 5779-5791.\u003c/li\u003e\n \u003cli\u003eHao, M., Jiao, K., 2022. Jatrorrhizine reduces myocardial infarction-induced apoptosis and fibrosis through inhibiting p53 and TGF-beta1/Smad2/3 pathways in mice. Acta Cir Bras. 37(7), e370705.\u003c/li\u003e\n \u003cli\u003eHinderer, S., Schenke-Layland, K., 2019. Cardiac fibrosis - A short review of causes and therapeutic strategies. Adv Drug Deliv Rev. 146(77-82).\u003c/li\u003e\n \u003cli\u003eJia, F., Zhang, X., Ma, W., Li, X., Zhou, X., 2021. Cytotoxicity and anti-inflammatory effect of a novel diminazene aceturate derivative in bovine mammary epithelial cells. Res Vet Sci. 137(102-110).\u003c/li\u003e\n \u003cli\u003eJia, Q.J., Wang, L.R., Zhang, X.N., Ding, Y.J., Li, H., Yang, Y.X., Zhang, A., Li, Y.Y., Lv, S.C., Zhang, J.P., 2020. Prevention and treatment of chronic heart failure through traditional Chinese medicine: Role of the gut microbiota. Pharmacol Res. 151.\u003c/li\u003e\n \u003cli\u003eKhalil, H., Kanisicak, O., Prasad, V., Correll, R.N., Fu, X., Schips, T., Vagnozzi, R.J., Liu, R., Huynh, T., Lee, S.J., Karch, J., Molkentin, J.D., 2017. Fibroblast-specific TGF-beta-Smad2/3 signaling underlies cardiac fibrosis. J Clin Invest. 127(10), 3770-3783.\u003c/li\u003e\n \u003cli\u003eKu, C.W., Day, C.H., Ou, H.C., Ho, T.J., Chen, R.J., Kumar, V.B., Lin, W.Y., Huang, C.Y., 2021. The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats. Open Life Sci. 16(1), 1182-1192.\u003c/li\u003e\n \u003cli\u003eLi, H., Yan, Z., Xiong, Q., Chen, X., Lin, Y., Xu, Y., Bai, L., Jiang, W., Zheng, D., Xing, C., 2019. Renoprotective effect and mechanism of polysaccharide from Polyporus umbellatus sclerotia on renal fibrosis. Carbohydr Polym. 212(1-10).\u003c/li\u003e\n \u003cli\u003eLi, M., 2021. Based on data mining to explore the thinking and medication rules of director Song Ping, an expert of Guoyitang, in the treatment of cardiac neurosis. [Tianjin University of Traditional Chinese Medicine.\u003c/li\u003e\n \u003cli\u003eLi, N., Hang, W., Shu, H., Zhou, N., 2022. Pirfenidone alleviates cardiac fibrosis induced by pressure overload via inhibiting TGF-beta1/Smad3 signalling pathway. J Cell Mol Med. 26(16), 4548-4555.\u003c/li\u003e\n \u003cli\u003eLi, P., Yu, P., Xia, J., 2020. Characterization of the complete chloroplast genome of Stellaria dichotoma var. lanceolata Bunge, a traditional Chinese medicinal plant. Mitochondrial DNA B Resour. 5(4), 3848-3850.\u003c/li\u003e\n \u003cli\u003eLi, P.F., He, R.H., Shi, S.B., Li, R., Wang, Q.T., Rao, G.T., Yang, B., 2019. Modulation of miR-10a-mediated TGF-beta1/Smads signaling affects atrial fibrillation-induced cardiac fibrosis and cardiac fibroblast proliferation. Biosci Rep. 39(2).\u003c/li\u003e\n \u003cli\u003eLi, Z., Wang, H., Feng, L., Song, L., Lu, Y., Li, H., Li, Y., Tian, G., Yang, Y., Li, H., Mei, X., Peng, L., 2022. Comparative metabolomics provides novel insights into correlation between dominant habitat factors and constituents of Stellaria Radix (Stellaria dichotoma L. var. lanceolata Bge.). Front Plant Sci. 13(1035712).\u003c/li\u003e\n \u003cli\u003eLiu, J., Lu, J., Zhang, L., Liu, Y., Zhang, Y., Gao, Y., Yuan, X., Xiang, M., Tang, Q., 2023. The combination of exercise and metformin inhibits TGF-beta1/Smad pathway to attenuate myocardial fibrosis in db/db mice by reducing NF-kappaB-mediated inflammatory response. Biomed Pharmacother. 157(114080).\u003c/li\u003e\n \u003cli\u003eLopez, B., Ravassa, S., Moreno, M.U., Jose, G.S., Beaumont, J., Gonzalez, A., Diez, J., 2021. Diffuse myocardial fibrosis: mechanisms, diagnosis and therapeutic approaches. Nat Rev Cardiol. 18(7), 479-498.\u003c/li\u003e\n \u003cli\u003eMasola, V., Gambaro, G., Onisto, M., 2020. Impact of Heparanse on Organ Fibrosis. Adv Exp Med Biol. 1221(669-684).\u003c/li\u003e\n \u003cli\u003eGong Tingxian. (Ming). Medical includes four hundred flavors.\u003c/li\u003e\n \u003cli\u003eNiu, P., Tan, X., Zhou, X., Xu, X., Zhang, G., Peng, L., Bai, M., 2023. Novel polysaccharide identified from \u003cem\u003eCortinarius purpurascens\u003c/em\u003e demonstrated anti-fibrosis effects in cardiac fibroblasts. Food Bioscience. 56.\u003c/li\u003e\n \u003cli\u003eQian, J., Liang, S., Wang, Q., Xu, J., Huang, W., Wu, G., Liang, G., 2023. Toll-like receptor-2 in cardiomyocytes and macrophages mediates isoproterenol-induced cardiac inflammation and remodeling. FASEB J. 37(2), e22740.\u003c/li\u003e\n \u003cli\u003eSabe, S.A., Xu, C.M., Sabra, M., Harris, D.D., Malhotra, A., Aboulgheit, A., Stanley, M., Abid, M.R., Sellke, F.W., 2023. Canagliflozin Improves Myocardial Perfusion, Fibrosis, and Function in a Swine Model of Chronic Myocardial Ischemia. J Am Heart Assoc. 12(1), e028623.\u003c/li\u003e\n \u003cli\u003eSu, Y.N., Lu, P.P., Yan, S.Y., Guo, X.T., Ma, J., Guo, C.X., Ma, L.H., 2023. Xinfuli granule alleviates metabolic remodeling through inhibition of endoplasmic reticulum stress and mitochondrial injury in heart failure. J Ethnopharmacol. 303(115782).\u003c/li\u003e\n \u003cli\u003eWang, S., Peng, Y., Zhuang, Y., Wang, N., Jin, J., Zhan, Z., 2023. Purification, Structural Analysis and Cardio-Protective Activity of Polysaccharides from Radix Astragali. Molecules. 28(10).\u003c/li\u003e\n \u003cli\u003eXia, M., Cui, X., Si, G., Peng, M., Li, W., 2022. To explore the mechanism of Zhigancao Decoction in the treatment of coronary heart disease based on \u0026quot;four in one\u0026quot;. Chinese Journal of Experimental Prescriptions. 28 (01) : 218-225.\u003c/li\u003e\n \u003cli\u003eXie, J., Tu, T., Zhou, S., Liu, Q., 2017. Transforming growth factor (TGF)-beta1 signal pathway: A promising therapeutic target for attenuating cardiac fibrosis. Int J Cardiol. 239(9).\u003c/li\u003e\n \u003cli\u003eYang, J.S., Mu, T.H., Ma, M.M., 2018. Extraction, structure, and emulsifying properties of pectin from potato pulp. Food Chem. 244(197-205).\u003c/li\u003e\n \u003cli\u003eYang, Y., Ding, Z., Zhong, R., Xia, T., Wang, W., Zhao, H., Wang, Y., Shu, Z., 2020. Cardioprotective effects of a Fructus Aurantii polysaccharide in isoproterenol-induced myocardial ischemic rats. International Journal of Biological Macromolecules. 155(995-1002).\u003c/li\u003e\n \u003cli\u003eYasukawa, K., Yamanouchi, S., Takido, M., 1982. [Studies on the constituents in the water extracts in crude drugs. IV. On the roots of Stellaria dichotoma L. var lanceolata Bge. (2(2)) (author\u0026apos;s transl)]. Yakugaku Zasshi. 102(3), 292-294.\u003c/li\u003e\n \u003cli\u003eYu, Q., Zhu, D., Zou, Y., Wang, K., Rao, P., Shen, Y., 2022. Catalpol Attenuates Pulmonary Fibrosis by Inhibiting Ang II/AT1 and TGF-beta/Smad-Mediated Epithelial Mesenchymal Transition. Front Med (Lausanne). 9(878601).\u003c/li\u003e\n \u003cli\u003eYue, Y., Meng, K., Pu, Y., Zhang, X., 2017. Transforming growth factor beta (TGF-beta) mediates cardiac fibrosis and induces diabetic cardiomyopathy. Diabetes Res Clin Pract. 133(124-130).\u003c/li\u003e\n \u003cli\u003eZhang, J.L., Du, C., Poon, C.C., He, M.C., Wong, M.S., Wang, N.N., Zhang, Y., 2023. Structural characterization and protective effect against renal fibrosis of polysaccharide from Ligustrum lucidum Ait. J Ethnopharmacol. 302(Pt A), 115898.\u003c/li\u003e\n \u003cli\u003eZhang, M., Lu, P., Zhao, F., Sun, X., Ma, W., Tang, J., Zhang, C., Ji, H., Wang, X., 2023. Uncovering the molecular mechanisms of Curcumae Rhizoma against myocardial fibrosis using network pharmacology and experimental validation. J Ethnopharmacol. 300(115751).\u003c/li\u003e\n \u003cli\u003eZhang, Y., Yuan, B., Xu, Y., Zhou, N., Zhang, R., Lu, L., Feng, Z., 2022. MiR-208b/miR-21 Promotes the Progression of Cardiac Fibrosis Through the Activation of the TGF-beta1/Smad-3 Signaling Pathway: An in vitro and in vivo Study. Front Cardiovasc Med. 9(924629).\u003c/li\u003e\n \u003cli\u003eZhou, X.L., Fang, Y.H., Wan, L., Xu, Q.R., Huang, H., Zhu, R.R., Wu, Q.C., Liu, J.C., 2019. Notch signaling inhibits cardiac fibroblast to myofibroblast transformation by antagonizing TGF-beta1/Smad3 signaling. J Cell Physiol. 234(6), 8834-8845.\u003c/li\u003e\n \u003cli\u003eZoppi, N., Chiarelli, N., Binetti, S., Ritelli, M., Colombi, M., 2018. Dermal fibroblast-to-myofibroblast transition sustained by alphavss3 integrin-ILK-Snail1/Slug signaling is a common feature for hypermobile Ehlers-Danlos syndrome and hypermobility spectrum disorders. Biochim Biophys Acta Mol Basis Dis. 1864(4 Pt A), 1010-1023.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"plant-foods-for-human-nutrition","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Plant Foods for Human Nutrition](https://www.springer.com/journal/11130)","snPcode":"11130","submissionUrl":"https://submission.nature.com/new-submission/11130/3","title":"Plant Foods for Human Nutrition","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"myocardial fibrosis, Stellariae Radix, polysaccharide, extraction, TGF-β/Smad signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-4230329/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4230329/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCardiovascular disease is characterized by thedevelopment of myocardial fibrosis, Stellariae Radix is a traditional Chinese medicine. A novel polysaccharide named SRP-1 from Stellariae Radix was structurally identified and its effect against myocardial fibrosis was explored. SRP-1 was extracted from Stellariae Radix and purified by DEAE-52 cellulose chromatography. According to physicochemical methods and monosaccharide composition analysis, SRP-1 was found to be mainly composed of galactose, glucose, xylose, fructose, mannose, and rhamnose, and its weight average molecular weight (Mw) was 31,309 Da. Tests of activity against myocardial fibrosis indicated marked downregulation of the expression of Col I, Col III, α-SMA, and proteins related to the TGF-β/Smad signaling pathway, which were induced by TGF-β1, in mouse cardiac fibroblasts pretreated with SRP-1. In addition, SRP-1 restrained the abnormal growth of cardiac fibroblasts cells and the expression of \u003cem\u003eSnail 1\u003c/em\u003e, \u003cem\u003eSnail 2\u003c/em\u003e, \u003cem\u003eTwist 1\u003c/em\u003e, and \u003cem\u003eSlug\u003c/em\u003e mRNA in vitro. SRP-1 can reduce the expression of TGF-β/Smad signaling pathway related proteins induced by TGF-β1. Taken together,SRP-1 can protect CFs from myocardial fibrosis induced by TGF-β1 by inhibiting TGF-β/Smad signaling. These results indicate that Stellariae Radix polysaccharide may warrant further analysis as a novel therapeutic agent for cardiovascular diseases.\u003c/p\u003e","manuscriptTitle":"Structural characterization and protective effect against myocardial fibrosis of polysaccharide from Stellariae Radix (Stellaria dichotoma L. var. lanceolata Bge.)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-17 13:09:31","doi":"10.21203/rs.3.rs-4230329/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-11-18T17:58:40+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-05T16:04:48+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"210477877130094817000532544739698301939","date":"2024-10-29T15:38:31+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"133851089480778375321565567342207375822","date":"2024-10-28T16:33:26+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"290076774921832532280780818202782658709","date":"2024-10-28T16:18:48+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-22T15:23:21+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"83100627916357506980965338646781974877","date":"2024-05-22T13:27:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"285917877302303828120632741038263395750","date":"2024-05-21T06:31:58+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-05-20T16:41:21+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-15T13:06:02+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-04-12T13:28:35+00:00","index":"","fulltext":""},{"type":"submitted","content":"Plant Foods for Human Nutrition","date":"2024-04-07T08:09:07+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"plant-foods-for-human-nutrition","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Plant Foods for Human Nutrition](https://www.springer.com/journal/11130)","snPcode":"11130","submissionUrl":"https://submission.nature.com/new-submission/11130/3","title":"Plant Foods for Human Nutrition","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"9b7cc745-3fc3-498a-a108-d96216f2a81d","owner":[],"postedDate":"April 17th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-03-10T12:53:34+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-17 13:09:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4230329","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4230329","identity":"rs-4230329","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}