N-terminal acetylation reduces α-synuclein pathology in models of Parkinson’s disease

N-terminal acetylation reduces α-synuclein pathology in models of Parkinson’s disease | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results N-terminal acetylation reduces α-synuclein pathology in models of Parkinson’s disease Esther del Cid-Pellitero , Thomas Goiran , View ORCID Profile Zaid A.M. Al-Azzawi , Nathan C. Karpilovsky , Jace Jones-Tabah , Jonas J. Mayo , Frederique Larroquette , Wen Luo , Irina Shlaifer , Yogitha Thattikota , Andrew Bayne , View ORCID Profile Jean-Francois Trempe , View ORCID Profile Thomas M. Durcan , View ORCID Profile Edward A. Fon doi: https://doi.org/10.1101/2025.11.21.689703 Esther del Cid-Pellitero 1 Department of Neurology and Neurosurgery, Montreal Neurological Institute-Hospital (The Neuro), McGill University , Montreal, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Thomas Goiran 1 Department of Neurology and Neurosurgery, Montreal Neurological Institute-Hospital (The Neuro), McGill University , Montreal, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Zaid A.M. Al-Azzawi 1 Department of Neurology and Neurosurgery, Montreal Neurological Institute-Hospital (The Neuro), McGill University , Montreal, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Zaid A.M. Al-Azzawi Nathan C. Karpilovsky 1 Department of Neurology and Neurosurgery, Montreal Neurological Institute-Hospital (The Neuro), McGill University , Montreal, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jace Jones-Tabah 1 Department of Neurology and Neurosurgery, Montreal Neurological Institute-Hospital (The Neuro), McGill University , Montreal, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jonas J. Mayo 1 Department of Neurology and Neurosurgery, Montreal Neurological Institute-Hospital (The Neuro), McGill University , Montreal, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Frederique Larroquette 1 Department of Neurology and Neurosurgery, Montreal Neurological Institute-Hospital (The Neuro), McGill University , Montreal, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Wen Luo 1 Department of Neurology and Neurosurgery, Montreal Neurological Institute-Hospital (The Neuro), McGill University , Montreal, Canada 2 The Neuro’s Early Drug Discovery Unit (EDDU), Montreal Neurological Institute, McGill University , Montreal, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Irina Shlaifer 1 Department of Neurology and Neurosurgery, Montreal Neurological Institute-Hospital (The Neuro), McGill University , Montreal, Canada 2 The Neuro’s Early Drug Discovery Unit (EDDU), Montreal Neurological Institute, McGill University , Montreal, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yogitha Thattikota 1 Department of Neurology and Neurosurgery, Montreal Neurological Institute-Hospital (The Neuro), McGill University , Montreal, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Andrew Bayne 3 Department of Pharmacology & Therapeutics and Centre de Recherche en Biologie Structurale, McGill University , Montreal, QC, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jean-Francois Trempe 3 Department of Pharmacology & Therapeutics and Centre de Recherche en Biologie Structurale, McGill University , Montreal, QC, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Jean-Francois Trempe Thomas M. Durcan 1 Department of Neurology and Neurosurgery, Montreal Neurological Institute-Hospital (The Neuro), McGill University , Montreal, Canada 2 The Neuro’s Early Drug Discovery Unit (EDDU), Montreal Neurological Institute, McGill University , Montreal, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Thomas M. Durcan Edward A. Fon 1 Department of Neurology and Neurosurgery, Montreal Neurological Institute-Hospital (The Neuro), McGill University , Montreal, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Edward A. Fon For correspondence: ted.fon{at}mcgill.ca Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract The α-synuclein protein, encoded by SNCA gene, is a major constituent of pathological intracellular inclusions such as Lewy bodies found in the brains of patients with Parkinson’s disease and other synucleinopathies. Whereas α-synuclein phosphorylation has been much studied, comparatively less work has been devoted to other post-translational modifications such as acetylation, especially given that N-terminally acetylated α-synuclein is the most abundant endogenous form of the protein in the brain. In this study, using multiple in vitro and in vivo models, we sought to better understand the role of N-terminal acetylation in the pathogenesis of synucleinopathies. We found that N-terminal acetylation slowed aggregation of both α-synuclein monomers and pre-formed fibrils in vitro . Uptake of acetylated α-synuclein pre-formed fibrils into both immortalized cell lines and iPSC-derived dopamine neurons was also slowed compared non-acetylated fibrils. In addition, exposure to acetylated pre-formed fibrils induced less seeding of endogenous α-synuclein, as measured by the accumulation of Serine129-phosphorylated α-synuclein inclusions in both iPSC-derived dopamine neurons and mouse brain. Finally, mice injected with N-terminally acetylated α-synuclein pre-formed fibrils survived significantly longer than mice injected with non-acetylated fibrils. Taken together, our study indicates that N-terminal acetylation reduces α-synuclein aggregation, uptake into cells, seeding of endogenous α-synuclein, and toxicity in vivo , suggesting that this prevalent post-translational modification represents a potent, physiologically relevant protective mechanism, which has thus far largely not been taken into consideration in most experimental paradigms of Parkinson’s disease and synucleinopathies. Introduction One of the main pathological hallmarks of Parkinson’s disease (PD) and other synucleinopathies is the presence of intracellular inclusions such as Lewy bodies, consisting of aggregated and phosphorylated α-synuclein (α-syn) protein along with accumulated lipids and organelles 1 – 3 . Moreover, mutations and copy number variants in the SNCA gene encoding α-syn have been associated with familial forms of PD 4 . While substantial progress has been made on understanding the normal function of α-syn 5 and its role in PD pathogenesis 6 , comparatively less is known about the impact of post-translational modifications (PTMs) of α-syn and their role in PD pathogenesis. PTMs are a series of modifications that influence protein localization, activity, and folding states. α-syn can undergo multiple different PTMs including but not limited to phosphorylation, glycation, acetylation, truncation, SUMOylation, and nitration 7 – 10 . Phosphorylation of α-syn on serine 129 (pSyn) is the best characterized marker of Lewy bodies isolated from or imaged in patient post-mortem brain tissue. However, N-terminally acetylated α-syn (NAc-syn) is the most abundant endogenous form of α-syn in vivo 11 – 13 . NAc-syn has been associated with a decreased propensity to form aggregates 14 – 18 . This effect is believed to stem from the alteration of α-syn’s ability to form β-sheets thereby altering the structure of aggregates compared to non-acetylated α-syn. However, a more recent study found no differences in the structure of aggregates formed, instead pointing to a reduced propensity of acetylated α-syn aggregates to bind lipid membranes 19 . Lipid membrane binding is an important initial step for the internalization of α-syn aggerates into cells. Misfolded and aggregated α-syn is believed to promote the template-induced misfolding of native α-syn and spread from one cell to another in a prion-like manner 20 – 22 . Multiple studies have demonstrated the spread of α-syn aggregates via different cell receptors present on cell membranes including heparin sulfate proteoglycans 23 – 27 , but the effect of acetylation on cell surface receptor binding has not been studied extensively in model systems. Therefore, in addition to a reduction in aggregation propensity of α-syn, acetylation may alter the cell-to-cell propagation of α-syn aggregates, thereby limiting their toxic effects. Thus, PTMs such as acetylation may play a crucial role in modifying the aggregation propensity, binding, and structural properties of α-syn, yet a clear elucidation of the cellular pathological effects of acetylation of α-syn using PD-relevant disease models is lacking. In this work, we report that N-terminal acetylation slowed α-syn aggregation kinetics in vitro via a seed amplification assay. Uptake of N-terminally acetylated α-syn pre-formed fibrils (NAc-PFFs) into immortalized cells and induced pluripotent stem cells (iPSC)-derived dopamine (DA) neurons was decreased compared to unmodified preformed fibrils (PFFs), possibly due to reduced binding to the cell surface. Finally, exposure to NAc-PFFs induced less seeding of endogenous α-syn than exposure to unmodified preformed fibrils (PFFs) in both iPSC-derived DA neurons and mouse brain. This also coincided with longer survival observed in mice injected with NAc-PFFs compared to PFFs. Materials and methods Generation and characterization of N-terminally acetylated α-synuclein preformed fibrils Acetylation of the first methionine at the N-terminus of α-syn was performed as described in Rovere, Powers, Patel and Bartels 28 . Briefly, E.coli were co-transformed with two plasmids, pET721a-α-syn (Addgene, #51486) and pTSara-NatB (a gift from Dr. Tim Bartels), which are responsible for expression of α-syn and the N-terminal acetylation enzyme NatB, respectively. Cultures were grown in LB+amp+cam media to OD ∼0.5-0.6 and induced with 0.2% L-arabinose 30 min before adding the second inducer (0.3mM isopropyl-β-D-thiogalactopyranoside) and further incubated for 4 hrs. NAc-α-syn in the clarified culture lysate after sonication was purified to homogeneity (>95% on SDS PAGE) by using a 5-ml HiTrap Q HP anion exchange column (GE Healthcare) and/or a 5-ml HiTrap Phenyl HP hydrophobic interaction column (GE Healthcare). N-terminal acetylation of α-syn was confirmed as by mass spectrometry ( Figure 1A ). Both α-syn and NAc-α-syn were tested to ensure endotoxin levels below 0.2 EU/mg prior to later steps. PFFs were generated by shaking 0.5-ml aliquot of unmodified or NAc-α-syn (5mg/ml) in 1.5-ml microtube at 1000rpm at 37°C for 7d. Additionally, both unmodified PFFs and NAc-PFFs were subjected to at least 40 cycles of 30s-On/30s-Off on a Bioruptor Pico sonication device (Diagenode). PFFs and NAc-PFFs were characterized using negative staining after sonication and visualized using a transmission electron microscope (Tecnai G2 Spirit Twin 120 kV Cryo-TEM) coupled to a camera (Gatan Ultrascan 4000 4 k × 4 k CCD Camera model 895) 29 . Additional characterization of sonicated PFFs and NAc-PFFs was performed using dynamic light scattering (DLS). Images were analyzed with Fiji-ImageJ1.5 and GraphPad Prism 9 software. Download figure Open in new tab FIGURE 1. Characterization of PFFs vs NAc-PFFs. A) Mass spectrometry analyses of monomer construct used to make either PFF or NAc-PFF. Top spectrum reveals deconvoluted mass as expected from amino acid sequence for human WT α-syn sequence. Bottom spectrum shows full acetylation at the N-terminal of human WT α-syn sequence with a rightward shift (+42 Da). B) Electron micrograph images and characterization of length distributions for PFFs and NAc-PFFs post-sonication for a single batch each. C) Average length of fibrils after sonication of all batches of PFFs and NAc-PFFs. Statistical significance was assessed using unpaired t-tests. Bar graphs represent mean with error bars denoting ± SD. D) Hydrodynamic diameter measurements of 5 batches each of PFFs and NAc-PFFs post-sonication using dynamic light scattering. Statistical significance was assessed using unpaired t-tests. Bar graphs represent mean with error bars denoting ± SD. E) Seed amplification assay using α-syn with and without either PFF or N-terminal acetylation. Graphs display average of 4 wells. Seed amplification assay Seed amplification assays were carried out as described previously with minor modifications 30 , 31 . The base reaction mix was composed of 100 mM PIPES buffer pH 6.5, 300 mM NaCl, 10 uM ThT, and 0.002% SDS in filtered double distilled water. In all reactions, 0.1 mg/mL of monomer was used regardless of acetylation status, and 2 uL of 1:1000 diluted PFF was used to seed reactions (Final concentration in each well of 9 nM). Reactions were performed in quadruplicate technical replicates with a final volume of 100 uL per replicate in a 96-well plate format (corning). Plates were incubated in an Omega Fluostar plate reader (BMGLabtech) for 105 hours at 37°C. Plates were intermittently shaken (double orbital) with 1 min shaking and 29 min rest. Fluorescence readings were taken at 450 nm excitation and 480 nm emission every 30 min with a gain setting of 1,500. Generation of SNCA knockout and overexpressing RPE1 cells For the generation of a SNCA -KO human retinal pigmented epithelial-1 cells (RPE1) cells, guide RNAs (gRNA1: GCCATGGATGTATTCATGAA and gRNA2: AAGCACCAAACTGACATTTG) were obtained from Integrated DNA Technologies (IDT) and dissolved in Nuclease-Free Duplex Buffer (IDT) according to the manufacturer’s instructions. The mixture was incubated at room temperature for 15 minutes to form the ribonucleoprotein (RNP) complex. Freshly isolated RPE1 cells (1.5 × 10⁵) were washed with PBS and resuspended in 75 μL of Nucleofector Solution mixed with Supplement 1 buffer (Lonza Nucleofector Kit V, Cat. No. VACA-1003), following the manufacturer’s protocol. The cells were then mixed with 25 μL of the prepared RNP complex by gentle pipetting and transferred to a nucleofection cuvette provided in the kit. Nucleofection was performed using the X-001 program on a Lonza Nucleofector device. Following nucleofection, the cells were transferred to a single well of a 12-well plate containing pre-warmed, antibiotic-free culture medium supplemented with 10% FBS and incubated at 37°C in a 5% CO₂ atmosphere. After 24 hours, the medium was replaced with fresh medium containing antibiotics. Genomic DNA was extracted from 0.5–1 × 10⁵ cells using QuickExtract DNA Extraction Solution (Lucigen, Cat. No. QE09050) according to the manufacturer’s protocol. DNA was processed in a thermal cycler with the following conditions: 65°C for 10 minutes, 68°C for 5 minutes, and 95°C for 5 minutes. Knockout of SNCA was confirmed by PCR using specific primers (Forward: TCCGTGGTTAGGTGGCTAGA, Reverse: CTGGAAAAGCAAACAGTCGCA), followed by sequencing and western blotting using an antibody against α-syn (BD Biosciences, Cat. No. 610787). For wildtype (WT) SNCA expression, RPE1 endogenously express α-syn and so were used without any genetic modification. As for the generation of SNCA overexpression RPE1 cells, the coding sequence of WT α-syn was ordered as gBlock gene fragments (Integrated DNA Technologies). The insert was cloned into the NheI and BamHI sites of the doxycycline-inducible pCW57.1 plasmid (Addgene #41393, gift from David Root) using Gibson Assembly (New England Biolabs). PCR amplification was performed with Q5 DNA polymerase (NEB), and construct was sequence verified. Next, Lentiviral particles encoding WT α-syn were produced from the pCW57.1 vectors and used to transduce the RPE1 SNCA -KO cells above. Stable polyclonal cell populations were generated by selection with 15 µg/mL puromycin. Subsequently, upon addition of 2ug/ml of doxycycline (Sigma) overnight into the media, validation of SNCA mRNA and α-syn protein expression was conducted using RT-qPCR and Western blot analysis using primers targeting the SNCA gene or primary antibodies targeting α-syn protein, respectively. RPE1 cells were grown and maintained at 37°C under a humidified atmosphere of 5% CO2. RPE1 cells were cultured in Dulbecco’s Modified Eagle’s Medium (Wisent) containing 4.5 g/l glucose, sodium pyruvate, supplemented with 10% heat inactivated fetal bovine serum (Wisent), 100 units (U)/ml penicillin, and 50 μg/ml streptomycin. Cells were passaged upon reaching approximately 70% - 90% confluence by rinsing in PBS followed by incubation in 0.05% Trypsin- EDTA (Wisent) at 37°C for approximately 5 min before propagation in a new cell culture dish or pelleted for experimental use. For propagation and passaging, trypsinized cells were re-suspended in fresh DMEM media to inactivate and dilute trypsin then counted using a Luna cell counter (Logos Biosystems) prior to plating at the desired cell density. For experimental use, trypsinized cells were resuspended in fresh media then split into 1.5 mL Eppendorf tubes or 15 mL falcon tubes depending on future use. Cells were pelleted by centrifuging at 1.2 rpm for 3 min, and the media was discarded via vacuum. Cell pellets were either stored at -20°C directly or re-suspended in cell lysis buffer and then stored at -20°C. iPSC culture and dopamine neuron differentiation iPSCs from a PD patient with a triplication in the SNCA gene (and isogenic SNCA WT and SNCA KO iPSC lines generated by CRISPR-based gene editing from the same patient) were provided by Pr. Tilo Kunath from The University of Edinburgh 32 – 34 . DA neuronal precursor cells (NPCs) and DA neurons were generated following previously established protocols 35 – 37 . Briefly, iPSCs were dissociated with Gentle Cell dissociation reagent and transferred to uncoated flasks in NPC Induction Media to allow for embryoid bodies (EB’s) to form. EBs were cultured for 7 days and then transferred to polyornithine/ laminin coated flasks and grown for another 7 days in NPC induction media. To expand NPCs the EBs were then dissociated into small colonies by trituration in Gentle Cell dissociation media and replated as a monolayer on polyornithine/ laminin coated flasks. After reaching confluence, NPCs were harvested and frozen in FBS with 10% DMSO and stored in liquid nitrogen. To differentiate neurons, NPCs were thawed in NPC maintenance Media with Y-27632 (ROCK inhibitor) and plated on polyornithine/ laminin. NPCs were grown for 5-7 days until confluent. For final differentiation into DA neurons, NPCs were dissociated using Accutase and plated on polyornithine/ laminin in DA neuron differentiation media. DA neurons were maintained by exchanging 1/2 of the culture volume for fresh DA neuron differentiation media every 5-7 days. Neurons from every batch were assessed by immunofluorescence for expression of Map2 and TH. Only batches achieving at least 50% Map2/TH positivity after 4 weeks of differentiation were used for the experiments in this manuscript. Supplementary table 1 describes all media components used for iPSC culture and neuronal differentiation. PFF internalization, seeding, and uptake assays RPE1 cells were seeded to 50% confluency in 96 well plates (Falcon), a day prior to treatment with 80nM of Alexafluor 488-labelled PFF or 488-labelled NAc-PFF. 24 hours post-treatment, cells were rinsed thrice with PBS, fixed with 4% PFA/PBS for 15min, and rinsed thrice in PBS. Cells were then processed for IF, before imaging and analysis. For DA neurons, NPCs were differentiated in 96-well plates (80,000 cells/ well) for 3 weeks and treated with vehicle (media), 80nM of Alexafluor 488-labelled PFF or 488-labelled NAc-PFF, for 6 or 24 hrs. Then, half of the media was removed and replaced with 8% PFA in PBS. The DA neurons were processed for IF followed by imaging and analysis. For seeding assays, DA neurons were treated with 300 nM unmodified PFF or NAc-PFF, followed by maintenance as described until desired timepoint (4- or 6-weeks post treatment). Immunofluorescence and high-content imaging Cells were permeabilized for 10 min with 0.2% triton X-100 in PBS and blocked with 5% goat-serum and 0.02% triton X-100 in PBS. Antibodies used are described in Supplementary Table 2. High content imaging was performed on an Opera Phenix high-content confocal microscope (Perkin Elmer) and image analysis was performed using Columbus (Perkin Elmer). For DA neurons, data processing was then conducted using R studio as previously described 35 . Nuclei were first identified by the Hoechst channel, and surrounding soma was identified as Map2-positive region. Relevant secondary stains were then quantified within this Map2-defined region. Single-cell data were then processed using a custom script in R studio to filter objects based on nuclear size, nuclear shape and Map2 staining intensity to identify only the neuronal cells for inclusion in subsequent analysis. Western Blot Cultured cells were washed with PBS and lysed using RIPA buffer 0.1% SDS, 20mM Tris pH 7.4, 150mM NaCl, 1mM EDTA, 1mM EGTA, 1% NP-40, and 1% sodium deoxycholate, supplemented with phosphatase and protease inhibitors. Protein concentrations were determined via BCA, and samples were prepared in 6X Laemmli buffer supplemented with 0.1M DTT. 20 μg of total protein were loaded onto SDS-PAGE gel and separated using Biorad gel system. Gels were transferred onto nitrocellulose membranes (Biorad) and blocked for 1h in 5% skim milk made in 1X PBS with 0.1% Tween-20. For α-syn blots, membranes were fixed using 4% PFA and 0.1% glutaraldehyde for 30 min before blocking. Blocked membranes were incubated with primary antibody (Supplementary Table 2) at 4°C overnight. After, membranes were washed 3 times in 1X PBS with 0.1% Tween 20, and membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Jackson ImmunoResearch) for 1h at room temperature. Protein detection was performed by capturing chemiluminescent signal on a ChemiDoc imaging system (Biorad) using Clarity/ Clarity max Western ECL Substrate (Biorad). Finally, blot signals were quantified using ImageJ. Intracerebral injection of PFFs in M83 transgenic mice Three-month-old M83 hemizygous mice, overexpressing mutant human A53T α-syn under the PrP promoter 38 were bred in house, and maintained on a 12/12 h light/dark cycle at 22 °C ambient temperature with unlimited access to food and water. Housing, breeding, and procedures were performed according to the Canadian Council on Animal Care and were approved by the McGill University Animal Care Committee. Prior to intracerebral injection, M83 mice (females and males) were housed in individual plastic cages; and prior to the craniotomy, a dose of 20 mg/kg carprofen and 250 mg/kg bupivacaine were administered subcutaneously. M83 mice were anesthetized with 2% isoflurane and stereotaxically injected with PBS, PFFs or NAc-PFFs (12.5 μg per brain), in the right dorsal striatum using a 5 µl Hamilton syringe with a 33-gauge needle (Luk et al., 2012). All mice were injected the same day and were divided into two groups, endpoint (n= 20) and survival (n= 20). Mice were weighed before and, at regular intervals, after injection. Humane endpoint was defined as the point in time when motor impairment became debilitating (severe loss of balance preventing proper food and water consumption), or if the mice lost more than 20% of their starting body weight. For the endpoint group, the mice were euthanized when the first mouse reached the humane endpoint. For the survival group, each mouse was euthanized when it reached its individual humane endpoint. Mice were anesthetized with 2% isoflurane and were perfused with PBS followed by 10% formalin. The brains were removed and postfixed with 10% formalin for 24h at 4°C. Brains were then incubated in 70% ethanol for a week before processing for paraffin embedding. Immunohistochemistry and immunofluorescence of M83 mice brains Coronal brain sections were cut with a paraffin microtome at 5 μm thickness. Tissue sections were incubated in citrate buffer (pH 6.0) for 10 min, rinsed with Tris-buffered saline containing 0.1% Tween-20 (TBST), and incubated in 3% oxidase peroxidase for 15 min. Subsequently, the sections were blocked with 10% normal goat serum in TBST for 30 min at room temperature and incubated with anti-pSyn antibody (abcam, ab184674) overnight at 4°C. The next day, sections were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Jackson ImmunoResearch) for 30 min. After washing with PBS, cells were analyzed. The peroxidase reaction product was visualized as a brown precipitate by incubating the tissue with the DAB substrate kit (8059, cell signal technology). Sections were additionally incubated in hematoxylin to stain for nuclei. Three coronal sections containing the substantia nigra (minimal distance between sections 40 μm), were examined by a bright-field microscope (Olympus DP-21SAL coupled to a digital camera DP21/DP26). Then the images were analyzed using Fiji-ImageJ 1.53 software. Macros for Fiji-ImageJ were written in Jython, using basic ImageJ functions. We defined each individual spot labeled with pSyn as a positive particle for pSyn. Cell particles were defined by perimeter, area, and size. For immunofluorescence staining, coronal brain sections were blocked in 10% normal goat serum in TBST for 1 hour at room temperature and incubated with anti-pSyn antibody and anti-TH overnight at 4°C. After rinsing with PBS, the tissue sections were incubated with anti-mouse Alexa fluor-488, anti-rabbit Alexa-Fluor-555 and DAPI for 2 hrs at room temperature. Coronal sections were examined using a Zeiss Axio Observer Z1 microscope. Two midbrain coronal sections (minimal distance between sections 40 μm) were analyzed using Fiji-ImageJ 1.53 software. Macros for Fiji-ImageJ were written in Jython, using basic ImageJ functions. Statistical Analysis All statistical analyses were conducted in GraphPad Prism9 software. For experiments involving retinal pigment epithelial cells (RPE1), a minimum of three replicates were utilized for each of the three experiments (n=3) performed for both the uptake assays and binding assays. For experiments in DA neurons, biological replicates were defined as separate individual differentiations of banked NPCs to neurons (n= 3). In the graphs, each point represents an average of technical replicates (between 2-3) for each batch of PFF (unmodified PFFs or NAc-PFFs) per experiment. Statistical comparisons were performed using unpaired t-tests, One- Way ANOVA or Two-Way ANOVA followed by Tukey-corrected tests or Dunnett’s multiple comparison test where applicable. Results Biochemical and structural properties of unmodified and N-terminally acetylated α-synuclein preformed fibrils Both unmodified and N-terminally acetylated wildtype human α-syn were produced in E. Coli and purified to homogeneity. Subsequent analysis by mass spectrometry showed complete N-terminal acetylation ( Fig. 1A ). PFFs or NAc-PFFs were then generated from their corresponding monomers in separate batches. After sonication, the length of both types of PFFs appeared similar, and this was quantified both using electron microscopy and dynamic light scattering measurements ( Fig. 1B-D ). We then sought to characterize the kinetics of aggregate formation using seed amplification assay. ThioflavinT selectively fluoresces when it binds to β-sheet-rich regions in protein aggregates monitored in real-time using a plate reader 39 . We observed that acetylation of either the monomer, PFFs, or both lead to a markedly longer lag phase and lower max RFU after 100 hours ( Fig. 1E ). These effects of acetylation on the kinetics of monomeric α-syn are in line with previous literature 17 , 18 , 40 . N-terminally acetylated α-synuclein preformed fibrils are internalized less efficiently by RPE1 cells Transmission of α-syn has been widely reported to occur in a prion-like manner in patients and animal models 41 – 45 , and many mechanisms have been suggested for this process including endocytic vesicles, receptor-mediated uptake, and phagocytosis 46 – 50 . PTMs such as acetylation have significant impact on α-syn’s stability, localization, and kinetics 16 , 51 . Therefore, we sought to evaluate and monitor the uptake of unmodified and NAc-PFFs using RPE1 cells that express varying levels of α-syn ( SNCA -WT, SNCA -KO, and SNCA -overexpression) ( Fig. 2A ). The purpose of this is two-fold: understand the impact of acetylation on uptake of α-syn, and the effect to which endogenous levels of α-syn may affect this process. We found that treatment with 15nM of 488nm-PFFs (either unmodified- or NAc-) for 1hr showed an approximately 50% reduction in uptake of NAc-PFFs compared to unmodified PFFs ( Fig. 2B-C ), regardless of the SNCA genotype of the cells. Similar results were observed with a longer incubation period of 24hrs ( Fig. 2D ). These findings indicate that, in RPE1 cells, the initial internalization and accumulation steps of both unmodified- and NAc-PFFs are independent of endogenous α-syn levels but that NAc-PFF uptake is reduced compared to unmodified PFFs. Download figure Open in new tab FIGURE 2. Fibril uptake is reduced in RPE1 cells with NAc-PFF compared to unmodified PFF. A) Schematic for experimental setup utilizing RPE1 cells to assess uptake of 488-AlexaFluor labelled PFF vs NAc-PFF fibrils. B) Representative immunofluorescence images of SNCA -WT RPE1 uptake assay at 1 hr timepoint. C) Quantification of labelled PFF uptake in RPE1 cells with different levels of endogenous SNCA expression (WT, KO, and overexpression) at 1 hr and 24 hr. Data was first normalized by subtracting vehicle for each cell line, and 488-PFF was set to 100% uptake. 488-NAc-PFF was expressed as a percent compared to 488-PFF. Statistical significance was assessed using two-way ANOVA followed by Dunnett’s multiple comparison test. Bar graphs represent mean with error bars denoting ± SD. Significance levels are depicted in figure legends (“***” indicates p≤0.0005, “****” indicates p<0.0001). Cleavage of extracellular heparan sulfate proteoglycans reduces cell surface binding of unmodified and N-terminally acetylated α-synuclein preformed fibrils in RPE1 cells To assess the mechanism of initial binding of unmodified- and NAc-PFF to the cell surface, labelled PFFs were incubated with RPE1 expressing endogenous levels of α-syn ( SNCA- WT) for 20 min on ice to inhibit any active endocytic mechanisms involved in PFF internalization 46 ( Fig. 3A ). We observed over 70% decrease in the amount of NAc-PFF bound to the cell surface compared to unmodified PFF ( Fig. 3B-C ). Previously, we and other groups have shown that heparan sulfate proteoglycans (HSPGs) facilitate the uptake of α-syn fibrils 23 , 24 . To this end, we pretreated SNCA -WT RPE1 cells with a cocktail of heparin lyases enzymes (heparinase) for 1 hr. This cocktail, containing Heparinase I and III, provided us an almost complete and selective cleavage of the heparin and heparan sulfate chains confirmed through immunofluorescence staining. By quantifying HSPG area per cell, we observe 1h pre-treatment to be sufficient in abolishing the HSPG fluorescence on the cell surface compared to untreated cells ( Fig. 3B and D ). Following this, we observed an approximate 80% reduction in unmodified PFF intensity per cell after Heparinase treatment ( Fig. 3B-C ), indicating a decrease in binding and internalization. Interestingly, we also observed an almost complete loss of NAc-PFF binding to the cell surface after heparinase treatment ( Fig. 3B-C ). Taken together, these findings indicate that NAc-PFF has reduced binding efficiency compared to PFF. Download figure Open in new tab FIGURE 3. Heparinase treatment abrogates PFF and NAc-PFF binding in RPE1 cells. A) Schematic for experimental setup utilizing RPE1 cells to assess binding affinity of 488-AlexaFluor labelled PFF vs NAc-PFF fibrils and hypothesized interaction via HSPGs. B) Representative immunofluorescence images of SNCA -WT RPE1 binding to 488-PFF vs 488-NAc-PFF with and without heparinase. C) Quantification of labelled PFF binding in SNCA -WT RPE1. Data was first normalized by subtracting vehicle condition to remove background fluorescence. Then, percent binding for 488-PFF without heparinase was set to 100%. All other conditions were expressed as percent cell surface binding compared to the PFF condition. Statistical significance was assessed using two-way ANOVA followed by Tukey’s multiple comparison test. Bar graphs represent mean with error bars denoting ± SD. D) Quantification of HSPG area per cell area with and without heparinase. Statistical significance was assed using unpaired t-test. Bar graphs represent mean with error bars denoting ± SD. Significance levels are depicted in figure legends (“***” indicates p≤0.0005, “****” indicates p<0.0001). N-terminally acetylated α-synuclein preformed fibrils are internalized less efficiently by iPSC-derived dopamine neurons To test whether NAc-PFF uptake is also reduced in human patient-derived dopamine DA neurons, we used iPSCs generated from a PD patient with a triplication of the SNCA gene (4 copies of the SNCA gene; SNCA -Triplication), as well as isogenic CRISPR edited iPSC lines with either 2 copies ( SNCA -WT) or zero copies ( SNCA -KO) of the SNCA gene 32 – 35 . Similar to the approach in RPE1 cells ( Fig. 2 ), we tracked the uptake of 488nm-PFFs (unmodified- or NAc-) over time ( Fig. 4A ). We observed that, in DA neurons from all three isogenic iPSC lines, NAc-PFFs were internalized less than unmodified PFFs ( Fig. 4B-C ) independent of endogenous α-syn expression. This difference was also observed at 24h but did not meet the threshold for statical significance ( Fig. 4B-C ) potentially indicating a levelling-off effect at this time point. Download figure Open in new tab FIGURE 4. NAc-PFFs exhibit reduced uptake in iPSC-derived dopamine neurons regardless of endogenous SNCA expression levels. A) Schematic for experimental setup utilizing DA neurons assessing 488-labelled PFF vs NAc-PFF uptake. B) Representative immunofluorescence images of SNCA -WT iPSC-derived DA neurons uptake of 488-PFF vs 488-NAc-PFF at 6 hr. C) Representative immunofluorescence images of SNCA -WT iPSC-derived DA neurons uptake of 488-PFF vs 488-NAc-PFF at 24 hr. Quantification was performed for all three levels of α-syn expression in neurons ( SNCA -WT, SNCA -KO, and SNCA -Triplication). All data was background corrected for each line by subtracting vehicle treatment condition. Statistical significance was assessed using two-way ANOVA followed by Tukey’s multiple comparison test. Bar graphs represent mean with error bars denoting ± SD. Significance levels are depicted in figure legends (“*” indicates p<0.05). N-terminally acetylated α-synuclein preformed fibrils induce less α-synuclein seeding in dopamine neurons We next sought to determine if N-terminal acetylation also affected the capacity of exogenous PFFs to seed endogenous α-syn aggregates in DA neurons ( Fig. 5A ). As most intracellular α-syn inclusions, including Lewy bodies in the brains of PD patients, contain α-syn that is phosphorylated on serine 129, we used pSyn staining as a surrogate for α-syn seeding. We first examined the total α-syn in Map2-TH double-positive neurons and confirmed that SNCA -KO lacked α-syn expression while SNCA -triplication had higher levels of total α-syn than the isogenic SNCA -WT (Supplementary Fig. 1). Next, SNCA -Triplication, SNCA -WT and SNCA -KO DA neurons were treated with 300 nM of unlabeled unmodified- or NAc-PFFs and maintained in culture for 4 and 6 weeks prior to fixation and analysis ( Fig. 5B-C ). At both 4 and 6 weeks timepoints, consistent with the well-established dependence of seeding on elevated endogenous α-syn levels 33 , 52 , we observed a statistically significant increase in seeding in the SNCA -Triplication line. More importantly, at both time points, unmodified-PFFs induced greater α-syn seeding than NAc-PFF. Together, these results show that, compared to unmodified α-syn PFFs, N-terminally acetylated PFFs induce less seeding in DA neurons, consistent with their propensity for reduced binding, uptake and in vitro fibrillization. Download figure Open in new tab FIGURE 5. NAc-PFFs exhibit reduced seeding efficiency in iPSC-derived dopamine neurons. A) Schematic for experimental setup utilizing DA neurons assessing PFF vs NAc-PFF seeding activity. B) Representative immunofluorescence images of SNCA -WT iPSC-derived DA neurons treated with PFFs or NAc-PFFs for 4 weeks. Yellow arrowheads indicate intracellular pSyn inclusions used for quantification of seeding. C) Quantification of seeding efficiency measured by pSyn staining intensity in all three lines of iPSC-derived DA neurons ( SNCA -WT, SNCA -KO, and SNCA -Triplication) for 4 weeks and 6 weeks. Data is expressed as pSyn intensity ratio for each treatment condition over baseline ( SNCA -WT, vehicle treated). Statistical significance was assessed using two-way ANOVA followed by Tukey’s multiple comparison test. Bar graphs represent mean with error bars denoting ± SD. Significance levels are depicted in figure legends (“*” indicates p<0.05, “**” indicates p≤0.005, “****” indicates p<0.0001). M83 α-synuclein hemizygous transgenic mice injected with N-terminally acetylated α-synuclein preformed fibrils survive longer than mice injected with unmodified preformed fibrils To address the role of the N-terminal acetylation of α-syn in vivo , we used a well-characterized mouse model of spreading synucleinopathy 38 . All M83 hemizygous mice were injected the same day with PBS (control), unmodified PFFs or NAc-PFFs, in the right dorsal striatum (n= 40), and we divided the mice into two groups – survival and endpoint experiments. Fig. 6A summarizes the experimental timeline. For the survival experiment, we allowed each mouse to reach its individual humane endpoint before euthanizing it; all the mice injected with unmodified-PFFs developed symptoms and reached their humane endpoint before the first mouse injected with NAc-PFF became symptomatic ( Fig. 6B ). For the endpoint experiment, all mice were euthanized at the same time point once the first mouse reached the humane endpoint. This first mouse was part of the group injected with unmodified-PFFs. In both groups NAc- and unmodified-PFF injected mice, pSyn positive profiles were found in cell soma, dendritic branches and axons ( Fig. 6C ) of the substantia nigra (SN) whereas no pSyn staining was observed in the control mice (PBS-injected group). Importantly, pSyn staining was significantly lower in the substantia nigra ( Fig. 6D ) and pons ( Fig. 6E ) of mice injected with NAc-PFFs compared to those injected with unmodified PFFs. In contrast, no such reduction was observed in pSyn staining adjacent to the site of NAc-PFF injections in the right striatum ( Fig. 6F ), with even a slight trend towards increased pSyn staining in this region when mice were injected with NAc-PFF. We also used immunofluorescence to determine if the DA neurons, positive for TH, contained pSyn in the SN. In agreement with our in vitro studies, the percentage of TH-positive neurons containing pSyn appeared higher in the mice injected with unmodified-PFFs compared to the NAc-PFF, although this did not reach statistical significance ( Fig. 6G-H ). Overall, our results suggest that mice injected with NAc-PFF survive longer and that NAc-PFF propagation in the brain is slower and less extensive than for unmodified-PFFs. Download figure Open in new tab FIGURE 6. PFF injections lead to shorter survival and higher levels of phosphorylated synuclein than NAc-PFFs in vivo . A) Experimental timeline of mice models indicating end point and survival paradigms. B) Survival curves for mice injected with PBS, PFF, or NAc-PFF in the survival paradigm. C) Representative immunohistochemistry staining pSyn within the substantia nigra of mice injected with PBS or PFFs (unmodified or N-terminally acetylated). Yellow arrows indicate phosphorylated α-syn inclusions identified . D) Quantification of phosphorylated α-syn inclusions in the substantia nigra, E) pons and F) right striatum (Site of PFF injection). Statistical significance was assessed using one-way ANOVA. Bar graphs represent mean with error bars denoting ± SD. (“*” indicates p<0.05, “**” indicates p≤0.005) G) Representative images showing colocalization of TH and pSyn within neurons of the substantia nigra injected with either PFFs (n= 4) or NAc-PFFs (n= 6). White arrows indicate pSyn inclusions co-localized to TH+ neurons used for quantification. H) Quantification of percent TH neurons that show colocalization with pSyn in the substantia nigra. Statistical significance was assessed using unpaired t-test. Bar graphs represent mean with error bars denoting ± SD. Discussion In the present study, we provide important in vitro and in vivo evidence supporting that PFFs generated from N-terminally acetylated monomeric α-syn have a lower propensity for fibrillization, binding to the cell surface, internalization and cell-to-cell transmission. We demonstrate in RPE1 cells and iPSC-derived DA neurons that NAc-PFFs are internalized less readily than unmodified PFFs, regardless of endogenous α-syn expression levels. Furthermore, we propose that this is likely due to reduced binding to the cell surface via HSPG-modified receptors. Several receptors have been identified to bind α-syn, including HSPGs, LAG3, and neurexin 1β 23 , 27 , 53 , 54 . It is described that unmodified-PFF are internalized using HSPG-modified receptors whereas NAc-PFFs bind N-linked glycans and neurexin 1β 53 . However, our findings using heparinase indicate that HSPG are also involved, at least in part, in NAc-PFFs binding. Previous studies have shown that lipids and lipid-binding partners can be an important driver for the aggregation of α-syn in vitro 19 , 55 – 57 . As such, lower binding propensity to lipid membranes via acetylation may not only impact α-syn’s endogenous function but also alter the cellular pathology involved in PD which can be of focus for future studies. We find that N-terminal acetylation has a significant effect on the pathological impact of PFFs. We demonstrate that iPSC-derived DA neurons incubated with NAc-PFFs developed less pathological pSyn-positive inclusions than those treated with unmodified PFFs. This could be explained in several ways. First, reduced binding to the cell surface as shown in RPE1 cells could lead to less uptake and subsequent reduced exposure to fibrils that seed pathology within cells. Second, our in vitro data (ThT assay) indicate that NAc-PFFs have a lower propensity for α-syn monomer recruitment, which could explain the comparatively lower seeding of endogenous α-syn in cells. The effect of N-terminal acetylation on α-syn aggregation properties is controversial. Some studies have shown that NAc has little or no effect on α-syn aggregation 58 ; whereas other studies have shown slower α-syn aggregation and fibril formation 15 – 17 , 40 , 57 which is consistent with our results. Yet another study by Birol, Wojcik, Miranker and Rhoades 53 , showed higher seeding efficiency in primary neurons treated with acetylated PFFs, which contrasts with our findings. This difference may be due to differences in the methods of PFF generation, as it has been previously shown that PFFs generated in the presence of salt can lead to distinct, more pathologically potent strains of PFFs than those formed without salt 59 . Additionally, differences in neuronal culture models might also explain these diverging results. Finally, we demonstrate in a well-characterized in vivo mouse model that injection of NAc-PFFs lead to slower spreading of α-syn pathology as shown by increased survival and decreased presence of pSyn inclusions in disease-relevant brain regions. PFFs have been extensively used to induce toxicity in mouse models 60 , 61 . We hypothesize that the attenuated spreading of NAc-PFF-induced pathology throughout the brain is due to, at least in part, to their reduced propensity for cell surface binding, internalization and seeding. We can even speculate that the trend towards higher amounts of pSyn observed at the NAc-PFF injection sites compared to the unmodified-PFF injection sites reflects a lack of spreading and propagation N-terminally acetylated form. PTMs can have significant impact on the structural, biochemical, and physiological properties of proteins. While PTMs of α-syn have been well-described, much of their physiological and pathological functions remain to be elucidated. In this work, for the first time, we demonstrate that PFFs generated from N-terminally acetylated α-syn exhibit fundamentally altered cell surface binding properties and reduced internalization, seeding and cell-to-cell spreading both in vitro and in vivo. Thus, more broadly, our work points to the possibility that an imbalance or dysregulation of N-terminal acetylation may impact α-syn pathology or the rate of disease progression of synucleinopathies such as PD. Data availability The authors confirm that the data supporting the findings of this study are available within the article [and/or] its supplementary material. Funding This work was funded by grants from the Canadian Institutes of Health Research (PJT-195804). EAF is supported by a Canada Research Chair (Tier 1) in Parkinson’s disease. ZAMA was supported by a Canadian Institutes of Health Research doctoral Vanier Canada Graduate Scholarship (CGS-D) (FRN: CGV-186893). NCK is supported by the Fonds de recherche du Québec doctoral award, a graduate studentship from the Parkinson Society of Canada, and a graduate award from McGill’s Healthy Brains Healthy Lives program. J.-F.T. is a member of the Centre de Recherche en Biologie Structurale, funded by Fonds de Recherche du Québec (Health Sector) Research Centres Grant #288558. Mass spectrometry was performed at the McGill Pharmacology SPR-MS facility, funded by a grant from the Canada Foundation for Innovation to J.-F.T. (#229792). T.M.D. is supported by a project grant from the CIHR (PJT – 169095). Competing interests The authors report no competing interests. Supplementary material Supplementary material is provided online. Figure S1. Synuclein expression in iPSc-derived dopamine neurons. Immunofluorescence quantification of α-syn expression levels in SNCA-WT, SNCA-KO, and SNCA-Triplication iPSC-derived DA neurons. Data was normalized by subtracting KO signal to account for any background. Statistical significance was assessed using two-way ANOVA followed by Tukey’s multiple comparison test. Bar graphs represent mean with error bars denoting ± SD. (“****” indicates p<0.0001) Supplementary Table 1. List of reagents used for iPSC and DA neuronal induction, differentiation and maintenance. Supplementary Table 2. List of antibodies and their dilutions used in the current study for immunofluorescence, immunohistochemistry and Western blot. Acknowledgements We thank Professor Tim Bartels for the pTSara-NatB plasmid. We thank Tilo Kunath for the patient-derived SNCA triplication iPSC line and for the CRISPR-corrected isogenic SNCA WT and SNCA KO iPSC lines generated from the same patient. References 1. ↵ Spillantini MG , Schmidt ML , Lee VM , Trojanowski JQ , Jakes R , Goedert M . Alpha-synuclein in Lewy bodies . Nature. Aug 28 1997; 388 ( 6645 ): 839 – 40 . doi: 10.1038/42166 OpenUrl CrossRef 2. Anderson JP , Walker DE , Goldstein JM , et al. Phosphorylation of Ser-129 Is the Dominant Pathological Modification of α-Synuclein in Familial and Sporadic Lewy Body Disease* . Journal of Biological Chemistry . 2006 /10/06/ 2006;281(40):29739-29752. doi: 10.1074/jbc.M600933200 OpenUrl Abstract / FREE Full Text 3. ↵ Shahmoradian SH , Lewis AJ , Genoud C , et al. Lewy pathology in Parkinson’s disease consists of crowded organelles and lipid membranes . Nat Neurosci . Jul 2019 ; 22 ( 7 ): 1099 – 1109 . doi: 10.1038/s41593-019-0423-2 OpenUrl CrossRef PubMed 4. ↵ Book A , Guella I , Candido T , et al. A Meta-Analysis of α-Synuclein Multiplication in Familial Parkinsonism . Front Neurol . 2018 ; 9 : 1021 . doi: 10.3389/fneur.2018.01021 OpenUrl CrossRef PubMed 5. ↵ Calabresi P , Di Lazzaro G , Marino G , Campanelli F , Ghiglieri V . Advances in understanding the function of alpha-synuclein: implications for Parkinson’s disease . Brain . 2023 ; 146 ( 9 ): 3587 – 3597 . doi: 10.1093/brain/awad150 OpenUrl CrossRef PubMed 6. ↵ Henderson MX , Trojanowski JQ , Lee VM . α-Synuclein pathology in Parkinson’s disease and related α-synucleinopathies . Neurosci Lett. Sep 14 2019; 709 : 134316 . doi: 10.1016/j.neulet.2019.134316 OpenUrl CrossRef PubMed 7. ↵ Barrett PJ , Timothy Greenamyre J . Post-translational modification of α-synuclein in Parkinson’s disease . Brain Res. Dec 2 2015 ;1628(Pt B ): 247 – 253 . doi: 10.1016/j.brainres.2015.06.002 OpenUrl CrossRef PubMed 8. Schmid AW , Fauvet B , Moniatte M , Lashuel HA . Alpha-synuclein post-translational modifications as potential biomarkers for Parkinson disease and other synucleinopathies . Mol Cell Proteomics . Dec 2013 ; 12 ( 12 ): 3543 – 58 . doi: 10.1074/mcp.R113.032730 OpenUrl Abstract / FREE Full Text 9. Savyon M , Engelender S . SUMOylation in α-Synuclein Homeostasis and Pathology . Front Aging Neurosci . 2020 ; 12 : 167 . doi: 10.3389/fnagi.2020.00167 OpenUrl CrossRef PubMed 10. ↵ Sevcsik E , Trexler AJ , Dunn JM , Rhoades E . Allostery in a disordered protein: oxidative modifications to α-synuclein act distally to regulate membrane binding . J Am Chem Soc. May 11 2011; 133 ( 18 ): 7152 – 8 . doi: 10.1021/ja2009554 OpenUrl CrossRef 11. ↵ Kellie JF , Higgs RE , Ryder JW , et al. Quantitative Measurement of Intact Alpha-Synuclein Proteoforms from Post-Mortem Control and Parkinson’s Disease Brain Tissue by Intact Protein Mass Spectrometry . Scientific Reports . 2014 /07/23 2014;4(1):5797. doi: 10.1038/srep05797 OpenUrl CrossRef PubMed 12. Zhang S , Zhu R , Pan B , et al. Post-translational modifications of soluble α-synuclein regulate the amplification of pathological α-synuclein . Nature Neuroscience . 2023 /02/01 2023;26(2):213-225. doi: 10.1038/s41593-022-01239-7 OpenUrl CrossRef PubMed 13. ↵ Anderson JP , Walker DE , Goldstein JM , et al. Phosphorylation of Ser-129 Is the Dominant Pathological Modification of α-Synuclein in Familial and Sporadic Lewy Body Disease Journal of Biological Chemistry . 2006 ;281(40):29739-29752. doi: 10.1074/jbc.M600933200 OpenUrl Abstract / FREE Full Text 14. ↵ Bartels T , Choi JG , Selkoe DJ . α-Synuclein occurs physiologically as a helically folded tetramer that resists aggregation . Nature . 2011 /09/01 2011;477(7362):107-110. doi: 10.1038/nature10324 OpenUrl CrossRef PubMed Web of Science 15. ↵ Bell R , Castellana-Cruz M , Nene A , et al. Effects of N-terminal Acetylation on the Aggregation of Disease-related α-synuclein Variants . J Mol Biol. Jan 15 2023; 435 ( 1 ): 167825 . doi: 10.1016/j.jmb.2022.167825 OpenUrl CrossRef 16. ↵ Kang L , Moriarty GM , Woods LA , Ashcroft AE , Radford SE , Baum J . N-terminal acetylation of α-synuclein induces increased transient helical propensity and decreased aggregation rates in the intrinsically disordered monomer . Protein Sci . Jul 2012 ; 21 ( 7 ): 911 – 7 . doi: 10.1002/pro.2088 OpenUrl CrossRef PubMed 17. ↵ Bartels T , Kim NC , Luth ES , Selkoe DJ . N-alpha-acetylation of α-synuclein increases its helical folding propensity, GM1 binding specificity and resistance to aggregation . PLoS One . 2014 ;9(7):e103727. doi: 10.1371/journal.pone.0103727 OpenUrl CrossRef PubMed 18. ↵ Bell R , Thrush RJ , Castellana-Cruz M , et al. N-Terminal Acetylation of α-Synuclein Slows down Its Aggregation Process and Alters the Morphology of the Resulting Aggregates . Biochemistry . 2022 /09/06 2022;61(17):1743-1756. doi: 10.1021/acs.biochem.2c00104 OpenUrl CrossRef PubMed 19. ↵ Runfola M , De Simone A , Vendruscolo M , Dobson CM , Fusco G . The N-terminal Acetylation of α-Synuclein Changes the Affinity for Lipid Membranes but not the Structural Properties of the Bound State . Sci Rep. Jan 14 2020; 10 ( 1 ): 204 . doi: 10.1038/s41598-019-57023-4 OpenUrl CrossRef 20. ↵ Jan A , Gonçalves NP , Vaegter CB , Jensen PH , Ferreira N . The Prion-Like Spreading of Alpha-Synuclein in Parkinson’s Disease: Update on Models and Hypotheses . Int J Mol Sci. Aug 3 2021; 22 (15) doi: 10.3390/ijms22158338 OpenUrl CrossRef PubMed 21. Kordower JH , Chu Y , Hauser RA , Freeman TB , Olanow CW . Lewy body-like pathology in long-term embryonic nigral transplants in Parkinson’s disease . Nat Med . May 2008 ; 14 ( 5 ): 504 – 6 . doi: 10.1038/nm1747 OpenUrl CrossRef PubMed Web of Science 22. ↵ Paumier KL , Luk KC , Manfredsson FP , et al. Intrastriatal injection of pre-formed mouse α-synuclein fibrils into rats triggers α-synuclein pathology and bilateral nigrostriatal degeneration . Neurobiol Dis . Oct 2015 ; 82 : 185 – 199 . doi: 10.1016/j.nbd.2015.06.003 OpenUrl CrossRef PubMed 23. ↵ Holmes BB , DeVos SL , Kfoury N , et al. Heparan sulfate proteoglycans mediate internalization and propagation of specific proteopathic seeds . Proc Natl Acad Sci U S A. Aug 13 2013; 110 ( 33 ): E3138 – 47 . doi: 10.1073/pnas.1301440110 OpenUrl CrossRef 24. ↵ Vanderperre B , Muraleedharan A , Dorion MF , et al. Novel regulators of heparan sulfate proteoglycans modulate cellular uptake of α-synuclein fibrils . Communications Biology (in press). 2025 /08/22/ 2025; 25. Mao X , Gu H , Kim D , et al. Aplp1 interacts with Lag3 to facilitate transmission of pathologic α-synuclein . Nature Communications . 2024 /05/31 2024;15(1):4663. doi: 10.1038/s41467-024-49016-3 OpenUrl CrossRef PubMed 26. Ihse E , Yamakado H , van Wijk XM , Lawrence R , Esko JD , Masliah E . Cellular internalization of alpha-synuclein aggregates by cell surface heparan sulfate depends on aggregate conformation and cell type . Scientific Reports . 2017 /08/21 2017;7(1):9008. doi: 10.1038/s41598-017-08720-5 OpenUrl CrossRef PubMed 27. ↵ Mao X , Ou MT , Karuppagounder SS , et al. Pathological α-synuclein transmission initiated by binding lymphocyte-activation gene 3 . Science . 2016 /09/30 2016;353(6307):aah3374. doi: 10.1126/science.aah3374 OpenUrl Abstract / FREE Full Text 28. ↵ Rovere M , Powers AE , Patel DS , Bartels T . pTSara-NatB, an improved N-terminal acetylation system for recombinant protein expression in E. coli . PLOS ONE . 2018 ; 13 ( 7 ): e0198715 . doi: 10.1371/journal.pone.0198715 OpenUrl CrossRef PubMed 29. ↵ Del Cid Pellitero E , Shlaifer R , Luo W , et al. Quality Control Characterization of α-Synuclein Preformed Fibrils (PFFs). Zenodo2019 . 30. ↵ Groveman BR , Orrù CD , Hughson AG , et al. Rapid and ultra-sensitive quantitation of disease-associated α-synuclein seeds in brain and cerebrospinal fluid by αSyn RT-QuIC . Acta Neuropathol Commun. Feb 9 2018; 6 ( 1 ): 7 . doi: 10.1186/s40478-018-0508-2 OpenUrl CrossRef 31. ↵ Concha-Marambio L , Pritzkow S , Shahnawaz M , Farris CM , Soto C . Seed amplification assay for the detection of pathologic alpha-synuclein aggregates in cerebrospinal fluid . Nat Protoc . Apr 2023 ; 18 ( 4 ): 1179 – 1196 . doi: 10.1038/s41596-022-00787-3 OpenUrl CrossRef PubMed 32. ↵ Chen Y , Dolt KS , Kriek M , et al. Engineering synucleinopathy-resistant human dopaminergic neurons by CRISPR-mediated deletion of the SNCA gene . Eur J Neurosci . Feb 2019 ; 49 ( 4 ): 510 – 524 . doi: 10.1111/ejn.14286 OpenUrl CrossRef PubMed 33. ↵ Mohamed N-V , Sirois J , Ramamurthy J , et al. Midbrain organoids with an SNCA gene triplication model key features of synucleinopathy . Brain Communications . 2021 ; 3 ( 4 ):fcab223. doi: 10.1093/braincomms/fcab223 OpenUrl CrossRef 34. ↵ Deyab G , Thomas RA , Ding XE , et al. Midbrain organoids with an SNCA gene triplication display dopamine-dependent alterations in network activity . bioRxiv . 2025 :2025.04.23.650231. doi: 10.1101/2025.04.23.650231 OpenUrl Abstract / FREE Full Text 35. ↵ Jones-Tabah J , He K , Karpilovsky N , et al. The Parkinson’s disease risk gene cathepsin B promotes fibrillar alpha-synuclein clearance, lysosomal function and glucocerebrosidase activity in dopaminergic neurons . Molecular Neurodegeneration . 2024 /11/25 2024;19(1):88. doi: 10.1186/s13024-024-00779-9 OpenUrl CrossRef 36. Chen X , Lauinger N , Rocha C , Rao T , Durcan TM . Generation of dopaminergic or cortical neurons from neuronal progenitors . 2019 . 37. ↵ Jefri M , Bell S , Peng H , et al. Stimulation of L-type calcium channels increases tyrosine hydroxylase and dopamine in ventral midbrain cells induced from somatic cells . Stem Cells Transl Med . Jun 2020 ; 9 ( 6 ): 697 – 712 . doi: 10.1002/sctm.18-0180 OpenUrl CrossRef PubMed 38. ↵ Giasson BI , Duda JE , Quinn SM , Zhang B , Trojanowski JQ , Lee VM . Neuronal alpha-synucleinopathy with severe movement disorder in mice expressing A53T human alpha-synuclein . Neuron. May 16 2002; 34 ( 4 ): 521 – 33 . doi: 10.1016/s0896-6273(02)00682-7 OpenUrl CrossRef 39. ↵ Xue C , Lin TY , Chang D , Guo Z . Thioflavin T as an amyloid dye: fibril quantification, optimal concentration and effect on aggregation . R Soc Open Sci . Jan 2017 ; 4 ( 1 ): 160696 . doi: 10.1098/rsos.160696 OpenUrl CrossRef PubMed 40. ↵ Watson MD , Lee JC . N-Terminal Acetylation Affects α-Synuclein Fibril Polymorphism . Biochemistry . 2019 /09/03 2019;58(35):3630-3633. doi: 10.1021/acs.biochem.9b00629 OpenUrl CrossRef PubMed 41. ↵ Kuan W-L , Stott K , He X , et al. Systemic α-synuclein injection triggers selective neuronal pathology as seen in patients with Parkinson’s disease . Molecular Psychiatry . 2021 /02/01 2021;26(2):556-567. doi: 10.1038/s41380-019-0608-9 OpenUrl CrossRef 42. Bernis ME , Babila JT , Breid S , Wüsten KA , Wüllner U , Tamgüney G . Prion-like propagation of human brain-derived alpha-synuclein in transgenic mice expressing human wild-type alpha-synuclein . Acta Neuropathologica Communications . 2015 /11/26 2015;3(1):75. doi: 10.1186/s40478-015-0254-7 OpenUrl CrossRef PubMed 43. Braak H , Tredici KD , Rüb U , de Vos RAI , Jansen Steur ENH , Braak E . Staging of brain pathology related to sporadic Parkinson’s disease . Neurobiology of Aging . 2003 /03/01/ 2003;24(2):197-211. doi: 10.1016/S0197-4580(02)00065-9 OpenUrl CrossRef PubMed Web of Science 44. Kordower JH , Chu Y , Hauser RA , Freeman TB , Olanow CW . Lewy body–like pathology in long-term embryonic nigral transplants in Parkinson’s disease . Nature Medicine . 2008 /05/01 2008;14(5):504-506. doi: 10.1038/nm1747 OpenUrl CrossRef PubMed Web of Science 45. ↵ Kurowska Z , Englund E , Widner H , Lindvall O , Li J-Y , Brundin P . Signs of Degeneration in 12–22-Year Old Grafts of Mesencephalic Dopamine Neurons in Patients with Parkinson’s Disease . Journal of Parkinson’s Disease . 2011 ; 1 ( 1 ): 83 – 92 . doi: 10.3233/jpd-2011-11004 OpenUrl CrossRef 46. ↵ Bayati A , Banks E , Han C , et al. Rapid macropinocytic transfer of α-synuclein to lysosomes . Cell Rep. Jul 19 2022; 40 ( 3 ): 111102 . doi: 10.1016/j.celrep.2022.111102 OpenUrl CrossRef 47. Yang X , Jeong D , Madeo G , et al. Neuronal LAG3 facilitates pathogenic α-synuclein neuron-to-neuron propagation . bioRxiv. Jan 3 2025; doi: 10.1101/2025.01.03.631221 OpenUrl Abstract / FREE Full Text 48. Gu H , Yang X , Mao X , et al. Lymphocyte Activation Gene 3 (Lag3) Contributes to α-Synucleinopathy in α-Synuclein Transgenic Mice . Front Cell Neurosci . 2021 ; 15 : 656426 . doi: 10.3389/fncel.2021.656426 OpenUrl CrossRef PubMed 49. Chen K , Martens YA , Meneses A , et al. LRP1 is a neuronal receptor for α-synuclein uptake and spread . Molecular Neurodegeneration . 2022 /09/02 2022;17(1):57. doi: 10.1186/s13024-022-00560-w OpenUrl CrossRef PubMed 50. ↵ Schechter M , Atias M , Abd Elhadi S , Davidi D , Gitler D , Sharon R . α-Synuclein facilitates endocytosis by elevating the steady-state levels of phosphatidylinositol 4,5-bisphosphate . J Biol Chem. Dec 25 2020; 295 ( 52 ): 18076 – 18090 . doi: 10.1074/jbc.RA120.015319 OpenUrl CrossRef 51. ↵ Oueslati A , Fournier M , Lashuel HA. Chapter 7 - Role of post-translational modifications in modulating the structure, function and toxicity of α-synuclein: Implications for Parkinson’s disease pathogenesis and therapies. In: Björklund A, Cenci MA, eds . Progress in Brain Research . Elsevier; 2010 :115-145. 52. ↵ Iannielli A , Luoni M , Giannelli SG , et al. Modeling native and seeded Synuclein aggregation and related cellular dysfunctions in dopaminergic neurons derived by a new set of isogenic iPSC lines with SNCA multiplications . Cell Death & Disease . 2022 /10/19 2022;13(10):881. doi: 10.1038/s41419-022-05330-6 OpenUrl CrossRef PubMed 53. ↵ Birol M , Wojcik SP , Miranker AD , Rhoades E . Identification of N-linked glycans as specific mediators of neuronal uptake of acetylated α-Synuclein . PLOS Biology . 2019 ; 17 ( 6 ): e3000318 . doi: 10.1371/journal.pbio.3000318 OpenUrl CrossRef PubMed 54. ↵ Feller B , Fallon A , Luo W , et al. α-Synuclein Preformed Fibrils Bind to β-Neurexins and Impair β-Neurexin-Mediated Presynaptic Organization . Cells. Apr 4 2023; 12 (7) doi: 10.3390/cells12071083 OpenUrl CrossRef 55. ↵ Maltsev AS , Ying J , Bax A . Impact of N-Terminal Acetylation of α-Synuclein on Its Random Coil and Lipid Binding Properties . Biochemistry . 2012 /06/26 2012;51(25):5004-5013. doi: 10.1021/bi300642h OpenUrl CrossRef PubMed Web of Science 56. Tang Z , Fang Z , Wu X , et al. Folding of N-terminally acetylated α-synuclein upon interaction with lipid membranes . Biophysical Journal . 2024 /11/05/ 2024;123(21):3698-3720. doi: 10.1016/j.bpj.2024.09.019 OpenUrl CrossRef PubMed 57. ↵ Iyer A , Roeters SJ , Schilderink N , et al. The Impact of N-terminal Acetylation of α-Synuclein on Phospholipid Membrane Binding and Fibril Structure . J Biol Chem. Sep 30 2016; 291 ( 40 ): 21110 – 21122 . doi: 10.1074/jbc.M116.726612 OpenUrl CrossRef 58. ↵ Fauvet B , Mbefo MK , Fares MB , et al. α-Synuclein in central nervous system and from erythrocytes, mammalian cells, and Escherichia coli exists predominantly as disordered monomer . J Biol Chem. May 4 2012; 287 ( 19 ): 15345 – 64 . doi: 10.1074/jbc.M111.318949 OpenUrl CrossRef 59. ↵ Lau A , So RWL , Lau HHC , et al. α-Synuclein strains target distinct brain regions and cell types . Nature Neuroscience . 2020 /01/01 2020;23(1):21-31. doi: 10.1038/s41593-019-0541-x OpenUrl CrossRef PubMed 60. ↵ Luk KC , Kehm V , Carroll J , et al. Pathological α-synuclein transmission initiates Parkinson-like neurodegeneration in nontransgenic mice . Science. Nov 16 2012; 338 ( 6109 ): 949 – 53 . doi: 10.1126/science.1227157 OpenUrl CrossRef 61. ↵ Masuda-Suzukake M , Nonaka T , Hosokawa M , et al. Prion-like spreading of pathological α-synuclein in brain . Brain . Apr 2013 ; 136 (Pt 4 ): 1128 – 38 . doi: 10.1093/brain/awt037 OpenUrl CrossRef PubMed Web of Science View the discussion thread. Back to top Previous Next Posted November 21, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following N-terminal acetylation reduces α-synuclein pathology in models of Parkinson’s disease Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share N-terminal acetylation reduces α-synuclein pathology in models of Parkinson’s disease Esther del Cid-Pellitero , Thomas Goiran , Zaid A.M. Al-Azzawi , Nathan C. Karpilovsky , Jace Jones-Tabah , Jonas J. Mayo , Frederique Larroquette , Wen Luo , Irina Shlaifer , Yogitha Thattikota , Andrew Bayne , Jean-Francois Trempe , Thomas M. Durcan , Edward A. Fon bioRxiv 2025.11.21.689703; doi: https://doi.org/10.1101/2025.11.21.689703 Share This Article: Copy Citation Tools N-terminal acetylation reduces α-synuclein pathology in models of Parkinson’s disease Esther del Cid-Pellitero , Thomas Goiran , Zaid A.M. Al-Azzawi , Nathan C. Karpilovsky , Jace Jones-Tabah , Jonas J. Mayo , Frederique Larroquette , Wen Luo , Irina Shlaifer , Yogitha Thattikota , Andrew Bayne , Jean-Francois Trempe , Thomas M. Durcan , Edward A. Fon bioRxiv 2025.11.21.689703; doi: https://doi.org/10.1101/2025.11.21.689703 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Molecular Biology Subject Areas All Articles Animal Behavior and Cognition (7636) Biochemistry (17704) Bioengineering (13897) Bioinformatics (41963) Biophysics (21460) Cancer Biology (18598) Cell Biology (25525) Clinical Trials (138) Developmental Biology (13383) Ecology (19908) Epidemiology (2067) Evolutionary Biology (24325) Genetics (15613) Genomics (22512) Immunology (17738) Microbiology (40422) Molecular Biology (17190) Neuroscience (88634) Paleontology (667) Pathology (2835) Pharmacology and Toxicology (4825) Physiology (7645) Plant Biology (15158) Scientific Communication and Education (2046) Synthetic Biology (4302) Systems Biology (9825) Zoology (2271)