Isolation, molecular detection and antimicrobial susceptibility profiles of Campylobacter from camel meat, feces and processing environments at municipal abattoirs in eastern Ethiopia

Isolation, molecular detection and antimicrobial susceptibility profiles of Campylobacter from camel meat, feces and processing environments at municipal abattoirs in eastern Ethiopia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Isolation, molecular detection and antimicrobial susceptibility profiles of Campylobacter from camel meat, feces and processing environments at municipal abattoirs in eastern Ethiopia Metages Yirgalem, Jelalu Kemal, Takele Wolkaro, Misgana Bekele, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4173994/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Campylobacteriosis is an infectious zoonotic disease caused by the genus Campylobacter . The disease is transmitted from animals to humans predominantly through the consumption of contaminated food and water. However, the lack of information on the status of Campylobacter makes it difficult to quantify the role of camel meat in the dissemination of the pathogen. A cross-sectional study was conducted from June 2022 to August 2023 to investigate the occurrence of Campylobacter and associated risk factors and to determine the antimicrobial susceptibility profiles of Campylobacter species from camels slaughtered at municipal abattoirs in the towns of Harar, Babile, Jigjiga and Dire Dawa in eastern Ethiopia. Methods A total of 324 (146 carcass swabs, 146 camel feces and 32 abattoir environmental swab samples) were collected and analyzed using TaqMan real-time PCR and culture techniques following standard procedures. In addition, antimicrobial susceptibility tests were performed using the disk diffusion method for eight antimicrobial agents according to the Clinical Laboratory Standards Institute. Results The overall prevalence of Campylobacter was found to be 7.7%. Campylobacter was more frequently detected from carcasses and surface contact environmental swabs. We isolated Campylobacter at the genus level from approximately half of the PCR-positive samples, representing 54.2% (13 out of 24). The isolation level of C. jejuni and C. coli were also 5.56% and 2.2%, respectively, which varied significantly (p = 0.037) based on sample type and site. We detected resistance to chloramphenicol (78.6%), followed by amoxicillin (71.4%). However, 93%, 78.6%, and 71.4% of the isolates were susceptible to ceftriaxone, ciprofloxacin, and nalidixic acid, respectively. MDR was detected in 48% of the isolates. Of these MDR isolates, 9 (36%) were C. jejuni and 3 (12%) were C. coli. Conclusion The study concluded that a considerable proportion of multidrug-resistant Campylobacter species are circulating in camel meat and abattoir environments. This indicates a possible carcass cross-contamination by Campylobacter during slaughtering that can pose a threat to humans and limits therapeutic options, which could have been prevented by applying good hygienic practices in the abattoirs. This needs to create awareness of abattoir workers about abattoir hygienic standard operating procedures. Regular coordinated actions should be implemented on the rational use of veterinary and medical drugs at national level together with training and awareness to workers on good hygienic practices. Antimicrobial resistance Camel carcass C. coli C. jejuni Figures Figure 1 Figure 2 Figure 3 Introduction Camel is one of the most important livestock species in arid and semiarid areas of Ethiopia. These compounds are crucial for addressing global protein shortages caused by the sharp increase in demand for animal proteins [ 1 ]. However, food of animal origin, particularly meat, can be prone to microbial spoilage and can harbor a wide variety of foodborne and zoonotic microorganisms [ 2 ]. Campylobacter is a genus of bacteria that is found in the intestines of animals and humans. This genus consists of 22 species, of which the best known are C. jejuni and C. coli , which are mainly responsible for gastroenteritis in humans worldwide [ 3 ]. Campylobacter is particularly prevalent, with an estimated 400 million cases per year worldwide. While campylobacteriosis cases have often been linked to the consumption of fecal contaminated food and water, the consumption of undercooked meat has also been identified as a source of infection. Above all, humans may be infected by contact with live animals and environments contaminated with animal feces and subsequent incidental ingestion of the pathogens [ 4 ]. Human campylobacteriosis symptoms can range from mild diarrhea to bloody diarrhea, and Campylobacter infections can lead to long-term detrimental neurological consequences in the form of postinfection Guillain‒Barré syndrome [ 5 ], Miller Fisher syndrome (MFS), and functional bowel diseases, such as irritable bowel syndrome [ 6 ]. In developing countries such as Ethiopia, it is one of the most common bacteria isolated from the stools of children under five years old with diarrhea, largely as a result of contaminated food or water. However, despite its extremely high worldwide incidence, it is underdiagnosed and underreported [ 7 ]. The majority of Campylobacter bacteria are highly resistant to beta-lactam drugs, including ampicillin, amoxicillin, and cefotaxime. The most effective medications for treating campylobacteriosis are believed to be macrolides and fluoroquinolones, although some strains of this bacterium are becoming resistant to these drugs [ 5 ]. The resistance of Campylobacter to common antibiotics used to treat infections is a rising problem worldwide and may limit the selection of available therapies [ 8 ]. Therefore, the emergence of drug-resistant Campylobacter strains underscores the need for robust surveillance systems to monitor the prevalence and distribution of antibiotic resistance. Additionally, there is a need for more prudent use of antibiotics in both human and veterinary medicine to reduce selective pressure and minimize the development and spread of antibiotic resistance [ 9 ]. A few recently reported studies of Campylobacter species from apparently healthy food animals and humans in Ethiopia showed isolation levels ranging from 5–16.7% [ 10 , 11 ]. This persistent occurrence of Campylobacter highlights its relevance as a public health concern and demands proper control. In addition, many countries, including Ethiopia, have reported a rapid increase in Campylobacter strains resistant to antimicrobial agents, particularly fluoroquinolones and macrolides. Nonetheless, there is a scarcity of data on the prevalence of antimicrobial resistance and the various risk factors that contribute to the occurrence of Campylobacter in Ethiopia. Despite the scarcity of data, few fragmented and limited studies have been conducted on Campylobacter species in the eastern parts of the country, where camel meat is one of the main sources of protein. For instance, Tegegne et al. [ 12 ] studied the microbiological safety and hygienic quality of camel meat at abattoirs and retail houses in Jigjiga city and reported an overall 5% prevalence of Campylobacter . In this study, only Jigjiga was targeted, and antimicrobial susceptibility tests were not performed. The authors identified Campylobacter at the genus level only with culture-based techniques. The lack of well-documented information regarding the epidemiological status and antimicrobial susceptibility pattern of Campylobacter species in camels in eastern Ethiopia makes it difficult to quantify the role of camels in the dissemination of the pathogen and design appropriate control and prevention measures. Therefore, the objective of this study was to investigate and assess the associated risk factors and determine the antimicrobial susceptibility profiles of Campylobacter species from camels slaughtered at municipal abattoirs in the towns of Harar, Babile, Jigjiga and Dire Dawa in eastern Ethiopia. Materials and methods Description of the study area The study was conducted in the Harar, Babile, Jigjiga and Dire Dawa municipal abattoirs. All the municipal abattoirs in these towns provide slaughter services for camels. The animals used for slaughter were mainly from the surrounding districts of the east Hararge zone, the Somali regional state, and other nearby areas. Harar town is geographically located between 9.11 0 and 9.24 0 north of latitude and 42.03 and 42.16 0 east of longitude and is located 526 km east of Addis Ababa and 31 km west of the Babile district [ 13 ]. The Dire Dawa city administration is geographically located in the eastern part of Ethiopia at 9°36′ N and 41°52′E and is located 515 km away from Addis Ababa. The area is situated 1200 meters above sea level and has a mean annual rainfall and humidity of 594 mm and 41.82%, respectively. The mean annual maximum and minimum temperatures of the town are 31.4 0 C and 18.41 0 C, respectively [ 14 ]. Babile town is located in the eastern corner of the eastern Hararge zone of the Oromia Regional State, bordering the Gursum, Fedis, Harari and Somali Regional States. It is located at 9°08’N latitude, 42°21’E longitude, and 557 km away from Addis Ababa. The town has an altitude that ranges from 950 to 2000 m above sea level. The mean annual minimum and maximum temperatures range from 18–28°C, while the mean annual rainfall and humidity range from 700–900 mm and 33–38%, respectively. The town has a total area of 3169.06 km 2 . The two prevailing agricultural production systems are pastoral and agro-pastoral production systems [ 14 ]. Jigjiga town is the administrative capital of the Ethiopian Somali Regional State. Geographically, it is located approximately 628 km east of Addis Ababa, 74 km east of the Babile district and 60 km west of the border with the Republic of Somali-land. The town has an altitude of 1609 metres above sea level, a latitude and longitude of 9°21’N and 42°48`E, and a mean annual rainfall and humidity of 712 mm and 57.1%, respectively. The mean annual maximum and minimum temperatures of the town are 27.49°C and 12.3°C, respectively [ 14 ] (Fig. 1 ). Study design and sample size determination A cross-sectional study was conducted from June 2022 to August 2023 to investigate the occurrence of Campylobacter species in camel carcasses, fecal samples, and environmental swab samples. An in vitro susceptibility test was applied to the isolates obtained from the collected samples using a disc diffusion technique. The sample size was determined using the formula given by Thrusfield [ 15 ], with a 95% confidence interval at 5% precision, based on the 5% expected incidence reported in a previous study by Tegegne et al . [ 12 ]. N = Z 2 *Pexp (1-Pexp) d 2 Accordingly, 73 samples were calculated, and this number was doubled to 146 to increase the precision of the estimate. The estimated number of camels slaughtered at each abattoir was obtained from abattoir records. Two separate pairs of samples (146 fecal and 146 carcass samples) were collected, for a total of 292 samples. Additionally, 32 environmental swab samples were collected. Therefore, 324 overall carcass, fecal and environmental swab samples were collected (Table 1 ). Table 1 Distributions of samples with respect to study sites and sample type Study sites Sample Type Total Carcass swab Fecal Environmental Dire Dawa 39 39 8 86 Harar 24 24 8 56 Babile 32 32 8 72 Jigjiga 51 51 8 110 Total 146 146 32 324 Sampling technique A total of 146 fresh fecal, 146 carcass and 32 environmental swab samples were collected from each systematically and purposively selected camel for laboratory analysis. Swab samples were collected by the use of commercially available transport tubes containing buffered peptone water that protects Campylobacter species from drying and the toxic effects of oxygen, as recommended by OIE [ 16 ]. The selected carcasses were swabbed using sterile cotton-tipped swabs fitted with a shaft on specific sites on the carcass, abdomen (flank), thorax (lateral), and breast (lateral), which are the sites with the highest rates of contamination. The sterile cotton at each site was first soaked in 10 ml of buffered peptone water (BPW), which was first rubbed horizontally and then vertically several times on the carcasses. Swab samples from four sites on the right and left sides of an animal were taken as a pool. Fecal samples were collected directly from the rectum immediately after slaughter. The fecal samples were subsequently placed in a sterile screw-capped container containing 10 ml of BPW [ 16 ]. Environmental samples were taken from the surfaces of the walls, floors, personnel hands, knives, hooks, and aprons with sterile cotton tipped swabs on each sampling day as a pooled sample in screw-capped test tubes containing 10 ml of BPW. Finally, the samples were immediately transported to Haramaya University Central Laboratory, Food Microbiology and Toxicology Lab. in an ice box with ice packs for microbiological analysis and molecular detection of the pathogen. Survey data collection A semi-structured interview questionnaire was presented for 60 abattoir workers (8, 15, 18, and 19 respondents, based on their consent from Babile, Harar, Dire Dawa and Jigjiga, respectively) with the intent of determining carcass contamination. The information collected included the sociodemographic characteristics of the abattoir workers, their knowledge and practices and their observational assessments of the abattoirs during each sampling day. Isolation and identification of Campylobacter species Selective solid media for the isolation of Campylobacter species were prepared using chromogenic agar media (CHROMagar™ Campylobacter base) (George Sand – La Plaine Saint-Denis, France). A selective supplement (CHROMagar™ Campylobacter CP572) (George Sand – La Plaine Saint-Denis, France) was filter sterilized through a 0.45 µm pore size cellulose acetate filter and added to the CHROM agar according to the manufacturer’s instructions (Paris, France). The samples were processed immediately and incubated at 42°C for 48 hours under microaerophilic conditions [ 17 ]. Suspected colonies (small colonies with a brick-red color) on the selective media were sub-cultured and incubated under microaerophilic conditions. For this test, presumptive colonies were subjected for sub-culturing from selective agar and incubated aerobically at 41.5 ± 1°C for 22 ± 1 hour and in microaerophilic condition. Presumptive colonies were subjected to further identification based on standard microbiological and biochemical procedures, including Gram reactions, motility tests, production of catalase and oxidase, hippurate hydrolysis tests, and susceptibility to cephalothin and nalidixic acid disks. Hippurate-positive isolates were identified as C. jejuni and nalidixic acid susceptible, and hypurate-negative isolates were considered C. coli [ 18 ]. Then, pure colonies of the identified Campylobacter species were picked up with a sterile loop, immersed in 0.5 ml of brain-heart infusion broth medium and preserved at -20°C. Antimicrobial susceptibility test Antimicrobial susceptibility tests were performed by the Kirby–Bauer disk diffusion method using Mueller–Hinton agar with 5% defibrinated sheep blood according to the Clinical Laboratory Standards Institute [ 19 ]. The following antimicrobial agents were tested for Campylobacter species: ampicillin (AMP) (10 µg), amoxicillin with clavulanic acid (AMC) (30 µg), chloramphenicol (C) (30 µg), ceftriaxone (CRO) (10 µg), sulfamethoxazole-trimethoprim (STX) (25 µg), erythromycin (E) (15 µg), ciprofloxacin (CIP) (30 µg), and nalidixic acid (NA) (5 µg). Molecular detection of Campylobacter by polymerase chain reaction (PCR) DNA extraction From the culture broth, DNA was extracted using a Genomic DNA Purification Kit and a QIAamp PowerFecal Pro DNA Kit (Qiagen, CA, USA) following the manufacturer’s protocol. Briefly, 0.25 ml of the culture sample was subjected to genomic DNA extraction according to the manufacturer’s instructions, after which the sample was suspended in 100 ml of nuclease-free water. DNA quality and quantity were assessed by a UV5 Nano spectrophotometer, and the DNA was stored at -20°C until further use. Confirmation of Campylobacter isolates using TaqMan real-time PCR Campylobacter was detected from culture samples using TaqMan real-time PCR. The primers used in PCRs targeting Campylobacter 16S rRNA were (forward: GATGACACTTTTCGGAGCGTAA and reverse: GCTTGCACCCTCCGTATTA) based on Platts-Mills et al. [ 20 ]. PCR was carried out in a total final volume of 25 µl containing 0.1 nM of each primer, 12.5 mL of PrimeTime gene expression master mix (an Integrated DNA Technologies, USA), 0.05 nM of the probe, 50 ng of normalized DNA, and nuclease-free water. QuantStudio 5 was used to run the real-time PCR. A positive control containing template genomic DNA from C. jejuni (ATCC 81–176) and C. upsaliensis (ATCC 49816) was used. As a negative control, nuclease-free water was used. The reaction thermocycler conditions were optimized with initial denaturation at 95°C for 10 min of 1 cycle of 45 cycles of denaturation at 95°C for 15 sec, annealing at 55°C for 1 min and extension at 72°C for 1 min. Finally, an additional extension was achieved for 7 min at 72°C, after which the samples were stored at 4°C. A cutoff C T value of 35 was used for the detection of Campylobacter in each sample: average C T for nuclease-free water − 2.5 × standard deviation. Data management and analysis All the data were stored and prepared in the Microsoft Excel sheet program, and the analysis was performed using STATA 12 statistical package software. Descriptive statistics, chi-square tests and univariate and multivariate logistic regression analyses were conducted to assess the associations among the independent variables and the outcome variable; variables found to be significant at a P value < 0.2 were used to construct a multivariate model. Odds ratios were calculated with 95% confidence intervals (CIs) to determine the strength of the associations, and differences were considered significant at p < 0.05. Results The overall prevalence of Campylobacter species The overall prevalence of Campylobacter species was 7.7% (25/324). The most prevalent Campylobacter species was C. jejuni (5.5%) followed by C. coli (2.2%). There were no significant differences among the study sites. However, the highest prevalence of Campylobacter was recorded in Babile town (40%), followed by Jigjiga (24%). The samples from Babile town had the highest C. jejuni occurrence among the study sites (P = 0.037). The proportion of C. coli in young camels was significantly greater than that in adult camels (P = 0.003). Similarly, there were significantly more Campylobacter species in the environmental samples than in the other sample types (P = 0.001) (Table 2 ). Table 2 Campylobacter prevalence and species distribution among different risk factors Variables Categories N o . examined N o positive (%) N o . (%) of samples positive C. jejuni C. coli Study site Dire Dawa 86 5 (5.8) 3 (3.5) 2 (2.3) Harar 56 4 (7.1) 2 (3.6) 2 (3.6) Babile 72 10 (13.9) 9 (12.5) 1 (1.4) Jigjiga 110 6 (5.5) 4 (3.6) 2 (1.8) Total 324 25 (7.7) 18 (5.5) 7 (2.2) χ2 (p value) 5.1057 (0.164) 8.51 (0.037)* 0.802 (0.849) Sex Male 263 13 (5) 7 (2.67) 6 (2.3) Female 29 2 (6.9) 2 (6.9) 0 Total 292 15 (5.1) 9 (3) 6 (2) χ 2 (p value ) 0.2046 (0.651) 1.568 (0.21) 0.676 (0.411) Age Young 79 7 (8.9) 2 (2.53) 5 (6.3) Adult 213 8 (3.75) 7 (3.3) 1 (0.47) Total 292 15 (5.1) 9 (3) 6 (2) χ2 (p value) 2.586 (0.108) 0.18 (0.675) 9.078(0.003)* Body condition Medium 104 5 (4.8) 2 (2) 3 (2.9) Good 188 10 (5.3) 7 (3.7) 3 (1.6) Total 292 15 (5.1) 9 (3) 6 (2) χ2 (p value) 0.0359 (0.850) 0.7265(0.394) 0.553 (0.457) Sample type Carcass 146 10 (6.8) 8 (5.5) 2 (1.4) Fecal 146 5 (3.4) 1 (0.7) 4 (2.7) Environment 32 10 (31.25) 9 (28) 1 (3.1) Total 324 25 (7.7) 18 (5.56) 7 (2.2) χ2 ( p value ) 28.819 (0.001)* 37.67(0.001)* 0.8043(0.669) Multivariate logistic regression analysis of C. coli and C. jejuni Multivariate logistic regression analysis for the occurrence of C. jejuni revealed a significant association among the study sites ( P < 0.05). The odds of occurrence of C. jejuni in Babile municipal abattoir was 4.55 times greater than those in Dire Dawa and the rest of the municipal abattoirs (p = 0.041; AOR = 4.549; 95% CI = 1.065–19.43). Multivariate logistic regression analysis of the occurrence of C. jejuni isolated from different sample types revealed a significant association ( P < 0.05). The odds of occurrence of C. jejuni in samples collected from abattoir environments was 7.52 times greater than those in carcass and fecal samples (P = 0.001; AOR = 7.5217; 95% CI = 2.4745–22.864) (Table 3 ). Table 3 Multivariable logistic regression analysis for the occurrence of C. jejuni isolates from camel meat samples in selected towns in eastern Ethiopia Variables Categories N o . examined No. (%) of C. jejuni isolates AOR (95% CI) p value Study site Dire Dawa 86 3 (3.5) 1 Harar 56 2 (3.6) 0.7884 (0.1167–5.327) 0.807 Babile 72 9 (12.5) 4.549 (1.065–19.43) 0.041* Jigjiga 110 4 (3.6) 1.189 (0.24–5.889) 0.83 Sample type Carcass 146 8 (5.5) 1 Feces 146 1 (0.7) 0.1153 (.01411-.9425) 0.044* Environment 32 9 (28) 7.5217(2.4745–22.864) 0.001* Prevalence of Campylobacter species in different sample types among sites There was a statistically significant difference among the different sample types in terms of the occurrence of C. jejuni (p = 0.001). A high prevalence of Campylobacter species was detected in the carcass swab samples collected from Babile (7.7%), followed by Jigjiga (5.9%). Examination of 146 camel fecal samples for intestinal carriage revealed that 5 (3.42%) were Campylobacter species positive (Table 3 ). The numbers and percentages of Campylobacter species isolated from fecal samples were 1 and 4 for C. jejuni and C. coli , respectively. C. jejuni and C. coli accounted for 9 and 1%, respectively, of the Campylobacter species isolated from the environmental samples (Table 4 ). Table 4 Prevalence of Campylobacter species isolated from different samples across study sites Variables Total Ex ’ d Dire Dawa Harar Babile Jigjiga No. Ex ’ d No. positive No. Ex ’ d No. positive No. Ex ’ d No. positive No. Ex ’ d No. positive C. jej C. col C. jej C.col C. jej C. col C. jej C. col Carcass s wab 146 39 2( 5.1 ) 1( 2.56 ) 24 - 1 ( 4.2 ) 32 3( 7.7 ) - 51 3( 5.9 ) - Fecal sample 146 39 - 1( 2.56 ) 24 - 1( 4.2 ) 32 1( 3.1) 1( 3.1 ) 51 - 1( 1.97 ) Environment 32 8 1( 12.5 ) - 8 2(6.3) - 8 5( 62.5 ) - 8 1 (1 2.5 ) 1( 12.5 ) Total 324 86 3(3.5) 2(2.3) 56 2(3.6) 2(3.6) 72 9(12.5) 1(1.4) 110 4(3.6) 2(1.8) PCR confirmation of Campylobacter isolates Molecular detection of Campylobacter from culture samples was determined based on the threshold cycle values ( CTs ) obtained for each sample against the no-DNA controls (nuclease-free water controls), which provided background noise estimates (i.e., fluorescence signals that were obtained through nonspecific amplification via PCR). Thus, it was used to examine Campylobacter -positive and -negative samples. For the detection of Campylobacter in the culture samples, a cutoff C T value of 35 was used for each sample (average C T value for nuclease-free water − 2.5 × standard deviation). With this PCR test of 24 culture samples examined, 13 (54.2%) were found to be positive for Campylobacter (Table 5 ; Fig. 2 ). Table 5 Details of PCR Campylobacter detection with C T values in 28 samples, including 2 positive and 2 negative control samples. Well Position Sample Code Target Name C T Value Remark A1 B3E2 Target 1 38.080 Negative A2 B6F4 Target 1 40.086 Negative A3 AC6 Target 1 22.353 Positive A4 B6F1 Target 1 25.534 Positive A5 B3E6 Target 1 23.985 Positive A6 H6C7 Target 1 22.572 Positive A7 A3C6 Target 1 33.124 Positive A8 B2H1 Target 1 35.366 Negative B1 A7E5 Target 1 37.209 Negative B2 J1A1 Target 1 39.697 Negative B3 A7C7 Target 1 37.078 Negative B4 A2C5 Target 1 32.522 Positive B5 B6E1 Target 1 23.970 Positive B6 B6C1 Target 1 31.870 Positive B7 H5C2 Target 1 Undetermined Negative B8 B6FA Target 1 21.909 Positive C1 H4C4 Target 1 38.128 Negative C2 H2C5 Target 1 25.195 Positive C3 B1C1 Target 1 40.162 Negative C4 J3E1 Target 1 32.604 Positive C5 D3C4 Target 1 33.673 Positive C6 D2C1 Target 1 37.774 Negative C7 D2F1 Target 1 33.560 Positive C8 D4C5 Target 1 37.153 Negative D1 PC1 Target 1 12.900 Positive D2 PC2 Target 1 13.714 Positive D3 NC Target 1 38.926 Negative D4 BC Target 1 36.801 Negative Antimicrobial susceptibility profile of Campylobacter isolates Among the 20 isolates tested, all (100%) were resistant to one or more antimicrobial agents, whereas two (1 C. jejuni and 1 C. coli ) were susceptible to the 5 antimicrobial agents tested. Three isolates (15%) were resistant to a single antimicrobial agent, and 5 isolates (25%) were resistant to 2 antimicrobial agents. The highest levels of Campylobacter resistance were recorded for chloramphenicol (70%) and amoxicillin-clavulanic acid (65%), while the least common antimicrobial agents for this specific test were ceftriaxone (5%), followed by ciprofloxacin and nalidixic acid (10%) (Table 6 ) (Fig. 3 ). Table 6 Antibiotic resistance profile of Campylobacter species isolated from camel carcass, feces and environmental samples in selected areas of eastern Ethiopia Drugs Drug potency C. jejuni (n = 14) C. coli (n = 6) S I R S I R N (%) N (%) N (%) N (%) N (%) N (%) AMC 30 µg 2 (14.2) 2 (14.2) 10(71.4) 2 (33.3) 1 (16.7) 3 (50) C 30µg 1 (7.1) 2 (14.2) 11 (78.6) 2 (33.3) 1 (16.7) 3 (50) CIP 30 µg 11 (78.6) 2 (14.2) 1 (7.1) 4 (66.7) 1 (16.7) 1 (16.7) CRO 10 µg 13 (93) - 1 (7.1) 5 (83.3) 1 (16.7) - E 15µg 6 (43) 3 (21.4) 5 (35.7) 3 (50) 1 (16.7) 2 (33.3) SAM 10 µg 4 (28.6) 4 (28.6) 6 (42.8) 4 (66.7) - 2 (33.3) STX 25µg 2 14.2) 3 (21.4) 9 (64.3) 2 (33.3) 2 (33.3) 2 (33.3) NA 5 µg 10 (71.4) 3 (21.4) 1 (7.1) 4 (66.7) 1 (16.7) 1 (16.7) AMC: amoxicillin-clavunated, C: chloramphenicol, CIP: ciprofloxacin, CRO: ceftriaxone, erythromycin, AMP: ampicillin, STX: sulfamethoxazole-trimethoprim, NA: nalidixic acid, S: susceptible, I: intermediate R: resistant Multidrug resistance (MDR) to three or more antimicrobial agents was observed in 12 (48%) Campylobacter isolates. Among these MDR isolates, 9 (36%) were C. jejuni and 3 (12%) were C. coli. Of these, 5 (41.7%) were from carcasses, 3 (25%) were from feces, and 4 (33.3%) were recovered from abattoir environment samples. The MDR for the maximum number of antimicrobial disks (five antimicrobial agents) observed was registered for C. jejuni strains (Table 7 ). Table 7 Multidrug resistance profile of Campylobacter isolates from camel meat Number Resistant profile Nu. of resistant isolates (%) C. jejuni (n = 14) C. coli (n = 6) One drug STX 1 (5.6) 1 (14.3) Two drugs NA - 1 (14.3) AMC,C 2 (11) 1 (14.3) SAM,STX 1 (5.6) - AMC, NA 1 (5.6) - Three & more drugs AMC,C,E,SAM,STX,CIP,AMC,CRO 9 (50) 3 (43) Total 14 (78) 6 (86) Results of the questionnaire survey Sociodemographic characteristics of the respondents Out of the 60 respondents interviewed, 55 (91.7%) were male, while the remaining 5 (8.3%) were female. The majority of the respondents were aged between 30 and 41 years, and nearly half (45%) of them could not read or write. Forty-three (71.7%) of them had abattoir work experience of 1 to 3 years (Table 8 ). Table 8 Sociodemographic characteristics of abattoir workers at the study sites Variables Response Frequency Percentage Address Dire Dawa 18 30 Harar 15 25 Babile 8 13.3 Jigjiga 19 31.7 Sex Male 55 91.7 Female 5 8.3 Age 18–29 20 33.3 30–41 26 43.3 42–53 14 23.3 Educational status Cannot read and write 27 45 Elementary 26 43.3 Secondary 7 11.7 Abattoir work experience (years) 1–3 years 43 71.7 4–6 12 20 7–10 5 8.3 Knowledge and practices of the respondents Among the 60 respondents, none (100%) had taken any course related to abattoir work. However, 23 (38.3%) of them responded that they had received lessons related to their work. Most of the respondents (68.3%) washed their hands using water only (Table 9 ). Table 9 Knowledge and handling practices of abattoir workers in the study towns Variables Responses Frequency Percentage Have you attended a course related to your work? Yes - - No 60 100 Have you received any lesson in personal hygiene? Yes 23 38.3 No 37 61.7 Washing hands with Soup & water 19 31.7 Water only 41 68.3 Do you wash your hands and knives after skinning and evisceration? Yes 55 91.7 No 5 8.3 Do you spray wash the carcass prior to inspection? Yes 45 75 No 15 25 Is there enough water available in abattoir Yes 21 35 No 39 65 General observational assessment of abattoirs According to the observation survey, 36.7% of abattoir workers did not wear protective cloths/aprons, and 40% of the workers did not use detergents or disinfectants for cleaning abattoirs. Most of the time (68.3%), there was demarcation between the dirty and clean areas in the abattoir. However, the present study showed that 73.3% of the time, carcasses and offal come into contact with floors, walls or soiling during dressing and evisceration (Table 10 ). Table 10 General observational assessment of abattoirs in the selected towns in eastern Ethiopia Variables Responses Frequency Percentage Do abattoir workers wear protective cloth/apron? Yes 38 63.3 No 22 36.7 Do workers use detergent/disinfectants for cleaning? Yes 24 60 No 36 40 Is there daily cleanliness of abattoir? Yes 46 76.7 No 14 23.3 Is there demarcation between the dirty and clean areas in the abattoir? Yes 41 68.3 No 19 31.7 Do the carcasses and offal come into contact with floors, walls or soiling? Yes 44 73.3 No 16 26.7 Discussion In this study, the total prevalence of Campylobacter species was relatively in agreement with that reported by Tegegne et al. [ 12 ], who reported a 5% prevalence of Campylobacter species in camel meat samples from Jigjiga town. Berhanu et al. [ 10 ] and Debelo et al. [ 21 ] from the Jimma municipal abattoir also reported overall prevalence rates of 5.6% and 7.9%, respectively, which are in agreement with the findings of the present study. In contrast, Chala et al . [ 11 ] from Addis Ababa and Hagos et al. [ 22 ] from Mekele reported relatively more Campylobacter isolates from different sample sources, with a prevalence of 18.5% and 16.67%, respectively. The differences could be a result of the different sampling techniques employed (meat sample, carcass swab, or carcass rinse fluid sample) and/or laboratory methodologies employed in different studies (bacteriological and biochemical testing against polymerase chain reaction assays). The prevalences of C. jejuni (72%) and C. coli ( 28%) in this study are in agreement with those of Berhanu et al. [ 10 ] who reported 78.6% C. jejuni and 21.4% C. coli . Similarly, Hagos et al . [ 22 ] reported C. jejuni and C. coli incidences of 81.25% and 18.75%, respectively, which is consistent with the findings of the present study. However, Seble [ 23 ] reported lower incidences of 25.4% and 9.0% for C. jejuni and C. coli , respectively. In the present study, a significantly high proportion of C. coli isolates was noted among the different age groups of camels. Significant differences were also recorded between sample types (P = 0.001), which may be due to the nonhygienic slaughtering process and cross contamination and may be related to abattoir environmental conditions that favor bacterial persistence. Multivariate analysis revealed that the odds of occurrence of C. jejuni in Babile municipal abattoirs was 4.55 times greater than that in Dire Dawa and the other municipal abattoirs. This indicates that the municipal abattoirs at the study sites need to implement hygienic slaughtering practices. In the present study, 6.8% of Campylobacter species were recorded in camel carcass swab samples, similar to the findings of a study conducted by Tegegne et al. [ 12 ], who reported a 5% overall prevalence of Campylobacter species in camel meat samples from Jigjiga municipal abattoir and retail houses. In contrast, some studies outside Ethiopia, such as Gwida et al . [ 2 ], reported a higher (33%) prevalence of Campylobacter species in raw camel meat from Egypt. This difference in prevalence may be attributed to differences in sample size, laboratory identification test employed and agro-ecological conditions of the study sites. The proportions of Campylobacter species isolated from camel carcass swabs for C. jejuni (80%) and C. coli (20%) are in agreement with the findings of Sabzmeydani et al. [ 24 ] from Iran, who reported 84.24% C. jejuni and 15.76% C. coli . This percentage is greater than that reported by Shafiei et al . [ 25 ] from India, who reported 57.8% C. jejuni and 42.1% C. coli . Hence, our findings demonstrated that C. jejuni is the most commonly identified species. This was in contrast with the findings of Gwida et al. [ 2 ]. The presence of Campylobacter in the intestinal tract of animals is a potential risk factor for carcass contamination, as determined by shedding patterns and hygienic slaughtering practices. The occurrence of Campylobacter species in carcasses might be related to cross-contamination during manual skinning, evisceration, and processing in the slaughterhouse [ 26 ]. The proportions of Campylobacter species isolated from fecal samples that were C. jejuni (20%) and C. coli (80%) were in agreement with those in a previous report by Gwida et al. [ 2 ], who described 10% and 90% of Campylobacter species from camel feces as C. jejuni and C. coli , respectively. However, the present study differs from a report by Shafiei et al. [ 25 ], who reported 62.5% and 37.5% for C. jejuni and C. coli , respectively. In this study, a considerably greater proportion of Campylobacter species was observed in carcass swabs (6.85%) and environmental samples (31%), possibly due to poor hygienic conditions during the slaughtering process. The high prevalence of Campylobacter in environmental samples may be attributed to fecal contamination and persistence of the microorganism in the environment since cracks and crevices in the abattoir floor and wall coupled with poor cleaning and drainage systems favor environmental persistence of the bacteria. The highest level of resistance recorded to chloramphenicol (70%) and amoxicillin-clavulanic acid (65%) was in line with the findings of Berhanu et al. [ 10 ], who reported the highest level of resistance of C ampylobacter isolates to ampicillin (10 µg) (100%) and amoxicillin (30 µg) (78.57%). However, Berhanu et al. [ 10 ] reported that chloramphenicol and amoxicillin were the least effective drugs, which is in contrast with the findings of the present study. The extensive use of these drugs in medical and veterinary practices might be the reason for such high resistance. In recent years, an increased prevalence of macrolide-resistant Campylobacter has been detected in certain regions of the world [ 27 ], and the findings of the present study are in agreement with this trend. For instance, our current study revealed 35% resistance to erythromycin, which is considered the drug of choice for the clinical treatment of campylobacteriosis, and r esistance to this drug is a public health concern, as options for the treatment of Campylobacter infections are currently limited [ 28 ]. Various investigations from different parts of the world have strongly indicated the emergence of multidrug-resistant Campylobacter strains. Since raw meat is widely consumed in Ethiopia, the occurrence of Campylobacter in meat increases the likelihood of pathogen transmission to humans. In this study, 48% of the Campylobacter isolates exhibited resistance to three or more antimicrobial agents. The increase in MDR to antimicrobial agents could be associated with the extensive use of antimicrobial agents not only as therapeutic agents for human infections but also for prophylaxis and growth promotion in animal husbandry. Similar MDR patterns have been observed in a previous study conducted in Ethiopia for these antimicrobial agents [ 29 ]. Thus, there is convincing evidence that MDR resistance has emerged and increased among food animals because of the use of antimicrobial agents in animal production, after which MDR strains spread to the food chain and cause infection in humans [ 29 ]. Mechanical hoists were absent at the study sites, and sufficient manual hoists were not present at some of the study sites. A lack of cleaning facilities, poor drainage systems, and insufficient water availability appeared to be the major constraints on the daily cleanliness of abattoirs. The absence of chlorinated and hot water baths and the inability to use detergents on clean floors and equipment might further increase the probability of carcass contamination. This study revealed that nearly half (45%) of abattoir workers are illiterate. Personnel and other workers at the abattoir were also not adequately trained. Hence, they mostly do not follow hygienic standards, which invariably contributes to microbial contamination. For instance, these workers dress carcasses on a bare floor in which the slaughter floor is smeared with blood, rumen contents and other waste from previously dressed animals, increasing the risk of contamination of subsequent carcasses. For example, unrestrained movement; putting knives in the rectal openings; not taking care to wash hands or knives frequently; slaughtering; skinning; eviscerating animals on the ground; absence of clear demarcation between the carcass and offal; absence of adequate water; and hot and/or chlorinated water for cleaning are identified as risk factors that facilitate persistence of pathogens and transfer of microbes onto sterile carcass surfaces. Conclusion A considerable proportion of C ampylobacter (7.7%) was detected in camel meat, feces, and environmental samples from the towns of interest. In comparison to others, Babile town had a significantly greater incidence of Campylobacter species (13.9%), and there was a greater occurrence of C ampylobacter species in camel carcass swabs and environmental samples than in fecal samples. This indicates possible carcass cross-contamination by Campylobacter species during the slaughtering process, which could have been prevented by applying good hygienic practices at abattoirs. The study revealed that more than one-third of the tested Campylobacter isolates exhibited considerably high resistance to erythromycin, and almost half of the isolates were multidrug resistant and may pose a threat to humans. A lack of awareness of abattoir workers and the absence of abattoir hygienic standard operating procedures could be important factors associated with the prevalence of Campylobacter contamination of carcasses at abattoirs. Therefore, further epidemiological studies on the magnitude of zoonotic enteric campylobacteriosis along the food chain and molecular characterization of Campylobacter species to identify genes responsible for drug resistance should be conducted. Regular coordinated actions should be implemented on the basis of the rational use of veterinary and medical drugs together with training and awareness of good hygienic practices. Declarations Acknowledgments We would like to acknowledge Haramaya University for the financial support we provided and for providing the material for this research. We are grateful to the Haramaya University central lab for giving permission to perform the lab work. We would like to thank Ms. Amanda Ojeda from University of Florida for bringing us lab consumables for Campylobacter isolation. We greatly acknowledge all abattoir workers who participated in this study. Funding The work was granted by Haramaya University Office of Research and Community Engagement under regular research grant with a grant code of HURG-2020-01-01-52. Availability of data and materials A llthe datasets used during the study are available from the corresponding author of the manuscript on reasonable request. Competing interests The authors declare that they have no competing interests. Authors’ contributions MY proposed and designed the research idea. MY, JK, TW, and YT outlined the research and designed the methodology. MB and JK carried out the sample collection and performed lab work, analyzed, and interpreted the data. JK prepared the first draft of the manuscript for publication. MY, JK, and TW reviewed the final version of the manuscript. YT involved in providing laboratory consumables. All authors read and approved the final version of the manuscript. Authors’ information The authors are veterinary and animal science professionals that have been working at the school and department of Animal and Range Land Sciences and College of Veterinary Medicine of Haramaya and Wolkite Universities. They are engaged in microbiological, molecular and immunological research activities including foodborne zoonoses and antimicrobial resistance. Author details 1 Wolkite University Department of Animal Science, P.O. Box 07, Wolkite, Ethiopia 2 Haramaya University College of Veterinary Medicine, P.O. Box 138, Dire Dawa, Ethiopia 3 Haramaya University School of Animal and Range Land Sciences, Dire Dawa, Ethiopia 4 Department of Veterinary Medical Sciences, Alma Mater Studiorum University of Bologna, Ozzano dell’Emilia; Bologna, Italy References Faye B. 2015. Role, distribution and perspective of camel breeding in the third millennium economies. Emirates J Food Agric, 318–27. Gwida Mayada, Zakaria A, Elkenany HE-SR, Mona E. Prevalence of Campylobacter , Enterococcus and Staphylococcus aureus in slaughtered camels. Vet Med. 2019;64(12):521–30. Acke E. Campylobacteriosis in dogs and cats: a review. N Z Vet J. 2018;66:221–8. Thomas KM, de Glanville WA, Barker GC, Benschop J, Buza JJ, Cleaveland S, Crump JA. Prevalence of Campylobacter and Salmonella in African food animals and meat: A systematic review and meta-analysis. Int J Food Microbiol. 2020;315:108382. Kaakoush NO, Castaño-Rodríguez N, Mitchell HM, Man SM. Global epidemiology of Campylobacter infection. Clin Microbiol Rev. 2015;28:687–20. Mughal MH. Campylobacteriosis : A Global Threat. Biomedical J Sci Tech Res. 2018;11(5):8804–8. Diriba K, Awulachew E, Anja A. Prevalence and associated factor of Campylobacter species among less than 5-year-old children in Ethiopia: a systematic review and meta-analysis. Eur J Med Res. 2021;26(1):1–10. European Food Safety Authority (EFSA). The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2017. Eur Food Saf Auth J. 2019;17:5598. Nisar M, Mushtaq MH, Shehzad W, Hussain A, Nasar M, Nagaraja KV, Goyal SM. Occurrence of Campylobacter in retail meat in Lahore, Pakistan. Acta Trop. 2018;185:42–5. ., Berhanu Leykun, Bedru H, Gume B, Tolosa T, Kassa T, Getaneh A, Seid T, Mereta. 2021. Occurrence, Risk Factors, and Antimicrobial Susceptibility Test of Thermophilic Campylobacter Species of Bovine Carcass at Municipal Abattoir and Butcher Shops of Jimma Town, Southwest Ethiopia. Infection and Drug Resistance , 14: 3753–3762. Chala G, Eguale T, Abunna F, Asrat D, Stringer A. Identification and characterization of Campylobacter species in livestock, humans, and water in livestock owning households of Peri-urban Addis Ababa, Ethiopia: A one health approach. Front Public Health. 2021;9(1):750551. Tegegne H, Ayalew. A, Berhanu Y, Getachew B Serda., Dagmar Nölkes., Sissay Tilahun. and, Berhanu S. 2019. Microbiological safety and hygienic quality of camel meat at abattoir and retail houses in Jigjiga city, Ethiopia. Journal of Infection in Developing Coutries , 13(3):188–194. Salih MD, Junaidu AU, Abubakar MB, Magaji AA, Mohammed LG. Isolation and characterization of Campylobacter spp. from Camel ( Camelusdramedarius ) in Sokoto State, Northwestern, Nigeria. Int J Anim Veterinary Adv. 2009;1:25–7. Central Statistical Agency (CSA). 2013. Federal Democratic Republic of Ethiopia, Central Statistical Agency, Addis Ababa, Ethiopia. Population projection of Ethiopia for the year 2014. 4–38. Thrusfield M. Veterinary epidemiology. Wiley; 2018. World Organization for Animal Health (OIE). Campylobacter jejuni and Campylobacter coli . Manual of diagnostic tests and vaccines for terrestrial animals. Volume 2, 6th ed. Paris, France: OIE; 2008. pp. 1185–9. Forbes BA, Sahm DF, Weissfeld AS. 2007. Diagnostic microbiology St Louis: Mosby, 288–302. Hariharan H, Sharma S, Chikweto A, Matthew V, DeAllie C. 2009. Antimicrobial drug resistance as determined by the E-test in Campylobacter jejuni , C. coli , and C. lari isolates from the ceca of broiler and layer chickens in Grenada. Comparative immunology, microbiology and infectious diseases , 32(1): 21–28. Clinical and Laboratory Standards Institute (CLSI). 2019. M100-ED29: 2019 Performance Standards for Antimicrobial Susceptibility Testing, 29th edn, Wayne, PA. Platts-Mills JA, Liu J, Gratz J, Mduma E, Amour C, Swai N, Taniuchi M, Begum S, Peñataro YP, Tilley DH, Lee G, Shen Z, Whary MT, Fox JG, McGrath M, Kosek M, Haque R, Houpt ER. Detection of Campylobacter in stool and determination of significance by culture, enzyme immunoassay, and PCR in developing countries. J Clin Microbiol. 2014;52:1074–80. Debelo M, Mohammed N, Tiruneh A, Tolosa T. Isolation, identification and antibiotic resistance profile of thermophilic Campylobacter species from Bovine, Knives and personnel at Jimma Town Abattoir, Ethiopia. PLoS ONE. 2022;17(10):1217. Hagos Y, Gugsa G, Awol N, Ahmed M, Tsegaye Y, Abebe N, Bsrat A. Isolation, identification, and antimicrobial susceptibility pattern of Campylobacter jejuni and Campylobacter coli from cattle, goat, and chicken meats in Mekelle, Ethiopia. PLoS ONE. 2021;16(2):246. Seble H. 2014. Prevalence, associated risk factors and antimicrobial susceptibility pattern of thermophilic Campylobacter spp. of ovine carcass at Addis Ababa abattoir enterprise, Ethiopia. Addis Ababa university, college of agriculture and veterinary medicine department of microbiology, immunology and veterinary public health, pp 1–36. Sabzmeydani Ali, Rahimi E and Amir Shakerian. Incidence and Antibiotic Resistance Properties of Campylobacter Species Isolated From Poultry Meat. Int J Enteric Pathogen. 2020;8(2):60–5. Shafiei A, Rahimi E, Shakerian A. Prevalence, Virulence, and Antimicrobial Resistance of Campylobacter Species Isolated From Carcasses of Camels Slaughtered in Slaughterhouses of Chaharmahal and Bakhtiari Province. Epidemiol Health Syst J. 2021;8(3):115–21. Wagenaar JA, French NP, Havelaar AH. Preventing Campylobacter at the source: why is it so difficult? Clin Infect Disease. 2013;57(11):1600–6. Shakir Z, Alhatami AO, Ismail KY, Muhsen AH. Antibiotic Resistance Profile and Multiple Antibiotic Resistance Index of Campylobacter Species Isolated from Poultry. Arch Razi Inst. 2021;76(6):1707–16. Wilkinson DA, O’Donnell AJ, Akhter RN, Fayaz A, Mack HJ, Rogers LE, Midwinter AC. Updating the genomic taxonomy and epidemiology of Campylobacter hyointestinalis . Sci Rep. 2018;8(1):2393. Dadi L, Asrat D. Prevalence and antimicrobial susceptibility profiles of thermotolerant Campylobacter strains in retail raw meat products in Ethiopia. Ethiop J Health Dev. 2009;22(2):1–7. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4173994","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":284829793,"identity":"bb44dc61-7ca4-48a3-b6a5-da53e31f98c8","order_by":0,"name":"Metages Yirgalem","email":"","orcid":"","institution":"Wolkite University","correspondingAuthor":false,"prefix":"","firstName":"Metages","middleName":"","lastName":"Yirgalem","suffix":""},{"id":284829795,"identity":"c4fd9aa5-e555-438d-82f8-3fc0e7dfb62b","order_by":1,"name":"Jelalu Kemal","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyklEQVRIiWNgGAWjYBACxgbmBoYHDAlyIM6BB8RpYWxgSGBIMAZrSSDWHpCWxAYQmygtzO2NjR8S29LS54cdfgi0xU5Ot4GQHT0HmyUS23JyN95OMwBqSTY2O0BIy4zEBqCWityNsxNAWg4kbiOoZf7D5h9ALemGs9M/EKllBmMbyGEJ8tI5xNrSk9hmkXAuzXCDdE7BgQQDIvxi2H748I0PZcny8rPTN3/4UGEnR1hLA5RhAFZpQEA5CMjDGQ14VI2CUTAKRsHIBgBjXUsHHb3J1QAAAABJRU5ErkJggg==","orcid":"","institution":"Haramaya University College of Veterinary Medicine","correspondingAuthor":true,"prefix":"","firstName":"Jelalu","middleName":"","lastName":"Kemal","suffix":""},{"id":284829798,"identity":"44b0c2c8-d8dc-48d7-9df2-a0006d07daab","order_by":2,"name":"Takele Wolkaro","email":"","orcid":"","institution":"Haramaya University School of Animal and Range Land Sciences","correspondingAuthor":false,"prefix":"","firstName":"Takele","middleName":"","lastName":"Wolkaro","suffix":""},{"id":284829801,"identity":"9a4a63cb-44dc-429f-acae-afaceca30615","order_by":3,"name":"Misgana Bekele","email":"","orcid":"","institution":"Haramaya University College of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Misgana","middleName":"","lastName":"Bekele","suffix":""},{"id":284829803,"identity":"8a5d2177-71a3-4d94-8304-eb955e3181ac","order_by":4,"name":"Yitagele Terefe","email":"","orcid":"","institution":"Haramaya University College of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yitagele","middleName":"","lastName":"Terefe","suffix":""}],"badges":[],"createdAt":"2024-03-27 06:59:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4173994/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4173994/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53887825,"identity":"371366a5-ef52-4e6f-8db0-b06fded0508d","added_by":"auto","created_at":"2024-04-01 20:08:07","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":56083,"visible":true,"origin":"","legend":"\u003cp\u003eMap of the study area (Dire Dawa city, Harar, Babile and Jigjiga)\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4173994/v1/159adf0ee6e7935289bb6693.png"},{"id":53887826,"identity":"22f2c218-d02f-46fd-9435-08654e62c3e7","added_by":"auto","created_at":"2024-04-01 20:08:07","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":160062,"visible":true,"origin":"","legend":"\u003cp\u003ePCR amplification plot. The red lines indicate the C\u003csub\u003eT\u003c/sub\u003e value of each sample. Samples within wells are shown on the left.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4173994/v1/f14a01c7f55a382ff8da4ad0.png"},{"id":53887827,"identity":"dd6cc71a-6601-4fd4-8d39-fb1faa17631d","added_by":"auto","created_at":"2024-04-01 20:08:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":8911,"visible":true,"origin":"","legend":"\u003cp\u003eAntimicrobial resistance profiles of \u003cem\u003eCampylobacter\u003c/em\u003e species isolated from camel meat, feces and environmental samples\u003c/p\u003e","description":"","filename":"Onlinedrawingimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4173994/v1/87b4df85a389b2efba5e080d.png"},{"id":55908844,"identity":"33fb6f97-837a-4106-9e8e-9be17be851b6","added_by":"auto","created_at":"2024-05-06 07:30:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1497458,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4173994/v1/b05287b7-9f99-4e11-8576-96d1003d3ed0.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Isolation, molecular detection and antimicrobial susceptibility profiles of Campylobacter from camel meat, feces and processing environments at municipal abattoirs in eastern Ethiopia","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCamel is one of the most important livestock species in arid and semiarid areas of Ethiopia. These compounds are crucial for addressing global protein shortages caused by the sharp increase in demand for animal proteins [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. However, food of animal origin, particularly meat, can be prone to microbial spoilage and can harbor a wide variety of foodborne and zoonotic microorganisms [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. \u003cem\u003eCampylobacter\u003c/em\u003e is a genus of bacteria that is found in the intestines of animals and humans. This genus consists of 22 species, of which the best known are \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e, which are mainly responsible for gastroenteritis in humans worldwide [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. \u003cem\u003eCampylobacter\u003c/em\u003e is particularly prevalent, with an estimated 400\u0026nbsp;million cases per year worldwide. While campylobacteriosis cases have often been linked to the consumption of fecal contaminated food and water, the consumption of undercooked meat has also been identified as a source of infection. Above all, humans may be infected by contact with live animals and environments contaminated with animal feces and subsequent incidental ingestion of the pathogens [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHuman campylobacteriosis symptoms can range from mild diarrhea to bloody diarrhea, and \u003cem\u003eCampylobacter\u003c/em\u003e infections can lead to long-term detrimental neurological consequences in the form of postinfection Guillain‒Barr\u0026eacute; syndrome [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], Miller Fisher syndrome (MFS), and functional bowel diseases, such as irritable bowel syndrome [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In developing countries such as Ethiopia, it is one of the most common bacteria isolated from the stools of children under five years old with diarrhea, largely as a result of contaminated food or water. However, despite its extremely high worldwide incidence, it is underdiagnosed and underreported [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe majority of \u003cem\u003eCampylobacter\u003c/em\u003e bacteria are highly resistant to beta-lactam drugs, including ampicillin, amoxicillin, and cefotaxime. The most effective medications for treating campylobacteriosis are believed to be macrolides and fluoroquinolones, although some strains of this bacterium are becoming resistant to these drugs [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. \u003cem\u003eThe\u003c/em\u003e resistance of \u003cem\u003eCampylobacter\u003c/em\u003e to common antibiotics used to treat infections is a rising problem worldwide and may limit the selection of available therapies [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Therefore, the emergence of drug-resistant \u003cem\u003eCampylobacter\u003c/em\u003e strains underscores the need for robust surveillance systems to monitor the prevalence and distribution of antibiotic resistance. Additionally, there is a need for more prudent use of antibiotics in both human and veterinary medicine to reduce selective pressure and minimize the development and spread of antibiotic resistance [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eA few recently reported studies of \u003cem\u003eCampylobacter\u003c/em\u003e species from apparently healthy food animals and humans in Ethiopia showed isolation levels ranging from 5\u0026ndash;16.7% [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. This persistent occurrence of \u003cem\u003eCampylobacter\u003c/em\u003e highlights its relevance as a public health concern and demands proper control. In addition, many countries, including Ethiopia, have reported a rapid increase in \u003cem\u003eCampylobacter\u003c/em\u003e strains resistant to antimicrobial agents, particularly fluoroquinolones and macrolides. Nonetheless, there is a scarcity of data on the prevalence of antimicrobial resistance and the various risk factors that contribute to the occurrence of \u003cem\u003eCampylobacter\u003c/em\u003e in Ethiopia. Despite the scarcity of data, few fragmented and limited studies have been conducted on \u003cem\u003eCampylobacter\u003c/em\u003e species in the eastern parts of the country, where camel meat is one of the main sources of protein. For instance, Tegegne \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] studied the microbiological safety and hygienic quality of camel meat at abattoirs and retail houses in Jigjiga city and reported an overall 5% prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e. In this study, only Jigjiga was targeted, and antimicrobial susceptibility tests were not performed. The authors identified \u003cem\u003eCampylobacter\u003c/em\u003e at the genus level only with culture-based techniques. The lack of well-documented information regarding the epidemiological status and antimicrobial susceptibility pattern of \u003cem\u003eCampylobacter\u003c/em\u003e species in camels in eastern Ethiopia makes it difficult to quantify the role of camels in the dissemination of the pathogen and design appropriate control and prevention measures. Therefore, the objective of this study was to investigate and assess the associated risk factors and determine the antimicrobial susceptibility profiles of \u003cem\u003eCampylobacter\u003c/em\u003e species from camels slaughtered at municipal abattoirs in the towns of Harar, Babile, Jigjiga and Dire Dawa in eastern Ethiopia.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eDescription of the study area\u003c/h2\u003e \u003cp\u003eThe study was conducted in the Harar, Babile, Jigjiga and Dire Dawa municipal abattoirs. All the municipal abattoirs in these towns provide slaughter services for camels. The animals used for slaughter were mainly from the surrounding districts of the east Hararge zone, the Somali regional state, and other nearby areas.\u003c/p\u003e \u003cp\u003e \u003cb\u003eHarar\u003c/b\u003e town is geographically located between 9.11\u003csup\u003e0\u003c/sup\u003e and 9.24\u003csup\u003e0\u003c/sup\u003e north of latitude and 42.03 and 42.16\u003csup\u003e0\u003c/sup\u003e east of longitude and is located 526 km east of Addis Ababa and 31 km west of the Babile district [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The \u003cb\u003eDire Dawa\u003c/b\u003e city administration is geographically located in the eastern part of Ethiopia at 9\u0026deg;36\u0026prime; N and 41\u0026deg;52\u0026prime;E and is located 515 km away from Addis Ababa. The area is situated 1200 meters above sea level and has a mean annual rainfall and humidity of 594 mm and 41.82%, respectively. The mean annual maximum and minimum temperatures of the town are 31.4\u003csup\u003e0\u003c/sup\u003eC and 18.41\u003csup\u003e0\u003c/sup\u003eC, respectively [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. \u003cb\u003eBabile\u003c/b\u003e town is located in the eastern corner of the eastern Hararge zone of the Oromia Regional State, bordering the Gursum, Fedis, Harari and Somali Regional States. It is located at 9\u0026deg;08\u0026rsquo;N latitude, 42\u0026deg;21\u0026rsquo;E longitude, and 557 km away from Addis Ababa. The town has an altitude that ranges from 950 to 2000 m above sea level. The mean annual minimum and maximum temperatures range from 18\u0026ndash;28\u0026deg;C, while the mean annual rainfall and humidity range from 700\u0026ndash;900 mm and 33\u0026ndash;38%, respectively. The town has a total area of 3169.06 km\u003csup\u003e2\u003c/sup\u003e. The two prevailing agricultural production systems are pastoral and agro-pastoral production systems [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. \u003cb\u003eJigjiga\u003c/b\u003e town is the administrative capital of the Ethiopian Somali Regional State. Geographically, it is located approximately 628 km east of Addis Ababa, 74 km east of the Babile district and 60 km west of the border with the Republic of Somali-land. The town has an altitude of 1609 metres above sea level, a latitude and longitude of 9\u0026deg;21\u0026rsquo;N and 42\u0026deg;48`E, and a mean annual rainfall and humidity of 712 mm and 57.1%, respectively. The mean annual maximum and minimum temperatures of the town are 27.49\u0026deg;C and 12.3\u0026deg;C, respectively [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eStudy design and sample size determination\u003c/h2\u003e \u003cp\u003eA cross-sectional study was conducted from June 2022 to August 2023 to investigate the occurrence of \u003cem\u003eCampylobacter\u003c/em\u003e species in camel carcasses, fecal samples, and environmental swab samples. \u003cem\u003eAn in vitro\u003c/em\u003e susceptibility test was applied to the isolates obtained from the collected samples using a disc diffusion technique. The sample size was determined using the formula given by Thrusfield [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], with a 95% confidence interval at 5% precision, based on the 5% expected incidence reported in a previous study by Tegegne \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eN\u0026thinsp;=\u0026thinsp;\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eZ\u003c/span\u003e\u003csup\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e2\u003c/span\u003e\u003c/sup\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e*Pexp (1-Pexp)\u003c/span\u003e\u003c/p\u003e \u003cp\u003ed\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eAccordingly, 73 samples were calculated, and this number was doubled to 146 to increase the precision of the estimate. The estimated number of camels slaughtered at each abattoir was obtained from abattoir records. Two separate pairs of samples (146 fecal and 146 carcass samples) were collected, for a total of 292 samples. Additionally, 32 environmental swab samples were collected. Therefore, 324 overall carcass, fecal and environmental swab samples were collected (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDistributions of samples with respect to study sites and sample type\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eStudy sites\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eSample Type\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarcass swab\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFecal\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eEnvironmental\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDire Dawa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e86\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHarar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBabile\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e72\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eJigjiga\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e110\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e146\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e146\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e324\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eSampling technique\u003c/h2\u003e \u003cp\u003eA total of 146 fresh fecal, 146 carcass and 32 environmental swab samples were collected from each systematically and purposively selected camel for laboratory analysis. Swab samples were collected by the use of commercially available transport tubes containing buffered peptone water that protects \u003cem\u003eCampylobacter\u003c/em\u003e species from drying and the toxic effects of oxygen, as recommended by OIE [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The selected carcasses were swabbed using sterile cotton-tipped swabs fitted with a shaft on specific sites on the carcass, abdomen (flank), thorax (lateral), and breast (lateral), which are the sites with the highest rates of contamination. The sterile cotton at each site was first soaked in 10 ml of buffered peptone water (BPW), which was first rubbed horizontally and then vertically several times on the carcasses. Swab samples from four sites on the right and left sides of an animal were taken as a pool. Fecal samples were collected directly from the rectum immediately after slaughter. The fecal samples were subsequently placed in a sterile screw-capped container containing 10 ml of BPW [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Environmental samples were taken from the surfaces of the walls, floors, personnel hands, knives, hooks, and aprons with sterile cotton tipped swabs on each sampling day as a pooled sample in screw-capped test tubes containing 10 ml of BPW. Finally, the samples were immediately transported to Haramaya University Central Laboratory, Food Microbiology and Toxicology Lab. in an ice box with ice packs for microbiological analysis and molecular detection of the pathogen.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eSurvey data collection\u003c/h2\u003e \u003cp\u003eA semi-structured interview questionnaire was presented for 60 abattoir workers (8, 15, 18, and 19 respondents, based on their consent from Babile, Harar, Dire Dawa and Jigjiga, respectively) with the intent of determining carcass contamination. The information collected included the sociodemographic characteristics of the abattoir workers, their knowledge and practices and their observational assessments of the abattoirs during each sampling day.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIsolation and identification of\u003c/b\u003e \u003cb\u003eCampylobacter\u003c/b\u003e \u003cb\u003especies\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSelective solid media for the isolation of \u003cem\u003eCampylobacter\u003c/em\u003e species were prepared using chromogenic agar media (CHROMagar\u0026trade; \u003cem\u003eCampylobacter\u003c/em\u003e base) (George Sand \u0026ndash; La Plaine Saint-Denis, France). A selective supplement (CHROMagar\u0026trade; \u003cem\u003eCampylobacter\u003c/em\u003e CP572) (George Sand \u0026ndash; La Plaine Saint-Denis, France) was filter sterilized through a 0.45 \u0026micro;m pore size cellulose acetate filter and added to the CHROM agar according to the manufacturer\u0026rsquo;s instructions (Paris, France). The samples were processed immediately and incubated at 42\u0026deg;C for 48 hours under microaerophilic conditions [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Suspected colonies (small colonies with a brick-red color) on the selective media were sub-cultured and incubated under microaerophilic conditions. For this test, presumptive colonies were subjected for sub-culturing from selective agar and incubated aerobically at 41.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C for 22\u0026thinsp;\u0026plusmn;\u0026thinsp;1 hour and in microaerophilic condition.\u003c/p\u003e \u003cp\u003ePresumptive colonies were subjected to further identification based on standard microbiological and biochemical procedures, including Gram reactions, motility tests, production of catalase and oxidase, hippurate hydrolysis tests, and susceptibility to cephalothin and nalidixic acid disks. Hippurate-positive isolates were identified as \u003cem\u003eC. jejuni\u003c/em\u003e and nalidixic acid susceptible, and hypurate-negative isolates were considered \u003cem\u003eC. coli\u003c/em\u003e [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Then, pure colonies of the identified \u003cem\u003eCampylobacter\u003c/em\u003e species were picked up with a sterile loop, immersed in 0.5 ml of brain-heart infusion broth medium and preserved at -20\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eAntimicrobial susceptibility test\u003c/h2\u003e \u003cp\u003eAntimicrobial susceptibility tests were performed by the Kirby\u0026ndash;Bauer disk diffusion method using Mueller\u0026ndash;Hinton agar with 5% defibrinated sheep blood according to the Clinical Laboratory Standards Institute [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The following antimicrobial agents were tested for \u003cem\u003eCampylobacter\u003c/em\u003e species: ampicillin (AMP) (10 \u0026micro;g), amoxicillin with clavulanic acid (AMC) (30 \u0026micro;g), chloramphenicol (C) (30 \u0026micro;g), ceftriaxone (CRO) (10 \u0026micro;g), sulfamethoxazole-trimethoprim (STX) (25 \u0026micro;g), erythromycin (E) (15 \u0026micro;g), ciprofloxacin (CIP) (30 \u0026micro;g), and nalidixic acid (NA) (5 \u0026micro;g).\u003c/p\u003e \u003cp\u003e \u003cb\u003eMolecular detection of\u003c/b\u003e \u003cb\u003eCampylobacter\u003c/b\u003e \u003cb\u003eby polymerase chain reaction (PCR)\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDNA extraction\u003c/h2\u003e \u003cp\u003eFrom the culture broth, DNA was extracted using a Genomic DNA Purification Kit and a QIAamp PowerFecal Pro DNA Kit (Qiagen, CA, USA) following the manufacturer\u0026rsquo;s protocol. Briefly, 0.25 ml of the culture sample was subjected to genomic DNA extraction according to the manufacturer\u0026rsquo;s instructions, after which the sample was suspended in 100 ml of nuclease-free water. DNA quality and quantity were assessed by a UV5 Nano spectrophotometer, and the DNA was stored at -20\u0026deg;C until further use.\u003c/p\u003e \u003cp\u003e \u003cb\u003eConfirmation of\u003c/b\u003e \u003cb\u003eCampylobacter\u003c/b\u003e \u003cb\u003eisolates using TaqMan real-time PCR\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003eCampylobacter\u003c/em\u003e was detected from culture samples using TaqMan real-time PCR. The primers used in PCRs targeting \u003cem\u003eCampylobacter\u003c/em\u003e 16S rRNA were (forward: GATGACACTTTTCGGAGCGTAA and reverse: GCTTGCACCCTCCGTATTA) based on Platts-Mills \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. PCR was carried out in a total final volume of 25 \u0026micro;l containing 0.1 nM of each primer, 12.5 mL of PrimeTime gene expression master mix (an Integrated DNA Technologies, USA), 0.05 nM of the probe, 50 ng of normalized DNA, and nuclease-free water. QuantStudio 5 was used to run the real-time PCR. A positive control containing template genomic DNA from \u003cem\u003eC. jejuni\u003c/em\u003e (ATCC 81\u0026ndash;176) and \u003cem\u003eC. upsaliensis\u003c/em\u003e (ATCC 49816) was used. As a negative control, nuclease-free water was used. The reaction thermocycler conditions were optimized with initial denaturation at 95\u0026deg;C for 10 min of 1 cycle of 45 cycles of denaturation at 95\u0026deg;C for 15 sec, annealing at 55\u0026deg;C for 1 min and extension at 72\u0026deg;C for 1 min. Finally, an additional extension was achieved for 7 min at 72\u0026deg;C, after which the samples were stored at 4\u0026deg;C. A cutoff C\u003csub\u003eT\u003c/sub\u003e value of 35 was used for the detection of \u003cem\u003eCampylobacter\u003c/em\u003e in each sample: average C\u003csub\u003eT\u003c/sub\u003e for nuclease-free water \u0026minus;\u0026thinsp;2.5 \u0026times; standard deviation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eData management and analysis\u003c/h2\u003e \u003cp\u003eAll the data were stored and prepared in the Microsoft Excel sheet program, and the analysis was performed using STATA 12 statistical package software. Descriptive statistics, chi-square tests and univariate and multivariate logistic regression analyses were conducted to assess the associations among the independent variables and the outcome variable; variables found to be significant at a P value\u0026thinsp;\u0026lt;\u0026thinsp;0.2 were used to construct a multivariate model. Odds ratios were calculated with 95% confidence intervals (CIs) to determine the strength of the associations, and differences were considered significant at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eThe overall prevalence of\u003c/b\u003e \u003cb\u003eCampylobacter\u003c/b\u003e \u003cb\u003especies\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe overall prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e species was 7.7% (25/324). The most prevalent \u003cem\u003eCampylobacter\u003c/em\u003e species was \u003cem\u003eC. jejuni\u003c/em\u003e (5.5%) followed by \u003cem\u003eC. coli\u003c/em\u003e (2.2%). There were no significant differences among the study sites. However, the highest prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e was recorded in Babile town (40%), followed by Jigjiga (24%). The samples from Babile town had the highest \u003cem\u003eC. jejuni\u003c/em\u003e occurrence among the study sites (P\u0026thinsp;=\u0026thinsp;0.037). The proportion of \u003cem\u003eC. coli\u003c/em\u003e in young camels was significantly greater than that in adult camels (P\u0026thinsp;=\u0026thinsp;0.003). Similarly, there were significantly more \u003cem\u003eCampylobacter\u003c/em\u003e species in the environmental samples than in the other sample types (P\u0026thinsp;=\u0026thinsp;0.001) (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cem\u003eCampylobacter\u003c/em\u003e prevalence and species distribution among different risk factors\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eVariables\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCategories\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eN\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eo\u003c/span\u003e. examined\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eN\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eo\u003c/span\u003e positive (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eN\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eo\u003c/span\u003e. (%) of samples positive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eC. jejuni\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eC. coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003eStudy site\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDire Dawa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5 (5.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3 (3.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2 (2.3)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHarar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4 (7.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2 (3.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2 (3.6)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBabile\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10 (13.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9 (12.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1 (1.4)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJigjiga\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e110\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6 (5.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4 (3.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2 (1.8)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e324\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25 (7.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e18 (5.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7 (2.2)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cem\u003eχ2 (p value)\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.1057 (0.164)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8.51 (0.037)*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.802 (0.849)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eSex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e263\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13 (5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7 (2.67)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6 (2.3)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2 (6.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2 (6.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e292\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15 (5.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9 (3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6 (2)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eχ\u003csup\u003e2\u003c/sup\u003e (p \u003cem\u003evalue\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.2046 (0.651)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.568 (0.21)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.676 (0.411)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYoung\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7 (8.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2 (2.53)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5 (6.3)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAdult\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e213\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8 (3.75)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7 (3.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1 (0.47)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e292\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15 (5.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9 (3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6 (2)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eχ2 (p value)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.586 (0.108)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.18 (0.675)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e9.078(0.003)*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eBody condition\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMedium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e104\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5 (4.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2 (2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3 (2.9)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGood\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e188\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10 (5.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7 (3.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3 (1.6)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e292\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15 (5.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9 (3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6 (2)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eχ2 (p value)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.0359 (0.850)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.7265(0.394)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.553 (0.457)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"4\" rowspan=\"5\"\u003e \u003cp\u003eSample type\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarcass\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e146\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10 (6.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8 (5.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2 (1.4)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFecal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e146\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5 (3.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (0.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4 (2.7)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEnvironment\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10 (31.25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9 (28)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1 (3.1)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e324\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25 (7.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e18 (5.56)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7 (2.2)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eχ2 (\u003cem\u003ep value\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e28.819 (0.001)*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e37.67(0.001)*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.8043(0.669)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eMultivariate logistic regression analysis of\u003c/b\u003e \u003cb\u003eC. coli\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eC. jejuni\u003c/b\u003e\u003c/p\u003e \u003cp\u003eMultivariate logistic regression analysis for the occurrence of \u003cem\u003eC. jejuni\u003c/em\u003e revealed a significant association among the study sites (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The odds of occurrence of \u003cem\u003eC. jejuni\u003c/em\u003e in Babile municipal abattoir was 4.55 times greater than those in Dire Dawa and the rest of the municipal abattoirs (p\u0026thinsp;=\u0026thinsp;0.041; AOR\u0026thinsp;=\u0026thinsp;4.549; 95% CI\u0026thinsp;=\u0026thinsp;1.065\u0026ndash;19.43). Multivariate logistic regression analysis of the occurrence of \u003cem\u003eC. jejuni\u003c/em\u003e isolated from different sample types revealed a significant association (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The odds of occurrence of \u003cem\u003eC. jejuni\u003c/em\u003e in samples collected from abattoir environments was 7.52 times greater than those in carcass and fecal samples (P\u0026thinsp;=\u0026thinsp;0.001; AOR\u0026thinsp;=\u0026thinsp;7.5217; 95% CI\u0026thinsp;=\u0026thinsp;2.4745\u0026ndash;22.864) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMultivariable logistic regression analysis for the occurrence of \u003cem\u003eC. jejuni\u003c/em\u003e isolates from camel meat samples in selected towns in eastern Ethiopia\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariables\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCategories\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eo\u003c/span\u003e. examined\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNo. (%) \u003cem\u003eof C. jejuni\u003c/em\u003e isolates\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAOR (95% CI)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ep value\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eStudy site\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDire Dawa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3 (3.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHarar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2 (3.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.7884 (0.1167\u0026ndash;5.327)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.807\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBabile\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9 (12.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.549 (1.065\u0026ndash;19.43)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.041*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJigjiga\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e110\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4 (3.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.189 (0.24\u0026ndash;5.889)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.83\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eSample type\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarcass\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e146\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8 (5.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFeces\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e146\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 (0.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.1153 (.01411-.9425)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.044*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEnvironment\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9 (28)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7.5217(2.4745\u0026ndash;22.864)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.001*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePrevalence of\u003c/b\u003e \u003cb\u003eCampylobacter\u003c/b\u003e \u003cb\u003especies in different sample types among sites\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThere was a statistically significant difference among the different sample types in terms of the occurrence of \u003cem\u003eC. jejuni\u003c/em\u003e (p\u0026thinsp;=\u0026thinsp;0.001). A high prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e species was detected in the carcass swab samples collected from Babile (7.7%), followed by Jigjiga (5.9%). Examination of 146 camel fecal samples for intestinal carriage revealed that 5 (3.42%) were \u003cem\u003eCampylobacter\u003c/em\u003e species positive (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The numbers and percentages of \u003cem\u003eCampylobacter\u003c/em\u003e species isolated from fecal samples were 1 and 4 for \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e, respectively. \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e accounted for 9 and 1%, respectively, of the \u003cem\u003eCampylobacter\u003c/em\u003e species isolated from the environmental samples (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrevalence of \u003cem\u003eCampylobacter\u003c/em\u003e species isolated from different samples across study sites\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"14\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c14\" colnum=\"14\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eVariables\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e\u003cem\u003eTotal\u003c/em\u003e Ex\u003cem\u003e\u0026rsquo;\u003c/em\u003ed\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e \u003cp\u003eDire Dawa\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c8\" namest=\"c6\"\u003e \u003cp\u003eHarar\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c11\" namest=\"c9\"\u003e \u003cp\u003eBabile\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c14\" namest=\"c12\"\u003e \u003cp\u003eJigjiga\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eNo.\u003c/em\u003e Ex\u003cem\u003e\u0026rsquo;\u003c/em\u003ed\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e\u003cem\u003eNo. positive\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNo. Ex\u003cem\u003e\u0026rsquo;\u003c/em\u003ed\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c8\" namest=\"c7\"\u003e \u003cp\u003e\u003cem\u003eNo. positive\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNo. Ex\u003cem\u003e\u0026rsquo;\u003c/em\u003ed\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e\u003cem\u003eNo. positive\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNo.\u003c/p\u003e \u003cp\u003eEx\u003cem\u003e\u0026rsquo;\u003c/em\u003ed\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c14\" namest=\"c13\"\u003e \u003cp\u003e\u003cem\u003eNo. positive\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eC. jej\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eC. col\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC. jej\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eC.col\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eC. jej\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003eC. col\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c13\"\u003e \u003cp\u003eC. jej\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c14\"\u003e \u003cp\u003eC. col\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCarcass \u003cb\u003es\u003c/b\u003ewab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e146\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e39\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2(\u003cb\u003e5.1\u003c/b\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1(\u003cb\u003e2.56\u003c/b\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e24\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e(\u003cb\u003e4.2\u003c/b\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e32\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e3(\u003cb\u003e7.7\u003c/b\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e51\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e3(\u003cb\u003e5.9\u003c/b\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFecal sample\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e146\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e39\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1(\u003cb\u003e2.56\u003c/b\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e24\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1(\u003cb\u003e4.2\u003c/b\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e32\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1(\u003cb\u003e3.1)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e1(\u003cb\u003e3.1\u003c/b\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e51\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1(\u003cb\u003e1.97\u003c/b\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEnvironment\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1(\u003cb\u003e12.5\u003c/b\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2(6.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e5(\u003cb\u003e62.5\u003c/b\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e(1\u003cb\u003e2.5\u003c/b\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1(\u003cb\u003e12.5\u003c/b\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e324\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e86\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e3(3.5)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e2(2.3)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e56\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e2(3.6)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e2(3.6)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e72\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e9(12.5)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u003cb\u003e1(1.4)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e110\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u003cb\u003e4(3.6)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cb\u003e2(1.8)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePCR confirmation of\u003c/b\u003e \u003cb\u003eCampylobacter\u003c/b\u003e \u003cb\u003eisolates\u003c/b\u003e\u003c/p\u003e \u003cp\u003eMolecular detection of \u003cem\u003eCampylobacter\u003c/em\u003e from culture samples was determined based on the threshold cycle values (\u003csub\u003eCTs\u003c/sub\u003e) obtained for each sample against the no-DNA controls (nuclease-free water controls), which provided background noise estimates (i.e., fluorescence signals that were obtained through nonspecific amplification via PCR). Thus, it was used to examine \u003cem\u003eCampylobacter\u003c/em\u003e-positive and -negative samples. For the detection of \u003cem\u003eCampylobacter\u003c/em\u003e in the culture samples, a cutoff C\u003csub\u003eT\u003c/sub\u003e value of 35 was used for each sample (average C\u003csub\u003eT\u003c/sub\u003e value for nuclease-free water \u0026minus;\u0026thinsp;2.5 \u0026times; standard deviation). With this PCR test of 24 culture samples examined, 13 (54.2%) were found to be positive for \u003cem\u003eCampylobacter\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDetails of PCR \u003cem\u003eCampylobacter\u003c/em\u003e detection with C\u003csub\u003eT\u003c/sub\u003e values in 28 samples, including 2 positive and 2 negative control samples.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWell Position\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSample Code\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eC\u003csub\u003eT\u003c/sub\u003e Value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eRemark\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eB3E2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e38.080\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eB6F4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e40.086\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAC6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e22.353\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eB6F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25.534\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eB3E6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e23.985\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eH6C7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e22.572\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA3C6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e33.124\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eB2H1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e35.366\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA7E5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e37.209\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJ1A1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e39.697\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA7C7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e37.078\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA2C5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e32.522\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eB6E1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e23.970\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eB6C1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e31.870\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eH5C2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eUndetermined\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eB6FA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e21.909\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eH4C4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e38.128\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eH2C5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25.195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eB1C1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e40.162\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJ3E1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e32.604\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eD3C4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e33.673\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eD2C1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e37.774\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eD2F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e33.560\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eD4C5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e37.153\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12.900\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePC2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13.714\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e38.926\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e36.801\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAntimicrobial susceptibility profile of\u003c/b\u003e \u003cb\u003eCampylobacter\u003c/b\u003e \u003cb\u003eisolates\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAmong the 20 isolates tested, all (100%) were resistant to one or more antimicrobial agents, whereas two (1 \u003cem\u003eC. jejuni\u003c/em\u003e and 1 \u003cem\u003eC. coli\u003c/em\u003e) were susceptible to the 5 antimicrobial agents tested. Three isolates (15%) were resistant to a single antimicrobial agent, and 5 isolates (25%) were resistant to 2 antimicrobial agents. The highest levels of \u003cem\u003eCampylobacter\u003c/em\u003e resistance were recorded for chloramphenicol (70%) and amoxicillin-clavulanic acid (65%), while the least common antimicrobial agents for this specific test were ceftriaxone (5%), followed by ciprofloxacin and nalidixic acid (10%) (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAntibiotic resistance profile of \u003cem\u003eCampylobacter\u003c/em\u003e species isolated from camel carcass, feces and environmental samples in selected areas of eastern Ethiopia\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eDrugs\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eDrug potency\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e \u003cp\u003e\u003cem\u003eC. jejuni\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;14)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c8\" namest=\"c6\"\u003e \u003cp\u003e\u003cem\u003eC. coli\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;6)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eS\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eI\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eR\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eS\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003eI\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eN (%)\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eN (%)\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eN (%)\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eN (%)\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003eN (%)\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003eN (%)\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAMC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e30 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2 (14.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2 (14.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10(71.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2 (33.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1 (16.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e3 (50)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e30\u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 (7.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2 (14.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e11 (78.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2 (33.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1 (16.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e3 (50)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e30 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11 (78.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2 (14.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (7.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4 (66.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1 (16.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1 (16.7)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCRO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13 (93)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (7.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5 (83.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1 (16.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15\u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6 (43)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3 (21.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5 (35.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1 (16.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2 (33.3)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSAM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4 (28.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4 (28.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6 (42.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4 (66.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2 (33.3)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSTX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e25\u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2 14.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3 (21.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9 (64.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2 (33.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2 (33.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2 (33.3)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10 (71.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3 (21.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (7.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4 (66.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1 (16.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1 (16.7)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"8\"\u003e\u003cem\u003eAMC: amoxicillin-clavunated, C: chloramphenicol, CIP: ciprofloxacin, CRO: ceftriaxone, erythromycin, AMP: ampicillin, STX: sulfamethoxazole-trimethoprim, NA: nalidixic acid, S: susceptible, I: intermediate R: resistant\u003c/em\u003e\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMultidrug resistance (MDR) to three or more antimicrobial agents was observed in 12 (48%) \u003cem\u003eCampylobacter\u003c/em\u003e isolates. Among these MDR isolates, 9 (36%) were \u003cem\u003eC. jejuni\u003c/em\u003e and 3 (12%) were \u003cem\u003eC. coli.\u003c/em\u003e Of these, 5 (41.7%) were from carcasses, 3 (25%) were from feces, and 4 (33.3%) were recovered from abattoir environment samples. The MDR for the maximum number of antimicrobial disks (five antimicrobial agents) observed was registered for \u003cem\u003eC. jejuni\u003c/em\u003e strains (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMultidrug resistance profile of \u003cem\u003eCampylobacter\u003c/em\u003e isolates from camel meat\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNumber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eResistant profile\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eNu. of resistant isolates (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eC. jejuni\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;14)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eC. coli\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;6)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOne drug\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSTX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 (5.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 (14.3)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eTwo drugs\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 (14.3)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAMC,C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2 (11)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 (14.3)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAM,STX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 (5.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAMC, NA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 (5.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eThree \u0026amp; more drugs\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAMC,C,E,SAM,STX,CIP,AMC,CRO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3 (43)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e14 (78)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e6 (86)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eResults of the questionnaire survey\u003c/h2\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003eSociodemographic characteristics of the respondents\u003c/h2\u003e \u003cp\u003eOut of the 60 respondents interviewed, 55 (91.7%) were male, while the remaining 5 (8.3%) were female. The majority of the respondents were aged between 30 and 41 years, and nearly half (45%) of them could not read or write. Forty-three (71.7%) of them had abattoir work experience of 1 to 3 years (Table\u0026nbsp;\u003cspan refid=\"Tab8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab8\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 8\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSociodemographic characteristics of abattoir workers at the study sites\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariables\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eResponse\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFrequency\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePercentage\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eAddress\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDire Dawa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHarar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBabile\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJigjiga\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e31.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e91.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e18\u0026ndash;29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e33.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e30\u0026ndash;41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e43.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e42\u0026ndash;53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e23.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eEducational status\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCannot read and write\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eElementary\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e43.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSecondary\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eAbattoir work experience (years)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u0026ndash;3 years\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e71.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u0026ndash;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7\u0026ndash;10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eKnowledge and practices of the respondents\u003c/h2\u003e \u003cp\u003eAmong the 60 respondents, none (100%) had taken any course related to abattoir work. However, 23 (38.3%) of them responded that they had received lessons related to their work. Most of the respondents (68.3%) washed their hands using water only (Table\u0026nbsp;\u003cspan refid=\"Tab9\" class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab9\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 9\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eKnowledge and handling practices of abattoir workers in the study towns\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariables\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eResponses\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFrequency\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePercentage\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHave you attended a course related to your work?\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHave you received any lesson in personal hygiene?\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e38.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e61.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eWashing hands with\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSoup \u0026amp; water\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e31.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWater only\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e68.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDo you wash your hands and knives after skinning and evisceration?\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e91.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDo you spray wash the carcass prior to inspection?\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e75\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIs there enough water available in abattoir\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e65\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eGeneral observational assessment of abattoirs\u003c/h2\u003e \u003cp\u003eAccording to the observation survey, 36.7% of abattoir workers did not wear protective cloths/aprons, and 40% of the workers did not use detergents or disinfectants for cleaning abattoirs. Most of the time (68.3%), there was demarcation between the dirty and clean areas in the abattoir. However, the present study showed that 73.3% of the time, carcasses and offal come into contact with floors, walls or soiling during dressing and evisceration (Table\u0026nbsp;\u003cspan refid=\"Tab10\" class=\"InternalRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab10\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 10\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGeneral observational assessment of abattoirs in the selected towns in eastern Ethiopia\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariables\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eResponses\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFrequency\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePercentage\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDo abattoir workers wear protective cloth/apron?\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e63.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e36.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDo workers use detergent/disinfectants for cleaning?\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIs there daily cleanliness of abattoir?\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e76.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e23.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIs there demarcation between the dirty and clean areas in the abattoir?\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e68.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e31.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDo the carcasses and offal come into contact with floors, walls or soiling?\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e73.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e26.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, the total prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e species was relatively in agreement with that reported by Tegegne \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], who reported a 5% prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e species in camel meat samples from Jigjiga town. Berhanu \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] and Debelo \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] from the Jimma municipal abattoir also reported overall prevalence rates of 5.6% and 7.9%, respectively, which are in agreement with the findings of the present study. In contrast, Chala \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] from Addis Ababa and Hagos \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] from Mekele reported relatively more \u003cem\u003eCampylobacter\u003c/em\u003e isolates from different sample sources, with a prevalence of 18.5% and 16.67%, respectively. The differences could be a result of the different sampling techniques employed (meat sample, carcass swab, or carcass rinse fluid sample) and/or laboratory methodologies employed in different studies (bacteriological and biochemical testing against polymerase chain reaction assays).\u003c/p\u003e \u003cp\u003eThe prevalences of \u003cem\u003eC. jejuni\u003c/em\u003e (72%) and \u003cem\u003eC. coli (\u003c/em\u003e28%) in this study are in agreement with those of Berhanu \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] who reported 78.6% \u003cem\u003eC. jejuni\u003c/em\u003e and 21.4% \u003cem\u003eC. coli\u003c/em\u003e. Similarly, Hagos \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] reported \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e incidences of 81.25% and 18.75%, respectively, which is consistent with the findings of the present study. However, Seble [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] reported lower incidences of 25.4% and 9.0% for \u003cem\u003eC. jejuni and C. coli\u003c/em\u003e, respectively. In the present study, a significantly high proportion of \u003cem\u003eC. coli\u003c/em\u003e isolates was noted among the different age groups of camels. Significant differences were also recorded between sample types (P\u0026thinsp;=\u0026thinsp;0.001), which may be due to the nonhygienic slaughtering process and cross contamination and may be related to abattoir environmental conditions that favor bacterial persistence. Multivariate analysis revealed that the odds of occurrence of \u003cem\u003eC. jejuni\u003c/em\u003e in Babile municipal abattoirs was 4.55 times greater than that in Dire Dawa and the other municipal abattoirs. This indicates that the municipal abattoirs at the study sites need to implement hygienic slaughtering practices.\u003c/p\u003e \u003cp\u003eIn the present study, 6.8% of \u003cem\u003eCampylobacter\u003c/em\u003e species were recorded in camel carcass swab samples, similar to the findings of a study conducted by Tegegne \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], who reported a 5% overall prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e species in camel meat samples from Jigjiga municipal abattoir and retail houses. In contrast, some studies outside Ethiopia, such as Gwida \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], reported a higher (33%) prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e species in raw camel meat from Egypt. This difference in prevalence may be attributed to differences in sample size, laboratory identification test employed and agro-ecological conditions of the study sites. The proportions of \u003cem\u003eCampylobacter\u003c/em\u003e species isolated from camel carcass swabs for \u003cem\u003eC. jejuni\u003c/em\u003e (80%) and \u003cem\u003eC. coli\u003c/em\u003e (20%) are in agreement with the findings of Sabzmeydani \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] from Iran, who reported 84.24% \u003cem\u003eC. jejuni\u003c/em\u003e and 15.76% \u003cem\u003eC. coli\u003c/em\u003e. This percentage is greater than that reported by Shafiei \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] from India, who reported 57.8% \u003cem\u003eC. jejuni\u003c/em\u003e and 42.1% \u003cem\u003eC. coli\u003c/em\u003e. Hence, our findings demonstrated that \u003cem\u003eC. jejuni\u003c/em\u003e is the most commonly identified species. This was in contrast with the findings of Gwida \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The presence of \u003cem\u003eCampylobacter\u003c/em\u003e in the intestinal tract of animals is a potential risk factor for carcass contamination, as determined by shedding patterns and hygienic slaughtering practices. The occurrence of \u003cem\u003eCampylobacter\u003c/em\u003e species in carcasses might be related to cross-contamination during manual skinning, evisceration, and processing in the slaughterhouse [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe proportions of \u003cem\u003eCampylobacter\u003c/em\u003e species isolated from fecal samples that were \u003cem\u003eC. jejuni\u003c/em\u003e (20%) and \u003cem\u003eC. coli\u003c/em\u003e (80%) were in agreement with those in a previous report by Gwida \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], who described 10% and 90% of \u003cem\u003eCampylobacter\u003c/em\u003e species from camel feces as \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e, respectively. However, the present study differs from a report by Shafiei \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], who reported 62.5% and 37.5% for \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e, respectively. In this study, a considerably greater proportion of \u003cem\u003eCampylobacter\u003c/em\u003e species was observed in carcass swabs (6.85%) and environmental samples (31%), possibly due to poor hygienic conditions during the slaughtering process. The high prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e in environmental samples may be attributed to fecal contamination and persistence of the microorganism in the environment since cracks and crevices in the abattoir floor and wall coupled with poor cleaning and drainage systems favor environmental persistence of the bacteria.\u003c/p\u003e \u003cp\u003eThe highest level of resistance recorded to chloramphenicol (70%) and amoxicillin-clavulanic acid (65%) was in line with the findings of Berhanu \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], who reported the highest level of resistance of C\u003cem\u003eampylobacter\u003c/em\u003e isolates to ampicillin (10 \u0026micro;g) (100%) and amoxicillin (30 \u0026micro;g) (78.57%). However, Berhanu \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] reported that chloramphenicol and amoxicillin were the least effective drugs, which is in contrast with the findings of the present study. The extensive use of these drugs in medical and veterinary practices might be the reason for such high resistance. In recent years, an increased prevalence of macrolide-resistant \u003cem\u003eCampylobacter\u003c/em\u003e has been detected in certain regions of the world [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], and the findings of the present study are in agreement with this trend. For instance, our current study revealed 35% resistance to erythromycin, which is considered the drug of choice for the clinical treatment of campylobacteriosis, \u003cem\u003eand r\u003c/em\u003eesistance to this drug is a public health concern, as options for the treatment of \u003cem\u003eCampylobacter\u003c/em\u003e infections are currently limited [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eVarious investigations from different parts of the world have strongly indicated the emergence of multidrug-resistant \u003cem\u003eCampylobacter\u003c/em\u003e strains. Since raw meat is widely consumed in Ethiopia, the occurrence of \u003cem\u003eCampylobacter\u003c/em\u003e in meat increases the likelihood of pathogen transmission to humans. In this study, 48% of the \u003cem\u003eCampylobacter\u003c/em\u003e isolates exhibited resistance to three or more antimicrobial agents. The increase in MDR to antimicrobial agents could be associated with the extensive use of antimicrobial agents not only as therapeutic agents for human infections but also for prophylaxis and growth promotion in animal husbandry. Similar MDR patterns have been observed in a previous study conducted in Ethiopia for these antimicrobial agents [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Thus, there is convincing evidence that MDR resistance has emerged and increased among food animals because of the use of antimicrobial agents in animal production, after which MDR strains spread to the food chain and cause infection in humans [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Mechanical hoists were absent at the study sites, and sufficient manual hoists were not present at some of the study sites. A lack of cleaning facilities, poor drainage systems, and insufficient water availability appeared to be the major constraints on the daily cleanliness of abattoirs. The absence of chlorinated and hot water baths and the inability to use detergents on clean floors and equipment might further increase the probability of carcass contamination.\u003c/p\u003e \u003cp\u003eThis study revealed that nearly half (45%) of abattoir workers are illiterate. Personnel and other workers at the abattoir were also not adequately trained. Hence, they mostly do not follow hygienic standards, which invariably contributes to microbial contamination. For instance, these workers dress carcasses on a bare floor in which the slaughter floor is smeared with blood, rumen contents and other waste from previously dressed animals, increasing the risk of contamination of subsequent carcasses. For example, unrestrained movement; putting knives in the rectal openings; not taking care to wash hands or knives frequently; slaughtering; skinning; eviscerating animals on the ground; absence of clear demarcation between the carcass and offal; absence of adequate water; and hot and/or chlorinated water for cleaning are identified as risk factors that facilitate persistence of pathogens and transfer of microbes onto sterile carcass surfaces.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eA considerable proportion of C\u003cem\u003eampylobacter\u003c/em\u003e (7.7%) was detected in camel meat, feces, and environmental samples from the towns of interest. In comparison to others, Babile town had a significantly greater incidence of \u003cem\u003eCampylobacter\u003c/em\u003e species (13.9%), and there was a greater occurrence of C\u003cem\u003eampylobacter\u003c/em\u003e species in camel carcass swabs and environmental samples than in fecal samples. This indicates possible carcass cross-contamination by \u003cem\u003eCampylobacter\u003c/em\u003e species during the slaughtering process, which could have been prevented by applying good hygienic practices at abattoirs. The study revealed that more than one-third of the tested \u003cem\u003eCampylobacter\u003c/em\u003e isolates exhibited considerably high resistance to erythromycin, and almost half of the isolates were multidrug resistant and may pose a threat to humans. A lack of awareness of abattoir workers and the absence of abattoir hygienic standard operating procedures could be important factors associated with the prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e contamination of carcasses at abattoirs. Therefore, further epidemiological studies on the magnitude of zoonotic enteric campylobacteriosis along the food chain and molecular characterization of \u003cem\u003eCampylobacter\u003c/em\u003e species to identify genes responsible for drug resistance should be conducted. Regular coordinated actions should be implemented on the basis of the rational use of veterinary and medical drugs together with training and awareness of good hygienic practices.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to acknowledge Haramaya University for the financial support we provided and for providing the material for this research. We are grateful to the Haramaya University central lab for giving permission to perform the lab work.\u0026nbsp;We would like to thank Ms. Amanda Ojeda from University of Florida for bringing us lab consumables for \u003cem\u003eCampylobacter\u003c/em\u003e isolation.\u0026nbsp;We greatly acknowledge all abattoir workers who participated in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe work was granted by Haramaya University Office of Research and Community Engagement under regular research grant with a grant code of HURG-2020-01-01-52.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003ellthe datasets used during the study are available from the corresponding author of the manuscript on reasonable request.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMY proposed and designed the research idea. MY, JK, TW, and YT outlined the research and designed the methodology. MB and JK carried out the sample collection and performed lab work, analyzed, and interpreted the data. JK prepared the first draft of the manuscript for publication. MY, JK, and TW reviewed the final version of the manuscript. YT involved in providing laboratory consumables. All authors read and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; information\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors are veterinary and animal science professionals that have been working at the school and department of Animal and Range Land Sciences and College of Veterinary Medicine of Haramaya and Wolkite Universities. They are engaged in microbiological, molecular and immunological research activities including foodborne zoonoses and antimicrobial resistance.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003eWolkite University Department of Animal Science, P.O. Box 07, Wolkite, Ethiopia\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e2\u003c/sup\u003eHaramaya University College of Veterinary Medicine, P.O. Box 138, Dire Dawa, Ethiopia\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e3\u003c/sup\u003eHaramaya University School of Animal and Range Land Sciences, Dire Dawa, Ethiopia\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e4\u003c/sup\u003eDepartment of Veterinary Medical Sciences, Alma Mater Studiorum University of Bologna, Ozzano dell\u0026rsquo;Emilia; Bologna, Italy\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eFaye B. 2015. Role, distribution and perspective of camel breeding in the third millennium economies. Emirates J Food Agric, 318\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGwida Mayada, Zakaria A, Elkenany HE-SR, Mona E. Prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e, \u003cem\u003eEnterococcus\u003c/em\u003e and \u003cem\u003eStaphylococcus aureus\u003c/em\u003e in slaughtered camels. Vet Med. 2019;64(12):521\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAcke E. \u003cem\u003eCampylobacteriosis\u003c/em\u003e in dogs and cats: a review. N Z Vet J. 2018;66:221\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThomas KM, de Glanville WA, Barker GC, Benschop J, Buza JJ, Cleaveland S, Crump JA. Prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e and \u003cem\u003eSalmonella\u003c/em\u003e in African food animals and meat: A systematic review and meta-analysis. Int J Food Microbiol. 2020;315:108382.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaakoush NO, Casta\u0026ntilde;o-Rodr\u0026iacute;guez N, Mitchell HM, Man SM. Global epidemiology of \u003cem\u003eCampylobacter\u003c/em\u003e infection. Clin Microbiol Rev. 2015;28:687\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMughal MH. \u003cem\u003eCampylobacteriosis\u003c/em\u003e: A Global Threat. Biomedical J Sci Tech Res. 2018;11(5):8804\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDiriba K, Awulachew E, Anja A. Prevalence and associated factor of \u003cem\u003eCampylobacter\u003c/em\u003e species among less than 5-year-old children in Ethiopia: a systematic review and meta-analysis. Eur J Med Res. 2021;26(1):1\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEuropean Food Safety Authority (EFSA). The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2017. Eur Food Saf Auth J. 2019;17:5598.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNisar M, Mushtaq MH, Shehzad W, Hussain A, Nasar M, Nagaraja KV, Goyal SM. Occurrence of \u003cem\u003eCampylobacter\u003c/em\u003e in retail meat in Lahore, Pakistan. Acta Trop. 2018;185:42\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e., Berhanu Leykun, Bedru H, Gume B, Tolosa T, Kassa T, Getaneh A, Seid T, Mereta. 2021. Occurrence, Risk Factors, and Antimicrobial Susceptibility Test of Thermophilic \u003cem\u003eCampylobacter\u003c/em\u003e Species of Bovine Carcass at Municipal Abattoir and Butcher Shops of Jimma Town, Southwest Ethiopia. \u003cem\u003eInfection and Drug Resistance\u003c/em\u003e, 14: 3753\u0026ndash;3762.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChala G, Eguale T, Abunna F, Asrat D, Stringer A. Identification and characterization of \u003cem\u003eCampylobacter\u003c/em\u003e species in livestock, humans, and water in livestock owning households of Peri-urban Addis Ababa, Ethiopia: A one health approach. Front Public Health. 2021;9(1):750551.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTegegne H, Ayalew. A, Berhanu Y, Getachew B Serda., Dagmar N\u0026ouml;lkes., Sissay Tilahun. and, Berhanu S. 2019. Microbiological safety and hygienic quality of camel meat at abattoir and retail houses in Jigjiga city, Ethiopia. \u003cem\u003eJournal of Infection in Developing Coutries\u003c/em\u003e, 13(3):188\u0026ndash;194.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalih MD, Junaidu AU, Abubakar MB, Magaji AA, Mohammed LG. Isolation and characterization of \u003cem\u003eCampylobacter\u003c/em\u003e spp. from Camel (\u003cem\u003eCamelusdramedarius\u003c/em\u003e) in Sokoto State, Northwestern, Nigeria. Int J Anim Veterinary Adv. 2009;1:25\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCentral Statistical Agency (CSA). 2013. Federal Democratic Republic of Ethiopia, Central Statistical Agency, Addis Ababa, Ethiopia. Population projection of Ethiopia for the year 2014. 4\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThrusfield M. Veterinary epidemiology. Wiley; 2018.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWorld Organization for Animal Health (OIE). \u003cem\u003eCampylobacter jejuni\u003c/em\u003e and \u003cem\u003eCampylobacter coli\u003c/em\u003e. Manual of diagnostic tests and vaccines for terrestrial animals. Volume 2, 6th ed. Paris, France: OIE; 2008. pp. 1185\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eForbes BA, Sahm DF, Weissfeld AS. 2007. Diagnostic microbiology St Louis: Mosby, 288\u0026ndash;302.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHariharan H, Sharma S, Chikweto A, Matthew V, DeAllie C. 2009. Antimicrobial drug resistance as determined by the E-test in \u003cem\u003eCampylobacter jejuni\u003c/em\u003e, \u003cem\u003eC. coli\u003c/em\u003e, and \u003cem\u003eC. lari\u003c/em\u003e isolates from the ceca of broiler and layer chickens in Grenada. \u003cem\u003eComparative immunology, microbiology and infectious diseases\u003c/em\u003e, 32(1): 21\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClinical and Laboratory Standards Institute (CLSI). 2019. M100-ED29: 2019 Performance Standards for Antimicrobial Susceptibility Testing, 29th edn, Wayne, PA.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePlatts-Mills JA, Liu J, Gratz J, Mduma E, Amour C, Swai N, Taniuchi M, Begum S, Pe\u0026ntilde;ataro YP, Tilley DH, Lee G, Shen Z, Whary MT, Fox JG, McGrath M, Kosek M, Haque R, Houpt ER. Detection of Campylobacter in stool and determination of significance by culture, enzyme immunoassay, and PCR in developing countries. J Clin Microbiol. 2014;52:1074\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDebelo M, Mohammed N, Tiruneh A, Tolosa T. Isolation, identification and antibiotic resistance profile of thermophilic \u003cem\u003eCampylobacter\u003c/em\u003e species from Bovine, Knives and personnel at Jimma Town Abattoir, Ethiopia. PLoS ONE. 2022;17(10):1217.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHagos Y, Gugsa G, Awol N, Ahmed M, Tsegaye Y, Abebe N, Bsrat A. Isolation, identification, and antimicrobial susceptibility pattern of \u003cem\u003eCampylobacter jejuni\u003c/em\u003e and \u003cem\u003eCampylobacter coli\u003c/em\u003e from cattle, goat, and chicken meats in Mekelle, Ethiopia. PLoS ONE. 2021;16(2):246.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeble H. 2014. Prevalence, associated risk factors and antimicrobial susceptibility pattern of thermophilic \u003cem\u003eCampylobacter\u003c/em\u003e spp. of ovine carcass at Addis Ababa abattoir enterprise, Ethiopia. Addis Ababa university, college of agriculture and veterinary medicine department of microbiology, immunology and veterinary public health, pp 1\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSabzmeydani Ali, Rahimi E and Amir Shakerian. Incidence and Antibiotic Resistance Properties of \u003cem\u003eCampylobacter\u003c/em\u003e Species Isolated From Poultry Meat. Int J Enteric Pathogen. 2020;8(2):60\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShafiei A, Rahimi E, Shakerian A. Prevalence, Virulence, and Antimicrobial Resistance of \u003cem\u003eCampylobacter\u003c/em\u003e Species Isolated From Carcasses of Camels Slaughtered in Slaughterhouses of Chaharmahal and Bakhtiari Province. Epidemiol Health Syst J. 2021;8(3):115\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWagenaar JA, French NP, Havelaar AH. Preventing \u003cem\u003eCampylobacter\u003c/em\u003e at the source: why is it so difficult? Clin Infect Disease. 2013;57(11):1600\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShakir Z, Alhatami AO, Ismail KY, Muhsen AH. Antibiotic Resistance Profile and Multiple Antibiotic Resistance Index of \u003cem\u003eCampylobacter\u003c/em\u003e Species Isolated from Poultry. Arch Razi Inst. 2021;76(6):1707\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilkinson DA, O\u0026rsquo;Donnell AJ, Akhter RN, Fayaz A, Mack HJ, Rogers LE, Midwinter AC. Updating the genomic taxonomy and epidemiology of \u003cem\u003eCampylobacter hyointestinalis\u003c/em\u003e. Sci Rep. 2018;8(1):2393.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDadi L, Asrat D. Prevalence and antimicrobial susceptibility profiles of thermotolerant \u003cem\u003eCampylobacter\u003c/em\u003e strains in retail raw meat products in Ethiopia. Ethiop J Health Dev. 2009;22(2):1\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Antimicrobial resistance, Camel carcass, C. coli, C. jejuni","lastPublishedDoi":"10.21203/rs.3.rs-4173994/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4173994/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eCampylobacteriosis is an infectious zoonotic disease caused by the genus \u003cem\u003eCampylobacter\u003c/em\u003e. The disease is transmitted from animals to humans predominantly through the consumption of contaminated food and water. However, the lack of information on the status of \u003cem\u003eCampylobacter\u003c/em\u003e makes it difficult to quantify the role of camel meat in the dissemination of the pathogen. A cross-sectional study was conducted from June 2022 to August 2023 to investigate the occurrence of \u003cem\u003eCampylobacter\u003c/em\u003e and associated risk factors and to determine the antimicrobial susceptibility profiles of \u003cem\u003eCampylobacter\u003c/em\u003e species from camels slaughtered at municipal abattoirs in the towns of Harar, Babile, Jigjiga and Dire Dawa in eastern Ethiopia.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eA total of 324 (146 carcass swabs, 146 camel feces and 32 abattoir environmental swab samples) were collected and analyzed using TaqMan real-time PCR and culture techniques following standard procedures. In addition, antimicrobial susceptibility tests were performed using the disk diffusion method for eight antimicrobial agents according to the Clinical Laboratory Standards Institute.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe overall prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e was found to be 7.7%. \u003cem\u003eCampylobacter\u003c/em\u003e was more frequently detected from carcasses and surface contact environmental swabs. We isolated \u003cem\u003eCampylobacter\u003c/em\u003e at the genus level from approximately half of the PCR-positive samples, representing 54.2% (13 out of 24). The isolation level \u003cem\u003eof C. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e were also 5.56% and 2.2%, respectively, which varied significantly (p\u0026thinsp;=\u0026thinsp;0.037) based on sample type and site. We detected resistance to chloramphenicol (78.6%), followed by amoxicillin (71.4%). However, 93%, 78.6%, and 71.4% of the isolates were susceptible to ceftriaxone, ciprofloxacin, and nalidixic acid, respectively. MDR was detected in 48% of the isolates. Of these MDR isolates, 9 (36%) were \u003cem\u003eC. jejuni\u003c/em\u003e and 3 (12%) were \u003cem\u003eC. coli.\u003c/em\u003e\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThe study concluded that a considerable proportion of multidrug-resistant \u003cem\u003eCampylobacter\u003c/em\u003e species are circulating in camel meat and abattoir environments. This indicates a possible carcass cross-contamination by \u003cem\u003eCampylobacter\u003c/em\u003e during slaughtering that can pose a threat to humans and limits therapeutic options, which could have been prevented by applying good hygienic practices in the abattoirs. This needs to create awareness of abattoir workers about abattoir hygienic standard operating procedures. Regular coordinated actions should be implemented on the rational use of veterinary and medical drugs at national level together with training and awareness to workers on good hygienic practices.\u003c/p\u003e","manuscriptTitle":"Isolation, molecular detection and antimicrobial susceptibility profiles of Campylobacter from camel meat, feces and processing environments at municipal abattoirs in eastern Ethiopia","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-01 20:08:02","doi":"10.21203/rs.3.rs-4173994/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0f391951-c72b-4660-828e-346a16784e07","owner":[],"postedDate":"April 1st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-06-28T12:15:32+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-01 20:08:02","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4173994","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4173994","identity":"rs-4173994","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}