Evolutionarily conserved temperature dependency leads to loss of protein O-GlcNAc in mammalian hypothermia

preprint OA: closed
📄 Open PDF Full text JSON View at publisher

Abstract

O-N-acetylglucosaminylation (O-GlcNAcylation) is a conserved, non-canonical glycosylation of intracellular proteins suggested to regulate a wide spectrum of fundamental cell processes and stress responses. O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA) add and remove, respectively, O-GlcNAc on protein serines and threonines. O-GlcNAcylation is thought to be primarily regulated by the availability of its substrate, UDP-GlcNAc, produced by the hexosamine biosynthetic pathway (HBP). We observed a body-wide loss of O-GlcNAcylated proteins in Bcs1l mutant mice, a model of mitochondrial complex III deficiency. UDP-GlcNAc precursors glutamine, UTP and acetyl-CoA were decreased in the mutant liver but, surprisingly, UDP-GlcNAc was not consistently decreased in the organs that showed low O-GlcNAc. Neither N-acetylglucosamine supplementation nor overexpression of the HBP rate-limiting enzyme GFPT1 restored the protein O-GlcNAc levels. The Bcs1l mutant mice become hypothermic and, interestingly, earlier evidence suggest that O-GlcNAcylation depends on ambient temperature in Drosophila embryos. We found that temperature determined O-GlcNAc abundance also in adult flies of tropical and boreal Drosophila species, in the poikilothermic vertebrate zebrafish, and in cultured mammalian cells. In cultured cells, the OGT-OGA protein ratio coincided with temperature and O-GlcNAc level, providing a regulatory mechanism. Pharmacological OGA inhibition decoupled the O-GlcNAc temperature dependency in cultured cells, as did an OGA null allele in Drosophila . In Bcs1l mutant mice, O-GlcNAc levels strongly correlated with body temperature. Increasing the mouse body temperature through transgenic expression of the heat-generating mitochondrial alternative oxidase (AOX) or housing at 35°C prevented the loss of O-GlcNAc. Pharmacological restoration of O-GlcNAc in the Bcs1l mutant mice produced minimal effects, suggesting that the bulk of O-GlcNAc is dispensable in mild hypothermia. Our findings imply an evolutionarily ancient role of protein O-GlcNAcylation in temperature adaptation and, instead of protein function-specific roles, argue for a global role of O-GlcNAc in temperature control of proteostasis.
Full text 78,735 characters · extracted from preprint-html · click to expand
Evolutionarily conserved temperature dependency leads to loss of protein O-GlcNAc in mammalian hypothermia | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Evolutionarily conserved temperature dependency leads to loss of protein O-GlcNAc in mammalian hypothermia View ORCID Profile Divya Upadhyay , View ORCID Profile Christa Kietz , Nasrin Sultana , View ORCID Profile Rishi Banerjee , View ORCID Profile Maaria Kankare , View ORCID Profile Vineta Fellman , View ORCID Profile Janne Purhonen , View ORCID Profile Jukka Kallijärvi doi: https://doi.org/10.1101/2025.07.08.660373 Divya Upadhyay 1 Folkhälsan Research Center ; Haartmaninkatu 8 , 00290 Helsinki, Finland 2 Stem Cells and Metabolism Research Program, Faculty of Medicine, University of Helsinki; P.O.Box 63 , 00014 Helsinki, Finland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Divya Upadhyay Christa Kietz 1 Folkhälsan Research Center ; Haartmaninkatu 8 , 00290 Helsinki, Finland 2 Stem Cells and Metabolism Research Program, Faculty of Medicine, University of Helsinki; P.O.Box 63 , 00014 Helsinki, Finland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Christa Kietz Nasrin Sultana 1 Folkhälsan Research Center ; Haartmaninkatu 8 , 00290 Helsinki, Finland 2 Stem Cells and Metabolism Research Program, Faculty of Medicine, University of Helsinki; P.O.Box 63 , 00014 Helsinki, Finland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Rishi Banerjee 1 Folkhälsan Research Center ; Haartmaninkatu 8 , 00290 Helsinki, Finland 2 Stem Cells and Metabolism Research Program, Faculty of Medicine, University of Helsinki; P.O.Box 63 , 00014 Helsinki, Finland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Rishi Banerjee Maaria Kankare 3 Department of Biological and Environmental Science, University of Jyväskylä , P.O. Box 35, 40014, Jyväskylä, Finland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Maaria Kankare Vineta Fellman 1 Folkhälsan Research Center ; Haartmaninkatu 8 , 00290 Helsinki, Finland 2 Stem Cells and Metabolism Research Program, Faculty of Medicine, University of Helsinki; P.O.Box 63 , 00014 Helsinki, Finland 4 Department of Clinical Sciences, Lund, Pediatrics, Lund University , P.O.Box 117, 221 00 Lund, Sweden 5 Clinicum, Faculty of Medicine, University of Helsinki , P.O. Box 63, 00014 Helsinki, Finland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Vineta Fellman Janne Purhonen 1 Folkhälsan Research Center ; Haartmaninkatu 8 , 00290 Helsinki, Finland 2 Stem Cells and Metabolism Research Program, Faculty of Medicine, University of Helsinki; P.O.Box 63 , 00014 Helsinki, Finland 6 Division of Clinical Microbiology, Department of Laboratory Medicine, Karolinska Institutet , Huddinge, Sweden Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Janne Purhonen Jukka Kallijärvi 1 Folkhälsan Research Center ; Haartmaninkatu 8 , 00290 Helsinki, Finland 2 Stem Cells and Metabolism Research Program, Faculty of Medicine, University of Helsinki; P.O.Box 63 , 00014 Helsinki, Finland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Jukka Kallijärvi For correspondence: jukka.kallijarvi{at}helsinki.fi Abstract Full Text Info/History Metrics Preview PDF Abstract O-N-acetylglucosaminylation (O-GlcNAcylation) is a conserved, non-canonical glycosylation of intracellular proteins suggested to regulate a wide spectrum of fundamental cell processes and stress responses. O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA) add and remove, respectively, O-GlcNAc on protein serines and threonines. O-GlcNAcylation is thought to be primarily regulated by the availability of its substrate, UDP-GlcNAc, produced by the hexosamine biosynthetic pathway (HBP). We observed a body-wide loss of O-GlcNAcylated proteins in Bcs1l mutant mice, a model of mitochondrial complex III deficiency. UDP-GlcNAc precursors glutamine, UTP and acetyl-CoA were decreased in the mutant liver but, surprisingly, UDP-GlcNAc was not consistently decreased in the organs that showed low O-GlcNAc. Neither N-acetylglucosamine supplementation nor overexpression of the HBP rate-limiting enzyme GFPT1 restored the protein O-GlcNAc levels. The Bcs1l mutant mice become hypothermic and, interestingly, earlier evidence suggest that O-GlcNAcylation depends on ambient temperature in Drosophila embryos. We found that temperature determined O-GlcNAc abundance also in adult flies of tropical and boreal Drosophila species, in the poikilothermic vertebrate zebrafish, and in cultured mammalian cells. In cultured cells, the OGT-OGA protein ratio coincided with temperature and O-GlcNAc level, providing a regulatory mechanism. Pharmacological OGA inhibition decoupled the O-GlcNAc temperature dependency in cultured cells, as did an OGA null allele in Drosophila . In Bcs1l mutant mice, O-GlcNAc levels strongly correlated with body temperature. Increasing the mouse body temperature through transgenic expression of the heat-generating mitochondrial alternative oxidase (AOX) or housing at 35°C prevented the loss of O-GlcNAc. Pharmacological restoration of O-GlcNAc in the Bcs1l mutant mice produced minimal effects, suggesting that the bulk of O-GlcNAc is dispensable in mild hypothermia. Our findings imply an evolutionarily ancient role of protein O-GlcNAcylation in temperature adaptation and, instead of protein function-specific roles, argue for a global role of O-GlcNAc in temperature control of proteostasis. Introduction The hexosamine biosynthetic pathway (HBP) consumes uridine triphosphate (UTP), glucose, glutamine, and acetyl-CoA as precursors to produce two amino sugars coupled to uridine diphosphate (UDP): UDP-N-acetylglucosamine (UDP-GlcNAc) and UDP-N-acetylgalactosamine (UDP-GalNAc). These activated sugars function, aside other activated sugars, as substrates for N- and O- linked glycosylation of proteins ( Akella et al., 2019 ). As the HBP integrates nucleotide, carbohydrate, amino acid, and fatty acid metabolism, it has been suggested to be a sensor of energy metabolism. The HBP takes place in the cytosol, however, the availability of its four metabolic precursors is linked directly or indirectly to the mitochondrial electron transport chain (ETC) ( Akella et al., 2019 ; Banerjee et al., 2021 ). For example, de novo UTP biosynthesis requires the ETC-dependent enzyme dihydroorotate dehydrogenase (DHODH). In oxidative phosphorylation (OXPHOS) deficiency, ATP production depends increasingly on glycolysis, resulting in hypoglycemia in many mitochondrial diseases. Finally, mitochondrial fatty acid oxidation can be the major source of cellular acetyl-CoA ( Banerjee et al., 2021 ). The nucleocytoplasmic O-GlcNAcylation has been proposed to be more sensitive to UDP-GlcNAc availability than the canonical protein glycosylation in the endoplasmic reticulum and the Golgi apparatus, making it particularly interesting in the context of mitochondrial disease and other disorders affecting energy metabolism. O-GlcNAcylation is a co- and post-translational modification of serine and threonine residues of mainly nuclear and cytosolic proteins, cycled by two enzymes: O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA) ( Hardivillé and Hart, 2014 ; Yang and Qian, 2017 ; Zachara et al., 2022 ). The modification has been widely suggested to be sensitive to cellular stress, including nutrient deprivation, and is proposed to have a cytoprotective role during various of stress responses ( Martinez et al., 2017 ; Zhao et al., 2024 ). However, stress-induced changes on the O-GlcNAc proteome seem to be more complex than that, as O-GlcNAc levels are chronically elevated in certain disease states such as in cancer and diabetes, and has been shown to decline in response to oxidative stress ( Chatham et al., 2021 ; Martinez et al., 2017 ). Adding to the complexity, the modification has been linked to a wide variety of cellular functions including genome maintenance, transcription, translation, autophagy, metabolism, and cellular differentiation, however, the mechanisms of regulation and the exact roles of O-GlcNAc in these phenomena remain elusive. In the present study, we have studied the HBP and O-GlcNAcylation in the knock-in mouse model of GRACILE (Growth Restriction, Aminoaciduria, Cholestasis, Iron overload in the liver, Lactic acidosis, Early death) syndrome, a neonatally lethal mitochondrial disease caused by a missense mutation in BCS1L ( c.A323G, p.S78G ), disrupting proper assembly of respiratory complex III ( Kotarsky et al., 2010 ; Visapää et al., 2002 ). We found that global O-GlcNAc level is dramatically decreased in the complex III-deficient mice with severe metabolic stress. We show that this decrease was not simply due to compromised HBP, but rather part of an evolutionarily conserved mechanism regulating the cellular response to temperature fluctuations. Results CIII-deficient mice show global loss of protein O-GlcNAc We quantified the levels of the HBP ( Fig. 1A ) precursors in the blood and liver of juvenile (postnatal day 30, P30) Bcs1l p.S78G ;mt-Cyb p.D254N mice, modelling severe mitochondrial CIII deficiency caused by the Bcs1l p.S78G patient mutation and an mtDNA background that exacerbates the CIII deficiency ( Purhonen et al., 2020 ). Blood glucose and hepatic UTP concentration, acetyl-CoA concentration, and glutamine/glutamate ratio were all significantly decreased in the mutant mice ( Fig. 1B-E ). We reasoned that the HBP may be compromised by such broad precursor depletion, leading to decreased nucleotide sugar UDP-GlcNAc biosynthesis and O-GlcNAcylation. Using the RL2 monoclonal antibody, we detected protein O-GlcNAc in liver lysates from P30 Bcs1l p.S78G ;mt-Cyb p.D254N mice and found that O-GlcNAc was robustly decreased in the liver, kidney, and skeletal muscle ( Fig. 1F-H ). Immunohistochemistry showed a similar decrease in the liver and kidney sections ( Fig. 1I and Supl. Fig. 1A ). We corroborated these results by analyzing adult mice with a wild-type (WT) mtDNA background, displaying a less severe CIII deficiency and longer survival ( Purhonen et al., 2020 ). At P200, the Bcs1l p.S78 ;mt-Cyb WT mice had a significant, but less pronounced loss of O-GlcNAc in the liver, kidney and skeletal muscle ( Supl. Fig. 1B-D ). Probing of liver proteins with wheat germ agglutinin (WGA) and concanavalin A (con A) lectins, recognizing canonical O- and N-linked glycosylations, revealed no changes in global protein glycosylation levels or patterns between WT and mutant mice ( Supl. Fig. 1E ). Taken together, these data indicate a specific loss of O-GlcNAc in multiple tissues of the CIII-deficient mice. Download figure Open in new tab Supplementary Figure 1. A) Representative O-GlcNAc immunohistochemistry kidney sections of WT and Bcs1l p.S78G ;mt-Cyb p.D254N mice. B-D) Representative western blot and quantification of O-GlcNAc level in the liver (B), kidney (C), and quadriceps (D) lysates of WT and Bcs1l p.S78G mice on WT mtDNA background at P200, n = 8/genotype. E) Representative lectin blots with WGA and Con A in liver lysates from WT and Bcs1l p.S78G ;mt-Cyb p.D254N mice, n = 6/genotype. F) Concentration of hepatic UDP-HexNAc n = 8/genotype, from WT and Bcs1l p.S78G ;mt-Cyb p.D254N mice. Statistics: Welch’s two-sided t-test. p values of the group comparisons are indicated above the panel. The error bars represent 95% CI of mean. All data points derive from independent mice. Download figure Open in new tab Figure 1. Global loss of protein O-GlcNAc in CIII-deficient Bcs1l p.S78G mice A) Schematic cartoon of the hexosamine biosynthetic pathway and O-GlcNAcylation. B) Blood glucose concentration in WT and Bcs1l p.S78G ;mt-Cyb p.D254N mice, n = 13-15/genotype. C) Concentration of UTP in liver tissues, n = 8/genotype. D) Concentration of acetyl-CoA in liver tissues, n = 8-9/genotype. E) Ratio of glutamine to glutamate in liver tissues, n = 18/genotype. F-G) Representative western blots and quantifications of O-GlcNAc level in the liver (F), kidney (G), and quadriceps (H) lysates, n = 7-9/genotype. I) Representative O-GlcNAc immunohistochemistry image of liver sections. Statistics: Welch’s two-sided t-test. p values of the group comparisons are indicated above the panel. The error bars represent 95% CI of mean. All data points derive from independent mice. All mice were on mt-Cyb p.D254N background. Neither hexosamine biosynthesis nor UDP accumulation limits O-GlcNAcylation in the CIII-deficient mice To assess if decreased UDP-GlcNAc biosynthesis underlay the loss of O-GlcNAcylation, we first performed an UPLC-MS quantification of total liver UDP-N-acetylhexosamine content (UDP-GlcNAc + UDP-GalNAc). This revealed no difference between WT and mutant mice ( Supl. Fig. 1F ). Next, we developed an enzymatic method to quantify UDP-GlcNAc specifically ( Sunden et al., 2023 ; Upadhyay et al., 2024 ). Despite the consistent loss of O-GlcNAc, only one out of three independent experiments showed statistically significant decrease in hepatic UDP-GlcNAc in Bcs1l p.S78G ;mt-Cyb p.D254N mice, with many mutants showing normal levels ( Fig. 2A ). Moreover, UDP-GlcNAc level were mostly normal in the kidney, and unchanged in the skeletal muscle ( Fig. 2A ). There was a weak positive correlation (R 2 =0.17) between the UDP-GlcNAc level and protein O-GlcNAc in the liver but not in the other tissues ( Fig. 2B ). To further interrogate this, we supplemented mouse chow with 1% (w/w) N-acetylglucosamine to support the HBP via the salvage pathway, and 0.5% triacetyluridine, which serves a precursor for UTP to bypass the potentially compromised pyrimidine nucleotide biosynthesis in the mutant mice. The glucosamine-uridine supplement from weaning to P29 had no effect on hepatic O-GlcNAcylation or UDP-GlcNAc levels, nor on total uridine or UTP levels in the mutant mice ( Fig. 2C-E ). The growth, blood glucose, or low body temperature of the treated mice were unaffected ( Fig. 2F, 2G ). Finally, to boost HBP, we overexpressed GFPT1, the rate-limiting enzyme of HBP, in the mice using recombinant adeno-associated viral (rAAV) delivery. GFPT1 overexpression did not increase UDP-GlcNAc levels nor O-GlcNAcylation in the liver ( Fig. 2H, 2I ). Taken together, these findings suggested that substrate availability was not the main cause of the decreased protein O-GlcNAc. Download figure Open in new tab Figure 2. Quantification of UDP-GlcNAc in key affected tissues of Bcs1l p.S78G mice A) Concentration of UDP-GlcNAc in the liver, kidney, and quadriceps of WT and Bcs1l p.S78G ;mt-Cyb p.D254N mice, n = 6-9/genotype. B) Correlation between O-GlcNAc level (western blot quantifications) and UDP-GlcNAc concentration in the liver, kidney and quadriceps, n = 6-14/genotype. C) Representative western blot and quantification of O-GlcNAc level in the liver of WT and Bcs1l p.S78G ;mt-Cyb p.D254N mice fed standard chow or chow supplemented with 1% (w/w) N-acetylglucosamine and 0.5% triacyl uridine, n = 6-11. D-E) Concentration of UDP-GlcNAc (D), total uridine nucleotides or UTP (E) in liver of WT and Bcs1l p.S78G ;mt-Cyb p.D254N mice fed standard chow or chow supplemented with 1% (w/w) N-acetylglucosamine and 0.5% triacyl uridine, n = 6-11. F) Non-sex segregated growth rate between days P25-P29 of Bcs1l p.S78G ;mt-Cyb p.D254N mice fed standard chow or chow supplemented with 1% (w/w) N-acetylglucosamine and 0.5% triacyl uridine, n = 4-6. G) Blood glucose concentration and skin temperature of WT and Bcs1l p.S78G ;mt-Cyb p.D254N mice fed standard chow or chow supplemented with 1% (w/w) N-acetylglucosamine and 0.5% triacyl uridine, n = 3-5. H) Concentration of UDP-GlcNAc in the liver of WT mice or of EGFP -or Gfpt1-V5 -injected Bcs1l p.S78G ;mt-Cyb p.D254N mice, n = 6. I) Representative western blot and quantification of O-GlcNAc level in liver of WT mice or of EGFP - or Gfpt1-V5 -injected Bcs1l p.S78G ;mt-Cyb p.D254N mice, n = 6. J) Concentration of UDP and UDP-GlcNAc/UDP ratio in liver tissue, n = 8/genotype. Statistics: Welch’s two-sided t-test (A, J) or one-way ANOVA followed by the selected pairwise comparisons with Welch’s statistics (C-I). p values of the group comparisons are indicated above the panel. The error bars represent 95% CI of mean. All data points derive from independent mice. All mice were on mt-Cyb p.D254N background. OXPHOS deficiency can lead to compromised biosynthesis and insufficient phosphorylation of uridine nucleotides (Purhonen et al. 2023a), possibly including accumulation of UDP, which is a strong end product inhibitor of OGT ( Sunden et al., 2023 ). To investigate whether elevated UDP contributes to the decreased O-GlcNAc levels in Bcs1l p.S78G ;mt-Cyb p.D254N mice, we measured UDP levels in the mutant liver. There was no accumulation of UDP. Instead, UDP was depleted by about 60% ( Fig. 2J ) similarly to UTP ( Fig. 1C ), and the ratio of UDP-GlcNAc to UDP was shifted towards UDP-GlcNAc in the mutant mice ( Fig. 2J ). Global O-GlcNAc level is temperature-dependent in mammalian cells, zebrafish, and fruit flies We recently reported that one-month-old Bcs1l p.S78G ;mt-Cyb p.D254N mice are hypothermic due to loss of both basal and adaptive thermogenesis (preprint; Banerjee et al., 2024 ). Seeking alternative mechanisms behind the decreased O-GlcNAcylation in OXPHOS deficiency, we came across an earlier study showing positive correlation between O-GlcNAc levels and ambient temperature during embryonic development of the poikilotherm Drosophila . No mechanism for this dependency was put forth ( Radermacher et al., 2014 ). We expanded this observation to mammalian systems and analyzed O-GlcNAc in mouse hepatocyte-derived cell lines AML12 and Hepa1-6, and in human dermal fibroblasts, maintained at 30°C, 37°C, and 41°C for 16 hours. We found that global O-GlcNAc levels correlated with the ambient temperature also in cells from homeothermic mammals ( Fig. 3A ). In the hepatocyte-derived cells, O-GlcNAc levels decreased gradually with colder temperature in a time-dependent manner and remained low upon extended culture at 30°C ( Fig. 3B-D , Supl. Fig. 2A-C ). To further explore this, we analyzed O-GlcNAc in the poikilothermic vertebrate model zebrafish and in adult fruit flies. In zebrafish muscle tissue, O-GlcNAc levels were closely associated with the aquarium water temperature (between 16°C and 32°C) ( Fig. 3E ). Similarly, in adult fruit flies maintained at 18°C, 25°C or 32°C for 16 hours, O-GlcNAc level increased progressively as the temperature increased ( Fig. 3F ). To corroborate the result from the originally tropical species Drosophila melanogaster in a boreal (cold climate) native species, we analyzed adult Drosophila montana flies maintained 24 h at different temperatures (-6°C to +19°C) within their natural range. O-GlcNAc was abundant at 19°C but almost undetectable at 10°C and lower ( Fig. 3G ). Except for the 41°C treatment in Hepa1-6 and in human fibroblast cells, temperature had no effect on UDP-GlcNAc levels in mammalian cells ( Fig. 3H ) nor in Drosophila ( Fig. 3I ), indicating that the change in O-GlcNAcylated proteins did not result from altered hexosamine biosynthesis. Download figure Open in new tab Supplementary Figure 2. A) Representative western blot and quantification of O-GlcNAc level in Hepa1-6 cells incubated 16 h at indicated temperatures, n = 9/condition. B) Representative western blot and quantification of O-GlcNAc level in Hepa1-6 cells incubated for the indicated time points at 30°C, n = 9/condition. C) Representative western blot and quantification of O-GlcNAc level in Hepa1-6 cells maintained for the indicated time points at 30°C, n = 3/condition. Statistics: One-way ANOVA followed by the selected pairwise comparisons with Welch’s statistics. p values of the group comparisons are indicated above the panel. Error bars represent for 95% CI of mean. Data in A and B derive from three biological repeats, each containing three technical repeats, one data point indicates one technical repeat. The data points in C indicate technical repeats. Download figure Open in new tab Figure 3. O-GlcNAc level is temperature-dependent in mammalian cells, in the fruit fly, and in zebrafish. A) Representative western blot and quantification of O-GlcNAc level in AML12 cells, Hepa1-6 cells and human fibroblasts incubated 16 h at indicated temperatures, n = 9/condition. B) Representative western blot and quantification of O-GlcNAc level in AML12 cells incubated 16 h at indicated temperatures, n = 9/condition. C) Representative western blot and quantification of O-GlcNAc level in AML12 cells incubated for the indicated time points at 30°C, n = 9/condition. D) Representative western blot and quantification of O-GlcNAc level in AML12 cells maintained for the indicated time points at 30°C, n = 3/condition. E) Representative western blot and quantification of O-GlcNAc level in muscle tissue from zebrafish kept 24 h at indicated temperatures, n = 5/condition. F) Representative western blot and quantification of O-GlcNAc level in Drosophila melanogaster whole-body lysates from the w 1118 fly line kept 16 h at indicated temperatures, n = 3/condition. G) Representative western blot and quantification of O-GlcNAc level in Drosophila montana whole-body lysates from WT flies kept 24 h at indicated temperatures, n = 3/condition. H-I) Concentration of UDP-GlcNAc in AML12 cells, Hepa1-6 cells, and human fibroblasts, n = 9/condition (H), and in Drosophila melanogaster , n = 3/condition (I), kept 16 h at indicated temperatures. Statistics: One-way ANOVA followed by the selected pairwise comparisons with Welch’s statistics. p values of the group comparisons are indicated above the panel. Error bars represent 95% CI of mean. Data in A, B, C and H derive from three biological repeats, each containing three technical repeats, one data point indicates one technical repeat. The data points in D indicate technical repeats. In panel E, each data point derives from independent zebrafish. In F, G, and I, each data point represents one biological repeat, consisting of 3-5 pooled Drosophila adult male flies. Loss of O-GlcNAc in cold coincides with decreased OGT-to-OGA ratio and requires OGA activity The balance of OGT and OGA activities is tightly regulated and its changes may result in increased or decreased O-GlcNAc ( Issad et al., 2022 ; Zhang et al., 2014 ). We quantified OGA and OGT proteins in AML12 ( Fig. 4A ) and in Hepa1-6 cells ( Supl. Fig. 3A ) at the different temperatures. The OGA levels increased significantly at colder temperature and, conversely, OGT increased at warmer temperature. As a result, the OGT/OGA ratio correlated with temperature, potentially mediating the temperature-dependency of O-GlcNAc abundance. A shift in Ogt/Oga ratio was also found on mRNA level ( Fig. 4B ). Inhibition of OGA with thiamet G (TMG) in the cultured cells at 30°C, or genetic manipulation of OGA in Drosophila kept 16 h at 6°C or 18°C, prevented the loss of O-GlcNAc, indicating that the deglycosylation upon hypothermia is an active rather than protein turnover-related process ( Fig. 4C, 4D , Supl. Fig. 3B ). Furthermore, OGT levels decreased upon TMG treatment, while OGA levels significantly increased, corroborating that the cells attempted to maintain a temperature-appropriate level of O-GlcNAc ( Fig. 4C and Supl. Fig. 3B ). Download figure Open in new tab Supplementary Figure 3. A) Representative western blot and quantification of OGT and OGA protein level, and their ratio, in Hepa1-6 cells incubated 16 h at indicated temperatures, n = 9/condition. B) Representative western blot and quantification of O-GlcNAc, OGT and OGA protein level in Hepa1-6 cells ± 0.5 µM thiamet G (TMG) incubated 16 h at 30°C or 37°C, n = 9/condition. C-E) Representative western blot and quantification of OGT and OGA protein level, and their ratio, in quadriceps (C), kidney (D), and liver (E) tissues of WT and Bcs1l p.S78G mice on WT mtDNA background at P200, n = 7-8/genotype. Statistics: One-way ANOVA followed by the selected pairwise comparisons with Welch’s statistics (A, B) or Welch’s two-sided t-test (C-E). p values of the group comparisons are indicated above the panel. Error bars represent for 95% CI of mean. Data in A and B derive from three biological repeats, each containing three technical repeats, one data point indicates one technical repeat. In C-E each data point derives from independent mice. Asterisks indicate isoforms of OGT or unspecific proteins. Download figure Open in new tab Figure 4. Inhibition of OGA rescues hypothermia-induced loss of O-GlcNAcylation in cells and flies A) Representative western blot and quantification of OGT and OGA protein level, and their ratio, in AML12 cells incubated 16 h at indicated temperatures, n = 9/condition. B) Fold change of normalized Ogt and Oga mRNA expression, and their ratio, from transcriptomics data set of AML12 cells incubated 16 h at 30°C or 37°C, n = 4/condition. C) Representative western blot and quantification of O-GlcNAc, OGT and OGA protein level in AML12 cells ± 0.5 µM thiametG (TMG) incubated 16 h at 30°C or 37°C, n = 9/condition. D) Representative western blot and quantification of O-GlcNAc level in w 1118 and oga del.1 fly lines kept 16 h at indicated temperatures, n = 3/condition. Statistics: One-way ANOVA followed by the selected pairwise comparisons with Welch’s statistics (A, C, D) and Welch’s two-sided t-test (B). p values of the group comparisons are indicated above the panel. Error bars represent for 95% CI of mean. In A and C, the data is derived from three biological repeats, each containing three technical repeats, one data point indicates one technical repeat. In B, each data point indicates one technical repeat. In D, each data point represents one biological repeat, consisting of 3-5 pooled Drosophila adult male flies. In the Bcs1l p.S78G ; mt-Cyb p.D254N mouse quadriceps, OGT was decreased and OGA increased on protein and mRNA levels similarly to the cells subjected to hypothermia, suggesting that the modulation of the OGT/OGA ratio contributed to the decreased O-GlcNAc in this tissue in the hypothermic mutant mice ( Fig. 5A, B ). However, OGT and OGA levels did not differ significantly between wild-type and Bcs1l p.S78G ; mt-Cyb p.D254N liver and kidney ( Fig. 5C, D ), alluding that their regulation is more complex in these tissues. In line with this, immunoprecipitated OGT from mutant livers showed normal O-GlcNAcylation rate of a short substrate peptide ( Fig. 5E ). Also, OGA activity in the mutant liver tissue lysates was unchanged ( Fig. 5E ). The expression patterns of OGT and OGA in skeletal muscle, liver and kidney followed a similar pattern in adult (P200) mice with the WT mtDNA background ( Supl. Fig. 3C-E ). Download figure Open in new tab Figure 5. Quantification of OGT and OGA in key affected tissues of Bcs1l p.S78G mice A) Representative western blot and quantification of OGT and OGA protein level, and their ratio, in quadriceps tissue of WT and Bcs1l p.S78G ;mt-Cyb p.D254N mice, n = 6/genotype. B) Fold change of normalized Ogt and Oga mRNA expression, and their ratio, from a quadriceps transcriptomics data, n = 6/genotype. C) Representative western blot and quantification of OGT and OGA protein level, and their ratio, in liver tissue, n = 8/genotype. D) Representative western blot and quantification of OGT and OGA protein level, and their ratio, in kidney tissue, n = 7-8/genotype. E) OGT and OGA activity in P28 liver tissue, n = 4 or 10/genotype, respectively. Statistics: Welch’s two-sided t-test. p values of the group comparisons are indicated above the panel. The error bars represent 95% CI of mean. All data points derive from independent mice. All mice were on mt-Cyb p.D254N background. Asterisks indicate isoforms of OGT or unspecific proteins. Hypothermia causes the global loss of O-GlcNAc in Bcs1l p.S78G mice We found that the post-weaning development (P19-36) of hypothermia, together with a robust hepatic induction of the cold-inducible genes Rbm3 and Cirbp 4 , coincided with the loss of O-GlcNAcylated proteins in the Bcs1l p.S78G ; mt-Cyb. p.D254N mice ( Fig. 6A-C ). Furthermore, the O-GlcNAc level correlated positively with skin temperature ( Fig. 6D ). To further study the temperature-dependency of O-GlcNAc, we utilized samples from mice in which we specifically restored CIII function in the juvenile mouse liver with rAAVs expressing wild-type Bcs1l under a hepatocyte-specific promoter. This correction of CIII deficiency in the mutant liver fully normalized the body temperature and provided a way to probe the consequences of normothermia in untargeted CIII-deficient tissues (preprint, Banerjee et al., 2024 ). O-GlcNAc levels were normalized to WT level not only in the mutant liver but also in the untargeted kidney ( Fig. 6E ). Download figure Open in new tab Figure 6. Correction of body temperature rescues O-GlcNAc levels in Bcs1l p.S78G ;mt-Cyb p.D254N mice A) Correlation between skin temperature and age in WT and Bcs1l p.S78G ;mt-Cyb p.D254N mice. B) Hepatic Rbm3 , Cirbp , and Cirbp splice variant 4 mRNA expression plotted against mouse age. C) Hepatic O-GlcNAc level (western blot quantifications) plotted against mouse age. D) Correlation between hepatic O-GlcNAc level (western blot quantifications) and skin temperature.. E) Representative western blot and quantification of O-GlcNAc level in liver and kidney tissues of WT, and EGFP -injected or Bcs1l- injected Bcs1l p.S78G ;mt-Cyb p.D254N mice. F) Representative infrared image of Bcs1l p.S78G ;mt-Cyb p.D254N and Bcs1l p.S78G ;mt-Cyb p.D254N ;AOX mice. G) Hepatic Rbm3 , Cirbp , and Cirbp splice variant 4 mRNA expression in WT, Bcs1l p.S78G ;mt-Cyb p.D254N , and Bcs1l p.S78G ;mt-Cyb p.D254N ;AOX mice, n = 6-7/genotype. H) Representative western blot and quantification of O-GlcNAc level in liver tissue of WT , AOX, Bcs1l p.S78G ;mt-Cyb p.D254N , and Bcs1l p.S78G ;mt-Cyb p.D254N ;AOX mice and in kidney and quadriceps tissues of WT , Bcs1l p.S78G ;mt-Cyb p.D254N and Bcs1l p.S78G ;mt-Cyb p.D254N ;AOX mice, n = 6-9/genotype. I) Representative western blot and quantification of O-GlcNAc level in liver and quadriceps tissues of mice kept three days at 35°C, n = 5-6/condition. F) Correlation between hepatic O-GlcNAc level (western blot quantification) and skin temperature. Statistics: One-way ANOVA followed by the selected pairwise comparisons with Welch’s statistics. p values of the group comparisons are indicated above the panel. Error bars represent 95% CI of mean. All data points derive from independent mice. All mice were on mt-Cyb p.D254N background. We previously crossed the Bcs1l p.S78G ;mt-Cyb p.D254N mice with mice expressing a non-mammalian mitochondrial enzyme alternative oxidase (AOX), which dissipates respiratory energy directly as heat instead of supporting membrane potential and ATP synthesis (Purhonen et al., 2023a, Rajendran et al., 2019 ). The AOX expression increased the core temperature and decreases cold-inducible gene expression to near-wild type level in the juvenile Bcs1l p.S78G ;mt-Cyb p.D254N mice (preprint; Banerjee et al., 2024 ) ( Fig. 6F, G ). The AOX expression prevented the loss of O-GlcNAc in the liver, kidney and skeletal muscle ( Fig. 6H ). Finally, we housed the mutant and WT mice in 35°C from P25 until sample collection at P28. This forced near-normothermia prevented the loss of O-GlcNAc in the liver and skeletal muscle ( Fig. 6I ). O-GlcNAc level in the WT and mutant mice correlated with skin temperature ( Fig. 6J ). Taken together, disease-associated hypothermia was the cause of the body-wide decrease in O-GlcNAc in the CIII-deficient mice. Enhancing O-GlcNAc levels in the hypothermic mice shows no beneficial effect We next sought to understand whether the loss of O-GlcNAc upon hypothermia is pathogenic per se in the Bcs1l p.S78G ;mt-Cyb p.D254N mice. We inhibited OGA in vivo with daily TMG injections intraperitoneally. After 5 days, O-GlcNAc levels were at WT level in the Bcs1l p.S78G ;mt-Cyb p.D254N mutant liver. The skeletal muscle of TMG-treated mutant mice had two-fold higher O-GlcNAc levels than that of WTs ( Fig. 7A ). Surprisingly, enhancing O-GlcNAc levels further lowered the blood glucose and skin temperature of the mutant mice ( Fig. 7B ), suggesting aggravated disease. Liver transcriptomics data from Bcs1l p.S78G ;mt-Cyb p.D254N mice and their TMG-injected counterparts mice showed minimal differences ( Fig. 7C ). Only 67 genes were significantly upregulated by the TMG-treatment ( Supl. Fig. 4A ). Notably, approximately one-third of these genes are related to liver disease ( Supl. Fig. 4B , Supl. Table 1 ), corroborating the exacerbated disease progression upon forcing O-GlcNAc abundance to WT levels. Download figure Open in new tab Supplementary Figure 4. A) Significantly differentially upregulated genes connected to liver disease in TMG-treated Bcs1l p.S78G ;mt-Cyb p.D254N mice compared untreated Bcs1l p.S78G ;mt-Cyb p.D254N mice. B) Heat map visualization of genes listed in B in WT mice, and in TMG-treated and untreated Bcs1l p.S78G ;mt-Cyb p.D254N mice. View this table: View inline View popup Download powerpoint Supplementary Table 1. Significantly upregulated genes associated with liver disease in TMG-treated Bcs1l p.S78G ;mt-Cyb p.D254N mice compared to untreated Bcs1l p.S78G ;mt-Cyb p.D254N mice. View this table: View inline View popup Download powerpoint Supplementary Table 2. List of antibodies used during western blotting and IHC. Download figure Open in new tab Figure 7. Enhancing O-GlcNAc levels in the hypothermic mice lacks therapeutic effect A) Representative western blot and quantification of O-GlcNAc level in liver and kidney tissue of WT, Bcs1l p.S78G ;mt-Cyb p.D254N , and TMG-injected Bcs1l p.S78G ;mt-Cyb p.D254N mice, n = 6/condition. B) Blood glucose concentration and skin temperature of Bcs1l p.S78G ;mt-Cyb p.D254N and TMG-injected Bcs1l p.S78G ;mt-Cyb p.D254N mice, n = 4-6/genotype. C) Principal component analysis of liver transcriptomics data set from WT, Bcs1l p.S78G ;mt-Cyb p.D254N , and TMG-injected Bcs1l p.S78G ;mt-Cyb p.D254N mice. Statistics: One-way ANOVA followed by the selected pairwise comparisons with Welch’s statistics (A), Mann-Whitney U test (B, blood glucose) and Welch’s two-sided t-test (B, skin temperature). p values of the group comparisons are indicated above the panel. Error bars represent 95% CI of mean. All mice were on mt-Cyb p.D254N background. Discussion O-GlcNAcylation is evolutionarily conserved and OGT is an essential gene in Drosophila , mice and cultured mammalian cells ( Hardivillé and Hart, 2014 ; Zachara et al., 2022 ), yet the mechanisms by which O-GlcNAc affects protein stability, function, and interactions remain largely unknown. For example, there is no known general binding motif or domain that mediates O-GlcNAc-dependent intra-or intermolecular interactions in mammals. The HBP and O-GlcNAcylation are frequently claimed to serve as sensors of nutrient availability ( Paneque et al., 2023 ; Yang and Qian, 2017 ). Surprisingly however, there is little knowledge about the HBP and O-GlcNAcylation in mitochondrial diseases, which often involve severely compromised energy metabolism, potentially decreasing the HBP flux and UDP-GlcNAc availability for O-GlcNAcylation. Unexpectedly, we found that UDP-GlcNAc levels are fairly well maintained in severe OXPHOS deficiency and instead, hypothermia dictates the loss of O-GlcNAcylated proteins in CIII-deficient mice. Our data from these mice and other models show an evolutionarily conserved linear dependency between temperature and global cellular O-GlcNAc status. We first observed that mitochondrial CIII-deficient Bcs1l p.S78G knock-in mice show a global loss of O-GlcNAc and initially hypothesized that this could stem from insufficient hexosamine biosynthesis. However, UDP-GlcNAc quantification showed no consistent decrease in UDP-GlcNAc in the mutant tissues. We previously showed that the liver has a large UDP-GlcNAc pool (>200 pmol/mg) whereas skeletal muscle has about a 10-fold smaller (<20 pmol/mg) ( Sunden et al., 2023 ), possibly because the liver constantly secretes large amounts of glycoproteins. Thus, the high consumption of UDP-GlcNAc in the liver may explain the slight decrease we observed in some of the mutant mice. Otherwise, the lack of correlation between UDP-GlcNAc and protein O-GlcNAc levels is consistent with our recent report that O-GlcNAcylation is highly resistant to nutrient and HBP manipulation, being affected only by rather extreme conditions such as Gfpt1 knock-out in cultured cells ( Sunden et al., 2023 ). This is in line with the data showing that OGT is active over a wide range of UDP-GlcNAc concentrations from the low nm range to >50 mM ( Zachara et al., 2022 ). Feedback inhibition of OGT by UDP, which is demonstrated by the fact that the enzymatic UDP-GlcNAc assay reactions require alkaline phosphatase to remove UDP, was also unlikely to explain the decreased O-GlcNAc as both UTP and UDP were decreased in the mutant mice. Neither oral GlcNAc supplementation nor GFPT1 overexpression affected UDP-GlcNAc levels nor protein O-GlcNAc in the CIII-deficient mice. GFAT is allosterically regulated by its products, including glucosamine-6-phosphate and UDP-GlcNAc ( Jia et al., 2020 ), which may have limited the UDP-GlcNAc levels in vivo , although GFPT1 overexpression leads to a robust increase of UDP-GlcNAc in cultured cells ( Sunden et al., 2023 ). Taken together, these data strongly pointed to a different mechanism than metabolic inhibition of O-GlcNAcylation in the CIII-deficient mice. A report from 2014 suggested that in Drosophila melanogaster embryos, global O-GlcNAc level correlates with ambient temperature, i.e. housing temperature of the flies ( Radermacher et al., 2014 ). Our experiments, in which we exposed also adult fruit flies, zebrafish and cultured mammalian cells to various temperatures within the physiological range, confirmed and expanded the initial observation. Moreover, three independent interventions that restored normothermia in the Bcs1l p.S78G mice indicated unequivocally that body temperature determined the O-GlcNAc status also in the hypothermic mutant mice. To explore the functional significance of the O-GlcNAc-body temperature correlation, we elevated O-GlcNAc in the hypothermic mutant mice by pharmacologically inhibiting OGA. Surprisingly, rather than mitigating the disease phenotype, the treated mutant mice exhibited further deterioration. In the liver, OGA inhibition had minimal effect on the global transcriptome, suggesting that decreased O-GlcNAc in cold is not harmful per se . O-GlcNac is evolutionarily conserved in all metazoans ranging from filamentous fungi, worms, insects, and plants to humans – organisms living in vastly different temperature optima and fluctuations. Nucleocytoplasmic O-glycosylation exists in plants but is still quite poorly characterized. Intriguingly, of the two plant OGT paralogs SECRET AGENT (SEC) and SPINDLY (SPY), SPY encodes a fucosyltransferase instead of an O-GlcNAc transferase ( Mutanwad and Lucyshyn, 2022 ). Similarly, the SPY gene in protozoa, e.g., Dictyostelium discoideum also encodes a fucosyltransferase ( Tiwari et al., 2025 ). Curiously, baker’s yeast ( S. cerevisiae ), which apparently lacks OGT and OGA paralogs, glycosylates nucleocytoplasmic proteins with O-mannose with a similar distribution to O-GlcNAc in multicellular organisms ( Bartels et al., 2016 ). Thus, it appears that different organisms have evolved to use similar, neutral sugar moieties for nucleocytoplasmic protein O-monoglycosylation, strongly suggesting that O-GlcNAc mainly serves a global, rather than protein-specific role, in regulating the proteome, as suggested by several studies in contexts other than intrinsic body temperature ( Kazemi et al., 2010 ; Ryan et al., 2019 ; Wang et al., 2014 ; Wulff-Fuentes et al., 2023; Zeidan et al., 2024 ). Taken together, our data argue against direct protein function-specific roles for the nucleocytoplasmic O-GlcNAc, as such specific roles seem incompatible with the global temperature dependency that we show here. Instead, the data suggest a general role in cellular protein homeostasis. In fact, O-GlcNAc has been suggested as a regulator of proteostasis, mainly from studies assessing the stability, turnover or degradation of individual proteins ( Zachara et al., 2022 ). O-GlcNAc has also been proposed to be a critical co-translational stabilizer of nascent proteins ( Zeidan et al., 2024 ; Zhu et al., 2015 ). We propose that O-GlcNAc is an evolutionarily ancient temperature adaptation mechanism that guards the proteome upon temperature fluctuations in both poikilothermic and homeothermic organisms. Materials and methods Mouse lines and husbandry We have described the Bcs1l p.S78G ;mt-Cyb p.D254N , Bcs1l p.S78G and AOX mouse lines in detail in our previous publications ( Levéen et al., 2011 ; Purhonen et al., 2020 ; Rajendran et al., 2019 ). The Bcs1l p.S78G mice on mt-Cyb p.D254N background were used as experimental model, unless otherwise stated. Bcs1l WTs and heterozygotes, irrespective of the mt-Cyb p.D254N variant were considered as phenotypically WT. The analyses included both sexes unless otherwise stated. All mice were on C57BL/6JCrl (RRID: IMSR_JAX:000664) nuclear genomic background and received water and chow (Teklad 2018, Harlan) ad libitum. The animal facilities of University of Helsinki housed the mice in temperature-controlled (23°C), individually ventilated cages under a 12-h light/dark cycle. The animal ethics committee of the State Provincial Office of Southern Finland approved the animal studies (permit numbers ESAVI/6365/04.10.07/2017, ESAVI/16278/2020 and ESAVI/31141/2023). We performed the animal experiments according to the FELASA (Federation of Laboratory Animal Science Associations) guidelines and best practices. The animal work and experimental set up was designed following3R principles. Dietary interventions in mice Powdered chow was supplemented to contain 1% (w/w) N-acetylglucosamine (Sigma-Aldrich, St. Louis, MO, USA) and 0.5% triacetyluridine (ChemCruz, Dallas, TX, USA). The chow was moistened, pressed into pellets, dried at room temperature, and stored at -20°C until use. The treated mice received this chow ad libitum from weaning (P19-22) until sample collection at P29. rAAV cloning, production and administration For the cloning of the rAAV constructs, mouse Bcs1l and Gfpt1 coding sequences were PCR-amplified and cloned into a pBluescript vector. After sequencing, the fragments were subcloned into the pAAV2-LSP1-EGFP vector (a kind gift from Prof. Ian Alexander, University of Sydney). This vector delivers hepatocyte-specific expression under ApoE enhancer and human α1-antitrypsin promoter ( Cunningham et al., 2015 ). The original vector containing EGFP was used as control. Serotype 9 viral particles were produced by AAV Gene Transfer and Cell Therapy Core Facility of University of Helsinki. The treated mice received 5×10 10 viral particles in 100 µl saline via intraperitoneal injection at P21-22. The tissue samples were collected on P28. A vector encoding enhanced green fluorescent protein was used as control for Bcs1l -injections and GFPT1-V5 expression was verified with Western blot. Thiamet G treatment in mice Mice were treated with 20 mg/kg thiamet G (TMG, MedChemExpress, Monmouth Junction, NJ, USA), administered via intraperitoneal injection daily at P25-P29. The samples were collected at P29. Thermoneutrality intervention in mice Mice were housed at 35°C (thermoneutral for the mutant mice with compromised basal and adaptive thermogenesis) for 3 days and sacrificed on P28. Fly husbandry, strains and populations Drosophila melanogaster strains were maintained at 25°C with a 12-h light-dark cycle on standard medium. The w 1118 strain was used as wild-type control. The oga del.1 strain ( Akan et al., 2016 ) was provided by Dr. John Hanover, Laboratory of Cell and Molecular Biology, National Institutes of Health, USA. For temperature treatments, five adult male flies (10-14 days old) were transferred into fresh vials and incubated at the specified temperature for 16 h. Drosophila montana was maintained at 18°C with a 12-h light-dark cycle on malt medium. The flies used originate from the populations Oulanka, Vancouver and Kamchatka. For the temperature treatment, three adult male flies (14 days old) were transferred into fresh vials and incubated at the specified temperature for 24 h. Zebrafish husbandry and strains The fish were housed at a density of 5 to 8 fish per tank in mixed-sex groups in 3-L tanks on a recirculating system (Aquatic Habitats) in 28.5°C water in a room with a 14:10-h light-dark cycle. The fish were fed three times a day with both a commercial pelleted diet (Special Diet Services, SDS400) and Artemia nauplii (Sanders, Great Salt Lake Artemia). For the temperature treatments, five adult fish of the AB wild-type strain were transferred to water of indicated temperatures for 24 h. Sample collection Mice were euthanized by cervical dislocation at P28-30 unless stated otherwise. Prior to sample collection, the mice were fasted for two hours, and all samples were collected approximately at the same time of the day, during the light period of the mice. Skin temperature was recorded with the Gentle Temp 720 IR meter (Omron Health Care, Tokyo, Japan). Tissues were either fixed in 10% histology-grade formalin or snap frozen in liquid nitrogen and stored at -80°C. Blood glucose levels were measured using a quick meter (Freestyle Lite, Abbott, Alameda, CA, USA) from blood within the body cavity during sample collection. Flies or zebrafish muscle tissue were collected by snap freezing in liquid nitrogen and samples were stored at -80°C. Cell culture and treatments Non-transformed mouse hepatocyte line AML12 (ATCC, #CRL-2254) was cultured in DMEM: Ham’s F-12 medium with 10% fetal bovine serum, 5 mM glucose, glutamine, an insulin-transferrin-selenium supplement (Gibco, Waltham, MA, USA), and penicillin and streptomycin. Hepa1-6 mouse hepatoma cells and human neonatal dermal fibroblast were cultured in DMEM with 10% fetal bovine serum, 5 mM glucose, glutamine, penicillin, and streptomycin. Cells were maintained at 37°C. For temperature treatments, the cells were plated in 6-cm plates at least one day prior to the experiment. At 40% confluency, the cells were transferred to indicated temperatures for 0-16 h. To inhibit OGA, AML12 and Hepa1-6 cells were treated with 0.5 μM TMG for 16 h at 30°C or 37°C. After treatment, the cells were rinsed quickly with ice cold PBS and harvested in cold 80% MeOH or in 2% SDS lysis buffer (60 mM Tris-Cl pH 6.8, 2% SDS, 12.5% glycerol, 1 mM EDTA) supplemented with protease inhibitors (Complete protease inhibitor mix, Roche, Basel, Switzerland). Cells used for RNA extraction were harvested in RNAzol (Sigma-Aldrich). SDS-PAGE and Western blot For Western blot analyses of tissues, 5-10-mg frozen tissue samples were homogenized in 2% SDS lysis buffer supplemented with protease inhibitors (Complete protease inhibitor mix, Roche), followed by a brief sonication. Protein concentrations were measured with Bradford reagent (Bio-Rad, Hecules, CA, USA) and bovine serum albumin standards. 2.5 mg/ml α-cyclodextrin (Sigma-Aldrich) was included in the reagent to chelate interfering SDS. For standard SDS-PAGE, bromophenol blue and 5% β-mercaptoethanol were added to the protein lysates and the samples were heated at 95°C for 5 minutes. Per lane, 5–30 µg total protein was run in TGX TM precast gradient gels (Bio-Rad). Transfer onto PVDF (Amersham Hybond P 0.2 PVDF, Cytiva, Marlborough, MA) membranes was performed using the tank transfer method with Towbin buffer containing 10% MeOH. Equal loading and transfer were confirmed by staining the PVDF membranes with Coomassie G-250. Supplementary Table 2 lists all antibodies used. Detection and documentation of immunoblots were performed using peroxidase-conjugated secondary antibodies, enhanced chemiluminescence, and a ChemiDoc MP (Bio-Rad) or a Li-Cor Odyssey M (Lincoln, NE, USA) imaging systems. Prior to immunodetection of biotin-conjugated lectins, endogenous biotin was blocked with 1 µg/ml streptavidin (Jackson ImmunoResearch, West Grove, PA, USA), whereafter unbound streptavidin was neutralized with 50 µM biotin (ChemCruz). All samples subjected to quantification were processed and run in a randomized order. For representative blots, individually analyzed samples were pooled together from each experimental group to obtain a representative average signal. RNA sequencing and differential expression analysis Total RNA was extracted from cells or snap-frozen tissue using the RNAzol RT reagent (Sigma-Aldrich) following the manufacturer’s instructions and sent to Novogene (Beijing, China) for mRNA sequencing. Raw sequencing reads were processed by Novogene. Downstream analysis of the count data was performed in R (version 4.4.2) using the DESeq2 package (version 1.46.0). Variance stabilizing transformation (VST) normalized read counts, generated using DESeq2, were used to perform principal component analysis (PCA) for visualization of sample clustering and variability. During differential expression analysis, genes with an adjusted p-value of 1 were considered significantly differentially expressed. Quantitative PCR For qPCR analyses, total RNA was extracted from snap-frozen tissue samples with RNAzol RT reagent (Sigma-Aldrich) according to manufacturer’s instructions. cDNA was synthesized, followed by qPCR using EvaGreen and Phire II Hot Start DNA polymerase-based detection chemistry, as described ( Purhonen et al., 2020 ). The qPCR and data analysis were performed using a CFX96 thermocycler and CFX Manager software (Bio-Rad). PCR efficiency was calculated using LinRegPCR software. The following primers were used to amplify cDNA: Rbm3 : 5ʹ– ACCGATGAACAGGCACTTGAA–3ʹ, 5ʹ–ATGCTCTGGGTTTGTGAAGGT–3ʹ, Cirbp : 5ʹ– GCCTTAGGAAGCTTGGGTGT–3ʹ, 5ʹ–TTGGTGTCGAAGCTGAGTCC–3ʹ, Cirbp splice variant 4 : 5ʹ–GGGGTCCTGGCATTCTTCTC–3ʹ, 5ʹ–GCTGAGTCCTCCCACGAAAA–3ʹ, Rab11a : 5ʹ– AAGGCACAGATATGGGACACA–3ʹ, 5’–CCTACTGCTCCACGATAGTATGC–3ʹ, Gak : 5ʹ-TTCCTCAACTGCCTTCCCATC-3ʹ, 5ʹ-ACGTATCCCATCCTCCTAGCA-3ʹ. Rab11a and Gak were used as reference genes. Histology Formalin-fixed paraffin-embedded liver and kidney tissue sections were used for immunohistochemical staining of O-GlcNAc (antibody: O-GlcNAc, clone RL2, BioLegend, San Diego, CA, USA). For detection, Vectastain Elite ABC peroxidase or alkaline phosphatase reagents, or ImmPRESS peroxidase or alkaline phosphatase polymer detection reagents (Vector Laboratories, Newark, CA, USA) were used. Metabolite analyses UDP-GlcNAc and uridine nucleotides were measured using protocols previously developed and described by our laboratory ( Sunden et al., 2023 ) ( Purhonen et al., 2023 ) ( Upadhyay et al., 2024 ). For Ac-CoA quantification, ∼10 mg liver samples were homogenized in 0.4 ml ice-cold buffered 60% MeOH (10 mM Bis-Tris-Cl pH 7.0), containing 10 mM N-ethylmaleimide (NEM) to alkylate CoA. After pelleting insoluble material, the extracts were incubated 5 minutes at 30°C to complete the alkylation. Further precipitation of macromolecules and phase separation was induced by addition of 0.18 ml chloroform. The aqueous fractions were washed twice with 1.6 ml chloroform to remove MeOH and NEM. Any residual NEM was quenched with 1 mM DTT. Ac-CoA was quantified with coupled enzymatic reactions leading to a cyclic accumulation of NADH, the rate of which depended on the Ac-CoA + CoA concentration and served as a readout for the assay (increase in 340 nm absorbance). The assay reactions comprised: 100 mM Tris-Cl pH 7.5, 10 mM malate, 0.5 mg/ml fatty acid-free BSA, 1.9 mM acetyl phosphate, 1.1 mM NAD + , 1 U/ml malate dehydrogenase (Megazyme, Bray, Ireland), 1.9 U citrate synthase (Megazyme), and 14.4 U/ml phosphotransacetylase (Megazyme). The Gln/Glu ratio was calculated from a published metabolomics dataset ( Kotarsky et al., 2012 ). OGT and OGA activity assays The liver tissues were homogenized in PBS containing 0.1% Triton X-100, 2 mM β-mercaptoethanol, and protease inhibitor mix (EDTA-free Complete protease inhibitor mix, Roche) and clarified by centrifugation. OGA activity was determined by following the cleavage of a fluorogenic substrate 4-methylumbelliferyl N-acetyl-β-D-glucosaminide (4-MUF-NAG). The assay reactions comprised 2 mM 4-MUF-NAG, 0.5 mg/ml BSA, 2 mM β-mercaptoethanol, and 20 mM N-acetylgalactosamine in 50 mM potassium phosphate buffer pH 7.0. The inclusion of N-acetylgalactosamine served to inhibit lysosomal hexosaminidases. The background was determined in the presence of 25 µM TMG. OGT activity was determined from the same lysates (0.7 mg protein) after immunoprecipitation of OGT with paramagnetic protein A beads (Dynabeads, Invitrogen, Waltham, MA USA) and 500 ng antibody against OGT (Novus, NBP1-32791). On-bead O-GlcNAcylation reactions (10 µl) were carried out in 25 mM Bis-Tris-Cl pH 7.0, 0.3 mg/ml BSA, 2 mM β-mercaptoethanol, 100 µM ultra-pure UDP-GlcNAc (Promega, Madison, WI, USA), and 25 µg/ml substrate peptide (KKKYPGGSTPVSSANMM). After a 3 h incubation at room temperature (21-23°C), the reactions were stopped by separating the beads and the reaction media. OGT activities were determined based on the UDP released from UDP-GlcNAc. The released UDP was quantified using Promega UDP-Glo reagent. Background was determined in the presence of 36 µM OSMI-1. Purified immunoprecipitated recombinant OGT served as a positive control and normal rabbit serum (200 nl) immunoprecipitated lysate as a negative control. Due to the nature of the assay, lysates from 2-3 distinct mice of the same genotype were pooled together. Statistics In the figures, error bars represent the mean and 95% confidence interval (CI) of the mean. Group differences were analyzed using Welch’s t-test, or Mann-Whitney U test when more propriate, for two groups, or one-way ANOVA followed by pre-selected pairwise comparisons (Welch’s t-statistics). All pairwise comparisons were performed using two-sided tests. In mouse and zebrafish experiments, each experimental unit ( n ) corresponds to an individual animal, except for the experiment regarding OGT activity, in which pooled lysates from individual mice were used. In Drosophila experiments, each experimental unit consisted of 3-5 pooled flies; within each experiment, at least three units originating from different fly generations were used. Cell culture experiments were performed in technical triplicates, with each treated replicate analyzed as an independent experimental unit. GraphPad Prism software was used for the statistical analyses (GraphPad Software Inc., La Jolla, CA, USA). The figure legends provide information on the specific statistical tests applied and the p -values are displayed in the graphs. Author contributions JK, JP and CK designed and supervised the study. DU, CK, RB, JP and JK performed the mouse experiments and sample collection. DU, CK, RB, NS, JP and JK performed the mouse tissue analyses. CK performed the Drosophila and zebrafish experiments and analyzed their data. CK, DU and NS performed the cell culture experiments and analyzed their data. CK analyzed the histological data. CK was responsible for the statistics. DU and JK wrote the first manuscript draft. CK and DU prepared the figure panels. VF and all other authors critically read and commented the manuscript, and JK, CK and DU revised it accordingly. Acknowledgments We thank Vilma Wanne for technical assistance. We thank the core facilities of University of Helsinki, the Viikki Metabolomics Unit, the Tissue Preparation and Histochemistry Unit (Department of Anatomy) and the Finnish Centre for Laboratory Animal Pathology (Faculty of Veterinary Medicine) for processing of histological samples, and the Laboratory Animal Center of the University of Helsinki for the animal husbandry. We thank Dr. Henri Koivula at the NC-ZebrafU, Helsinki In Vivo Animal Imaging Unit, University of Helsinki for the zebrafish sample collection. We acknowledge the funding from Folkhälsan Research Center, Jane and Aatos Erkko Foundation, the Foundation for Pediatric Research, Finska Läkaresällskapet and Medicinska Understödsföreningen Liv och Hälsa rf, and Magnus Ehrnrooth Foundation. Funder Information Declared Samfundet Folkhälsan Jane and Aatos Erkko Foundation, https://ror.org/03vxy9y38 Sigrid Jusélius Foundation, https://ror.org/00ckakm23 Medicinska Understödsföreningen Liv och Hälsa, https://ror.org/00qx9g681 Finska Läkaresällskapet, https://ror.org/04vbzm272 Lastentautien Tutkimussäätiö, https://ror.org/001wmc692 Finska Vetenskaps-Societeten Footnotes ↵ # Equal contribution References ↵ Akan , I. , Love , D.C. , Harwood , K.R. , Bond , M.R. , Hanover , J.A ., 2016 . Drosophila O-GlcNAcase deletion globally perturbs chromatin O-GlcNAcylation . J Biol Chem 291 , 9906 – 9919 . OpenUrl Abstract / FREE Full Text ↵ Akella , N.M. , Ciraku , L. , Reginato , M.J ., 2019 . Fueling the fire: emerging role of the hexosamine biosynthetic pathway in cancer . BMC Biol . 17 , 52 . OpenUrl CrossRef PubMed ↵ Banerjee , R. , Purhonen , J. , Kallijärvi , J ., 2021 . The mitochondrial coenzyme Q junction and complex III: biochemistry and pathophysiology . FEBS J 289 ( 22 ): 6936 – 6958 . OpenUrl PubMed ↵ Banerjee , R. , Upadhyay , D. , Zarybnický , T. , Kietz , C. , Kuure , S. , Fellman , V. , Purhonen , J. , Kallijärvi , J. , 2024 . Hepatic mitochondrial respiration is crucial for euthermia in complex III-deficient mice with impaired brown adipose tissue thermogenesis . bioRxiv 2024.09.23.612616 ↵ Bartels , M.F. , Winterhalter , P.R. , Yu , J. , Liu , Y. , Lommel , M. , Möhrlen , F. , Hu , H. , Feizi , T. , Westerlind , U. , Ruppert , T. , Strahl , S ., 2016 . Protein O-mannosylation in the murine brain: Occurrence of mono-O-mannosyl glycans and identification of new substrates . PLoS One 11 , e0166119 . OpenUrl PubMed ↵ Chatham , J.C. , Zhang , J. , Wende , A.R ., 2021 . Role of O-linked N-acetylglucosamine protein modification in cellular (patho)physiology . Physiological Reviews 101 , 427 – 493 . OpenUrl CrossRef PubMed ↵ Cunningham , S.C. , Siew , S.M. , Hallwirth , C.V. , Bolitho , C. , Sasaki , N. , Garg , G. , Michael , I.P. , Hetherington , N.A. , Carpenter , K. , de Alencastro , G. , Nagy , A. , Alexander , I.E. , 2015 . Modeling correction of severe urea cycle defects in the growing murine liver using a hybrid recombinant adeno-associated virus/piggyBac transposase gene delivery system . Hepatology 62 , 417 – 428 . OpenUrl CrossRef PubMed ↵ Hardivillé , S. , Hart , G.W ., 2014 . Nutrient regulation of signaling, transcription, and cell physiology by O-GlcNAcylation . Cell Metab 20 , 208 – 213 . OpenUrl CrossRef PubMed ↵ Issad , T. , Al-Mukh , H. , Bouaboud , A. , Pagesy , P ., 2022 . Protein O-GlcNAcylation and the regulation of energy homeostasis: lessons from knock-out mouse models . J Biomed Sci 29 , 64 . OpenUrl CrossRef PubMed ↵ Jia , C. , Li , H. , Fu , D. , Lan , Y ., 2020 . GFAT1/HBP/O-GlcNAcylation axis regulates β-catenin activity to promote pancreatic cancer aggressiveness . Biomed Res Int 2020 , 1921609 . OpenUrl PubMed ↵ Kazemi , Z. , Chang , H. , Haserodt , S. , McKen , C. , Zachara , N.E ., 2010 . O -Linked β- N - acetylglucosamine ( O -GlcNAc) regulates stress-induced heat shock protein expression in a GSK-3β-dependent manner . Journal of Biological Chemistry 285 , 39096 – 39107 . OpenUrl Abstract / FREE Full Text ↵ Kotarsky , H. , Karikoski , R. , Mörgelin , M. , Marjavaara , S. , Bergman , P. , Zhang , D.-L. , Smet , J. , van Coster , R. , Fellman , V. , 2010 . Characterization of complex III deficiency and liver dysfunction in GRACILE syndrome caused by a BCS1L mutation . Mitochondrion 10 , 497 – 509 . OpenUrl CrossRef PubMed ↵ Kotarsky , H. , Keller , M. , Davoudi , M. , Levéen , P. , Karikoski , R. , Enot , D.P. , Fellman , V ., 2012 . Metabolite profiles reveal energy failure and impaired β-oxidation in liver of mice with complex III deficiency due to a BCS1L mutation . PLoS ONE 7 , e41156 . OpenUrl CrossRef PubMed ↵ Levéen , P. , Kotarsky , H. , Mörgelin , M. , Karikoski , R. , Elmér , E. , Fellman , V ., 2011 . The GRACILE mutation introduced into Bcs1l causes postnatal complex III deficiency: a viable mouse model for mitochondrial hepatopathy . Hepatology 53 , 437 – 447 . OpenUrl CrossRef PubMed Web of Science ↵ Martinez , M.R. , Dias , T.B. , Natov , P.S. , Zachara , N.E ., 2017 . Stress-induced O-GlcNAcylation, an adaptive process of injured cells . Biochem Soc Trans 45 , 237 – 249 . OpenUrl Abstract / FREE Full Text ↵ Mutanwad , K.V. , Lucyshyn , D ., 2022 . Balancing O-GlcNAc and O-fucose in plants . FEBS J 289 , 3086 – 3092 . OpenUrl PubMed ↵ Paneque , A. , Fortus , H. , Zheng , J. , Werlen , G. , Jacinto , E ., 2023 . The hexosamine biosynthesis pathway: Regulation and function . Genes 14 , 933 . OpenUrl ↵ Purhonen , J. , Grigorjev , V. , Ekiert , R. , Aho , N. , Rajendran , J. , Pietras , R. , Truvé , K. , Wikström , M. , Sharma , V. , Osyczka , A. , Fellman , V. , Kallijärvi , J ., 2020 . A spontaneous mitonuclear epistasis converging on Rieske Fe-S protein exacerbates complex III deficiency in mice . Nat Commun 11 , 322 . OpenUrl CrossRef PubMed ↵ Purhonen , J. , Hofer , A. , Kallijärvi , J ., 2023 . Quantification of all 12 canonical ribonucleotides by real-time fluorogenic in vitro transcription . Nucleic Acids Research gkad 1091 . ↵ Radermacher , P.T. , Myachina , F. , Bosshardt , F. , Pandey , R. , Mariappa , D. , Müller , H.-A.J. , Lehner , C.F ., 2014 . O-GlcNAc reports ambient temperature and confers heat resistance on ectotherm development . PNAS 111 , 5592 – 5597 . OpenUrl Abstract / FREE Full Text ↵ Rajendran , J. , Purhonen , J. , Tegelberg , S. , Smolander , O.-P. , Mörgelin , M. , Rozman , J. , Gailus-Durner , V. , Fuchs , H. , Hrabe de Angelis , M. , Auvinen , P. , Mervaala , E. , Jacobs , H.T. , Szibor , M. , Fellman , V. , Kallijärvi , J. , 2019 . Alternative oxidase-mediated respiration prevents lethal mitochondrial cardiomyopathy . EMBO Mol Med 11 . ↵ Ryan , P. , Xu , M. , Davey , A.K. , Danon , J.J. , Mellick , G.D. , Kassiou , M. , Rudrawar , S ., 2019 . O-GlcNAc modification protects against protein misfolding and aggregation in neurodegenerative disease . ACS Chem. Neurosci . 10 , 2209 – 2221 . OpenUrl PubMed ↵ Sunden , M. , Upadhyay , D. , Banerjee , R. , Sipari , N. , Fellman , V. , Kallijärvi , J. , Purhonen , J ., 2023 . Enzymatic assay for UDP-GlcNAc and its application in the parallel assessment of substrate availability and protein O-GlcNAcylation . Cell Rep Methods 3 , 100518 . OpenUrl PubMed ↵ Tiwari , M. , Gas-Pascual , E. , Goyal , M. , Popov , M. , Matsumoto , K. , Grafe , M. , Gräf , R. , Haltiwanger , R.S. , Olszewski , N. , Orlando , R. , Samuelson , J.C. , West , C.M ., 2025 . Novel antibodies detect nucleocytoplasmic O-fucose in protist pathogens, cellular slime molds, and plants . mSphere 10 , e0094524 . OpenUrl PubMed ↵ Upadhyay , D. , Banerjee , R. , Kallijärvi , J. , Purhonen , J ., 2024 . Protocol for quantification of UDP-GlcNAc using an enzymatic microplate assay . STAR Protoc 5 , 102817 . OpenUrl PubMed ↵ Visapää , I. , Fellman , V. , Vesa , J. , Dasvarma , A. , Hutton , J.L. , Kumar , V. , Payne , G.S. , Makarow , M. , Van Coster , R. , Taylor , R.W. , Turnbull , D.M. , Suomalainen , A. , Peltonen , L. , 2002 . GRACILE syndrome, a lethal metabolic disorder with iron overload, is caused by a point mutation in BCS1L . Am. J. Hum. Genet . 71 , 863 – 876 . OpenUrl CrossRef PubMed Web of Science ↵ Wang , Z.V. , Deng , Y. , Gao , N. , Pedrozo , Z. , Li , D.L. , Morales , C.R. , Criollo , A. , Luo , X. , Tan , W. , Jiang , N. , Lehrman , M.A. , Rothermel , B.A. , Lee , A.-H. , Lavandero , S. , Mammen , P.P.A. , Ferdous , A. , Gillette , T.G. , Scherer , P.E. , Hill , J.A ., 2014 . Spliced X-box binding protein 1 couples the unfolded protein response to hexosamine biosynthetic pathway . Cell 156 , 1179 – 1192 . OpenUrl CrossRef PubMed Web of Science Wulff-Fuentes , E. , Boakye , J. , Kroenke , K. , Berendt , R.R. , Martinez-Morant , C. , Pereckas , M. , Hanover , J.A. , Olivier-Van Stichelen , S. , 2023 . O-GlcNAcylation regulates OTX2’s proteostasis . iScience 26 , 108184 . OpenUrl PubMed ↵ Yang , X. , Qian , K ., 2017 . Protein O-GlcNAcylation: emerging mechanisms and functions . Nat Rev Mol Cell Biol 18 , 452 – 465 . OpenUrl CrossRef PubMed ↵ Varki , A. , Cummings , R.D. , Esko , J.D. , Stanley , P. , Hart , G.W. , Aebi , M. , Mohnen , D. , Kinoshita , T. , Packer , N.H. , Prestegard , J.H. , Schnaar , R.L. , Seeberger , P.H Zachara , N.E. , Akimoto , Y. , Boyce , M. , Hart , G.W ., 2022 . The O-GlcNAc Modification , in: Varki , A. , Cummings , R.D. , Esko , J.D. , Stanley , P. , Hart , G.W. , Aebi , M. , Mohnen , D. , Kinoshita , T. , Packer , N.H. , Prestegard , J.H. , Schnaar , R.L. , Seeberger , P.H . (Eds.), Essentials of Glycobiology . Cold Spring Harbor Laboratory Press, Cold Spring Harbor ( NY ). ↵ Zeidan , Q. , Tian , J.L. , Ma , J. , Eslami , F. , Hart , G.W ., 2024 . O-GlcNAcylation of ribosome-associated proteins is concomitant with translational reprogramming during proteotoxic stress . Journal of Biological Chemistry 300 . ↵ Zhang , Z. , Tan , E.P. , VandenHull , N.J. , Peterson , K.R. , Slawson , C ., 2014 . O-GlcNAcase Expression is Sensitive to Changes in O-GlcNAc Homeostasis . Front Endocrinol (Lausanne ) 5 , 206 . OpenUrl PubMed ↵ Zhao , Y. , Li , R. , Wang , W. , Zhang , H. , Zhang , Q. , Jiang , J. , Wang , Y. , Li , Y. , Guan , F. , Nie , Y ., 2024 . O-GlcNAc signaling: Implications for stress-induced adaptive response pathway in the tumor microenvironment . Cancer Letters 598 , 217101 . OpenUrl PubMed ↵ Zhu , Y. , Liu , T.-W. , Cecioni , S. , Eskandari , R. , Zandberg , W.F. , Vocadlo , D.J ., 2015 . O-GlcNAc occurs cotranslationally to stabilize nascent polypeptide chains . Nat Chem Biol 11 , 319 – 325 . OpenUrl CrossRef PubMed Supplementary references Ahmed , S. , Bott , D. , Gomez , A. , Tamblyn , L. , Rasheed , A. , Cho , T. , MacPherson , L. , Sugamori , K.S. , Yang , Y. , Grant , D.M. , Cummins , C.L. , Matthews , J ., 2015 . Loss of the mono-ADP-ribosyltransferase, Tiparp, increases sensitivity to dioxin-induced steatohepatitis and lethality . J. Biol. Chem . 290 , 16824 – 16840 . OpenUrl Abstract / FREE Full Text Carter , J.K. , Tsai , M.-C. , Venturini , N. , Hu , J. , Lemasters , J.J. , Torres Martin , M. , Sia , D. , Wang , S. , Lee , Y.A. , Friedman , S.L ., 2024 . Stellate cell-specific adhesion molecule protocadherin 7 regulates sinusoidal contraction . Hepatol. Baltim. Md 80 , 566 – 577 . OpenUrl Chen , L. , Xia , S. , Wang , F. , Zhou , Yuanyuan , Wang , S. , Yang , T. , Li , Y. , Xu , M. , Zhou , Ya , Kong , D. , Zhang , Z. , Shao , J. , Xu , X. , Zhang , F. , Zheng , S ., 2023 . m6A methylation-induced NR1D1 ablation disrupts the HSC circadian clock and promotes hepatic fibrosis . Pharmacol. Res . 189 , 106704 . OpenUrl PubMed Chen , X. , Lv , X. , Han , M. , Hu , Y. , Zheng , W. , Xue , H. , Li , Z. , Li , K. , Tan , W ., 2023 . EMP1 as a potential biomarker in liver fibrosis: A bioinformatics analysis . Gastroenterol. Res. Pract . 2023 , 2479192 . OpenUrl PubMed Ding , C. , Wang , Z. , Shi , K. , Li , S. , Dou , X. , Ning , Y. , Cheng , G. , Yang , Q. , Sang , X. , Peng , M. , Lyu , Q. , Wang , L. , Han , X. , Cao , G ., 2025 . Taxifolin attenuates liver fibrosis by regulating the phosphorylation of NDRG1 at Thr328 via hepatocyte-stellate cell cross talk . Acta Pharm. Sin. B 15 , 2059 – 2076 . OpenUrl PubMed Huang , G. , Besner , G.E. , Brigstock , D.R ., 2012 . Heparin-binding epidermal growth factor-like growth factor suppresses experimental liver fibrosis in mice . Lab. Investig. J. Tech. Methods Pathol . 92 , 703 – 712 . OpenUrl Kikuchi , A. , Singh , S. , Poddar , M. , Nakao , T. , Schmidt , H.M. , Gayden , J.D. , Sato , T. , Arteel , G.E. , Monga , S.P ., 2020 . Hepatic stellate cell-specific Platelet-derived growth factor receptor-α loss reduces fibrosis and promotes repair after hepatocellular injury . Am. J. Pathol . 190 , 2080 – 2094 . OpenUrl CrossRef PubMed Kim , H.Y. , Rosenthal , S.B. , Liu , X. , Miciano , C. , Hou , X. , Miller , M. , Buchanan , J. , Poirion , O.B. , Chilin-Fuentes , D. , Han , C. , Housseini , M. , Carvalho-Gontijo Weber , R. , Sakane , S. , Lee , W. , Zhao , H. , Diggle , K. , Preissl , S. , Glass , C.K. , Ren , B. , Wang , A. , Brenner , D.A. , Kisseleva , T ., 2025 . Multi-modal analysis of human hepatic stellate cells identifies novel therapeutic targets for metabolic dysfunction-associated steatotic liver disease . J. Hepatol . 82 , 882 – 897 . OpenUrl PubMed Liu , X. , Yue , S. , Li , C. , Yang , L. , You , H. , Li , L ., 2011 . Essential roles of sphingosine 1-phosphate receptor types 1 and 3 in human hepatic stellate cells motility and activation . J. Cell. Physiol . 226 , 2370 – 2377 . OpenUrl PubMed Mattos , M.S. , Lopes , M.E. , de Araujo , A.M. , Alvarenga , D.M. , Nakagaki , B.N. , Mafra , K. , de Miranda , C.D.M. , Diniz , A.B. , Antunes , M.M. , Lopes , M.A.F. , Rezende , R.M. , Menezes , G.B. , 2020 . Prolonged neutrophil survival at necrotic sites is a fundamental feature for tissue recovery and resolution of hepatic inflammation . J. Leukoc. Biol . 108 , 1199 – 1213 . OpenUrl CrossRef PubMed Ogata , H. , Chinen , T. , Yoshida , T. , Kinjyo , I. , Takaesu , G. , Shiraishi , H. , Iida , M. , Kobayashi , T. , Yoshimura , A ., 2006 . Loss of SOCS3 in the liver promotes fibrosis by enhancing STAT3-mediated TGF-beta1 production . Oncogene 25 , 2520 – 2530 . OpenUrl CrossRef PubMed Web of Science Pusec , C.M. , De Jesus , A. , Khan , M.W. , Terry , A.R. , Ludvik , A.E. , Xu , K. , Giancola , N. , Pervaiz , H. , Daviau Smith , E. , Ding , X. , Harrison , S. , Chandel , N.S. , Becker , T.C. , Hay , N. , Ardehali , H. , Cordoba-Chacon , J. , Layden , B.T. , 2019 . Hepatic HKDC1 expression contributes to liver metabolism . Endocrinology 160 , 313 – 330 . OpenUrl CrossRef PubMed Ramani , K. , Mavila , N. , Abeynayake , A. , Tomasi , M.L. , Wang , J. , Matsuda , M. , Seki , E ., 2022 . Targeting A-kinase anchoring protein 12 phosphorylation in hepatic stellate cells regulates liver injury and fibrosis in mouse models . eLife 11 , e78430 . OpenUrl PubMed Ramnath , D. , Irvine , K.M. , Lukowski , S.W. , Horsfall , L.U. , Loh , Z. , Clouston , A.D. , Patel , P.J. , Fagan , K.J. , Iyer , A. , Lampe , G. , Stow , J.L. , Schroder , K. , Fairlie , D.P. , Powell , J.E. , Powell , E.E. , Sweet , M.J ., 2018 . Hepatic expression profiling identifies steatosis-independent and steatosis-driven advanced fibrosis genes . JCI Insight 3 . Renzi , A. , Glaser , S. , Demorrow , S. , Mancinelli , R. , Meng , F. , Franchitto , A. , Venter , J. , White , M. , Francis , H. , Han , Y. , Alvaro , D. , Gaudio , E. , Carpino , G. , Ueno , Y. , Onori , P. , Alpini , G ., 2011 . Melatonin inhibits cholangiocyte hyperplasia in cholestatic rats by interaction with MT1 but not MT2 melatonin receptors . Am. J. Physiol. Gastrointest. Liver Physiol . 301 , G634 – 643 . OpenUrl CrossRef PubMed Web of Science Schulien , I. , Hockenjos , B. , Schmitt-Graeff , A. , Perdekamp , M.G. , Follo , M. , Thimme , R. , Hasselblatt , P ., 2019 . The transcription factor c-Jun/AP-1 promotes liver fibrosis during non-alcoholic steatohepatitis by regulating Osteopontin expression . Cell Death Differ . 26 , 1688 – 1699 . OpenUrl CrossRef PubMed Steen , E.H. , Wang , X. , Balaji , S. , Butte , M.J. , Bollyky , P.L. , Keswani , S.G ., 2020 . The role of the anti-inflammatory cytokine interleukin-10 in tissue fibrosis . Adv. Wound Care 9 , 184 – 198 . OpenUrl Wang , Z. , Ge , W. , Zhong , X. , Tong , S. , Zheng , S. , Xu , X. , Wang , K ., 2024 . Inhibition of cysteine-serine-rich nuclear protein 1 ameliorates ischemia–reperfusion injury during liver transplantation in an MAPK-dependent manner . Mol. Biomed . 5 , 22 OpenUrl PubMed Zhang , P. , Li , X. , Liang , J. , Zheng , Y. , Tong , Y. , Shen , J. , Chen , Y. , Han , P. , Chu , S. , Liu , R. , Zheng , M. , Zhai , Y. , Tang , X. , Zhang , C. , Qu , H. , Mi , P. , Chai , J. , Yuan , D. , Li , S ., 2025 . Chenodeoxycholic acid modulates cholestatic niche through FXR/Myc/P-selectin axis in liver endothelial cells . Nat. Commun . 16 , 2093 . OpenUrl PubMed View the discussion thread. Back to top Previous Next Posted July 11, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Evolutionarily conserved temperature dependency leads to loss of protein O-GlcNAc in mammalian hypothermia Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Evolutionarily conserved temperature dependency leads to loss of protein O-GlcNAc in mammalian hypothermia Divya Upadhyay , Christa Kietz , Nasrin Sultana , Rishi Banerjee , Maaria Kankare , Vineta Fellman , Janne Purhonen , Jukka Kallijärvi bioRxiv 2025.07.08.660373; doi: https://doi.org/10.1101/2025.07.08.660373 Share This Article: Copy Citation Tools Evolutionarily conserved temperature dependency leads to loss of protein O-GlcNAc in mammalian hypothermia Divya Upadhyay , Christa Kietz , Nasrin Sultana , Rishi Banerjee , Maaria Kankare , Vineta Fellman , Janne Purhonen , Jukka Kallijärvi bioRxiv 2025.07.08.660373; doi: https://doi.org/10.1101/2025.07.08.660373 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Physiology Subject Areas All Articles Animal Behavior and Cognition (7640) Biochemistry (17707) Bioengineering (13903) Bioinformatics (41980) Biophysics (21465) Cancer Biology (18613) Cell Biology (25528) Clinical Trials (138) Developmental Biology (13387) Ecology (19920) Epidemiology (2067) Evolutionary Biology (24332) Genetics (15615) Genomics (22519) Immunology (17747) Microbiology (40424) Molecular Biology (17194) Neuroscience (88664) Paleontology (667) Pathology (2839) Pharmacology and Toxicology (4827) Physiology (7650) Plant Biology (15160) Scientific Communication and Education (2046) Synthetic Biology (4302) Systems Biology (9826) Zoology (2271)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00