Synergistic Hepatotoxicity of Voriconazole and Mild Inflammation: Involvement of Bile Acid Dysregulation, Intestinal Dysbiosis, and TLR4 Pathway Activation

Synergistic Hepatotoxicity of Voriconazole and Mild Inflammation: Involvement of Bile Acid Dysregulation, Intestinal Dysbiosis, and TLR4 Pathway Activation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Synergistic Hepatotoxicity of Voriconazole and Mild Inflammation: Involvement of Bile Acid Dysregulation, Intestinal Dysbiosis, and TLR4 Pathway Activation Hongan Zeng, Liping Xiang, Weijing Gong, Bingyu Cheng, Xinxin Zhu, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7986820/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Voriconazole (VCZ) is the first-line drug for invasive fungal infections. However, the growing concern regarding its hepatotoxicity necessitates a comprehensive understanding of the underlying mechanisms responsible for VCZ-induced liver injury. In this study, we found that rats treated with a nontoxic dose of lipopolysaccharides (LPS) and VCZ triggered liver injury, as demonstrated by increased serum biochemical indicators and swollen lesions of liver cells. Accordingly, the bile acid metabolism was disordered in the LPS+VCZ group, manifested as remarkable increases in primary bile acids (CDCA, GCDCA), secondary bile acids (DCA, TDCA), and total secondary bile acids in the liver. The species richness and diversity of the gut microbiota were reduced, with Bacteroides and Sutterella emerging as the dominant bacteria in the LPS+VCZ group. The increases in Bacteroides and Isoprevotella might be associated with VCZ-induced cholestatic liver injury. Furthermore, VCZ down-regulated the expression of BSEP, MRP2, and nuclear receptors and up-regulated the expression of bile acid synthetase CYP7A1. Meanwhile, it stimulated the TLR4-Myd88-NF-κB pathway, which promoted the release of inflammatory factors. In addition, the expression of ZO-1 and Occludin in the ileum was decreased in the LPS+VCZ group. These findings suggest that VCZ may induce liver injury by regulating bile acid metabolism and gut microbiota in the context of mild inflammation. Health sciences/Diseases Health sciences/Gastroenterology Biological sciences/Microbiology Drug-induced liver injury Voriconazole Gut microbiota Cholestasis FXR Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1. Introduction Drug-induced liver injury (DILI) has emerged as a significant drug safety problem, potentially resulting in drug withdrawal and even liver failure. Voriconazole (VCZ) is widely recognized as the primary therapeutic agent for managing invasive aspergillosis and other fungal infections in immunocompromised patients, due to its broad antibacterial spectrum and strong antibacterial activity. However, VCZ-induced liver injury is frequently observed in clinical settings, manifesting as transient elevation of liver enzymes, cholestasis, and fulminant hepatic failure, and may even lead to death 1,2 . A retrospective case-control study involving 156,570 patients showed that VCZ has the highest incidence rate of DILI 3 . The incidence of DILI induced by VCZ is as high as 18.19% among patients receiving oral azole antifungal drugs, higher than that of fluconazole and itraconazole 1 . Although therapeutic drug monitoring reduces the incidence of VCZ-induced liver injury, hepatotoxicity is not excluded even at low blood concentrations of VCZ. Research has suggested that there is no direct correlation between blood drug concentration and liver toxicity for VCZ 4 . Numerous factors, including liver and kidney function and genetic polymorphisms, may be related to VCZ-induced liver injury 5-7 . According to the pathogenesis, DILI can be categorized into intrinsic DILI and idiosyncratic drug-induced liver injury (IDILI) 8 . IDILI varies greatly among individuals, is not dose-dependent and is unpredictable, making it more common in clinical practice. Previous studies have emphasized that the pathogenesis of IDILI includes the inflammatory stress hypothesis, the mitochondrial damage hypothesis, the immune response hypothesis, and so on 9 . Numerous studies have demonstrated that inflammation is an independent predisposing factor or promoter of DILI 10,11 . Hepatocytes in an inflammatory state are more sensitive to toxic cytokines released by immune cells. As a stimulator, inflammation may lower the liver’s response threshold to potential hepatotoxic substances, thereby predisposing patients to liver damage 12 . Lipopolysaccharide (LPS), as a classic inflammatory stimulus, has been used in numerous studies on inflammatory reactions and liver toxicity. Previous studies in rats have demonstrated that liver injury was evident only in animals treated with both ranitidine and LPS, whereas no liver injury was observed when ranitidine was used alone 13 . Other drugs that can induce liver injury under the induction of LPS include diclofenac 14 , chlorpromazine 15 , trovafloxacin 16 , and amiodarone 17 . Previous clinical studies have indicated that VCZ has the potential to induce cholestatic liver injury in immunosuppressive patients 18 . A study of the incidence of DILI in the general population suggested that 47% of cases were cholestatic or mixed 19 . Drug-induced cholestasis is a common manifestation of DILI, characterized by impaired bile duct flow and subsequent accumulation of bile in the blood and tissues 20 . Bile acids (BAs) are important components of bile, synthesized in the liver and metabolized into secondary BAs in the gut by the gut flora. Moreover, secondary BAs, as metabolites, combine with the farnesoid X receptor (FXR) and thereby affect BAs synthesis in the liver via signaling cascades. In turn, this process induces a series of inflammatory signaling cascades 21 . In addition, the proposal of the gut-liver axis theory has led us to pay attention to the gut microbiota when studying liver diseases. Research has revealed a close interaction between these two organs in terms of normal physiology and disease. Gut microbiota is involved in disease regulation and drug metabolism, thereby affecting drug safety 22 . Numerous studies have demonstrated that cholestasis is associated with changes in microbiome composition; for example, the fecal microbial composition of patients with primary sclerosing cholangitis is significantly different from that of healthy people 23 . In the absence of a microbiome, cholestasis fails to promote liver damage 24 . In recent years, increasing evidence has shown that changes in the gut microbiota are closely related to DILI, ranging from antithyroid drugs such as methimazole and propylthiouracil 25 , tacrine 26 , to granisetron 27 as well as acetaminophen 28 . These studies have mentioned that the LPS-related signaling pathway is associated with gut microbiota and DILI. There are numerous clinical reports on VCZ-induced liver injury, and studies have identified that these patients present with clinical features of cholestasis, such as elevated total bilirubin 5,14,29,30 . Meanwhile, limited research has revealed possible mechanisms of VCZ-induced DILI. The results of a plasma metabolomics study revealed that VCZ-induced liver injury may be associated with oxidative stress 31 . Furthermore, it has been suggested that reduced fatty acid oxidation and bile acid excretion may underlie VCZ-induced liver injury 32 . However, the increasing concern about its hepatotoxicity necessitates a comprehensive understanding of the mechanisms underlying VCZ-induced liver injury. Therefore, we speculate that the inflammatory stimulus may cause abnormal metabolism of BAs and disrupt the gut microbiota, thereby exacerbating the liver damage caused by VCZ. In this study, we established a model of VCZ-induced liver injury in Sprague Dawley (SD) rats, in which mild inflammation was triggered by a non-toxic dose of LPS. Targeted metabolomics analysis was performed to examine the levels of BAs in the plasma and liver across different groups. High-throughput sequencing analysis was conducted to investigate changes in the gut microbiota. The association between bile stasis and gut microbiota was explored. Finally, the proposed mechanism of VCZ-induced liver injury was validated at the genetic level. 2. Materials and methods 2.1 Chemicals and reagents VCZ (CAS number 137234-62-9; analytical standard, 99%) was provided by Grand Pharmaceutical (China) Co., Ltd. LPS (derived from E. coli serotype O55:B5, source strain CDC 1644-70) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Biochemical indicator assay kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The BA standards and internal standards were purchased from Sigma Aldrich Company (St Louis, MO, USA). 2.2 Model establishment of VCZ-induced liver injury in SD rats Male SD rats 33 (6-8 w, 180-200 g) were purchased from the Experimental Animal Center of Three Gorges University (Yichang, China). Animals were allowed to eat and drink freely under conditions of controlled temperature, humidity, and a 12-h light/12-h dark cycle. All experimental procedures were conducted in accordance with the National Institutes of Health guidelines for the care and use of laboratory animals. 32 rats were randomly divided into four groups: Control group ((normal saline and 0.5% carboxymethylcellulose sodium (CMC-Na)); LPS group (4 mg/kg LPS and 0.5% CMC-Na); VCZ group (40 mg/kg VCZ and normal saline); LPS + VCZ group (40 mg/kg VCZ and 4 mg/kg LPS). A 10 mg/mL VCZ solution was prepared by dissolving 100 mg of VCZ in 10 mL of 0.5% CMC-Na solution, and the drug was administered to rats at a dose of 4 mL/kg, and LPS was dissolved in normal saline. Rats were treated with normal saline or LPS by intraperitoneal injection, and 0.5% CMC-Na or VCZ were given by oral gavage 2 h later 14 . The VCZ dose was based on the clinical human dose, whereas the LPS dose was screened according to the pre-test (SI Figure_1-2). In the 7-day experiments, LPS was administered only on the first day, and VCZ was administered once daily. On day 8, fecal collection was performed before anesthesia. Subsequently, the rats were anesthetized with 1g/kg urethane (20%w/v), and their blood (plasma by centrifugation), livers, and ilea were collected. A part of the liver was fixed in paraformaldehyde for pathological sectioning, and the remaining liver tissue was frozen. The removed tissues, plasma, and feces were stored at -80 °C. 2.3 Serum biochemical analysis and liver histology evaluation Commercial kits were used to measure the level of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bile acids (TBA), total bilirubin (TBIL) in plasma. The liver sections fixed in 4% paraformaldehyde were sequentially dehydrated, embedded in paraffin, sectioned, stained with hematoxylin-eosin (H&E), and then examined under an optical microscope. 2.4 Targeted quantification analysis of BAs by LC-MS/MS Sample processing was performed according to the protocol established by Huang et al., with the following modifications to the chromatographic conditions: Mobile phase A consisted of water (containing 1% formic acid), while methanol (containing 1% formic acid) was used as mobile phase B. The total flow rate was maintained at 0.3 mL/min during injection. The organic phase gradient was increased from 60% to 90% over the first 20 min, held at this level for 2 min, then decreased to 60% in 0.01 min, followed by a 2-min equilibration time. A 10 μL volume of each sample was analyzed in negative ionization mode. The contents of 16 BAs in rat plasma and liver were assessed, including cholic acid (CA), chenodeoxycholic acid (CDCA), muricholic acid (MCA), glycocholic acid (GCA), taurocholic acid (TCA), taurodeoxycholic acid (TDCA), taurochenodeoxycholic acid (TCDCA), tauromuricholic acid (TMCA), deoxycholic acid (DCA), ursodeoxycholic acid (UDCA), glycodeoxycholic acid (GDCA), glycolithocholic acid (GLCA), glycochenodeoxycholic acid (GCDCA), glycoursodeoxycholic acid (GUDCA), taurolithocholic acid (TLCA), tauroursodeoxycholic acid (TUDCA); chenodeoxycholic acid -2,2,4,4-D4 (CDCA-D4) was used as the internal standard. Bile acid (BA) analysis was performed using an LC-MS/MS system comprising a Shimadzu Prominence UFLC system (Shimadzu Corporation, Kyoto, Japan) and an API4000 QTrap® triple quadrupole mass spectrometer (AB Sciex, Foster City, CA, USA) equipped with an electrospray ionization source. Chromatographic separation was achieved using a Waters ACQUITY HSS T3 column (2.1×100 mm, particle size 1.8 μm, Waters, USA) at a column temperature of 40 °C. 2.5 Gut microbiota analysis The DNA of microorganisms in rat feces was extracted using the FastDNA® Spin Kit for Soil (MP Biomedicals, USA) according to the kit manual, and the DNA quality was assessed by 1% agarose gel electrophoresis. The V3-V4 region of the 16S rRNA gene was amplified by PCR using specific primers (5′-barcode- ACTCCTACGGGAGGCAGCAG -3′, 5′- GGACTACHVGGGTWTCTAAT -3′) with a thermocycler PCR system (ABI GeneAmp 9700, USA). The PCR products were purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA), and qualified products were subjected to Illumina Miseq PE300 sequencing (Illumina, San Diego, USA). The filtered sequencing results were clustered into operational taxonomic units (OTUs) using UPARSE (version 7.1; http://drive5.com/uparse). The taxonomic annotation of each 16S rRNA gene sequence was performed using the RDP Classifier algorithm (http://rdp.cme.msu.edu) against the Silva (V138) 16S rRNA database, with a comparison threshold of 70%. The entire sequencing process was conducted according to the standard protocols of Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China), and the results were analyzed using the Majorbio Cloud Platform (https://www.majorbio.com). 2.6 Gene expression analysis RNA was extracted from rat liver and ileum tissues using Trizol reagent (Invitrogen, USA) according to the manufacturer's instructions. The UV absorption peaks of nucleic acids at 260 nm and 280 nm were measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA) to assess RNA purity. RNA samples with A260/A280 ratios between 1.8 and 2.0 were used for subsequent analysis. cDNA was synthesized from RNA using the HiFiScript cDNA Synthesis Kit (YEASEN, China) with 2.5 μg of total RNA input. The cDNA was diluted 10-fold and used as a template for quantitative reverse transcription-PCR (qPCR) reactions. qPCR was performed using SYBR Green PCR Master Mix (Bio-Rad, USA) on an ABI 7500 Real-Time PCR System (Applied Biosystems, USA) with the associated 7500 System Software (Applied Biosystems, USA). 2.7 Western blotting Rat liver and ileum tissue samples were lysed with 500 μL of lysis buffer (PMSF: Cocktail: RIPA=1:4:100). The protein concentration in the supernatant was measured using the BCA method, and the protein was denatured by adding loading buffer after uniform loading volume in boiling water. After electrophoresis, the gel was cut into bands of different widths according to the molecular weight of the protein of interest, as indicated by the marker, for membrane transfer. The membrane was then blocked with 5% nonfat milk and subsequently incubated with the primary antibody at 4 ℃ overnight and the secondary antibody at room temperature for 1 hour. Before each step, the bands were washed three times for 10 min each with a buffer containing Tris-HCl, NaCl, and Tween. Protein bands were visualized and photographed using an enhanced chemiluminescence detection system (Millipore, USA). 2.8 Statistical analysis One-way ANOVA was performed on the data using GraphPad Prism 8.0 (GraphPad Software Inc., California, USA), and the results were expressed as the mean ± SD. 16S rRNA sequencing data analysis was conducted using ANOSIM, the Wilcoxon rank-sum test, and the Kruskal-Wallis H test. The correlations between the microbiota and BAs were analyzed using Spearman's rank correlation. p <0.05 was considered to indicate statistical significance. 3. Results 3.1 VCZ induced liver injury To assess liver damage following one week of modeling, the biochemical indicators in rat plasma were measured. As shown in Fig. 1b, the plasma levels of ALT and γ-GGT in LPS+VCZ group were significantly higher than other three groups ( p =0.0077, p =0.0002, p =0.0064, respectively), and the plasma AST level was higher than VCZ group. Moreover, both TBA and TBIL levels were significantly higher than Control group. Furthermore, histopathological analysis revealed significant inflammatory infiltration and the presence of round vacuoles in the cytoplasm of hepatocytes in LPS+VCZ group (Fig. 1c). These findings indicated that VCZ increased the risk of liver injury and exacerbated the hepatic inflammatory response in the context of mild inflammation. 3.2 VCZ increased bile acid accumulation in mild inflammation The elevated levels of TBA and TBIL in plasma suggested cholestatic liver injury (Fig. 1b). Therefore, the concentrations of 16 BAs in liver and plasma samples were further measured by LC-MS/MS. As shown in Fig. 2a, in the rat liver, the primary BAs CA in LPS + VCZ group was significantly lower than other three groups ( p =0.0038, p =0.0089, p =0.0325, respectively), while CDCA and GCDCA were significantly higher than Control and LPS group ( p <0.0001, and p =0.0138, p =0.0027, respectively). The secondary BAs DCA and GLCA were significantly higher than Control and LPS group ( p <0.0001, and p =0.0402, p =0.0372, respectively). Meanwhile, the content of TDCA was significantly higher than other three groups ( p =0.0018, p =0.0007, p =0.0049, respectively), while TUDCA was significantly lower than Control group ( p =0.0112) (Fig. 2b). As shown in Fig. 2c, d, in the plasma samples, the primary BAs TMCA in LPS + VCZ group was significantly higher than other three groups ( p =0.0060, p =0.0006, p <0.0010, respectively), CDCA was significantly higher than Control and VCZ group ( p =0.0251, p =0.0233, respectively), GCDCA was significantly higher than Control and LPS group (( p =0.0396, p =0.0204, respectively), and MCA was significantly higher than VCZ group ( p =0.0068). The secondary BAs DCA and TDCA in LPS + VCZ group were significantly higher than other three groups ( p =0.0008, p =0.0034, p =0.0074, respectively and p <0.0001), GDCA was significantly higher than Control group ( p =0.0154), and GUDCA was significantly higher than LPS group ( p =0.0473). However, due to the low concentrations of GLCA and TLCA, they were not detected. 3.3 VCZ promoted gut microbiota alteration in mild inflammation The feces of rats in each group were collected and stored in sterile centrifuge tubes, after which 16S rRNA sequencing was performed to investigate the changes in the intestinal flora. The mean number of OTUs and the number of shared OTUs in each group were shown by Venn plots (Fig. 3a). Compared with the other three groups, the Sobs and Shannon index of LPS+VCZ was lower ( p <0.05), indicating that the species richness and diversity of the gut microbiota were reduced after LPS+VCZ treatment (Fig. 3c, d). The samples in these groups exhibited hierarchical clustering based on the Bray–Curtis distance. We found that the control group and the LPS+VCZ group were the farthest apart overall, indicating that these two groups of samples had the largest difference in the composition of the flora (Fig. 3b). Principal Component Analysis (PCA) and UniFrac distance-based principal coordinate analysis (PCoA) can reflect the differences in the structure of bacterial taxa. As shown in Fig. 3E and F, the microbes in Control, LPS, and VCZ group clustered together in both the PCA and PCoA graphs, and they were clearly separated from the LPS+VCZ group, which revealed that VCZ given under inflammatory conditions had a certain effect on the structure of the intestinal flora in rats. The community composition analysis maps revealed specific changes. As shown in Fig. 4a, LPS+VCZ treatment increased the proportion of Bacteroidetes while decreasing Firmicutes at the phylum level compared with the other three groups. Similarly, at the level of family, there was an increased relative abundance of Bacteroidaceae and a reduction of Muribaculaceae and Lachnospiraceae in LPS+VCZ group (Fig. 4b). Furthermore, at the genus level, the LPS+VCZ group exhibited an increased abundance of Bacteroides and Alloprevotella and a decreased abundance of norank_f__Muribaculaceae (Fig. 4c). In addition, we used the LEfSe algorithm to identify different taxa from the phylum to genus level among the four groups. Bacterial species that differed significantly ( p 2.0 with p <0.05), LDA was used. As depicted in Fig. 4e, 41 kinds of significant phylotypes were identified, with 5, 10, 9, and 17 bacterial species being abundant in Control, LPS, VCZ, and LPS+VCZ groups, respectively. The LDA score was utilized to further compare taxa between the Control and LPS+VCZ groups. The analysis revealed that Bacteroides (phylum Bacteroidetes ), gammaproteobacterial , sutterella (phylum Proteobacteria ), and Butyricicoccaceae , which were enriched in LPS+VCZ group, might play an important role in liver injury (Fig. 4f). 3.4 Correlation between gut microbiota and bile acids To investigate whether dysbacteriosis was related to BAs metabolism, Spearman’s correlation analysis was performed to correlate the top 15 species in taxonomic level abundance in each of the four groups with BAs detected in plasma and liver samples. As shown in Fig. 5a, Bacteroides and Alloprevotella were positively correlated to the most BAs, and UCG-005 , Ruminococcus and Alistipes were negatively correlated to the most BAs in plasma. Furthermore, Bacteroides and Alloprevotella were positively correlated with the most BAs, Romboutsia , Ruminococcus , Alistipes and norank_f__norank_o__Clostridia_UCG-014 were negatively correlated to the most BAs in liver (Fig. 5b). These results suggested that the increase in Bacteroides and Isoprevotella may be associated with cholestasis induced by LPS+VCZ treatment. 3.5 Expression of genes and proteins related to BAs metabolism in the liver and ileum The BAs nuclear receptors, metabolic enzymes, and transporters were studied to further elucidate the mechanism underlying BAs homeostasis induced by VCZ. As shown in Fig. 6, the mRNA levels of CAR, VDR, PXR and FXR in LPS+VCZ group were down-regulated compared with the other three groups. Furthermore, this downward trend of the protein expression was more obvious. In addition, the mRNA levels of the BAs synthase Cyp7a1 ( p ＜0.0001) and the key BAs uptake transporter Ntcp ( p ＜0.05) were up-regulated in LPS+VCZ group. The expression levels of Bsep and Mrp2 were significantly reduced than Control group ( p =0.0012, and p ＜0.0001). Moreover, western blotting assay illustrated that the expression levels of BSEP and MRP2 were markedly decreased in LPS+VCZ group. As shown in Fig. 6d, the mRNA level of FXR in the rat ileum was reduced but not significantly in LPS + VCZ group compared with Control group. Nevertheless, the mRNA level of Tgr5 was significantly reduced ( p =0.0084). FXR protein expression was remarkably decreased in LPS + VCZ group compared with Control and VCZ groups ( p =0.0026 and p =0.0229), but no significant trend was observed for TGR5 protein expression (Fig. 6e, f). Overall, these results indicated that inhibiting the expression of BAs nuclear receptors, promoting the synthesis and uptake of BAs, and reducing the efflux may be the reasons for cholestasis triggered by LPS+VCZ. 3.6 VCZ activated the TLR4-MyD88-NF-κB signaling pathway We investigated the expression of the TLR4/NF-κB signaling pathway in the liver tissue. As shown in Fig. 7, the mRNA levels of Tlr4 , Myd88 and Nf-κb in the LPS+VCZ group were significantly up-regulated compared with the other three groups, and the same up-regulation trend was also observed in the protein expression results. The levels of pro-inflammatory cytokines, including IL-1β, IL-6, and TNF-α, in the liver were detected. As shown in Fig. 8a, the level of IL-1β mRNA in LPS+VCZ group was significantly higher than Control and VCZ groups ( p =0.0003, p =0.0266, respectively), and TNF-α mRNA was significantly increased compared with the other three groups ( p <0.0001, p =0.0041, p =0.0023, respectively), while the level of IL-6 mRNA showed no significant difference among the four groups. Similarly, the protein levels of pro-inflammatory cytokines IL-1β and TNF-α in LPS+VCZ group significantly increased (Fig. 8b, c). Moreover, the mRNA levels and protein expression levels of the inflammatory factors IL-1β and TNF-α were upregulated compared with the other three groups in ileum (Fig. 8d-f). 3.7 Damage to the intestinal barrier To explore whether the intestinal barrier was damaged, we detected the expression levels of intestinal tight junction proteins ZO-1, Occludin, and Claudin-1. As shown in Fig. 9a, b, treatment with LPS + VCZ significantly down-regulated Occludin expression compared with the other three groups ( p <0.0001, p =0.0003, p =0.0045, respectively), and ZO-1 expression compared with LPS group ( p =0.0320). The expression of Claudin-1 showed a downward trend, but there was no significant difference among the groups. These results indicated that under LPS induction, VCZ disrupted the balance between intestinal commensal bacteria and pathogenic bacteria, leading to an imbalance of gut microbiota, and ultimately damaging the integrity of the intestinal barrier. 4. Discussion As a potentially hepatotoxic drug, VCZ has attracted great attention in clinical practice. When liver injury occurs, clinicians often have to discontinue VCZ treatment to avoid more severe liver damage, which further leads to treatment failure for fungal infections and even death 34 . Previous studies have suggested that VCZ could cause cholestasis in patients 3,5,35 , because current research on VCZ mainly focuses on the analysis of clinical phenomena and data. Although one study has suggested that VCZ-induced cholestatic liver injury is related to decreased fatty acid oxidation and BAs excretion, the specific molecular mechanism has not been elucidated 32 . However, VCZ altering BAs metabolism, as well as triggering liver damage, is rarely reported. This study revealed that VCZ induced cholestatic liver injury by disrupting the balance of BAs synthesis, uptake and secretion, consequently promoting the release of inflammatory factors in rats with mild inflammation. In addition, the disturbance of gut microbiota and the destruction of intestinal barrier aggravate the accumulation of BAs, further exacerbating liver damage. BAs are synthesized from cholesterol in the liver and are the major component in bile. In addition to their role in lipid digestion and absorption, BAs are also signaling molecules involved in cholestatic liver injury, linking the liver and gut 36 . In our results, levels of some BAs increased significantly after LPS+VCZ treatment, which was demonstrated by the expression of genes and proteins of BAs metabolism. Activation of FXR, as a key BAs nuclear receptor, leading to decreased expression of the enzyme cytochrome P450 cholesterol 7α-hydroxylase (CYP7A1) 37 and sterol 12α-hydroxylase (CYP8B1) 38 , thereby inhibiting BAs synthesis. Moreover, BAs efflux transporters bile salt export pump (BSEP) and multi-drug resistance related protein 2 (MRP2) are inhibited due to the activation of FXR, affecting the rate of BAs excretion by hepatocytes 39 . Knocking out BSEP in HepaRG cells leads to excessive accumulation of BAs, thereby increasing the sensitivity of the cells to drug-induced cholestatic liver injury 40 . Meanwhile, FXR can also inhibit the expression of basal Na+-taurocholic acid cotransporter polypeptide (NTCP), thereby inhibiting the entry of BAs into hepatocytes 38 . G protein-coupled receptor 5 (TGR5) is a bile acid-responsive cell surface receptor of BAs, which plays an important role in body energy homeostasis, BAs balance, and inflammatory response 41 . Studies have confirmed that TGR5 knockout mice are more susceptible to cholestatic liver injury induced by the BA diet or LPS stimulation 42 . Moreover, it was revealed that pregnane X receptor (PXR) could regulate genes involved in BAs biosynthesis and transport when activated by LCA, thereby reducing LCA-induced liver injury and playing a protective role 43 . Constitutive androstane receptor (CAR) plays a similar role to PXR, and CAR knockout mice showed more severe liver damage than wild type, which was associated with the altered expression of related genes in BAs metabolism 44 . Moreover, pharmacological activation of Vitamin D receptor (VDR) increased the excretion of BAs, confirming that VDR acts in regulating BAs metabolism in vivo 45 . In this study, we confirmed that after LPS+VCZ treatment, the expression levels of FXR, TGR5, BSEP and MRP2 were restrained, and the expression of CYP7A1 was up-regulated. Consequently, the synthesis of BAs increased, and excretion was hindered, and thus the BAs accumulation occurred. In addition, the down-regulated expression of nuclear receptor VDR will reduce the excretion of BAs, especially through urine excretion, which will aggravate the accumulation of more toxic BAs in the body. Meanwhile, PXR and CXR were down-regulated in gene and protein levels in our study, which would attenuate the protective effect on liver and aggravate cholestatic liver injury. A previous study proved the toxicity of several BAs is LCA>DCA>CDCA>CA>UDCA 46 . We found that BAs in liver and plasma such as DCA, CDCA were increased significantly by LPS+VCZ. The accumulation of BAs in hepatocytes can induce oxidative stress and inflammation, thereby leading to abnormal liver function or liver injury 47 . It has been proposed that BAs can trigger inflammatory responses, which are manifested as promoting neutrophil recruitment and the release of the cytokine CXCL1, CXCL2 48 . Moreover, many studies have shown that alleviating cholestatic liver injury can be achieved inhibiting NF-κB-mediated inflammatory pathways 49-51 . In addition, the activation of FXR usually exerts an anti-inflammatory effect, and it has been demonstrated in various cells and tissues in vivo that FXR activation antagonizes NF-κB activation. Thus, inhibition of FXR during inflammation may amplify inflammatory effects 52 . In the present study, on the one hand, LPS+VCZ administration activated the TLR4-MyD88-NF-κB pathway and increased the release of inflammatory factors. On the other hand, the inhibitory effect of FXR on NF-κB was weakened, thereby further promoting inflammation. Therefore, VCZ mainly caused BAs stasis in mild inflammation, which activated TLR4-MyD88-NF-κB pathway and led to liver inflammation, thereby further promoting liver injury. Multiply studies have reported the relationship between BAs and gut microbiota in recent years 53-55 . BAs could control the growth and distribution of gut microbiota and influence intestinal barrier function. Previous results have shown that an increase in CA contributes to impaired gut barrier function 56 . Moreover, primary BAs synthesized in the liver are metabolized in the gut into secondary BAs. Studies have shown that gut microflora can affect the size and composition of the BAs pool within the enterohepatic system 57 . In this study, changes in gut microbiota after LPS+VCZ treatment were tested, indicating VCZ caused disturbances in the intestinal flora. Bacteroides can produce bile salt hydrolase, which mediates the hydrolytic transformation of primary BAs 58 . Studies have shown that the abundance of Bacteroides increased in α-naphthyl isothiocyanate induced cholestatic model rats, and that down-regulation of Bacteroides was positively correlated with reduced secondary BAs 59 . Consistently, we found that Bacteroides were heavily expanded in the LPS+VCZ group, and that increased numbers of Bacteroides and Alloprevotella were positively correlated with increased BAs content. In addition, alterations in Alloprevotella are often observed in intestinal injury diseases 60-62 , and its increase in the LPS+VCZ group suggested the occurrence of intestinal injury. Sutterella is widely distributed in the human gastrointestinal tract. Previous studies have considered that the increase of Sutterella is associated with human diseases, such as inflammatory bowel disease, gastrointestinal diseases and type 2 diabetes mellitus 63-66 . Similarly, in our study, LEfSe analysis showed that Sutterella and Bacteroides were the dominant bacteria following LPS+VCZ treatment, which corresponded to a more severe inflammatory response and liver injury in the LPS+VCZ group. However, there were also some contrasting findings suggesting that Sutterella and Bacteroides were less abundant in patients with nonalcoholic fatty liver disease 67 . In other words, they were negatively correlated with the development of the disease. Overall, the microbiota analysis results showed that VCZ under LPS induction induced dysbiosis of the microbiota in rats, which was associated with BAs changes, indicating that VCZ could cause liver injury by regulating BAs metabolism and gut microbiota. The intestinal barrier is affected by the imbalance of BAs and gut microbiota 68 . The mechanisms by which BAs affect intestinal barrier function are highly complex. They can regulate the death and apoptosis of intestinal epithelial cells through signaling pathways, regulate the expression of tight junction proteins, or affect the secretion of mucus or cytokines in intestinal epithelial cells 69 . Furthermore, the gut microbiome can affect immune system development and modulate immune mediators, thereby affecting the intestinal barrier 70 . Intestinal tight junction proteins, including Occludin, Claudins and ZOs, connect the transmembrane skeleton or form membrane protein complexes, thereby building the intestinal epithelial barrier together 71 . When the function of tight junction proteins is altered, their ability to maintain the intestinal barrier is also compromised. In our study, LPS+VCZ administration significantly decreased the protein level of Occludin ( p <0.05), while ZO-1 and claudin-1 were decreased but not significantly. These results suggest that VCZ, under LPS induction, disrupts the balance of gut microbiota. This imbalance disrupted the intestinal barrier, increased intestinal permeability, and consequently led to the translocation of bacteria and toxins from the gut to the liver, thereby causing further liver damage. 5. Conclusion In conclusion, this study indicated that VCZ, under LPS induction, induced liver injury in SD rats by regulating BAs metabolism and gut microbiota, with the TLR4-MyD88-NF-κB pathway involved in the inflammatory signal transduction induced by BAs accumulation. Specifically, LPS+VCZ upregulated the expression of CYP7A1 and downregulated that of BSEP, MRP2, TGR5, FXR, CAR, PXR and VDR, thereby increasing BAs synthesis, inhibiting excretion, and causing hepatic BAs accumulation. In addition, LPS+VCZ administration increased the abundance of intestinal flora, such as Bacteroides , Alloprevotella and Sutterella , which are related to inflammation, BAs regulation or intestinal injury, thereby leading to intestinal barrier damage and exacerbating liver injury. However, this study has some limitations. First, the comprehensive assessment of VCZ-induced liver injury within an inflammatory context remains limited in our current evaluation. Our exploration predominantly focused on biochemical indicators of liver function, but there was no more direct biomarker to determine the degree of liver injury. Further research is needed to determine whether the altered BAs can serve as biomarkers for VCZ-induced liver injury. Second, our study utilized a limited scope of available models, focusing primarily on the widely employed rat model. Future investigations will encompass a broader array of models for validation, including the development of gene knockout rat models, intestinal microbiota transplantation models and gene-silenced cell models. In summary, the present study reveals that VCZ-induced liver injury involves a complex pathway from cholestasis to gut microbiota, with the increase of CDCA, GCDCA, DCA, TDCA in BAs and the increase of Bacteroides and Isoprevotella in the gut serving as additional evidence for VCZ-induced liver injury. Reducing the level of inflammation in patients or regulating their intestinal flora may play a role in the prevention and treatment of liver injury, which may initially provide new ideas for the diagnosis, prevention and treatment of VCZ-induced liver injury in the future. Declarations All authors declare that they have no financial or competing interest. Conflict of interests All authors have no conflict of interest to disclose. CRediT author statement (Authors’ contributions) Hongan Zeng: Data curation; Formal analysis; Investigation; Methodology; Writing - original draft; and Writing - review & editing Liping Xiang: Investigation; Methodology; Software; Project administration; Resources; and Writing - review & editing Weijing Gong: Investigation; Methodology; Software; Project administration; Resources; and Writing - review & editing Bingyu Cheng: Conceptualization; and Data curation Xinxin Zhu: Project administration; and Resources Luqin Si: Validation; and Visualization Jiangeng Huang: Methodology; Project administration; Funding acquisition; and Supervision Sanlan Wu: Funding acquisition; Project administration; Supervision; and Writing - review & editing Ethical standards All animal studies have been approved by the appropriate ethics committee and have therefore been performed in accordance with the ethical standards laid down in the 1964 Declaration of Helsinki and its later amendments. The manuscript does not contain clinical studies or patient data. Approval was granted by the Ethics Committee of Huazhong University of Science and Technology. (No. 3157). Funding This study was supported by the National Natural Science Foundation of China (81803619, 81302837); Hubei Province health and family planning scientific research project (WJ2017M118); and Major Basic Research Development Program of Hubei Province (2020BCB045). Acknowledgment We sincerely wish to thank all members for participating in this study. Data availability Data is provided within the manuscript or supplementary information files. Statement We confirm that this study was reported in accordance with the ARRIVE guidelines. References Lo Re, V et al. Oral Azole Antifungal Medications and Risk of Acute Liver Injury, Overall and by Chronic Liver Disease Status. American Journal of Medicine 129 , 283-91.e5, doi:10.1016/j.amjmed.2015.10.029 (2016). Costa-Pinto, R et al. Assessing the safety profile of voriconazole use in suspected COVID-19-associated pulmonary aspergillosis-a two-centre observational study. Medical Mycology 61 , myad054, doi:ARTN myad05410.1093/mmy/myad054 (2023). Kong, XH, Guo, DH, Liu, SY, Zhu, Y & Yu, CX. Incidence, characteristics and risk factors for drug-induced liver injury in hospitalized patients: A matched case-control study. British Journal of Clinical Pharmacology 87 , 4304-4312, doi:10.1111/bcp.14847 (2021). Mihăilă, R-G. Voriconazole and the liver. World Journal of Hepatology 7 , 1828-1833, doi:10.4254/wjh.v7.i14.1828 (2015). Solís-Muñoz, P et al. Voriconazole hepatotoxicity in severe liver dysfunction. Journal of Infection 66 , 80-86, doi:10.1016/j.jinf.2012.09.011 (2013). Shi, CC, Xiao, YB, Mao, Y, Wu, J & Lin, NM. Voriconazole: A Review of Population Pharmacokinetic Analyses. Clinical Pharmacokinetics 58 , 687-703, doi:10.1007/s40262-019-00735-7 (2019). Aiuchi, N et al. Impact of polymorphisms of pharmacokinetics-related genes and the inflammatory response on the metabolism of voriconazole. Pharmacol Res Perspe 10 , e00935, doi:ARTN e0093510.1002/prp2.935 (2022). Roth, RA & Ganey, PE. Intrinsic versus Idiosyncratic Drug-Induced Hepatotoxicity—Two Villains or One? Journal of Pharmacology and Experimental Therapeutics 332 , 692-697, doi:10.1124/jpet.109.162651 (2010). Uetrecht, J. Mechanistic Studies of Idiosyncratic DILI: Clinical Implications. Frontiers in Pharmacology 10 , 837, doi:ARTN 83710.3389/fphar.2019.00837 (2019). Cai, XP et al. Molecular pathogenesis of acetaminophen-induced liver injury and its treatment options. Journal of Zhejiang University-Science B 23 , 265-285, doi:10.1631/jzus.B2100977 (2022). Woolbright, BL & Jaeschke, H. Role of the inflammasome in acetaminophen-induced liver injury and acute liver failure. Journal of Hepatology 66 , 836-848, doi:10.1016/j.jhep.2016.11.017 (2017). Ganey, PE, Luyendyk, JP, Maddox, JF & Roth, RA. Adverse hepatic drug reactions: inflammatory episodes as consequence and contributor. Chemico-Biological Interactions 150 , 35-51, doi:10.1016/j.cbi.2004.09.002 (2004). Luyendyk, JP et al. Ranitidine treatment during a modest inflammatory response precipitates idiosyncrasy-like liver injury in rats. Journal of Pharmacology and Experimental Therapeutics 307 , 9-16, doi:10.1124/jpet.103.054288 (2003). Ramm, S et al. Application of a discovery to targeted LC-MS proteomics approach to identify deregulated proteins associated with idiosyncratic liver toxicity in a rat model of LPS/diclofenac co-administration. Toxicology 331 , 100-111, doi:10.1016/j.tox.2015.03.004 (2015). Gandhi, A, Guo, T, Shah, P, Moorthy, B & Ghose, R. Chlorpromazine-induced hepatotoxicity during inflammation is mediated by TIRAP-dependent signaling pathway in mice. Toxicology and Applied Pharmacology 266 , 430-438, doi:10.1016/j.taap.2012.11.030 (2013). Shaw, PJ, Ganey, PE & Roth, RA. Trovafloxacin Enhances the Inflammatory Response to a Gram-Negative or a Gram-Positive Bacterial Stimulus, Resulting in Neutrophil-Dependent Liver Injury in Mice. Journal of Pharmacology and Experimental Therapeutics 330 , 72-78, doi:10.1124/jpet.109.151068 (2009). Lu, JT, Jones, AD, Harkema, JR, Roth, RA & Ganey, PE. Amiodarone Exposure During Modest Inflammation Induces Idiosyncrasy-like Liver Injury in Rats: Role of Tumor Necrosis Factor-alpha. Toxicological Sciences 125 , 126-133, doi:10.1093/toxsci/kfr266 (2012). Mohammed, Y, Abousamra, A, Abdeldayem, AAI, Zafar, M & Muhammad, T. Voriconazole-Induced Cholestatic Hepatotoxicity in an Immune Competent Patient. Cureus Journal of Medical Science 14 , e21346, doi:ARTN e2134610.7759/cureus.21346 (2022). Chatterjee, S & Annaert, P. Drug-induced Cholestasis: Mechanisms, Models, and Markers. Current Drug Metabolism 19 , 808-818, doi:10.2174/1389200219666180427165035 (2018). Fernández-Murga, ML et al. Advances in drug-induced cholestasis: Clinical perspectives, potential mechanisms and systems. Food and Chemical Toxicology 120 , 196-212, doi:10.1016/j.fct.2018.07.017 (2018). Kriaa, A et al. Microbial impact on cholesterol and bile acid metabolism: current status and future prospects. Journal of Lipid Research 60 , 323-332, doi:10.1194/jlr.R088989 (2019). Noh, K et al. Impact of gut microbiota on drug metabolism: an update for safe and effective use of drugs. Archives of Pharmacal Research 40 , 1345-1355, doi:10.1007/s12272-017-0986-y (2017). Sabino, J et al. Primary sclerosing cholangitis is characterised by intestinal dysbiosis independent from IBD. Gut 65 , 1681-1689, doi:10.1136/gutjnl-2015-311004 (2016). Isaacs-Ten, A et al. Intestinal Microbiome-Macrophage Crosstalk Contributes to Cholestatic Liver Disease by Promoting Intestinal Permeability in Mice. Hepatology 72 , 2090-2108, doi:10.1002/hep.31228 (2020). Sun, JY et al. Gut Microbiota Participates in Antithyroid Drug Induced Liver Injury Through the Lipopolysaccharide Related Signaling Pathway. Frontiers in Pharmacology 11 , 598170, doi:ARTN 59817010.3389/fphar.2020.598170 (2020). Yip, LY et al. The liver-gut microbiota axis modulates hepatotoxicity of tacrine in the rat. Hepatology 67 , 282-295, doi:10.1002/hep.29327 (2018). Gong, SH et al. Intestinal Microbiota Mediates the Susceptibility to Polymicrobial Sepsis-Induced Liver Injury by Granisetron Generation in Mice. Hepatology 69 , 1751-1767, doi:10.1002/hep.30361 (2019). Gong, SH et al. Gut microbiota mediates diurnal variation of acetaminophen induced acute liver injury in mice. Journal of Hepatology 69 , 51-59, doi:10.1016/j.jhep.2018.02.024 (2018). Vanstraelen, K et al. Impact of Hypoalbuminemia on Voriconazole Pharmacokinetics in Critically Ill Adult Patients. Antimicrobial Agents and Chemotherapy 58 , 6782-6789, doi:10.1128/Aac.03641-14 (2014). Liu, XY et al. Significance of monitoring plasma concentration of voriconazole in a patient with liver failure: A case report. Medicine 96 , e8039, doi:ARTN e803910.1097/MD.0000000000008039 (2017). Wu, SL, Cheng, CN, Wang, CC, Lin, SW & Kuo, CH. Metabolomics analysis of plasma reveals voriconazole-induced hepatotoxicity is associated with oxidative stress. Toxicology and Applied Pharmacology 403 , 115157, doi:ARTN 11515710.1016/j.taap.2020.115157 (2020). Du, Q et al. Metabolic characteristics of voriconazole - Induced liver injury in rats. Chemico-Biological Interactions 383 , 110693, doi:ARTN 11069310.1016/j.cbi.2023.110693 (2023). Xu, K et al. Gender effect of hyperuricemia on the development of nonalcoholic fatty liver disease (NAFLD): A clinical analysis and mechanistic study. Biomed Pharmacother 117 , 109158, doi:10.1016/j.biopha.2019.109158 (2019). Pata, R, Dolkar, T, Patel, M & Nway, N. Voriconazole-Induced Acute Liver Injury: A Case Report. Cureus Journal of Medical Science 13 , e20115, doi:ARTN e2011510.7759/cureus.20115 (2021). Celik, IH et al. Compassionate use of voriconazole in newborn infants diagnosed with severe invasive fungal sepsis. European Review for Medical and Pharmacological Sciences 17 , 729-734 (2013). Li, M, Cai, SY & Boyer, JL. Mechanisms of bile acid mediated inflammation in the liver. Molecular Aspects of Medicine 56 , 45-53, doi:10.1016/j.mam.2017.06.001 (2017). Zarrinpar, A et al. Antibiotic-induced microbiome depletion alters metabolic homeostasis by affecting gut signaling and colonic metabolism. Nature Communications 9 , 2872, doi:ARTN 287210.1038/s41467-018-05336-9 (2018). Xu, Y et al. Farnesoid X receptor activation increases reverse cholesterol transport by modulating bile acid composition and cholesterol absorption in mice. Hepatology 64 , 1072-1085, doi:10.1002/hep.28712 (2016). Yuan, ZQ & Li, KW. Role of farnesoid X receptor in cholestasis. Journal of Digestive Diseases 17 , 501-509, doi:10.1111/1751-2980.12378 (2016). Qiu, X et al. Disruption of BSEP Function in HepaRG Cells Alters Bile Acid Disposition and Is a Susceptive Factor to Drug-Induced Cholestatic Injury. Mol Pharmaceut 13 , 1206-1216, doi:10.1021/acs.molpharmaceut.5b00659 (2016). Jia, W, Xie, GX & Jia, WP. Bile acid-microbiota crosstalk in gastrointestinal inflammation and carcinogenesis. Nature Reviews Gastroenterology & Hepatology 15 , 111-128, doi:10.1038/nrgastro.2017.119 (2018). Reich, M et al. Role of the G Protein-Coupled Bile Acid Receptor TGR5 in Liver Damage. Digestive Diseases 35 , 235-240, doi:10.1159/000450917 (2017). Staudinger, JL et al. The nuclear receptor PXR is a lithocholic acid sensor that protects against liver toxicity. Proceedings of the National Academy of Sciences of the United States of America 98 , 3369-3374, doi:DOI 10.1073/pnas.051551698 (2001). Stedman, CAM et al. Nuclear receptors constitutive androstane receptor and pregnane X receptor ameliorate cholestatic liver injury. Proceedings of the National Academy of Sciences of the United States of America 102 , 2063-2068, doi:DOI 10.1073/pnas.0409794102 (2005). Nishida, S, Ozeki, J & Makishima, M. Modulation of Bile Acid Metabolism by 1α-Hydroxyvitamin D Administration in Mice. Drug Metabolism and Disposition 37 , 2037-2044, doi:10.1124/dmd.109.027334 (2009). Thomas, C, Pellicciari, R, Pruzanski, M, Auwerx, J & Schoonjans, K. Targeting bile-acid signalling for metabolic diseases. Nature Reviews Drug Discovery 7 , 678-693, doi:10.1038/nrd2619 (2008). Nuño-Lámbarri, N et al. Liver Cholesterol Overload Aggravates Obstructive Cholestasis by Inducing Oxidative Stress and Premature Death in Mice. Oxidative Medicine and Cellular Longevity 2016 , 9895176, doi:Artn 989517610.1155/2016/9895176 (2016). Woolbright, BL & Jaeschke, H. Inflammation and Cell Death During Cholestasis: The Evolving Role of Bile Acids. Gene Expression-the Journal of Liver Research 19 , 215-228, doi:10.3727/105221619x15614873062730 (2019). Li, WK et al. Protective effect of herbal medicine Huangqi decoction against chronic cholestatic liver injury by inhibiting bile acid-stimulated inflammation in DDC-induced mice. Phytomedicine 62 , 152948, doi:ARTN 15294810.1016/j.phymed.2019.152948 (2019). Liu, J et al. Allopurinol Protects Against Cholestatic Liver Injury in Mice Not Through Depletion of Uric Acid. Toxicological Sciences 181 , 295-305, doi:10.1093/toxsci/kfab034 (2021). Wu, J-S et al. Quantitative Proteomics Reveals the Protective Effects of Huangqi Decoction Against Acute Cholestatic Liver Injury by Inhibiting the NF-κB/IL-6/STAT3 Signaling Pathway. Journal of Proteome Research 19 , 677-687, doi:10.1021/acs.jproteome.9b00563 (2019). Bertolini, A, Fiorotto, R & Strazzabosco, M. Bile acids and their receptors: modulators and therapeutic targets in liver inflammation. Seminars in Immunopathology 44 , 547-564, doi:10.1007/s00281-022-00935-7 (2022). Hu, H et al. Gut microbiota promotes cholesterol gallstone formation by modulating bile acid composition and biliary cholesterol secretion. Nature Communications 13 , 252, doi:ARTN 25210.1038/s41467-021-27758-8 (2022). Funabashi, M et al. A metabolic pathway for bile acid dehydroxylation by the gut microbiome. Nature 582 , 566-570, doi:10.1038/s41586-020-2396-4 (2020). Yang, M et al. Bile Acid-Gut Microbiota Axis in Inflammatory Bowel Disease: From Bench to Bedside. Nutrients 13 , 3143, doi:ARTN 314310.3390/nu13093143 (2021). Chen, L et al. Hepatic cytochrome P450 8B1 and cholic acid potentiate intestinal epithelial injury in colitis by suppressing intestinal stem cell renewal. Cell Stem Cell 29 , 1366-1381, doi:10.1016/j.stem.2022.08.008 (2022). Sayin, SI et al. Gut Microbiota Regulates Bile Acid Metabolism by Reducing the Levels of Tauro-beta-muricholic Acid, a Naturally Occurring FXR Antagonist. Cell Metabolism 17 , 225-235, doi:10.1016/j.cmet.2013.01.003 (2013). Gérard, P. Metabolism of Cholesterol and Bile Acids by the Gut Microbiota. Pathogens 3 , 14-24, doi:10.3390/pathogens3010014 (2013). Xu, JJ et al. Paeoniae Radix Rubra can enhance fatty acid β-oxidation and alleviate gut microbiota disorder in α-naphthyl isothiocyanate induced cholestatic model rats. Frontiers in Pharmacology 13 , 1002922, doi:ARTN 100292210.3389/fphar.2022.1002922 (2022). Wang, KL et al. Gut microbiota disorder caused by diterpenoids extracted from aggravates intestinal mucosal damage. Pharmacology Research & Perspectives 9 , e00765, doi:ARTN e0076510.1002/prp2.765 (2021). Wang, C-S-E et al. VSL#3 can prevent ulcerative colitis-associated carcinogenesis in mice. World Journal of Gastroenterology 24 , 4254-4262, doi:10.3748/wjg.v24.i37.4254 (2018). Huang, L et al. 5-Aminosalicylic acid ameliorates dextran sulfate sodium-induced colitis in mice by modulating gut microbiota and bile acid metabolism. Cell Mol Life Sci 79 , 460, doi:ARTN 46010.1007/s00018-022-04471-3 (2022). Hiippala, K, Kainulainen, V, Kalliomäki, M, Arkkila, P & Satokari, R. Mucosal Prevalence and Interactions with the Epithelium Indicate Commensalism of spp. Front Microbiol 7 , 1706, doi:ARTN 170610.3389/fmicb.2016.01706 (2016). Okamoto, K et al. Dysbiosis-Associated Polyposis of the Colon-Cap Polyposis. Front Immunol 9 , 918, doi:ARTN 91810.3389/fimmu.2018.00918 (2018). Paramsothy, S et al. Specific Bacteria and Metabolites Associated With Response to Fecal Microbiota Transplantation in Patients With Ulcerative Colitis. Gastroenterology 156 , 1440-1454.e2, doi:10.1053/j.gastro.2018.12.001 (2019). Pircalabioru, GG et al. Snapshot into the Type-2-Diabetes-Associated Microbiome of a Romanian Cohort. Int J Mol Sci 23 , 15023, doi:ARTN 1502310.3390/ijms232315023 (2022). Del Chierico, F et al. Gut Microbiota Profiling of Pediatric Nonalcoholic Fatty Liver Disease and Obese Patients Unveiled by an Integrated Meta-omics-Based Approach. Hepatology 65 , 451-464, doi:10.1002/hep.28572 (2017). Milosevic, I et al. Gut-Liver Axis, Gut Microbiota, and Its Modulation in the Management of Liver Diseases: A Review of the Literature. Int J Mol Sci 20 , 395, doi:ARTN 39510.3390/ijms20020395 (2019). Hegyi, P, Maléth, J, Walters, JR, Hofmann, AF & Keely, SJ. Guts and Gall: Bile Acids in Regulation of Intestinal Epithelial Function in Health and Disease. Physiol Rev 98 , 1983-2023, doi:10.1152/physrev.00054.2017 (2018). Takiishi, T, Fenero, CIM & Câmara, NOS. Intestinal barrier and gut microbiota: Shaping our immune responses throughout life. Tissue Barriers 5 , e1373208, doi:10.1080/21688370.2017.1373208 (2017). Heinemann, U & Schuetz, A. Structural Features of Tight-Junction Proteins. Int J Mol Sci 20 , 6020, doi:ARTN 602010.3390/ijms20236020 (2019). Additional Declarations No competing interests reported. Supplementary Files Supplementaryinformation.pdf Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 13 Mar, 2026 Reviews received at journal 20 Dec, 2025 Reviewers agreed at journal 15 Dec, 2025 Reviewers invited by journal 11 Dec, 2025 Editor assigned by journal 12 Nov, 2025 Submission checks completed at journal 06 Nov, 2025 First submitted to journal 06 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7986820","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":560346787,"identity":"30d11412-6646-43b8-b24b-3f8f9635f507","order_by":0,"name":"Hongan Zeng","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Hongan","middleName":"","lastName":"Zeng","suffix":""},{"id":560346788,"identity":"4aeca1aa-dd4d-48ed-887f-5e9980dd2da6","order_by":1,"name":"Liping Xiang","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Liping","middleName":"","lastName":"Xiang","suffix":""},{"id":560346790,"identity":"92942d39-d5be-4165-9401-7964c3aa0ecf","order_by":2,"name":"Weijing Gong","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Weijing","middleName":"","lastName":"Gong","suffix":""},{"id":560346792,"identity":"cd1f81c4-1fdb-4ced-afa7-f966fdaee8aa","order_by":3,"name":"Bingyu Cheng","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Bingyu","middleName":"","lastName":"Cheng","suffix":""},{"id":560346793,"identity":"d2a6bede-590f-4135-a426-1d7e61d9ae27","order_by":4,"name":"Xinxin Zhu","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xinxin","middleName":"","lastName":"Zhu","suffix":""},{"id":560346794,"identity":"70b76f76-00ff-4de2-a3d6-9781d7a748c6","order_by":5,"name":"Luqin Si","email":"","orcid":"","institution":"Huazhong University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Luqin","middleName":"","lastName":"Si","suffix":""},{"id":560346798,"identity":"d00ea50c-71d6-43a7-985d-377b9983e746","order_by":6,"name":"Jiangeng Huang","email":"","orcid":"","institution":"Huazhong University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Jiangeng","middleName":"","lastName":"Huang","suffix":""},{"id":560346799,"identity":"24e5eeba-fca6-4372-a855-9f229e71566f","order_by":7,"name":"Sanlan Wu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIiWNgGAWjYNCCAgYGfgkIk7GBOC0GDAySM4D0AZK0GNwgVovBjfSHnwsM7PKMb/cYf/7AYCO74QDzswf4teQYS88wSC42u3PGTOIAQ5rxhgNs5gb4tJjdyGGQ5jFgTtx2I8cM6LDDiRsO8LBJ4NeS/vg3j0F94uYZOcYfDjD8J0ZLghnQFqDhEjkGQIcdIKzF/swbM2seg+OJM26klUmcMUg2nnmYzQyvFsn29Me3eSqqE/tnJG/+UFFhJ9t3vPkZXi1oABRUzCSoHwWjYBSMglGAHQAAvpFKW5+AUNcAAAAASUVORK5CYII=","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":true,"prefix":"","firstName":"Sanlan","middleName":"","lastName":"Wu","suffix":""}],"badges":[],"createdAt":"2025-10-30 08:23:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7986820/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7986820/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":98410517,"identity":"07c791cf-9296-437b-a896-cea458a501ae","added_by":"auto","created_at":"2025-12-17 13:39:50","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":56236948,"visible":true,"origin":"","legend":"\u003cp\u003eVCZ triggered liver injury in rats with mild inflammation. \u003cstrong\u003e(a)\u003c/strong\u003e The drug administration protocol of animal model. \u003cstrong\u003e(b)\u003c/strong\u003eDetection of plasma biochemical indicators in rats. Plasma ALT, γ-GGT, TBA, and TBIL were significantly higher in LPS + VCZ group. (Comparison of data among multiple groups analysis was conducted using one-way ANOVA, and the results were expressed as the mean ± SD, \u003cem\u003en\u003c/em\u003e=6~8, *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001) \u003cstrong\u003e(c)\u003c/strong\u003e Representative H\u0026amp;E staining images at 100x magnification showing significant inflammatory infiltration (red arrow) and vacuolation necrosis (black arrow) in liver sections of LPS+VCZ group compared with other groups.\u003c/p\u003e","description":"","filename":"FIG.1.png","url":"https://assets-eu.researchsquare.com/files/rs-7986820/v1/6c49dc8f396ad3e35dba8270.png"},{"id":98410523,"identity":"d1db7500-cead-4983-bd4c-55696cbd8b13","added_by":"auto","created_at":"2025-12-17 13:39:50","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":376843,"visible":true,"origin":"","legend":"\u003cp\u003eVCZ led to abnormal BAs metabolism in the liver and plasma of rats with mild inflammation. \u003cstrong\u003e(a) \u003c/strong\u003eThe primary BA levels in the liver. \u003cstrong\u003e(b)\u003c/strong\u003e The secondary BA levels in the liver. \u003cstrong\u003e(c) \u003c/strong\u003eThe primary BA levels in the plasma. \u003cstrong\u003e(d)\u003c/strong\u003e The secondary BA levels in the plasma. 16 and 14 kinds of BAs were detected in the liver and plasma of rats respectively. The concentration of most BAs from liver samples, including TDCA, GCDCA, CDCA, DCA, GLCA were significantly increased in LPS+VCZ group compared with the other three groups. By contrast, the levels of CA and TUDCA decreased (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05). Similarly, the concentrations of 8 BAs from plasma samples, including TDCA, TMCA, GCDCA, MCA, CDCA, DCA, GDCA, and GUDCA, were higher in LPS+VCZ group than other three groups. (Comparison of data among multiple groups analysis was conducted using one-way ANOVA, and the results were expressed as the mean ± SD, \u003cem\u003en\u003c/em\u003e=6~8, *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001, ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001)\u003c/p\u003e","description":"","filename":"FIG.21.png","url":"https://assets-eu.researchsquare.com/files/rs-7986820/v1/1e6a000197b54c1969ca2e65.png"},{"id":98410513,"identity":"9fcefe60-fc99-43d0-9e89-b08548d7d924","added_by":"auto","created_at":"2025-12-17 13:39:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1207562,"visible":true,"origin":"","legend":"\u003cp\u003eVCZ led to disruption of gut microbiota in rats with mild inflammation. \u003cstrong\u003e(a)\u003c/strong\u003e Venn diagram of intestinal flora sequencing in rats. There were 8 specific species in the LPS + VCZ group. There was no significant difference in the number of OTUs. \u003cstrong\u003e(b)\u003c/strong\u003e In Hierarchical Clustering, the LPS + VCZ group samples were furthest apart from the Control group. The sobs index \u003cstrong\u003e(c)\u003c/strong\u003e and the Shannon index \u003cstrong\u003e(d)\u003c/strong\u003e were both significantly decreased in the LPS + VCZ group. PCA analysis \u003cstrong\u003e(e)\u003c/strong\u003e, PcoA analysis \u003cstrong\u003e(f)\u003c/strong\u003e, and PLS-DA analysis G showed that the gut microbiota of the LPS + VCZ group could be well separated from the other three groups. (mean ± SD, n=5, *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05)\u003c/p\u003e","description":"","filename":"FIG.3.png","url":"https://assets-eu.researchsquare.com/files/rs-7986820/v1/95b91b1ef4a51d3448108567.png"},{"id":98410516,"identity":"da403c75-2f4b-4d7e-a0f9-077615eb7253","added_by":"auto","created_at":"2025-12-17 13:39:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3255200,"visible":true,"origin":"","legend":"\u003cp\u003eVCZ led to disruption of gut microbiota in rats with mild inflammation. Composition of fecal microbiota at the phylum \u003cstrong\u003e(a)\u003c/strong\u003e, the family \u003cstrong\u003e(b)\u003c/strong\u003e, and genus \u003cstrong\u003e(c)\u003c/strong\u003elevel. \u003cstrong\u003e(d)\u003c/strong\u003e Evolutionary Branch Maps of LEfSe Analysis from the phylum to genus level. \u003cstrong\u003e(e)\u003c/strong\u003e Histogram of LDA value distribution under LEfSe analysis among the four groups. \u003cem\u003eSutterella\u003c/em\u003e, \u003cem\u003eYaniella\u003c/em\u003e, \u003cem\u003eHoldemania\u003c/em\u003eand \u003cem\u003eAnaerofustis\u003c/em\u003e were enriched in LPS+VCZ group. \u003cstrong\u003e(f)\u003c/strong\u003e Histogram of LDA value distribution under LEfSe analysis; Control vs LPS+VCZ. \u003cem\u003eBacteroides\u003c/em\u003e, \u003cem\u003eSutterella\u003c/em\u003e and\u003cem\u003e Dietzia\u003c/em\u003e were enriched in LPS+VCZ group. (Data analysis was conducted using ANOSIM, the Wilcoxon rank-sum test, and the Kruskal-Wallis H test, n=5)\u003c/p\u003e","description":"","filename":"FIG.4.png","url":"https://assets-eu.researchsquare.com/files/rs-7986820/v1/81d3dffbb55384715c15e6d8.png"},{"id":98410512,"identity":"1e62c635-21eb-44a1-b1ed-99be1ace6c70","added_by":"auto","created_at":"2025-12-17 13:39:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":672435,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation analysis of intestinal microbiota and BAs. \u003cstrong\u003e(a)\u003c/strong\u003e There were 2 strains were positively, and 3 strains were negatively correlated with most BAs in rat plasma. \u003cstrong\u003e(b)\u003c/strong\u003eThere were 2 strains were negatively, and 4 strains were positively correlated with most BAs in rat liver. (The comparison of data among multiple groups was conducted using Spearman's rank correlation analysis. Green represents positive correlation, while red represents negative correlation. The darkness of the color indicates the strength of the correlation. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001)\u003c/p\u003e","description":"","filename":"FIG.5.png","url":"https://assets-eu.researchsquare.com/files/rs-7986820/v1/19ecb47bb159d2cdd21c6e55.png"},{"id":98440796,"identity":"ae192617-845b-4bb9-805e-7fdd8613c185","added_by":"auto","created_at":"2025-12-17 17:04:21","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3073311,"visible":true,"origin":"","legend":"\u003cp\u003emRNA and protein expression levels of BAs regulatory pathways in the liver and ileum. \u003cstrong\u003e(a)\u003c/strong\u003e In the liver, the mRNA levels of CAR, VDR, PXR, FXR, BSEP, and MRP2 of LPS+VCZ group were significantly reduced, and the mRNA levels of CYP7A1 and NTCP were significantly increased. \u003cstrong\u003e(b)\u003c/strong\u003eThe Western-Blot analysis results showed that the protein levels of CAR, VDR, PXR, FXR, BSEP, and MRP2 and CYP7A1 in LPS+VCZ group were significantly increased. \u003cstrong\u003e(c)\u003c/strong\u003e Protein expression quantification results in the liver. \u003cstrong\u003e(d)\u003c/strong\u003eIn the rat ileum, the mRNA expression levels of both FXR and TGR5 in LPS+VCZ group was reduced. \u003cstrong\u003e(e) \u003c/strong\u003eProtein expression quantification in ileum tissue. \u003cstrong\u003e(f)\u003c/strong\u003e FXR protein expression levels were significantly decreased in LPS + VCZ group. (Comparison of data among multiple groups analysis was conducted using one-way ANOVA, and the results were expressed as the mean ± SD, qPCR: \u003cem\u003en\u003c/em\u003e=6~8, WB: \u003cem\u003en\u003c/em\u003e=3, *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001, ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001)\u003c/p\u003e","description":"","filename":"FIG.6.png","url":"https://assets-eu.researchsquare.com/files/rs-7986820/v1/5d07eb6be5c32835d328918f.png"},{"id":98440479,"identity":"7a5e7a9e-3911-45c4-9e5d-057c12afb755","added_by":"auto","created_at":"2025-12-17 17:03:54","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":831684,"visible":true,"origin":"","legend":"\u003cp\u003emRNA and protein expression levels of inflammatory regulatory pathways in the liver. \u003cstrong\u003e(a) \u003c/strong\u003eThe mRNA levels of TLR4, MYD88, and NF-κB were significantly increased in LPS + VCZ group. \u003cstrong\u003e(b) \u003c/strong\u003eThe protein expression levels of TLR4, MYD88, and NF-κB were significantly increased in LPS + VCZ group. \u003cstrong\u003e(c)\u003c/strong\u003e Figure of protein expression quantification results. (Comparison of data among multiple groups analysis was conducted using one-way ANOVA, and the results were expressed as the mean ± SD, qPCR: \u003cem\u003en\u003c/em\u003e=6~8, WB: \u003cem\u003en\u003c/em\u003e=3, *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001, ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001)\u003c/p\u003e","description":"","filename":"FIG.7.png","url":"https://assets-eu.researchsquare.com/files/rs-7986820/v1/2323fb5a9edb9e26c562655e.png"},{"id":98410515,"identity":"4b43320e-648f-4cae-ad64-453539920f64","added_by":"auto","created_at":"2025-12-17 13:39:49","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1677481,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of mRNA and protein expression levels of inflammatory factors. \u003cstrong\u003e(a) \u003c/strong\u003eThe mRNA expression levels of IL-1β, IL-6 and TNF-α were significantly upregulated in LPS + VCZ group. \u003cstrong\u003e(b)\u003c/strong\u003e The results of Western-Blot analysis showed that the protein expression level of IL-1β, IL-6 and TNF-α was significantly increased in the liver and \u003cstrong\u003e(c) \u003c/strong\u003eFigure of protein expression quantification results. \u003cstrong\u003e(d)\u003c/strong\u003eThe mRNA expression levels of IL-1β and TNF-α were significantly upregulated in LPS + VCZ group in the ileum. \u003cstrong\u003e(e)\u003c/strong\u003e The protein confession levels of IL-1β and TNF-α increased significantly in the rat ileum and \u003cstrong\u003e(f)\u003c/strong\u003e Figure of protein expression quantification results. (Comparison of data among multiple groups analysis was conducted using one-way ANOVA, and the results were expressed as the mean ± SD, qPCR: \u003cem\u003en\u003c/em\u003e=6~8, WB: \u003cem\u003en\u003c/em\u003e=3, *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001, ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001)\u003c/p\u003e","description":"","filename":"FIG.8.png","url":"https://assets-eu.researchsquare.com/files/rs-7986820/v1/521040b572bfe221af4ebee9.png"},{"id":98410519,"identity":"78e3d435-8229-4412-8283-2ef1a7f22df0","added_by":"auto","created_at":"2025-12-17 13:39:50","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":1074972,"visible":true,"origin":"","legend":"\u003cp\u003eIntestinal tight junction protein expression in the ileum of rats. \u003cstrong\u003e(a)\u003c/strong\u003e The Western-Blot analysis results showed that the protein expression levels of ZO-1 and Occludin were significantly reduced and \u003cstrong\u003e(b)\u003c/strong\u003eFigure of protein expression quantification results. (Comparison of data among multiple groups analysis was conducted using one-way ANOVA, and the results were expressed as the mean ± SD, \u003cem\u003en\u003c/em\u003e=3, *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001, ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001)\u003c/p\u003e","description":"","filename":"FIG.9.png","url":"https://assets-eu.researchsquare.com/files/rs-7986820/v1/d84a524780be3ab1e1be617d.png"},{"id":98410520,"identity":"cb483c4d-3d34-41db-bf26-4f82ab1d93bd","added_by":"auto","created_at":"2025-12-17 13:39:50","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":3161588,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryinformation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7986820/v1/22d471f6bc8b8ad3d3b6497f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Synergistic Hepatotoxicity of Voriconazole and Mild Inflammation: Involvement of Bile Acid Dysregulation, Intestinal Dysbiosis, and TLR4 Pathway Activation","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eDrug-induced liver injury (DILI) has emerged as a significant drug safety problem, potentially resulting in drug withdrawal and even liver failure. Voriconazole (VCZ) is widely recognized as the primary therapeutic agent for managing invasive aspergillosis and other fungal infections in immunocompromised patients, due to its broad antibacterial spectrum and strong antibacterial activity. However, VCZ-induced liver injury is frequently observed in clinical settings, manifesting as transient elevation of liver enzymes, cholestasis, and fulminant hepatic failure, and may even lead to death\u003csup\u003e1,2\u003c/sup\u003e. A retrospective case-control study involving 156,570 patients showed that VCZ has the highest incidence rate of DILI\u003csup\u003e3\u003c/sup\u003e. The incidence of DILI induced by VCZ is as high as 18.19% among patients receiving oral azole antifungal drugs, higher than that of fluconazole and itraconazole\u003csup\u003e1\u003c/sup\u003e. Although therapeutic drug monitoring reduces the incidence of VCZ-induced liver injury, hepatotoxicity is not excluded even at low blood concentrations of VCZ. Research has suggested that there is no direct correlation between blood drug concentration and liver toxicity for VCZ\u003csup\u003e4\u003c/sup\u003e. Numerous factors, including liver and kidney function and genetic polymorphisms, may be related to VCZ-induced liver injury\u003csup\u003e5-7\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eAccording to the pathogenesis, DILI can be categorized into intrinsic DILI and idiosyncratic drug-induced liver injury (IDILI)\u003csup\u003e8\u003c/sup\u003e. IDILI varies greatly among individuals, is not dose-dependent and is unpredictable, making it more common in clinical practice. Previous studies have emphasized that the pathogenesis of IDILI includes the inflammatory stress hypothesis, the mitochondrial damage hypothesis, the immune response hypothesis, and so on\u003csup\u003e9\u003c/sup\u003e. Numerous studies have demonstrated that inflammation is an independent predisposing factor or promoter of DILI\u003csup\u003e10,11\u003c/sup\u003e. Hepatocytes in an inflammatory state are more sensitive to toxic cytokines released by immune cells. As a stimulator, inflammation may lower the liver\u0026rsquo;s response threshold to potential hepatotoxic substances, thereby predisposing patients to liver damage\u003csup\u003e12\u003c/sup\u003e. Lipopolysaccharide (LPS), as a classic inflammatory stimulus, has been used in numerous studies on inflammatory reactions and liver toxicity. Previous studies in rats have demonstrated that liver injury was evident only in animals treated with both ranitidine and LPS, whereas no liver injury was observed when ranitidine was used alone\u003csup\u003e13\u003c/sup\u003e. Other drugs that can induce liver injury under the induction of LPS include diclofenac\u003csup\u003e14\u003c/sup\u003e, chlorpromazine\u003csup\u003e15\u003c/sup\u003e, trovafloxacin\u003csup\u003e16\u003c/sup\u003e, and amiodarone\u003csup\u003e17\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Previous clinical studies have indicated that VCZ has the potential to induce cholestatic liver injury in immunosuppressive patients\u003csup\u003e18\u003c/sup\u003e. A study of the incidence of DILI in the general population suggested that 47% of cases were cholestatic or mixed\u003csup\u003e19\u003c/sup\u003e. Drug-induced cholestasis is a common manifestation of DILI, characterized by impaired bile duct flow and subsequent accumulation of bile in the blood and tissues\u003csup\u003e20\u003c/sup\u003e. Bile acids (BAs) are important components of bile, synthesized in the liver and metabolized into secondary BAs in the gut by the gut flora. Moreover, secondary BAs, as metabolites, combine with the farnesoid X receptor (FXR) and thereby affect BAs synthesis in the liver via signaling cascades. In turn, this process induces a series of inflammatory signaling cascades\u003csup\u003e21\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eIn addition, the proposal of the gut-liver axis theory has led us to pay attention to the gut microbiota when studying liver diseases. Research has revealed a close interaction between these two organs in terms of normal physiology and disease. Gut microbiota is involved in disease regulation and drug metabolism, thereby affecting drug safety\u003csup\u003e22\u003c/sup\u003e. Numerous studies have demonstrated that cholestasis is associated with changes in microbiome composition; for example, the fecal microbial composition of patients with primary sclerosing cholangitis is significantly different from that of healthy people\u003csup\u003e23\u003c/sup\u003e. In the absence of a microbiome, cholestasis fails to promote liver damage\u003csup\u003e24\u003c/sup\u003e. In recent years, increasing evidence has shown that changes in the gut microbiota are closely related to DILI, ranging from antithyroid drugs such as methimazole and propylthiouracil\u003csup\u003e25\u003c/sup\u003e, tacrine\u003csup\u003e26\u003c/sup\u003e, to granisetron\u003csup\u003e27\u003c/sup\u003e as well as acetaminophen\u003csup\u003e28\u003c/sup\u003e. These studies have mentioned that the LPS-related signaling pathway is associated with gut microbiota and DILI.\u003c/p\u003e\n\u003cp\u003eThere are numerous clinical reports on VCZ-induced liver injury, and studies have identified that these patients present with clinical features of cholestasis, such as elevated total bilirubin\u003csup\u003e5,14,29,30\u003c/sup\u003e. Meanwhile, limited research has revealed possible mechanisms of VCZ-induced DILI. The results of a plasma metabolomics study revealed that VCZ-induced liver injury may be associated with oxidative stress\u003csup\u003e31\u003c/sup\u003e. Furthermore, it has been suggested that reduced fatty acid oxidation and bile acid excretion may underlie VCZ-induced liver injury\u003csup\u003e32\u003c/sup\u003e. However, the increasing concern about its hepatotoxicity necessitates a comprehensive understanding of the mechanisms underlying VCZ-induced liver injury.\u003c/p\u003e\n\u003cp\u003eTherefore, we speculate that the inflammatory stimulus may cause abnormal metabolism of BAs and disrupt the gut microbiota, thereby exacerbating the liver damage caused by VCZ. In this study, we established a model of VCZ-induced liver injury in Sprague Dawley (SD) rats, in which mild inflammation was triggered by a non-toxic dose of LPS. Targeted metabolomics analysis was performed to examine the levels of BAs in the plasma and liver across different groups. High-throughput sequencing analysis was conducted to investigate changes in the gut microbiota. The association between bile stasis and gut microbiota was explored. Finally, the proposed mechanism of VCZ-induced liver injury was validated at the genetic level.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003ch2\u003e2.1 \u0026nbsp; Chemicals and reagents\u003c/h2\u003e\n\u003cp\u003eVCZ (CAS number 137234-62-9; analytical standard, 99%) was provided by Grand Pharmaceutical (China) Co., Ltd. LPS (derived from E. coli serotype O55:B5, source strain CDC 1644-70) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Biochemical indicator assay kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The BA standards and internal standards were purchased from Sigma Aldrich Company (St Louis, MO, USA).\u003c/p\u003e\n\u003ch2\u003e2.2 \u0026nbsp;Model establishment of VCZ-induced liver injury in SD rats\u003c/h2\u003e\n\u003cp\u003eMale SD rats\u003csup\u003e33\u003c/sup\u003e (6-8 w, 180-200 g) were purchased from the Experimental Animal Center of Three Gorges University (Yichang, China). Animals were allowed to eat and drink freely under conditions of controlled temperature, humidity, and a 12-h light/12-h dark cycle. All experimental procedures were conducted in accordance with the National Institutes of Health guidelines for the care and use of laboratory animals.\u003c/p\u003e\n\u003cp\u003e32 rats were randomly divided into four groups: Control group ((normal saline and 0.5% carboxymethylcellulose sodium (CMC-Na)); LPS group (4 mg/kg LPS and 0.5% CMC-Na); VCZ group (40 mg/kg VCZ and normal saline); LPS + VCZ group (40 mg/kg VCZ and 4 mg/kg LPS). A 10 mg/mL VCZ solution was prepared by dissolving 100 mg of VCZ in 10 mL of 0.5% CMC-Na solution, and the drug was administered to rats at a dose of 4 mL/kg, and LPS was dissolved in normal saline. Rats were treated with normal saline or LPS by intraperitoneal injection, and 0.5% CMC-Na or VCZ were given by oral gavage 2 h later\u003csup\u003e14\u003c/sup\u003e. The VCZ dose was based on the clinical human dose, whereas the LPS dose was screened according to the pre-test (SI Figure_1-2). In the 7-day experiments, LPS was administered only on the first day, and VCZ was administered once daily.\u003c/p\u003e\n\u003cp\u003eOn day 8, fecal collection was performed before anesthesia. Subsequently, the rats were anesthetized with 1g/kg urethane (20%w/v), and their blood (plasma by centrifugation), livers, and ilea were collected. A part of the liver was fixed in paraformaldehyde for pathological sectioning, and the remaining liver tissue was frozen. The removed tissues, plasma, and feces were stored at -80 \u0026deg;C.\u003c/p\u003e\n\u003ch2\u003e2.3 \u0026nbsp;Serum biochemical analysis and liver histology evaluation\u003c/h2\u003e\n\u003cp\u003eCommercial kits were used to measure the level of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bile acids (TBA), total bilirubin (TBIL) in plasma. The liver sections fixed in 4% paraformaldehyde were sequentially dehydrated, embedded in paraffin, sectioned, stained with hematoxylin-eosin (H\u0026amp;E), and then examined under an optical microscope.\u003c/p\u003e\n\u003ch2\u003e2.4 \u0026nbsp;Targeted quantification analysis of BAs by LC-MS/MS\u003c/h2\u003e\n\u003cp\u003eSample processing was performed according to the protocol established by Huang et al., with the following modifications to the chromatographic conditions: Mobile phase A consisted of water (containing 1% formic acid), while methanol (containing 1% formic acid) was used as mobile phase B. The total flow rate was maintained at 0.3 mL/min during injection. The organic phase gradient was increased from 60% to 90% over the first 20 min, held at this level for 2 min, then decreased to 60% in 0.01 min, followed by a 2-min equilibration time. A 10 \u0026mu;L volume of each sample was analyzed in negative ionization mode. The contents of 16 BAs in rat plasma and liver were assessed, including cholic acid (CA), chenodeoxycholic acid (CDCA), muricholic acid (MCA), glycocholic acid (GCA), taurocholic acid (TCA), taurodeoxycholic acid (TDCA), taurochenodeoxycholic acid (TCDCA), tauromuricholic acid (TMCA), deoxycholic acid (DCA), ursodeoxycholic acid (UDCA), glycodeoxycholic acid (GDCA), glycolithocholic acid (GLCA), glycochenodeoxycholic acid (GCDCA), glycoursodeoxycholic acid (GUDCA), taurolithocholic acid (TLCA), tauroursodeoxycholic acid (TUDCA); chenodeoxycholic acid -2,2,4,4-D4 (CDCA-D4) was used as the internal standard. Bile acid (BA) analysis was performed using an LC-MS/MS system comprising a Shimadzu Prominence UFLC system (Shimadzu Corporation, Kyoto, Japan) and an API4000 QTrap\u0026reg; triple quadrupole mass spectrometer (AB Sciex, Foster City, CA, USA) equipped with an electrospray ionization source. Chromatographic separation was achieved using a Waters ACQUITY HSS T3 column (2.1\u0026times;100 mm, particle size 1.8 \u0026mu;m, Waters, USA) at a column temperature of 40 \u0026deg;C.\u003c/p\u003e\n\u003ch2\u003e2.5 \u0026nbsp;Gut microbiota analysis\u003c/h2\u003e\n\u003cp\u003eThe DNA of microorganisms in rat feces was extracted using the FastDNA\u0026reg; Spin Kit for Soil (MP Biomedicals, USA) according to the kit manual, and the DNA quality was assessed by 1% agarose gel electrophoresis. The V3-V4 region of the 16S rRNA gene was amplified by PCR using specific primers (5\u0026prime;-barcode- ACTCCTACGGGAGGCAGCAG -3\u0026prime;, 5\u0026prime;- GGACTACHVGGGTWTCTAAT -3\u0026prime;) with a thermocycler PCR system (ABI GeneAmp 9700, USA). The PCR products were purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA), and qualified products were subjected to Illumina Miseq PE300 sequencing (Illumina, San Diego, USA). The filtered sequencing results were clustered into operational taxonomic units (OTUs) using UPARSE (version 7.1; http://drive5.com/uparse). The taxonomic annotation of each 16S rRNA gene sequence was performed using the RDP Classifier algorithm (http://rdp.cme.msu.edu) against the Silva (V138) 16S rRNA database, with a comparison threshold of 70%. The entire sequencing process was conducted according to the standard protocols of Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China), and the results were analyzed using the Majorbio Cloud Platform (https://www.majorbio.com).\u003c/p\u003e\n\u003ch2\u003e2.6 \u0026nbsp;Gene expression analysis\u003c/h2\u003e\n\u003cp\u003eRNA was extracted from rat liver and ileum tissues using Trizol reagent (Invitrogen, USA) according to the manufacturer\u0026apos;s instructions. The UV absorption peaks of nucleic acids at 260 nm and 280 nm were measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA) to assess RNA purity. RNA samples with A260/A280 ratios between 1.8 and 2.0 were used for subsequent analysis. cDNA was synthesized from RNA using the HiFiScript cDNA Synthesis Kit (YEASEN, China) with 2.5 \u0026mu;g of total RNA input. The cDNA was diluted 10-fold and used as a template for quantitative reverse transcription-PCR (qPCR) reactions. qPCR was performed using SYBR Green PCR Master Mix (Bio-Rad, USA) on an ABI 7500 Real-Time PCR System (Applied Biosystems, USA) with the associated 7500 System Software (Applied Biosystems, USA).\u003c/p\u003e\n\u003ch2\u003e2.7 \u0026nbsp;Western blotting\u003c/h2\u003e\n\u003cp\u003eRat liver and ileum tissue samples were lysed with 500 \u0026mu;L of lysis buffer (PMSF: Cocktail: RIPA=1:4:100). The protein concentration in the supernatant was measured using the BCA method, and the protein was denatured by adding loading buffer after uniform loading volume in boiling water. After electrophoresis, the gel was cut into bands of different widths according to the molecular weight of the protein of interest, as indicated by the marker, for membrane transfer. The membrane was then blocked with 5% nonfat milk and subsequently incubated with the primary antibody at 4 ℃ overnight and the secondary antibody at room temperature for 1 hour. Before each step, the bands were washed three times for 10 min each with a buffer containing Tris-HCl, NaCl, and Tween. Protein bands were visualized and photographed using an enhanced chemiluminescence detection system (Millipore, USA).\u003c/p\u003e\n\u003ch2\u003e2.8 \u0026nbsp;Statistical analysis\u003c/h2\u003e\n\u003cp\u003eOne-way ANOVA was performed on the data using GraphPad Prism 8.0 (GraphPad Software Inc., California, USA), and the results were expressed as the mean \u0026plusmn; SD. 16S rRNA sequencing data analysis was conducted using ANOSIM, the Wilcoxon rank-sum test, and the Kruskal-Wallis H test. The correlations between the microbiota and BAs were analyzed using Spearman\u0026apos;s rank correlation. \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05 was considered to indicate statistical significance.\u003c/p\u003e"},{"header":"3. Results","content":"\u003ch2\u003e3.1 \u0026nbsp;VCZ induced liver injury\u003c/h2\u003e\n\u003cp\u003eTo assess liver damage following one week of modeling, the biochemical indicators in rat plasma were measured. As shown in Fig. 1b, the plasma levels of ALT and \u0026gamma;-GGT in LPS+VCZ group were significantly higher than other three groups (\u003cem\u003ep\u003c/em\u003e=0.0077, \u003cem\u003ep\u003c/em\u003e=0.0002, \u003cem\u003ep\u003c/em\u003e=0.0064, respectively), and the plasma AST level was higher than VCZ group. Moreover, both TBA and TBIL levels were significantly higher than Control group. Furthermore, histopathological analysis revealed significant inflammatory infiltration and the presence of round vacuoles in the cytoplasm of hepatocytes in LPS+VCZ group (Fig. 1c). These findings indicated that VCZ increased the risk of liver injury and exacerbated the hepatic inflammatory response in the context of mild inflammation.\u003c/p\u003e\n\u003ch2\u003e3.2 \u0026nbsp;VCZ increased bile acid accumulation in mild inflammation\u003c/h2\u003e\n\u003cp\u003eThe elevated levels of TBA and TBIL in plasma suggested cholestatic liver injury (Fig. 1b). Therefore, the concentrations of 16 BAs in liver and plasma samples were further measured by LC-MS/MS. As shown in Fig. 2a, in the rat liver, the primary BAs CA in LPS + VCZ group was significantly lower than other three groups\u0026nbsp;(\u003cem\u003ep\u003c/em\u003e=0.0038, \u003cem\u003ep\u003c/em\u003e=0.0089, \u003cem\u003ep\u003c/em\u003e=0.0325, respectively), while CDCA and GCDCA were significantly higher than Control and LPS group\u0026nbsp;(\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, and \u003cem\u003ep\u003c/em\u003e=0.0138, \u003cem\u003ep\u003c/em\u003e=0.0027, respectively). The secondary BAs DCA and GLCA were significantly higher than Control and LPS group\u0026nbsp;(\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, and \u003cem\u003ep\u003c/em\u003e=0.0402, \u003cem\u003ep\u003c/em\u003e=0.0372, respectively). Meanwhile, the content of TDCA was significantly higher than other three groups\u0026nbsp;(\u003cem\u003ep\u003c/em\u003e=0.0018, \u003cem\u003ep\u003c/em\u003e=0.0007, \u003cem\u003ep\u003c/em\u003e=0.0049, respectively), while TUDCA was significantly lower than Control group\u0026nbsp;(\u003cem\u003ep\u003c/em\u003e=0.0112)\u0026nbsp;(Fig. 2b). As shown in Fig. 2c, d, in the plasma samples, the primary BAs TMCA in LPS + VCZ group was significantly higher than other three groups\u0026nbsp;(\u003cem\u003ep\u003c/em\u003e=0.0060, \u003cem\u003ep\u003c/em\u003e=0.0006, \u003cem\u003ep\u003c/em\u003e\u0026lt;0.0010, respectively), CDCA was significantly higher than Control and VCZ group\u0026nbsp;(\u003cem\u003ep\u003c/em\u003e=0.0251, \u003cem\u003ep\u003c/em\u003e=0.0233, respectively), GCDCA was significantly higher than Control and LPS group\u0026nbsp;((\u003cem\u003ep\u003c/em\u003e=0.0396, \u003cem\u003ep\u003c/em\u003e=0.0204, respectively), and MCA was significantly higher than VCZ group\u0026nbsp;(\u003cem\u003ep\u003c/em\u003e=0.0068). The secondary BAs DCA and TDCA in LPS + VCZ group were significantly higher than other three groups\u0026nbsp;(\u003cem\u003ep\u003c/em\u003e=0.0008, \u003cem\u003ep\u003c/em\u003e=0.0034, \u003cem\u003ep\u003c/em\u003e=0.0074, respectively and \u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001), GDCA was significantly higher than Control group\u0026nbsp;(\u003cem\u003ep\u003c/em\u003e=0.0154), and GUDCA was significantly higher than LPS group\u0026nbsp;(\u003cem\u003ep\u003c/em\u003e=0.0473). However, due to the low concentrations of GLCA and TLCA, they were not detected.\u003c/p\u003e\n\u003ch2\u003e3.3 \u0026nbsp;VCZ promoted gut microbiota alteration in mild inflammation\u003c/h2\u003e\n\u003cp\u003eThe feces of rats in each group were collected and stored in sterile centrifuge tubes, after which 16S rRNA sequencing was performed to investigate the changes in the intestinal flora. The mean number of OTUs and the number of shared OTUs in each group were shown by Venn plots (Fig. 3a). Compared with the other three groups, the Sobs and Shannon index of LPS+VCZ was lower (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05), indicating that the species richness and diversity of the gut microbiota were reduced after LPS+VCZ treatment (Fig. 3c, d).\u003c/p\u003e\n\u003cp\u003eThe samples in these groups exhibited hierarchical clustering based on the Bray\u0026ndash;Curtis distance. We found that the control group and the LPS+VCZ group were the farthest apart overall, indicating that these two groups of samples had the largest difference in the composition of the flora (Fig. 3b). Principal Component Analysis (PCA) and UniFrac distance-based principal coordinate analysis (PCoA) can reflect the differences in the structure of bacterial taxa. As shown in Fig. 3E and F, the microbes in Control, LPS, and VCZ group clustered together in both the PCA and PCoA graphs, and they were clearly separated from the LPS+VCZ group, which revealed that VCZ given under inflammatory conditions had a certain effect on the structure of the intestinal flora in rats. The community composition analysis maps revealed specific changes. As shown in Fig. 4a, LPS+VCZ treatment increased the proportion of \u003cem\u003eBacteroidetes\u003c/em\u003e while decreasing \u003cem\u003eFirmicutes\u003c/em\u003e at the phylum level compared with the other three groups. Similarly, at the level of family, there was an increased relative abundance of \u003cem\u003eBacteroidaceae\u003c/em\u003e and a reduction of \u003cem\u003eMuribaculaceae\u003c/em\u003e and \u003cem\u003eLachnospiraceae\u003c/em\u003e in LPS+VCZ group (Fig. 4b). Furthermore, at the genus level, the LPS+VCZ group exhibited an increased abundance of \u003cem\u003eBacteroides\u003c/em\u003e and \u003cem\u003eAlloprevotella\u003c/em\u003e and a decreased abundance of \u003cem\u003enorank_f__Muribaculaceae\u003c/em\u003e (Fig. 4c).\u003c/p\u003e\n\u003cp\u003eIn addition, we used the LEfSe algorithm to identify different taxa from the phylum to genus level among the four groups. Bacterial species that differed significantly (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) among Control, LPS, VCZ and LPS+VCZ groups were screened using LEfSe to construct a cladogram (Fig. 3d). To identify significantly abundant bacteria among the four groups (LDA score \u0026gt;2.0 with \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05), LDA was used. As depicted in Fig. 4e, 41 kinds of significant phylotypes were identified, with 5, 10, 9, and 17 bacterial species being abundant in Control, LPS, VCZ, and LPS+VCZ groups, respectively. The LDA score was utilized to further compare taxa between the Control and LPS+VCZ groups. The analysis revealed that \u003cem\u003eBacteroides\u003c/em\u003e (phylum \u003cem\u003eBacteroidetes\u003c/em\u003e), \u003cem\u003egammaproteobacterial\u003c/em\u003e, \u003cem\u003esutterella\u003c/em\u003e (phylum \u003cem\u003eProteobacteria\u003c/em\u003e), and \u003cem\u003eButyricicoccaceae\u003c/em\u003e, which were enriched in LPS+VCZ group, might play an important role in liver injury (Fig. 4f).\u003c/p\u003e\n\u003ch2\u003e3.4 \u0026nbsp; Correlation between gut microbiota and bile acids\u003c/h2\u003e\n\u003cp\u003eTo investigate whether dysbacteriosis was related to BAs metabolism, Spearman\u0026rsquo;s correlation analysis was performed to correlate the top 15 species in taxonomic level abundance in each of the four groups with BAs detected in plasma and liver samples. As shown in Fig. 5a, \u003cem\u003eBacteroides\u003c/em\u003e and \u003cem\u003eAlloprevotella\u003c/em\u003e were positively correlated to the most BAs, and \u003cem\u003eUCG-005\u003c/em\u003e, \u003cem\u003eRuminococcus\u003c/em\u003e and \u003cem\u003eAlistipes\u003c/em\u003e were negatively correlated to the most BAs in plasma. Furthermore, \u003cem\u003eBacteroides\u003c/em\u003e and \u003cem\u003eAlloprevotella\u003c/em\u003e were positively correlated with the most BAs, \u003cem\u003eRomboutsia\u003c/em\u003e, \u003cem\u003eRuminococcus\u003c/em\u003e, \u003cem\u003eAlistipes\u003c/em\u003e and \u003cem\u003enorank_f__norank_o__Clostridia_UCG-014\u003c/em\u003e were negatively correlated to the most BAs in liver (Fig. 5b). These results suggested that the increase in \u003cem\u003eBacteroides\u003c/em\u003e and \u003cem\u003eIsoprevotella\u003c/em\u003e may be associated with cholestasis induced by LPS+VCZ treatment.\u003c/p\u003e\n\u003ch2\u003e3.5 \u0026nbsp; Expression of genes and proteins related to BAs metabolism in the liver and ileum\u003c/h2\u003e\n\u003cp\u003eThe BAs nuclear receptors, metabolic enzymes, and transporters were studied to further elucidate the mechanism underlying BAs homeostasis induced by VCZ. As shown in Fig. 6, the mRNA levels of CAR, VDR, PXR and FXR in LPS+VCZ group were down-regulated compared with the other three groups. Furthermore, this downward trend of the protein expression was more obvious. In addition, the mRNA levels of the BAs synthase \u003cem\u003eCyp7a1\u003c/em\u003e (\u003cem\u003ep\u003c/em\u003e＜0.0001) and the key BAs uptake transporter \u003cem\u003eNtcp\u003c/em\u003e (\u003cem\u003ep\u003c/em\u003e＜0.05) were up-regulated in LPS+VCZ group. The expression levels of \u003cem\u003eBsep\u003c/em\u003e and \u003cem\u003eMrp2\u003c/em\u003e were significantly reduced than Control group (\u003cem\u003ep\u003c/em\u003e=0.0012, and \u003cem\u003ep\u003c/em\u003e＜0.0001). Moreover, western blotting assay illustrated that the expression levels of BSEP and MRP2 were markedly decreased in LPS+VCZ group. As shown in Fig. 6d, the mRNA level of FXR in the rat ileum was reduced but not significantly in LPS + VCZ group compared with Control group. Nevertheless, the mRNA level of \u003cem\u003eTgr5\u003c/em\u003e was significantly reduced (\u003cem\u003ep\u003c/em\u003e=0.0084). FXR protein expression was remarkably decreased in LPS + VCZ group compared with Control and VCZ groups (\u003cem\u003ep\u003c/em\u003e=0.0026 and \u003cem\u003ep\u003c/em\u003e=0.0229), but no significant trend was observed for TGR5 protein expression (Fig. 6e, f). Overall, these results indicated that inhibiting the expression of BAs nuclear receptors, promoting the synthesis and uptake of BAs, and reducing the efflux may be the reasons for cholestasis triggered by LPS+VCZ.\u003c/p\u003e\n\u003ch2\u003e3.6 \u0026nbsp;VCZ activated the TLR4-MyD88-NF-\u0026kappa;B signaling pathway\u003c/h2\u003e\n\u003cp\u003e\u0026nbsp;We investigated the expression of the TLR4/NF-\u0026kappa;B signaling pathway in the liver tissue. As shown in Fig. 7, the mRNA levels of \u003cem\u003eTlr4\u003c/em\u003e, \u003cem\u003eMyd88\u003c/em\u003e and \u003cem\u003eNf-\u0026kappa;b\u003c/em\u003e in the LPS+VCZ group were significantly up-regulated compared with the other three groups, and the same up-regulation trend was also observed in the protein expression results.\u003c/p\u003e\n\u003cp\u003eThe levels of pro-inflammatory cytokines, including IL-1\u0026beta;, IL-6, and TNF-\u0026alpha;, in the liver were detected. As shown in Fig. 8a, the level of IL-1\u0026beta; mRNA in LPS+VCZ group was significantly higher than Control and VCZ groups (\u003cem\u003ep\u003c/em\u003e=0.0003, \u003cem\u003ep\u003c/em\u003e=0.0266, respectively), and TNF-\u0026alpha; mRNA was significantly increased compared with the other three groups (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, \u003cem\u003ep\u003c/em\u003e=0.0041, \u003cem\u003ep\u003c/em\u003e=0.0023, respectively), while the level of IL-6 mRNA showed no significant difference among the four groups. Similarly, the protein levels of pro-inflammatory cytokines IL-1\u0026beta; and TNF-\u0026alpha; in LPS+VCZ group significantly increased (Fig. 8b, c). Moreover, the mRNA levels and protein expression levels of the inflammatory factors IL-1\u0026beta; and TNF-\u0026alpha; were upregulated compared with the other three groups in ileum (Fig. 8d-f).\u003c/p\u003e\n\u003ch2\u003e3.7 \u0026nbsp;Damage to the intestinal barrier\u003c/h2\u003e\n\u003cp\u003eTo explore whether the intestinal barrier was damaged, we detected the expression levels of intestinal tight junction proteins ZO-1, Occludin, and Claudin-1. As shown in Fig. 9a, b, treatment with LPS + VCZ significantly down-regulated Occludin expression compared with the other three groups (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, \u003cem\u003ep\u003c/em\u003e=0.0003, \u003cem\u003ep\u003c/em\u003e=0.0045, respectively), and ZO-1 expression compared with LPS group (\u003cem\u003ep\u003c/em\u003e=0.0320). The expression of Claudin-1 showed a downward trend, but there was no significant difference among the groups. These results indicated that under LPS induction, VCZ disrupted the balance between intestinal commensal bacteria and pathogenic bacteria, leading to an imbalance of gut microbiota, and ultimately damaging the integrity of the intestinal barrier.\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eAs a potentially hepatotoxic drug, VCZ has attracted great attention in clinical practice. When liver injury occurs, clinicians often have to discontinue VCZ treatment to avoid more severe liver damage, which further leads to treatment failure for fungal infections and even death\u003csup\u003e34\u003c/sup\u003e. Previous studies have suggested that VCZ could cause cholestasis in patients\u003csup\u003e3,5,35\u003c/sup\u003e, because current research on VCZ mainly focuses on the analysis of clinical phenomena and data. Although one study has suggested that VCZ-induced cholestatic liver injury is related to decreased fatty acid oxidation and BAs excretion, the specific molecular mechanism has not been elucidated\u003csup\u003e32\u003c/sup\u003e. However, VCZ altering BAs metabolism, as well as triggering liver damage, is rarely reported. This study revealed that VCZ induced cholestatic liver injury by disrupting the balance of BAs synthesis, uptake and secretion, consequently promoting the release of inflammatory factors in rats with mild inflammation. In addition, the disturbance of gut microbiota and the destruction of intestinal barrier aggravate the accumulation of BAs, further exacerbating liver damage.\u003c/p\u003e\n\u003cp\u003eBAs are synthesized from cholesterol in the liver and are the major component in bile. In addition to their role in lipid digestion and absorption, BAs are also signaling molecules involved in cholestatic liver injury, linking the liver and gut\u003csup\u003e36\u003c/sup\u003e. In our results, levels of some BAs increased significantly after LPS+VCZ treatment, which was demonstrated by the expression of genes and proteins of BAs metabolism. Activation of FXR, as a key BAs nuclear receptor, leading to decreased expression of the enzyme cytochrome P450 cholesterol 7\u0026alpha;-hydroxylase (CYP7A1) \u003csup\u003e37\u003c/sup\u003e and sterol 12\u0026alpha;-hydroxylase (CYP8B1) \u003csup\u003e38\u003c/sup\u003e, thereby inhibiting BAs synthesis. Moreover, BAs efflux transporters bile salt export pump (BSEP) and multi-drug resistance related protein 2 (MRP2) are inhibited due to the activation of FXR, affecting the rate of BAs excretion by hepatocytes\u003csup\u003e39\u003c/sup\u003e. Knocking out BSEP in HepaRG cells leads to excessive accumulation of BAs, thereby increasing the sensitivity of the cells to drug-induced cholestatic liver injury\u003csup\u003e40\u003c/sup\u003e. Meanwhile, FXR can also inhibit the expression of basal Na+-taurocholic acid cotransporter polypeptide (NTCP), thereby inhibiting the entry of BAs into hepatocytes\u003csup\u003e38\u003c/sup\u003e. G protein-coupled receptor 5 (TGR5) is a bile acid-responsive cell surface receptor of BAs, which plays an important role in body energy homeostasis, BAs balance, and inflammatory response\u003csup\u003e41\u003c/sup\u003e. Studies have confirmed that TGR5 knockout mice are more susceptible to cholestatic liver injury induced by the BA diet or LPS stimulation\u003csup\u003e42\u003c/sup\u003e. Moreover, it was revealed that pregnane X receptor (PXR) could regulate genes involved in BAs biosynthesis and transport when activated by LCA, thereby reducing LCA-induced liver injury and playing a protective role\u003csup\u003e43\u003c/sup\u003e. Constitutive androstane receptor (CAR) plays a similar role to PXR, and CAR knockout mice showed more severe liver damage than wild type, which was associated with the altered expression of related genes in BAs metabolism\u003csup\u003e44\u003c/sup\u003e. Moreover, pharmacological activation of Vitamin D receptor (VDR) increased the excretion of BAs, confirming that VDR acts in regulating BAs metabolism in vivo\u003csup\u003e45\u003c/sup\u003e. In this study, we confirmed that after LPS+VCZ treatment, the expression levels of FXR, TGR5, BSEP and MRP2 were restrained, and the expression of CYP7A1 was up-regulated. Consequently, the synthesis of BAs increased, and excretion was hindered, and thus the BAs accumulation occurred. In addition, the down-regulated expression of nuclear receptor VDR will reduce the excretion of BAs, especially through urine excretion, which will aggravate the accumulation of more toxic BAs in the body. Meanwhile, PXR and CXR were down-regulated in gene and protein levels in our study, which would attenuate the protective effect on liver and aggravate cholestatic liver injury. A previous study proved the toxicity of several BAs is LCA\u0026gt;DCA\u0026gt;CDCA\u0026gt;CA\u0026gt;UDCA\u003csup\u003e46\u003c/sup\u003e. We found that BAs in liver and plasma such as DCA, CDCA were increased significantly by LPS+VCZ.\u003c/p\u003e\n\u003cp\u003eThe accumulation of BAs in hepatocytes can induce oxidative stress and inflammation, thereby leading to abnormal liver function or liver injury\u003csup\u003e47\u003c/sup\u003e. It has been proposed that BAs can trigger inflammatory responses, which are manifested as promoting neutrophil recruitment and the release of the cytokine CXCL1, CXCL2\u003csup\u003e48\u003c/sup\u003e. Moreover, many studies have shown that alleviating cholestatic liver injury can be achieved inhibiting NF-\u0026kappa;B-mediated inflammatory pathways\u003csup\u003e49-51\u003c/sup\u003e. In addition, the activation of FXR usually exerts an anti-inflammatory effect, and it has been demonstrated in various cells and tissues in vivo that FXR activation antagonizes NF-\u0026kappa;B activation. Thus, inhibition of FXR during inflammation may amplify inflammatory effects\u003csup\u003e52\u003c/sup\u003e. In the present study, on the one hand, LPS+VCZ administration activated the TLR4-MyD88-NF-\u0026kappa;B pathway and increased the release of inflammatory factors. On the other hand, the inhibitory effect of FXR on NF-\u0026kappa;B was weakened, thereby further promoting inflammation. Therefore, VCZ mainly caused BAs stasis in mild inflammation, which activated TLR4-MyD88-NF-\u0026kappa;B pathway and led to liver inflammation, thereby further promoting liver injury.\u003c/p\u003e\n\u003cp\u003eMultiply studies have reported the relationship between BAs and gut microbiota in recent years\u003csup\u003e53-55\u003c/sup\u003e. BAs could control the growth and distribution of gut microbiota and influence intestinal barrier function. Previous results have shown that an increase in CA contributes to impaired gut barrier function\u003csup\u003e56\u003c/sup\u003e. Moreover, primary BAs synthesized in the liver are metabolized in the gut into secondary BAs. Studies have shown that gut microflora can affect the size and composition of the BAs pool within the enterohepatic system\u003csup\u003e57\u003c/sup\u003e. In this study, changes in gut microbiota after LPS+VCZ treatment were tested, indicating VCZ caused disturbances in the intestinal flora. \u003cem\u003eBacteroides\u003c/em\u003e can produce bile salt hydrolase, which mediates the hydrolytic transformation of primary BAs\u003csup\u003e58\u003c/sup\u003e. Studies have shown that the abundance of \u003cem\u003eBacteroides\u003c/em\u003e increased in \u0026alpha;-naphthyl isothiocyanate induced cholestatic model rats, and that down-regulation of \u003cem\u003eBacteroides\u003c/em\u003e was positively correlated with reduced secondary BAs\u003csup\u003e59\u003c/sup\u003e. Consistently, we found that \u003cem\u003eBacteroides\u003c/em\u003e were heavily expanded in the LPS+VCZ group, and that increased numbers of \u003cem\u003eBacteroides\u003c/em\u003e and \u003cem\u003eAlloprevotella\u003c/em\u003e were positively correlated with increased BAs content. In addition, alterations in \u003cem\u003eAlloprevotella\u003c/em\u003e are often observed in intestinal injury diseases\u003csup\u003e60-62\u003c/sup\u003e, and its increase in the LPS+VCZ group suggested the occurrence of intestinal injury. \u003cem\u003eSutterella\u003c/em\u003e is widely distributed in the human gastrointestinal tract. Previous studies have considered that the increase of \u003cem\u003eSutterella\u003c/em\u003e is associated with human diseases, such as inflammatory bowel disease, gastrointestinal diseases and type 2 diabetes mellitus\u003csup\u003e63-66\u003c/sup\u003e. Similarly, in our study, LEfSe analysis showed that \u003cem\u003eSutterella\u003c/em\u003e and \u003cem\u003eBacteroides\u003c/em\u003e were the dominant bacteria following LPS+VCZ treatment, which corresponded to a more severe inflammatory response and liver injury in the LPS+VCZ group. However, there were also some contrasting findings suggesting that \u003cem\u003eSutterella\u003c/em\u003e and \u003cem\u003eBacteroides\u003c/em\u003e were less abundant in patients with nonalcoholic fatty liver disease\u003csup\u003e67\u003c/sup\u003e. In other words, they were negatively correlated with the development of the disease. Overall, the microbiota analysis results showed that VCZ under LPS induction induced dysbiosis of the microbiota in rats, which was associated with BAs changes, indicating that VCZ could cause liver injury by regulating BAs metabolism and gut microbiota.\u003c/p\u003e\n\u003cp\u003eThe intestinal barrier is affected by the imbalance of BAs and gut microbiota\u003csup\u003e68\u003c/sup\u003e. The mechanisms by which BAs affect intestinal barrier function are highly complex. They can regulate the death and apoptosis of intestinal epithelial cells through signaling pathways, regulate the expression of tight junction proteins, or affect the secretion of mucus or cytokines in intestinal epithelial cells\u003csup\u003e69\u003c/sup\u003e. Furthermore, the gut microbiome can affect immune system development and modulate immune mediators, thereby affecting the intestinal barrier\u003csup\u003e70\u003c/sup\u003e. Intestinal tight junction proteins, including Occludin, Claudins and ZOs, connect the transmembrane skeleton or form membrane protein complexes, thereby building the intestinal epithelial barrier together\u003csup\u003e71\u003c/sup\u003e. When the function of tight junction proteins is altered, their ability to maintain the intestinal barrier is also compromised. In our study, LPS+VCZ administration significantly decreased the protein level of Occludin (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05), while ZO-1 and claudin-1 were decreased but not significantly. These results suggest that VCZ, under LPS induction, disrupts the balance of gut microbiota. This imbalance disrupted the intestinal barrier, increased intestinal permeability, and consequently led to the translocation of bacteria and toxins from the gut to the liver, thereby causing further liver damage.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn conclusion, this study indicated that VCZ, under LPS induction, induced liver injury in SD rats by regulating BAs metabolism and gut microbiota, with the TLR4-MyD88-NF-\u0026kappa;B pathway involved in the inflammatory signal transduction induced by BAs accumulation. Specifically, LPS+VCZ upregulated the expression of CYP7A1 and downregulated that of BSEP, MRP2, TGR5, FXR, CAR, PXR and VDR, thereby increasing BAs synthesis, inhibiting excretion, and causing hepatic BAs accumulation. In addition, LPS+VCZ administration increased the abundance of intestinal flora, such as \u003cem\u003eBacteroides\u003c/em\u003e, \u003cem\u003eAlloprevotella\u003c/em\u003e and \u003cem\u003eSutterella\u003c/em\u003e, which are related to inflammation, BAs regulation or intestinal injury, thereby leading to intestinal barrier damage and exacerbating liver injury. However, this study has some limitations. First, the comprehensive assessment of VCZ-induced liver injury within an inflammatory context remains limited in our current evaluation. Our exploration predominantly focused on biochemical indicators of liver function, but there was no more direct biomarker to determine the degree of liver injury. Further research is needed to determine whether the altered BAs can serve as biomarkers for VCZ-induced liver injury. Second, our study utilized a limited scope of available models, focusing primarily on the widely employed rat model. Future investigations will encompass a broader array of models for validation, including the development of gene knockout rat models, intestinal microbiota transplantation models and gene-silenced cell models. In summary, the present study reveals that VCZ-induced liver injury involves a complex pathway from cholestasis to gut microbiota, with the increase of CDCA, GCDCA, DCA, TDCA in BAs and the increase of \u003cem\u003eBacteroides\u003c/em\u003e and \u003cem\u003eIsoprevotella\u003c/em\u003e in the gut serving as additional evidence for VCZ-induced liver injury. Reducing the level of inflammation in patients or regulating their intestinal flora may play a role in the prevention and treatment of liver injury, which may initially provide new ideas for the diagnosis, prevention and treatment of VCZ-induced liver injury in the future.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eAll authors declare that they have no financial or competing interest.\u003c/p\u003e\n\u003cp\u003eConflict of interests\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have no conflict of interest to disclose.\u003c/p\u003e\n\u003cp\u003eCRediT author statement (Authors\u0026rsquo; contributions)\u003c/p\u003e\n\u003cp\u003eHongan Zeng: Data curation; Formal analysis; Investigation; Methodology; Writing - original draft; and Writing - review \u0026amp; editing\u003c/p\u003e\n\u003cp\u003eLiping Xiang: Investigation; Methodology; Software; Project administration; Resources; and Writing - review \u0026amp; editing\u003c/p\u003e\n\u003cp\u003eWeijing Gong: Investigation; Methodology; Software; Project administration; Resources; and Writing - review \u0026amp; editing\u003c/p\u003e\n\u003cp\u003eBingyu Cheng: Conceptualization; and Data curation\u003c/p\u003e\n\u003cp\u003eXinxin Zhu: Project administration; and Resources\u003c/p\u003e\n\u003cp\u003eLuqin Si: Validation; and Visualization\u003c/p\u003e\n\u003cp\u003eJiangeng Huang: Methodology; Project administration; Funding acquisition; and Supervision\u003c/p\u003e\n\u003cp\u003eSanlan Wu: Funding acquisition; Project administration; Supervision; and Writing - review \u0026amp; editing\u003c/p\u003e\n\u003cp\u003eEthical standards\u003c/p\u003e\n\u003cp\u003eAll animal studies have been approved by the appropriate ethics committee and have therefore been performed in accordance with the ethical standards laid down in the 1964 Declaration of Helsinki and its later amendments. The manuscript does not contain clinical studies or patient data. Approval was granted by the Ethics Committee of Huazhong University of Science and Technology. (No. 3157).\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis study was supported by the National Natural Science Foundation of China (81803619, 81302837); Hubei Province health and family planning scientific research project (WJ2017M118); and Major Basic Research Development Program of Hubei Province (2020BCB045).\u003c/p\u003e\n\u003cp\u003eAcknowledgment\u003c/p\u003e\n\u003cp\u003eWe sincerely wish to thank all members for participating in this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eData availability\u003c/p\u003e\n\u003cp\u003eData is provided within the manuscript or supplementary information files.\u003c/p\u003e\n\u003cp\u003eStatement\u003c/p\u003e\n\u003cp\u003eWe confirm that this study was reported in accordance with the ARRIVE guidelines.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLo Re, V\u003cem\u003e et al.\u003c/em\u003e Oral Azole Antifungal Medications and Risk of Acute Liver Injury, Overall and by Chronic Liver Disease Status. \u003cem\u003eAmerican Journal of Medicine\u003c/em\u003e \u003cstrong\u003e129\u003c/strong\u003e, 283-91.e5, doi:10.1016/j.amjmed.2015.10.029 (2016).\u003c/li\u003e\n\u003cli\u003eCosta-Pinto, R\u003cem\u003e et al.\u003c/em\u003e Assessing the safety profile of voriconazole use in suspected COVID-19-associated pulmonary aspergillosis-a two-centre observational study. \u003cem\u003eMedical Mycology\u003c/em\u003e \u003cstrong\u003e61\u003c/strong\u003e, myad054, doi:ARTN myad05410.1093/mmy/myad054 (2023).\u003c/li\u003e\n\u003cli\u003eKong, XH, Guo, DH, Liu, SY, Zhu, Y \u0026amp; Yu, CX. Incidence, characteristics and risk factors for drug-induced liver injury in hospitalized patients: A matched case-control study. \u003cem\u003eBritish Journal of Clinical Pharmacology\u003c/em\u003e \u003cstrong\u003e87\u003c/strong\u003e, 4304-4312, doi:10.1111/bcp.14847 (2021).\u003c/li\u003e\n\u003cli\u003eMihăilă, R-G. Voriconazole and the liver. \u003cem\u003eWorld Journal of Hepatology\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 1828-1833, doi:10.4254/wjh.v7.i14.1828 (2015).\u003c/li\u003e\n\u003cli\u003eSol\u0026iacute;s-Mu\u0026ntilde;oz, P\u003cem\u003e et al.\u003c/em\u003e Voriconazole hepatotoxicity in severe liver dysfunction. \u003cem\u003eJournal of Infection\u003c/em\u003e \u003cstrong\u003e66\u003c/strong\u003e, 80-86, doi:10.1016/j.jinf.2012.09.011 (2013).\u003c/li\u003e\n\u003cli\u003eShi, CC, Xiao, YB, Mao, Y, Wu, J \u0026amp; Lin, NM. Voriconazole: A Review of Population Pharmacokinetic Analyses. \u003cem\u003eClinical Pharmacokinetics\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e, 687-703, doi:10.1007/s40262-019-00735-7 (2019).\u003c/li\u003e\n\u003cli\u003eAiuchi, N\u003cem\u003e et al.\u003c/em\u003e Impact of polymorphisms of pharmacokinetics-related genes and the inflammatory response on the metabolism of voriconazole. \u003cem\u003ePharmacol Res Perspe\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, e00935, doi:ARTN e0093510.1002/prp2.935 (2022).\u003c/li\u003e\n\u003cli\u003eRoth, RA \u0026amp; Ganey, PE. Intrinsic versus Idiosyncratic Drug-Induced Hepatotoxicity\u0026mdash;Two Villains or One? \u003cem\u003eJournal of Pharmacology and Experimental Therapeutics\u003c/em\u003e \u003cstrong\u003e332\u003c/strong\u003e, 692-697, doi:10.1124/jpet.109.162651 (2010).\u003c/li\u003e\n\u003cli\u003eUetrecht, J. Mechanistic Studies of Idiosyncratic DILI: Clinical Implications. \u003cem\u003eFrontiers in Pharmacology\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 837, doi:ARTN 83710.3389/fphar.2019.00837 (2019).\u003c/li\u003e\n\u003cli\u003eCai, XP\u003cem\u003e et al.\u003c/em\u003e Molecular pathogenesis of acetaminophen-induced liver injury and its treatment options. \u003cem\u003eJournal of Zhejiang University-Science B\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 265-285, doi:10.1631/jzus.B2100977 (2022).\u003c/li\u003e\n\u003cli\u003eWoolbright, BL \u0026amp; Jaeschke, H. Role of the inflammasome in acetaminophen-induced liver injury and acute liver failure. \u003cem\u003eJournal of Hepatology\u003c/em\u003e \u003cstrong\u003e66\u003c/strong\u003e, 836-848, doi:10.1016/j.jhep.2016.11.017 (2017).\u003c/li\u003e\n\u003cli\u003eGaney, PE, Luyendyk, JP, Maddox, JF \u0026amp; Roth, RA. Adverse hepatic drug reactions: inflammatory episodes as consequence and contributor. \u003cem\u003eChemico-Biological Interactions\u003c/em\u003e \u003cstrong\u003e150\u003c/strong\u003e, 35-51, doi:10.1016/j.cbi.2004.09.002 (2004).\u003c/li\u003e\n\u003cli\u003eLuyendyk, JP\u003cem\u003e et al.\u003c/em\u003e Ranitidine treatment during a modest inflammatory response precipitates idiosyncrasy-like liver injury in rats. \u003cem\u003eJournal of Pharmacology and Experimental Therapeutics\u003c/em\u003e \u003cstrong\u003e307\u003c/strong\u003e, 9-16, doi:10.1124/jpet.103.054288 (2003).\u003c/li\u003e\n\u003cli\u003eRamm, S\u003cem\u003e et al.\u003c/em\u003e Application of a discovery to targeted LC-MS proteomics approach to identify deregulated proteins associated with idiosyncratic liver toxicity in a rat model of LPS/diclofenac co-administration. \u003cem\u003eToxicology\u003c/em\u003e \u003cstrong\u003e331\u003c/strong\u003e, 100-111, doi:10.1016/j.tox.2015.03.004 (2015).\u003c/li\u003e\n\u003cli\u003eGandhi, A, Guo, T, Shah, P, Moorthy, B \u0026amp; Ghose, R. Chlorpromazine-induced hepatotoxicity during inflammation is mediated by TIRAP-dependent signaling pathway in mice. \u003cem\u003eToxicology and Applied Pharmacology\u003c/em\u003e \u003cstrong\u003e266\u003c/strong\u003e, 430-438, doi:10.1016/j.taap.2012.11.030 (2013).\u003c/li\u003e\n\u003cli\u003eShaw, PJ, Ganey, PE \u0026amp; Roth, RA. Trovafloxacin Enhances the Inflammatory Response to a Gram-Negative or a Gram-Positive Bacterial Stimulus, Resulting in Neutrophil-Dependent Liver Injury in Mice. \u003cem\u003eJournal of Pharmacology and Experimental Therapeutics\u003c/em\u003e \u003cstrong\u003e330\u003c/strong\u003e, 72-78, doi:10.1124/jpet.109.151068 (2009).\u003c/li\u003e\n\u003cli\u003eLu, JT, Jones, AD, Harkema, JR, Roth, RA \u0026amp; Ganey, PE. Amiodarone Exposure During Modest Inflammation Induces Idiosyncrasy-like Liver Injury in Rats: Role of Tumor Necrosis Factor-alpha. \u003cem\u003eToxicological Sciences\u003c/em\u003e \u003cstrong\u003e125\u003c/strong\u003e, 126-133, doi:10.1093/toxsci/kfr266 (2012).\u003c/li\u003e\n\u003cli\u003eMohammed, Y, Abousamra, A, Abdeldayem, AAI, Zafar, M \u0026amp; Muhammad, T. Voriconazole-Induced Cholestatic Hepatotoxicity in an Immune Competent Patient. \u003cem\u003eCureus Journal of Medical Science\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, e21346, doi:ARTN e2134610.7759/cureus.21346 (2022).\u003c/li\u003e\n\u003cli\u003eChatterjee, S \u0026amp; Annaert, P. Drug-induced Cholestasis: Mechanisms, Models, and Markers. \u003cem\u003eCurrent Drug Metabolism\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 808-818, doi:10.2174/1389200219666180427165035 (2018).\u003c/li\u003e\n\u003cli\u003eFern\u0026aacute;ndez-Murga, ML\u003cem\u003e et al.\u003c/em\u003e Advances in drug-induced cholestasis: Clinical perspectives, potential mechanisms and systems. \u003cem\u003eFood and Chemical Toxicology\u003c/em\u003e \u003cstrong\u003e120\u003c/strong\u003e, 196-212, doi:10.1016/j.fct.2018.07.017 (2018).\u003c/li\u003e\n\u003cli\u003eKriaa, A\u003cem\u003e et al.\u003c/em\u003e Microbial impact on cholesterol and bile acid metabolism: current status and future prospects. \u003cem\u003eJournal of Lipid Research\u003c/em\u003e \u003cstrong\u003e60\u003c/strong\u003e, 323-332, doi:10.1194/jlr.R088989 (2019).\u003c/li\u003e\n\u003cli\u003eNoh, K\u003cem\u003e et al.\u003c/em\u003e Impact of gut microbiota on drug metabolism: an update for safe and effective use of drugs. \u003cem\u003eArchives of Pharmacal Research\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 1345-1355, doi:10.1007/s12272-017-0986-y (2017).\u003c/li\u003e\n\u003cli\u003eSabino, J\u003cem\u003e et al.\u003c/em\u003e Primary sclerosing cholangitis is characterised by intestinal dysbiosis independent from IBD. \u003cem\u003eGut\u003c/em\u003e \u003cstrong\u003e65\u003c/strong\u003e, 1681-1689, doi:10.1136/gutjnl-2015-311004 (2016).\u003c/li\u003e\n\u003cli\u003eIsaacs-Ten, A\u003cem\u003e et al.\u003c/em\u003e Intestinal Microbiome-Macrophage Crosstalk Contributes to Cholestatic Liver Disease by Promoting Intestinal Permeability in Mice. \u003cem\u003eHepatology\u003c/em\u003e \u003cstrong\u003e72\u003c/strong\u003e, 2090-2108, doi:10.1002/hep.31228 (2020).\u003c/li\u003e\n\u003cli\u003eSun, JY\u003cem\u003e et al.\u003c/em\u003e Gut Microbiota Participates in Antithyroid Drug Induced Liver Injury Through the Lipopolysaccharide Related Signaling Pathway. \u003cem\u003eFrontiers in Pharmacology\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 598170, doi:ARTN 59817010.3389/fphar.2020.598170 (2020).\u003c/li\u003e\n\u003cli\u003eYip, LY\u003cem\u003e et al.\u003c/em\u003e The liver-gut microbiota axis modulates hepatotoxicity of tacrine in the rat. \u003cem\u003eHepatology\u003c/em\u003e \u003cstrong\u003e67\u003c/strong\u003e, 282-295, doi:10.1002/hep.29327 (2018).\u003c/li\u003e\n\u003cli\u003eGong, SH\u003cem\u003e et al.\u003c/em\u003e Intestinal Microbiota Mediates the Susceptibility to Polymicrobial Sepsis-Induced Liver Injury by Granisetron Generation in Mice. \u003cem\u003eHepatology\u003c/em\u003e \u003cstrong\u003e69\u003c/strong\u003e, 1751-1767, doi:10.1002/hep.30361 (2019).\u003c/li\u003e\n\u003cli\u003eGong, SH\u003cem\u003e et al.\u003c/em\u003e Gut microbiota mediates diurnal variation of acetaminophen induced acute liver injury in mice. \u003cem\u003eJournal of Hepatology\u003c/em\u003e \u003cstrong\u003e69\u003c/strong\u003e, 51-59, doi:10.1016/j.jhep.2018.02.024 (2018).\u003c/li\u003e\n\u003cli\u003eVanstraelen, K\u003cem\u003e et al.\u003c/em\u003e Impact of Hypoalbuminemia on Voriconazole Pharmacokinetics in Critically Ill Adult Patients. \u003cem\u003eAntimicrobial Agents and Chemotherapy\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e, 6782-6789, doi:10.1128/Aac.03641-14 (2014).\u003c/li\u003e\n\u003cli\u003eLiu, XY\u003cem\u003e et al.\u003c/em\u003e Significance of monitoring plasma concentration of voriconazole in a patient with liver failure: A case report. \u003cem\u003eMedicine\u003c/em\u003e \u003cstrong\u003e96\u003c/strong\u003e, e8039, doi:ARTN e803910.1097/MD.0000000000008039 (2017).\u003c/li\u003e\n\u003cli\u003eWu, SL, Cheng, CN, Wang, CC, Lin, SW \u0026amp; Kuo, CH. Metabolomics analysis of plasma reveals voriconazole-induced hepatotoxicity is associated with oxidative stress. \u003cem\u003eToxicology and Applied Pharmacology\u003c/em\u003e \u003cstrong\u003e403\u003c/strong\u003e, 115157, doi:ARTN 11515710.1016/j.taap.2020.115157 (2020).\u003c/li\u003e\n\u003cli\u003eDu, Q\u003cem\u003e et al.\u003c/em\u003e Metabolic characteristics of voriconazole - Induced liver injury in rats. \u003cem\u003eChemico-Biological Interactions\u003c/em\u003e \u003cstrong\u003e383\u003c/strong\u003e, 110693, doi:ARTN 11069310.1016/j.cbi.2023.110693 (2023).\u003c/li\u003e\n\u003cli\u003eXu, K\u003cem\u003e et al.\u003c/em\u003e Gender effect of hyperuricemia on the development of nonalcoholic fatty liver disease (NAFLD): A clinical analysis and mechanistic study. \u003cem\u003eBiomed Pharmacother\u003c/em\u003e \u003cstrong\u003e117\u003c/strong\u003e, 109158, doi:10.1016/j.biopha.2019.109158 (2019).\u003c/li\u003e\n\u003cli\u003ePata, R, Dolkar, T, Patel, M \u0026amp; Nway, N. Voriconazole-Induced Acute Liver Injury: A Case Report. \u003cem\u003eCureus Journal of Medical Science\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, e20115, doi:ARTN e2011510.7759/cureus.20115 (2021).\u003c/li\u003e\n\u003cli\u003eCelik, IH\u003cem\u003e et al.\u003c/em\u003e Compassionate use of voriconazole in newborn infants diagnosed with severe invasive fungal sepsis. \u003cem\u003eEuropean Review for Medical and Pharmacological Sciences\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 729-734 (2013).\u003c/li\u003e\n\u003cli\u003eLi, M, Cai, SY \u0026amp; Boyer, JL. Mechanisms of bile acid mediated inflammation in the liver. \u003cem\u003eMolecular Aspects of Medicine\u003c/em\u003e \u003cstrong\u003e56\u003c/strong\u003e, 45-53, doi:10.1016/j.mam.2017.06.001 (2017).\u003c/li\u003e\n\u003cli\u003eZarrinpar, A\u003cem\u003e et al.\u003c/em\u003e Antibiotic-induced microbiome depletion alters metabolic homeostasis by affecting gut signaling and colonic metabolism. \u003cem\u003eNature Communications\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 2872, doi:ARTN 287210.1038/s41467-018-05336-9 (2018).\u003c/li\u003e\n\u003cli\u003eXu, Y\u003cem\u003e et al.\u003c/em\u003e Farnesoid X receptor activation increases reverse cholesterol transport by modulating bile acid composition and cholesterol absorption in mice. \u003cem\u003eHepatology\u003c/em\u003e \u003cstrong\u003e64\u003c/strong\u003e, 1072-1085, doi:10.1002/hep.28712 (2016).\u003c/li\u003e\n\u003cli\u003eYuan, ZQ \u0026amp; Li, KW. Role of farnesoid X receptor in cholestasis. \u003cem\u003eJournal of Digestive Diseases\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 501-509, doi:10.1111/1751-2980.12378 (2016).\u003c/li\u003e\n\u003cli\u003eQiu, X\u003cem\u003e et al.\u003c/em\u003e Disruption of BSEP Function in HepaRG Cells Alters Bile Acid Disposition and Is a Susceptive Factor to Drug-Induced Cholestatic Injury. \u003cem\u003eMol Pharmaceut\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 1206-1216, doi:10.1021/acs.molpharmaceut.5b00659 (2016).\u003c/li\u003e\n\u003cli\u003eJia, W, Xie, GX \u0026amp; Jia, WP. Bile acid-microbiota crosstalk in gastrointestinal inflammation and carcinogenesis. \u003cem\u003eNature Reviews Gastroenterology \u0026amp; Hepatology\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 111-128, doi:10.1038/nrgastro.2017.119 (2018).\u003c/li\u003e\n\u003cli\u003eReich, M\u003cem\u003e et al.\u003c/em\u003e Role of the G Protein-Coupled Bile Acid Receptor TGR5 in Liver Damage. \u003cem\u003eDigestive Diseases\u003c/em\u003e \u003cstrong\u003e35\u003c/strong\u003e, 235-240, doi:10.1159/000450917 (2017).\u003c/li\u003e\n\u003cli\u003eStaudinger, JL\u003cem\u003e et al.\u003c/em\u003e The nuclear receptor PXR is a lithocholic acid sensor that protects against liver toxicity. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, 3369-3374, doi:DOI 10.1073/pnas.051551698 (2001).\u003c/li\u003e\n\u003cli\u003eStedman, CAM\u003cem\u003e et al.\u003c/em\u003e Nuclear receptors constitutive androstane receptor and pregnane X receptor ameliorate cholestatic liver injury. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e \u003cstrong\u003e102\u003c/strong\u003e, 2063-2068, doi:DOI 10.1073/pnas.0409794102 (2005).\u003c/li\u003e\n\u003cli\u003eNishida, S, Ozeki, J \u0026amp; Makishima, M. Modulation of Bile Acid Metabolism by 1\u0026alpha;-Hydroxyvitamin D Administration in Mice. \u003cem\u003eDrug Metabolism and Disposition\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 2037-2044, doi:10.1124/dmd.109.027334 (2009).\u003c/li\u003e\n\u003cli\u003eThomas, C, Pellicciari, R, Pruzanski, M, Auwerx, J \u0026amp; Schoonjans, K. Targeting bile-acid signalling for metabolic diseases. \u003cem\u003eNature Reviews Drug Discovery\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 678-693, doi:10.1038/nrd2619 (2008).\u003c/li\u003e\n\u003cli\u003eNu\u0026ntilde;o-L\u0026aacute;mbarri, N\u003cem\u003e et al.\u003c/em\u003e Liver Cholesterol Overload Aggravates Obstructive Cholestasis by Inducing Oxidative Stress and Premature Death in Mice. \u003cem\u003eOxidative Medicine and Cellular Longevity\u003c/em\u003e \u003cstrong\u003e2016\u003c/strong\u003e, 9895176, doi:Artn 989517610.1155/2016/9895176 (2016).\u003c/li\u003e\n\u003cli\u003eWoolbright, BL \u0026amp; Jaeschke, H. Inflammation and Cell Death During Cholestasis: The Evolving Role of Bile Acids. \u003cem\u003eGene Expression-the Journal of Liver Research\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 215-228, doi:10.3727/105221619x15614873062730 (2019).\u003c/li\u003e\n\u003cli\u003eLi, WK\u003cem\u003e et al.\u003c/em\u003e Protective effect of herbal medicine Huangqi decoction against chronic cholestatic liver injury by inhibiting bile acid-stimulated inflammation in DDC-induced mice. \u003cem\u003ePhytomedicine\u003c/em\u003e \u003cstrong\u003e62\u003c/strong\u003e, 152948, doi:ARTN 15294810.1016/j.phymed.2019.152948 (2019).\u003c/li\u003e\n\u003cli\u003eLiu, J\u003cem\u003e et al.\u003c/em\u003e Allopurinol Protects Against Cholestatic Liver Injury in Mice Not Through Depletion of Uric Acid. \u003cem\u003eToxicological Sciences\u003c/em\u003e \u003cstrong\u003e181\u003c/strong\u003e, 295-305, doi:10.1093/toxsci/kfab034 (2021).\u003c/li\u003e\n\u003cli\u003eWu, J-S\u003cem\u003e et al.\u003c/em\u003e Quantitative Proteomics Reveals the Protective Effects of Huangqi Decoction Against Acute Cholestatic Liver Injury by Inhibiting the NF-\u0026kappa;B/IL-6/STAT3 Signaling Pathway. \u003cem\u003eJournal of Proteome Research\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 677-687, doi:10.1021/acs.jproteome.9b00563 (2019).\u003c/li\u003e\n\u003cli\u003eBertolini, A, Fiorotto, R \u0026amp; Strazzabosco, M. Bile acids and their receptors: modulators and therapeutic targets in liver inflammation. \u003cem\u003eSeminars in Immunopathology\u003c/em\u003e \u003cstrong\u003e44\u003c/strong\u003e, 547-564, doi:10.1007/s00281-022-00935-7 (2022).\u003c/li\u003e\n\u003cli\u003eHu, H\u003cem\u003e et al.\u003c/em\u003e Gut microbiota promotes cholesterol gallstone formation by modulating bile acid composition and biliary cholesterol secretion. \u003cem\u003eNature Communications\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 252, doi:ARTN 25210.1038/s41467-021-27758-8 (2022).\u003c/li\u003e\n\u003cli\u003eFunabashi, M\u003cem\u003e et al.\u003c/em\u003e A metabolic pathway for bile acid dehydroxylation by the gut microbiome. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e582\u003c/strong\u003e, 566-570, doi:10.1038/s41586-020-2396-4 (2020).\u003c/li\u003e\n\u003cli\u003eYang, M\u003cem\u003e et al.\u003c/em\u003e Bile Acid-Gut Microbiota Axis in Inflammatory Bowel Disease: From Bench to Bedside. \u003cem\u003eNutrients\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 3143, doi:ARTN 314310.3390/nu13093143 (2021).\u003c/li\u003e\n\u003cli\u003eChen, L\u003cem\u003e et al.\u003c/em\u003e Hepatic cytochrome P450 8B1 and cholic acid potentiate intestinal epithelial injury in colitis by suppressing intestinal stem cell renewal. \u003cem\u003eCell Stem Cell\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 1366-1381, doi:10.1016/j.stem.2022.08.008 (2022).\u003c/li\u003e\n\u003cli\u003eSayin, SI\u003cem\u003e et al.\u003c/em\u003e Gut Microbiota Regulates Bile Acid Metabolism by Reducing the Levels of Tauro-beta-muricholic Acid, a Naturally Occurring FXR Antagonist. \u003cem\u003eCell Metabolism\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 225-235, doi:10.1016/j.cmet.2013.01.003 (2013).\u003c/li\u003e\n\u003cli\u003eG\u0026eacute;rard, P. Metabolism of Cholesterol and Bile Acids by the Gut Microbiota. \u003cem\u003ePathogens\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 14-24, doi:10.3390/pathogens3010014 (2013).\u003c/li\u003e\n\u003cli\u003eXu, JJ\u003cem\u003e et al.\u003c/em\u003e Paeoniae Radix Rubra can enhance fatty acid \u0026beta;-oxidation and alleviate gut microbiota disorder in \u0026alpha;-naphthyl isothiocyanate induced cholestatic model rats. \u003cem\u003eFrontiers in Pharmacology\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 1002922, doi:ARTN 100292210.3389/fphar.2022.1002922 (2022).\u003c/li\u003e\n\u003cli\u003eWang, KL\u003cem\u003e et al.\u003c/em\u003e Gut microbiota disorder caused by diterpenoids extracted from aggravates intestinal mucosal damage. \u003cem\u003ePharmacology Research \u0026amp; Perspectives\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, e00765, doi:ARTN e0076510.1002/prp2.765 (2021).\u003c/li\u003e\n\u003cli\u003eWang, C-S-E\u003cem\u003e et al.\u003c/em\u003e VSL#3 can prevent ulcerative colitis-associated carcinogenesis in mice. \u003cem\u003eWorld Journal of Gastroenterology\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 4254-4262, doi:10.3748/wjg.v24.i37.4254 (2018).\u003c/li\u003e\n\u003cli\u003eHuang, L\u003cem\u003e et al.\u003c/em\u003e 5-Aminosalicylic acid ameliorates dextran sulfate sodium-induced colitis in mice by modulating gut microbiota and bile acid metabolism. \u003cem\u003eCell Mol Life Sci\u003c/em\u003e \u003cstrong\u003e79\u003c/strong\u003e, 460, doi:ARTN 46010.1007/s00018-022-04471-3 (2022).\u003c/li\u003e\n\u003cli\u003eHiippala, K, Kainulainen, V, Kalliom\u0026auml;ki, M, Arkkila, P \u0026amp; Satokari, R. Mucosal Prevalence and Interactions with the Epithelium Indicate Commensalism of spp. \u003cem\u003eFront Microbiol\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 1706, doi:ARTN 170610.3389/fmicb.2016.01706 (2016).\u003c/li\u003e\n\u003cli\u003eOkamoto, K\u003cem\u003e et al.\u003c/em\u003e Dysbiosis-Associated Polyposis of the Colon-Cap Polyposis. \u003cem\u003eFront Immunol\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 918, doi:ARTN 91810.3389/fimmu.2018.00918 (2018).\u003c/li\u003e\n\u003cli\u003eParamsothy, S\u003cem\u003e et al.\u003c/em\u003e Specific Bacteria and Metabolites Associated With Response to Fecal Microbiota Transplantation in Patients With Ulcerative Colitis. \u003cem\u003eGastroenterology\u003c/em\u003e \u003cstrong\u003e156\u003c/strong\u003e, 1440-1454.e2, doi:10.1053/j.gastro.2018.12.001 (2019).\u003c/li\u003e\n\u003cli\u003ePircalabioru, GG\u003cem\u003e et al.\u003c/em\u003e Snapshot into the Type-2-Diabetes-Associated Microbiome of a Romanian Cohort. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 15023, doi:ARTN 1502310.3390/ijms232315023 (2022).\u003c/li\u003e\n\u003cli\u003eDel Chierico, F\u003cem\u003e et al.\u003c/em\u003e Gut Microbiota Profiling of Pediatric Nonalcoholic Fatty Liver Disease and Obese Patients Unveiled by an Integrated Meta-omics-Based Approach. \u003cem\u003eHepatology\u003c/em\u003e \u003cstrong\u003e65\u003c/strong\u003e, 451-464, doi:10.1002/hep.28572 (2017).\u003c/li\u003e\n\u003cli\u003eMilosevic, I\u003cem\u003e et al.\u003c/em\u003e Gut-Liver Axis, Gut Microbiota, and Its Modulation in the Management of Liver Diseases: A Review of the Literature. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 395, doi:ARTN 39510.3390/ijms20020395 (2019).\u003c/li\u003e\n\u003cli\u003eHegyi, P, Mal\u0026eacute;th, J, Walters, JR, Hofmann, AF \u0026amp; Keely, SJ. Guts and Gall: Bile Acids in Regulation of Intestinal Epithelial Function in Health and Disease. \u003cem\u003ePhysiol Rev\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, 1983-2023, doi:10.1152/physrev.00054.2017 (2018).\u003c/li\u003e\n\u003cli\u003eTakiishi, T, Fenero, CIM \u0026amp; C\u0026acirc;mara, NOS. Intestinal barrier and gut microbiota: Shaping our immune responses throughout life. \u003cem\u003eTissue Barriers\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, e1373208, doi:10.1080/21688370.2017.1373208 (2017).\u003c/li\u003e\n\u003cli\u003eHeinemann, U \u0026amp; Schuetz, A. Structural Features of Tight-Junction Proteins. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 6020, doi:ARTN 602010.3390/ijms20236020 (2019).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":false,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Drug-induced liver injury, Voriconazole, Gut microbiota, Cholestasis, FXR","lastPublishedDoi":"10.21203/rs.3.rs-7986820/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7986820/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Voriconazole (VCZ) is the first-line drug for invasive fungal infections. However, the growing concern regarding its hepatotoxicity necessitates a comprehensive understanding of the underlying mechanisms responsible for VCZ-induced liver injury. In this study, we found that rats treated with a nontoxic dose of lipopolysaccharides (LPS) and VCZ triggered liver injury, as demonstrated by increased serum biochemical indicators and swollen lesions of liver cells. Accordingly, the bile acid metabolism was disordered in the LPS+VCZ group, manifested as remarkable increases in primary bile acids (CDCA, GCDCA), secondary bile acids (DCA, TDCA), and total secondary bile acids in the liver. The species richness and diversity of the gut microbiota were reduced, with Bacteroides and Sutterella emerging as the dominant bacteria in the LPS+VCZ group. The increases in Bacteroides and Isoprevotella might be associated with VCZ-induced cholestatic liver injury. Furthermore, VCZ down-regulated the expression of BSEP, MRP2, and nuclear receptors and up-regulated the expression of bile acid synthetase CYP7A1. Meanwhile, it stimulated the TLR4-Myd88-NF-κB pathway, which promoted the release of inflammatory factors. In addition, the expression of ZO-1 and Occludin in the ileum was decreased in the LPS+VCZ group. These findings suggest that VCZ may induce liver injury by regulating bile acid metabolism and gut microbiota in the context of mild inflammation.","manuscriptTitle":"Synergistic Hepatotoxicity of Voriconazole and Mild Inflammation: Involvement of Bile Acid Dysregulation, Intestinal Dysbiosis, and TLR4 Pathway Activation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-17 13:39:31","doi":"10.21203/rs.3.rs-7986820/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"272939435250048461040022464307836222788","date":"2026-03-13T14:36:30+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-20T13:24:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"82625181025691174689115167740592514073","date":"2025-12-15T07:08:32+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-12T01:18:31+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-11-12T05:53:14+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-06T07:42:57+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-11-06T07:41:32+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"fc86b9cb-8333-4b70-8fc7-36319da2cb21","owner":[],"postedDate":"December 17th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":59645294,"name":"Health sciences/Diseases"},{"id":59645295,"name":"Health sciences/Gastroenterology"},{"id":59645296,"name":"Biological sciences/Microbiology"}],"tags":[],"updatedAt":"2025-12-17T13:39:31+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-17 13:39:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7986820","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7986820","identity":"rs-7986820","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}