Synergistic Effects of IL-16 and KRAS in Endometriosis with Emphasis on Oxidative Stress

In: Journal of Obstetrics, Gynecology and Cancer Research · 2026 · vol. 11(4) , pp. 358–366 · doi:10.24200/jogcr.11.4.358 · W7142974433
article OA: diamond CC0
AI-generated summary by gemini-2.5-flash-lite, 2026-06-13

This study found elevated IL-16 and KRAS gene expression, reduced antioxidant enzyme activity, and increased IL-6 levels in endometriosis, indicating their synergistic role in disease progression via oxidative stress and inflammation.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-13 · read from full text

This case-control study examined IL-16 and KRAS gene expression in 150 women diagnosed with endometriosis and 150 healthy controls, alongside oxidative stress markers and IL-6, using RT-PCR and immunoassays. The authors found significantly elevated IL-16 and KRAS gene expression in endometriosis cases versus controls, with KRAS as an independent predictor (P=0.002); oxidative stress was characterized by reduced SOD and glutathione peroxidase and decreased vitamin C, alongside higher IL-6 levels (>5.57 pg/mL; OR=7.91, P=0.032). The paper’s main limitation, as stated in its design description, is that measurements were based on case-control associations using blood-based markers rather than direct mechanistic experiments linking IL-16/KRAS to oxidative stress pathways. This paper is centrally about endometriosis — it focuses on IL-16 and KRAS gene expression and their association with oxidative stress and IL-6–related inflammatory changes in endometriosis.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Background & Objective: Endometriosis is characterized by the growth of endometrial-like tissue outside the uterus, leading to inflammation, pain, and infertility. Its pathogenesis involves genetic, immunological, and hormonal factors. This study examines the synergistic roles of IL‑16 and KRAS gene expression in endometriosis and their interaction with oxidative stress markers to identify potential biomarkers for targeted therapy.Materials & Methods: A case-control study was conducted with 300 subjects, including 150 cases diagnosed with endometriosis and 150 healthy controls. Gene expression levels of IL‑16 and KRAS were analyzed using real-time PCR. Oxidative stress markers, including Superoxide Dismutase (SOD), glutathione peroxidase, and vitamin C, along with the inflammatory cytokine IL‑6, were measured.Results: IL‑16 and KRAS gene expression levels were significantly elevated in cases compared with controls, with KRAS identified as an independent predictor (P=0.002). Oxidative stress markers demonstrated a marked reduction in SOD and glutathione peroxidase levels, accompanied by decreased vitamin C levels. Elevated IL‑6 levels (>5.57 pg/mL, OR=7.91, P=0.032) were associated with increased inflammation and oxidative stress related cellular damage.Conclusion: The findings indicate that IL‑16 and KRAS contribute to the progression of endometriosis through oxidative stress-mediated genetic alterations and inflammatory pathways. The study underscores the combined impact of oxidative imbalance, IL‑6 driven inflammation, and KRAS dysregulation in disease pathogenesis. Unlike previous research focusing on genetic polymorphisms, this study provides novel insights into gene expression patterns and their clinical implications. Further investigation into the mechanistic interactions among IL‑16, KRAS, and oxidative stress may aid in the development of targeted therapeutic strategies.
Full text 39,717 characters · extracted from oa-pdf · 7 sections · click to expand

Background

& Objective: Endometriosis is characterized by the growth of endometrial-like tissue outside the uterus, leading to inflammation, pain, and infertility. Its pathogenesis involves genetic, immunological, and hormonal factors. This study examines the synergistic roles of IL‑16 and KRAS gene expression in endometriosis and their interaction with oxidative stress markers to identify potential biomarkers for targeted therapy.

Materials

& Methods : A case -control study was conducted with 300 subjects, including 150 cases diagnosed with endometriosis and 150 healthy controls. Gene expression levels of IL‑16 and KRAS were analyzed using real-time PCR. Oxidative stress markers, including Superoxide Dismutase (SOD), glutathione peroxidase, and vitamin C, along with the inflammatory cytokine IL‑6, were measured.

Results

IL‑16 and KRAS gene expression levels were significantly elevated in cases compared with controls, with KRAS identified as an independent predictor (P=0.002). Oxidative stress markers demonstrated a marked reduction in SOD and glutathione peroxidase levels, accompanied by decreased vitamin C levels. Elevated IL‑6 levels (>5.57 pg/mL, OR=7.91, P=0.032) were associated with increased inflammation and oxidative stress related cellular damage.

Conclusion

The findings indicate that IL‑16 and KRAS contribute to the progression of endometriosis through oxidative stress -mediated genetic alterations and inflammatory pathways. The study underscores the combined impact of oxidative imbalance, IL‑6 driven inflammation, and KRAS dysregulation in disease pathogenesis. Unlike previous research focusing on genetic polymorphisms, this study provides novel insights into gene expression patterns and their clinical implications. Further investigation into th e mechanistic interactions among IL‑16, KRAS, and oxidative stress may aid in the development of targeted therapeutic strategies.

Keywords

Endometriosis , Genetic expression, IL-16, Inflammatory markers, KRAS, Oxidative stress Received: 2025/02/08 Accepted: 2025/03/18 Published Online: 23 Mar. 2026 Corresponding Information: Natrajan Muninathan, Central Research Laboratory, Meenakshi Medical College Hospital and Research Institute, Meenakshi Academy of Higher Education and Research (Deemed to be University), Kanchipuram, Tamil Nadu, India Email: [email protected] Dinesh Roy Divakaran, Deptartment of Cytogenetics, Genetika Centre for Advanced Genetic Studies, Thiruvananthapuram, Kerala, India Email: [email protected] Copyright © 2025, This is an original open -access article distributed under the terms of the Creative Commons Attribution-noncommercial 4.0 International License which permits copy and redistribution of the material just in noncommercial usages with proper citation . 1. Introduction The growth of tissue similar to the lining of the uterus outside the uterus is known as endometriosis, leading to inflammation, pain, and infertility. This condition is commonly attributed to retrograde menstruation (1). It affects approximately 6-10% of women worldwide, of whom 10% are of childbearing age, totaling 247 million individuals globally and 42 million in India alone (2). A variety of factors influence the development of endometriosis, including hormonal imbalances, immune system dysfunction, gen etic predisposition, surgical scars, and environmental toxins (3). Major contributors to the development and progression of endometriosis include variations in the KRAS and IL‑16 genes. 359 IL-16, KRAS, and Oxidative Stress in Endometriosise Volume 11, April 2026 Journal of Obstetrics, Gynecology and Cancer Research Interleukins are integral to endometriosis research, as they are key regulators of inflammation, autoimmunity, and immune modulation. Prostaglandin E, Tumor Necrosis Facto r‑α (TNF‑α), and proinflammatory cytokines such as Interleukins (IL‑1, IL‑6, IL‑10, and IL‑16) contribute to the development of endometriosis (4). Interleukin‑16 (IL‑16), a lymphocyte chemoattractant factor, plays a multifunctional role in immune and inflammatory responses. The pathogenesis of endometriosis is driven by the production of key proinflammatory cytokines, such as IL‑6, IL‑1β, and TNF‑α , by peripheral blood mononuclear cells. These cells are, in turn, stimulated by IL‑16 (5). Additionally, recent studies have identified the IL‑16 gene polymorphism rs11556218 as a potential genetic risk factor for endometriosis, suggesting that this variant may contribute to abnormal IL‑16 expression and heightened inflammation (6). KRAS (Kirsten rat sarcoma virus) is a critical oncogenic driver in human cancer and the most commonly mutated gene in the RAS family (7). It encodes a protein that regulates cell‑signaling pathways involved in cell proliferation, differentiation, and survival. KRAS mutations have been observed in endometriosis, indicating a possible role in disease pathogenesis (8). Yachida et al., (2021) confirmed the role of the KRAS p.G12V mutation in the progression of ovarian endometriosis and its association with elevated inflammation (9). Oxidative stress is a major factor in the pathophysiology of endometriosis, as it triggers a peritoneal inflammatory response. This stress results from an imbalance between Reactive Oxygen Species (ROS) production and the body’s antioxidant defense mechanisms. ROS, which are natural byproducts of oxygen metabolism, can cause cellular damage, initiate inflammation, and support the survival and proliferation of endometriotic lesions (10). Although ROS are normally neutralized by antioxidant systems such as superoxide dismutase, glutathione peroxidase, and vitamins C and E, an imbalance can lead to oxidative stress. Additionally, ROS production in the peritoneal cavity is enhanced by macrophages, erythrocytes, and apoptotic endometrial tissue resulting from ret rograde menstruation, thereby promoting the development of endometriosis (11). Both IL‑16 and KRAS play critical roles in pathways associated with oxidative stress and inflammation. Their interaction in endometriosis is an emerging area of research, and their potential synergistic effects may contribute to disease progression. This s tudy aims to investigate the combined influence of IL‑16 and KRAS in endometriosis, with a particular focus on oxidative stress. Understanding these interactions could provide deeper insights into disease pathogenesis and aid in the development of targeted therapeutic strategies. 2. Materials and Methods To focus on oxidative stress in patients with endometriosis, a case -control study was conducted to explore the synergistic effects of the IL‑16 and KRAS genes. The study was approved by the Institutional Ethics Committee of Genetika (03/2022/IECG), and informed consent was obtained from 300 participants, equally divided into 150 cases and 150 healthy controls to enhance statistical power. Sample collection was carried out in collaboration with Credence Hospital, Pran Fertility and Well Woman Centre, PRS Hos pital Pvt Ltd, Yana Women’s Hospital & Fertility Centre, and Genetika, Centre for Advanced Genetic Studies, Thiruvananthapuram, where the laboratory investigations were performed. Participants were aged between 20 and 45 years. Health controls had no history of chronic diseases, were not taking medications that affect oxidative stress or gene expression and provided informed consent. Endometriosis cases were diagnosed through clinical examination, laparoscopy, or imaging, had no prior treatment involving KRAS inhibitors or IL‑16 modulators, and provided informed consent. Exclusion criteria included a history of chronic diseases, current use of medications affecting oxidative stress o r gene expression, pregnancy, recent surgery or significant medical procedures within the last six months, and inability to provide informed consent. Data collection involved demographic, physiological, biochemical, and genetic parameters. Blood samples (8-10 mL) were collected and analyzed. Demographic and lifestyle information was obtained through face‑to‑face interviews using a detailed questionnaire. The sample size was calculated using the formula: Sample size= Z²pq/d², Where Z represents the standard normal deviation, p denotes prevalence, q is 1-p, and d indicates the degree of accuracy. The prevalence (p) was derived from existing literature, ensuring a reliable estimate and an adequate sample size for the study. Gene expression analysis of IL‑16 and KRAS was performed using RT‑PCR techniques with specific primers on the Bio‑Rad CFX Opus 96 Real‑Time PCR system. For the genetic assessment of the IL‑16 gene, a 20 μL PCR reaction mixture was prepared, containing 2× Real‑Time PCR Master Mix, primers, cDNA, and nuclease‑free water. Primers for IL‑16 and KRAS were designed by Eurofins Genomics India Pvt. Ltd. and validated for specificity. The IL‑16 primers were carefully selected and evaluated to ensure specificity. The forward primer (TTGGACACAGGGTTCTCGCTCA) was 22 bp in length, with a GC content of 54.55%, a melting temperature ™ of 62.12°C, an annealing temperature of 57°C, and a molecular weight of 6.726 g/mol. The reverse primer (AGCAGGGAGATAACGGACTGAC) was also 22 bp in length, with a GC content of 54.55%, a melting Deepthi S, et al. 360 Volume 11, April 2026 Journal of Obstetrics, Gynecology and Cancer Research temperature of 62.12°C, an annealing temperature of 57°C, and a molecular weight of 6.842 g/mol. The KRAS primers were designed to ensure specificity and efficiency in real‑time PCR analysis. The forward primer (CAGTAGACACAAAACAGGCTCAG) was 23 bp in length, with a GC content of 48%, a melting temperature ™ of 60.65°C, an annealing temperature of 53 °C, and a molecular weight of 7059.65 g/mol. The reverse primer (TGTCGGATCTCCCTCACCAATG) was 22 bp in length, with a GC content of 55%, a melting temperature of 62.12°C, an annealing temperature of 57°C, and a molecular weight of 6646.30 g/mol. The PCR steps included denaturation, annealing, and extension, followed by melt curve analysis. Gene expression levels were calculated using the 2⁻ΔΔCt method. Laboratory analyses included sandwich enzyme immunoassays for IL‑6, FSH, SOD, glutathione peroxi dase, LH, and SDHA, as well as a competitive inhibition enzyme immunoassay for vitamin C. 3. Results This study included 150 individuals diagnosed with endometriosis and 150 control subjects to assess the clinical, biochemical, hormonal, and genetic alterations associated with the disease. To better understand the

Background

characteristics of the study p opulation, a comparison was made between the 150 control subjects and the 150 cases. As summarized in Table 1, the two groups did not show any appreciable differences in baseline parameters, including age. Oxidative stress markers showed reduced superoxide dismutase and glutathione peroxidase levels, while inflammatory markers, including IL‑6, were elevated. Vita min C levels were significantly lower in cases (57.3% vs. 20.7%, χ²=42.4, P=0.001). SDHA levels were higher in cases (44.7%>1.5 ng/mL vs. 28% in controls). Reproductive hormone levels varied, with altered FSH and LH levels. Elevated IL‑16 and KRAS expression suggested a genetic influence on disease progression. Table 2 presents a comparative analysis between cases and controls across various physiological, biochemical, and genetic parameters. Oxidative stress markers were notably reduced in cases, with lower levels of superoxide dismutase (2.45±1.82 U/mL vs. 5.10±2.48 U/mL, P=0.001) and glutathione peroxidase (56.2±24.5 ng/mL vs. 67.2 ± 24.9 ng/mL, P=0.001). Interleukin‑6, an inflammatory marker, was significantly elevated in cases (7.74±5.13 pg/mL vs. 3.18±1.99 pg/mL, P=0.001) Reproductive hormone analysis indicated that cases had significantly increased FSH levels (15.9±5.5 mIU/mL vs. 14.1±5.7 mIU/mL, P=0.004). In contrast, LH levels were lower in cases (12.0±5.8 mIU/mL vs. 13.9±3.7 mIU/mL, P=0.001). Vitamin C levels were significantly reduced in cases (1.167±0.716 mg/dL vs. 1.746±0.896 mg/dL, P=0.001). Gene expression analysis demonstrated that IL‑16 (1.483±0.748 vs. 1.006±0.166, P=0.001) and KRAS (1.488±0.860 vs. 1.001±0.210, P=0.001) expression levels were significantly higher in cases. Levels of succinate dehydrogenase complex flavoprotein subunit A were the same between the two groups. Receiver Operating Characteristic (ROC) curve analysis of six markers revealed varying degrees of diagnostic performance. Interleukin‑6 demonstrated the most promising results, exhibiting the highest sensitivity and specificity among the markers tested. In contrast, FSH was the least informative marker, showing minimal discriminatory power. The IL‑16 and KRAS genes displayed reasonably good diagnostic performance. Glutathione peroxidase and LH showed intermediate discriminatory power, as shown in Figure 1. Figure 1 . ROC curve comparisons of variables for identifying predictors of endometriosis IL-6 (AUC 0.801, >5.57 pg/mL) and SOD (AUC 0.820, ≤3.23 U/mL) demonstrated good diagnostic potential. IL-16 (AUC 0.717) and KRAS (AUC 0.681) showed moderate diagnostic value. FSH (AUC 0.595) and glutathione (AUC 0.626) exhibited modest sensitivity and specifi city. SDHA (AUC 0.536) showed limited clinical utility. Vitamin C (AUC 0.697, ≤1.1989 mg/dL) demonstrated moderate predictive value (Table 3). The multivariate binary logistic regression model (Table 4) demonstrated strong predictive accuracy (86.9%). Significant independent predictors of endometriosis included low SOD levels (≤3.23 U/mL, OR=112.71, P5.57 pg/mL, OR=7.91, P=0.032), and increased KRAS gene expression (>1.23, OR=13.93, P=0.002). Other variables, including LH, FSH, vitamin C, and IL‑16 gene expression, were not statistically significant. 361 IL-16, KRAS, and Oxidative Stress in Endometriosise Volume 11, April 2026 Journal of Obstetrics, Gynecology and Cancer Research Table 1. Baseline comparison of demographic and laboratory findings between study groups Control (n=150) Case (n=150) χ2 df P n % n % Age 1.62 1 0.204 ≤35 years 72 48 83 55.3 >35 years 78 52 67 44.7 SOD 126 1 0.001 >3.23 (U/mL) 129 86 32 21.3 ≤3.23 (U/mL) 21 14 118 78.7 Glutathione Peroxidase 15.8 1 0.001 >72.2 (ng /mL) 80 53.3 46 30.7 ≤72.2 (ng /mL) 70 46.7 104 69.3 LH 30.4 1 0.001 >12.25 (mIU/mL) 112 74.7 65 43.3 ≤12.25 (mIU/mL) 38 25.3 85 56.7 FSH 16.1 1 0.001 ≤15.86 (mIU/mL) 108 72 74 49.3 >15.86 (mIU/mL) 42 28 76 50.7 SDHA 9.01 1 0.003 ≤1.5 (ng/mL) 108 72 83 55.3 >1.5 (ng/mL) 42 28 67 44.7 Vitamin C 42.4 1 0.001 >1.1989 (mg/dL) 119 79.3 64 42.7 ≤1.1989 (mg/dL) 31 20.7 86 57.3 Interleukin-6 86.9 1 0.001 ≤5.57 (pg/mL) 130 86.7 51 34 >5.57 (pg/mL) 20 13.3 99 66 Il-16 Gene 76 1 0.001 ≤1.23 136 90.7 65 43.3 >1.23 14 9.3 85 56.7 KRAS Gene 62.1 1 0.001 ≤1.23 127 84.7 61 40.7 >1.23 23 15.3 89 59.3 SOD: Superoxide dismutase, LH: Luteinizing hormone, FSH: Follicle-stimulating hormone, SDHA: Succinate dehydrogenase complex flavoprotein subunit A, IL-6: Interleukin-6, IL-16: Interleukin-16 gene, KRAS: Kirsten rat sarcoma viral oncogene homolog, χ² - Chi-square test value, df -Degrees of freedom. The results are expressed as numbers (%). P<0.05 is statistically significant. Deepthi S, et al. 362 Volume 11, April 2026 Journal of Obstetrics, Gynecology and Cancer Research Table 2. Comparison of Physiological, Biochemical, and Genetic Parameters Between Study Groups Control (n=150) Case (n=150) t test means SD means SD t P Superoxide dismutase (U/mL) 5.10 2.48 2.45 1.82 10.568 0.001 Glutathione Peroxidase (ng /mL) 67.2 24.9 56.2 24.5 3.845 0.001 Interleukin 6 (pg/mL) 3.18 1.99 7.74 5.13 10.152 0.001 FSH (mIU/mL) 14.1 5.7 15.9 5.5 2.921 0.004 LH (mIU/mL) 13.9 3.7 12.0 5.8 3.339 0.001 Succinate Dehydrogenase Complex Flavoprotein Subunit A (ng/mL) 1.453 0.950 1.599 1.118 1.221 0.223 Vitamin C (mg/dL) 1.746 0.896 1.167 0.716 6.189 0.001 IL-16 gene 1.006 0.166 1.483 0.748 7.616 0.001 KRAS gene 1.001 0.210 1.488 0.860 6.733 0.001 The results are expressed as mean±standard deviation (SD). P-values are derived from an independent sample t-test. SDHA: Succinate Dehydrogenase Complex Subunit A; IL-16: Interleukin-16; KRAS: Kirsten Rat Sarcoma Viral Oncogene Homolog. P<0.05 is statistically significant. Table 3. AUC Values for Biomarkers in Endometriosis Variable AUC se 95% CI z statistic P Youden index Optimu m cut off Sensiti vity Specifici ty +LR -LR PPV NPV FSH (mIU/mL) 0.595 0.033 0.537 to 0.651 2.888 0.004 0.227 >15.86 50.67 72 1.81 0.69 64.4 59.3 Glutathione Peroxidase (ng /mL) 0.626 0.032 0.568 to 0.681 3.929 0.001 0.227 ≤72.2 69.33 53.33 1.49 0.58 59.8 63.5 IL-16 gene 0.717 0.032 0.663 to 0.768 6.883 0.001 0.473 >1.23 56.67 90.67 6.07 0.48 85.9 67.7 Interleukin-6 (pg/mL) 0.801 0.026 0.751 to 0.845 11.489 0.001 0.526 >5.57 66 86.58 4.92 0.39 83.2 71.7 KRAS gene 0.681 0.033 0.625 to 0.734 5.445 0.001 0.440 >1.23 59.33 84.67 3.87 0.48 79.5 67.6 LH (mIU/mL) 0.638 0.033 0.580 to 0.692 4.173 0.001 0.313 ≤12.25 56.67 74.67 2.24 0.58 69.1 63.3 SDHA (ng/mL) 0.536 0.034 0.478 to 0.594 1.08 0.001 0.167 >1.5 44.67 72 1.6 0.77 61.5 56.5 SOD (U/mL) 0.82 0.026 0.772 to 0.862 12.298 0.001 0.647 ≤3.23 78.67 86 5.62 0.25 84.9 80.1 Vitamin C (mg/dL) 0.697 0.030 0.642 to 0.749 6.534 0.001 0.367 ≤1.1989 57.33 79.33 2.77 0.54 73.5 65 AUC: Area Under the Curve, a measure of diagnostic accuracy, SE: Standard error of AUC, CI: Confidence Interval (95%), +LR: Positive Likelihood Ratio, -LR: Negative Likelihood Ratio, PPV: Positive Predictive Value, NPV: Negative Predictive Value, Optimum cutoff values were determined using the Youden index. Higher AUC values indicate better diagnostic performance. Table 4. Logistic Regression Analysis of Predictors for Endometriosis B S.E. Wald df P OR 95% C.I. for OR Lower Upper SOD 4.725 1.193 15.692 1 0.001 112.71 10.88 1167.41 Glutathione Peroxidase 1.594 0.882 3.265 1 0.071 4.93 0.87 27.76 LH 0.495 0.707 0.49 1 0.484 1.64 0.41 6.56 FSH 0.537 0.777 0.479 1 0.489 1.71 0.37 7.84 SDHA 0.551 0.76 0.525 1 0.469 1.74 0.39 7.70 Vitamin C 0.337 0.692 0.237 1 0.627 1.40 0.36 5.44 Interleukin-6 2.068 0.965 4.594 1 0.032 7.91 1.19 52.45 IL-16 Gene 0.535 0.989 0.293 1 0.588 1.71 0.25 11.86 KRAS Gene 2.634 0.834 9.97 1 0.002 13.93 2.72 71.46 Constant -12.238 2.611 21.974 1 0.000 B: Regression coefficient, indicating the strength and direction of the relationship between the variable and the outcome, S.E.: Standard error of the regression coefficient, Wald: Wald test statistic, assessing the significance of each predictor, df: Degrees of freedom for the Wald test, P: P- value, indicating statistical significance (p < 0.05 is considered significant), OR: Odds Ratio, representing the likelihood of the outcome occurring with each unit increase in the predictor, 95% C.I. for OR (Lower, Upper): Confidence interval, showing the range within which the true odds ratio is likely to fall, Constant: Intercept of the logistic regression model. 363 IL-16, KRAS, and Oxidative Stress in Endometriosise Volume 11, April 2026 Journal of Obstetrics, Gynecology and Cancer Research 4. Discussion We designed this case -control study to investigate the synergistic effects of IL‑16 and KRAS gene expression in endometriosis, with a specific focus on their interaction with oxidative stress markers. This study identified that IL‑16 and KRAS gene expression levels were lower in the control group than in the case group, as shown in Table 1. While previous research has predominantly focused on polymorphic variations, the present findings highlight a potential interaction between these genes in the pathophysi ology of endometriosis. Oxidative stress acts as a disease promoter, and the observed gene expression patterns suggest a link between inflammatory pathways and oxidative damage. Further research is required to elucidate the mechanistic roles of IL‑16 and K RAS in oxidative stress -mediated endometriosis, as indicated by these findings. Recent studies have highlighted the role of IL‑16 gene polymorphisms in disease susceptibility. Notably, the IL‑16 rs4778889 variant has been implicated as a potential genetic marker for endometriosis in Nigerian and African populations, suggesting ethnic‑ specific genetic predispositions (6). IL‑16 gene polymorphisms are associated with the development of endometriosis and may be used as predictive risk factors for susceptibility to the disease (12). Previous studies have primarily focused on the role of KRAS in ovarian and other gynecological malignancies, with limited evidence linking it to endometriosis. Soliman et al. , (2018) suggested that any risk of endometriosis associated with common KRAS variations is likely minimal (13). Additionally, Suda et al. , (2018) identified KRAS mutations in ovarian endometriosis, reporting that 42.6% (23/54) of cases harbored somatic KRAS mutations (14). However, these studies did not establish KRAS as an independent predictor of endometriosis. In contrast, a novel finding of the current study is the identification of KRAS as a significant and independent predictor of endometriosis ( P=0.002), as shown in Figure 1. Unlike the diffuse and homogeneous distribution of KRAS p.G12V mutations observed in ovarian cancer, KRAS mutant allele expression was detected in only two endometriosis cases, and the mutation signals in endometriosis appeared more spatially distinct (8). The synergistic effect of IL‑16 and KRAS in endometriosis has not been explored in previous research, making this study the first to investigate their combined influence. While KRAS has been implicated in ovarian endometriosis and identified as an independent predictor in the current study ( P=0.002), no prior studies have examined its potential interaction with IL‑16 (14). The absence of such investigations highlights a critical gap in understanding the molecular mechanisms underlying endometriosis. Oxidative stress can lead to cellular damage, inflammation, and fibrosis, thereby exacerbating the symptoms of endometriosis (15). The development and progression of endometriosis were assessed by examining the roles of various enzymatic and non‑enzymatic oxidative stress markers. The enzymatic markers included Superoxide Dismutase (SOD), glutathione peroxidase, and Succinate Dehydrogenase (SDHA), while the non‑enzymatic marker assessed was vitamin C. Our aim was to determine how these oxidative stress markers contribute to genetic defects associated with the progression of endometriosis. Findings from this study revealed that SOD levels were significantly higher in the control group compared with the case group, as shown in Table 2. Reduced SOD activity has been reported in the peritoneal fluid of women affected by endometriosis, leading to an imbalance in oxidative stress regulation and significantly contributing to disease pathophysiology (16). This reduction suggests dysregulated oxidative stress control which, in combination with inflammatory mediators such as IL‑16, may enhance cellula r damage and promote genetic instability. Similarly, the present study observed significantly higher glutathione peroxidase levels in the control group (67.2±24.9 ng/mL, P=0.001) compared with the cases (56.2±24.5 ng/mL), as indicated in Table 1. These findings are consistent with previous reports suggesting that SOD and glutathione peroxidase levels are lowest in patients with severe‑stage endometriosis (17). Reported SOD and GPx activities in disease and control groups were 6.15 and 8.11, and 463.9 and 472.34 nmol/min/mL, respectively (18). Furthermore, different phases of the menstrual cycle have been shown to exhibit varying expression of oxidative stress markers. Zwahlen et al. , (2024) reported that expression was minimal during the early proliferative phase, gradually increased, peaked during the early secretory phase, and subsequently declined. This cyclical pattern may indicate hormonal influences on oxidative stress mechanism s in endometriosis. Overall, the observed alterations in oxidative stress marker levels emphasize the critical ro le of oxidative imbalance in the progression of endometriosis (19). In the present study, SDHA exhibited limited clinical utility (AUC 0.536), as shown in Table 3. The role of SDHA in endometriosis remains largely unexplored, as most existing research has predominantly focused on its involvement in endometrial and ovarian cancers. The scarcity of studies examining SDHA in the context of endometriosis highlights the need for further investigations to determine its potential significance in disease pathophysiology. Future studies focusing on the impact of SDHA expression on m itochondrial function and oxidative stress in endometriosis may provide deeper insights into its role in disease progression. Deepthi S, et al. 364 Volume 11, April 2026 Journal of Obstetrics, Gynecology and Cancer Research In the current study, vitamin C levels were significantly reduced in cases (1.167±0.716 mg/dL) compared with controls (1.746± 0.896 mg/dL, P=0.001). Additionally, vitamin C demonstrated moderate predictive value for endometriosis (AUC 0.697, ≤1.1989 mg/dL), as shown in Table 3. These findings are consistent with previous research by Lu et al. , (2018), which reported lower serum and Follicular Fluid (FF) levels of vitamin C and SOD in individuals with endometriosis compared with healthy controls (20). The reduction in vitamin C levels suggests a compromised antioxidant defense system, which may contribute to increased oxidative stress, inflammation, and subsequent disease progression. The current study also highlights the role of IL‑6 in the pathophysiology of endometriosis, demonstrating significantly elevated levels in affected individuals. Increased IL‑6 levels (>5.57 pg/mL, OR=7.91, P=0.032) were identified as a significant predictor of the disease. IL‑6 is a pro‑inflammatory cytokine known to enhance immune cell recruitment and inflammatory responses, thereby exacerbating oxidative stress - induced damage in endometrial tissue (21). The observed increase in IL‑6 levels suggests a stro ng association between inflammatory responses and disease severity. When comparedometriosis literature, previous studies have likewise reported elevated IL‑6 levels in patients with endometriosis, correlating with an increased inflammatory burden and impaired immune tolerance (22). However, variations in IL‑6 expression among different studies may be attributed to differences in patient populations, disease stage, and methodological approaches. The current study further supports IL‑6 as a potential marker of inflammation‑induced ox idative stress, as evidenced by its associa tion with reduced antioxidant enzyme levels (SOD, glutathione peroxidase, and vitamin C). Despite its statistical significance ( P=0.032, OR=7.91), the precise mechanistic link between IL‑6 and KRAS/IL‑16 gene dysregulation in endometriosis remains unclear and warrants further investigation. IL‑6 may contribute to KRAS activation through inflammatory signaling pathways, thereby promo ting aberrant cellular proliferation and fibrosis. In addition, IL‑6‑induced oxidative stress may exacerbate epigenetic modifications, leading to altered gene expression patterns in endometrial lesions. Furthermore, KRAS gene expression (>1.23, OR=13.93, P=0.002) was identified as a significant genetic determinant of endometriosis. As a key regulator of cell proliferation and survival, KRAS overexpression may contribute to uncontrolled cellular growth and genetic instability, thereby further promoting the i mplantation and invasion of ectopic endometrial tissue. The present findings suggest that variables such as LH, FSH, vitamin C, and IL‑16 gene expression were not major statistical predictors in the multivariate model, as indicated in Table 4; however, a potential synergistic interaction appears to exist between oxidative stress, IL‑6‑driven inflammation, and KRAS‑mediated genetic alterations in the pathophysiology of endometriosis. Although vitamin C plays a role in counteracting oxidative stress, its independent contribution may be limited due to interactions with other antioxidant and inflammatory pathways. Similarly, while IL‑16 has been implicated in immune modulation, its direct role in driving the progression of endometriosis remains unclear. The findings of this study emphasize the synergistic interplay between oxidative stress markers, IL‑16‑mediated inflammation, and KRAS‑driven genetic alterations in the pathogenesis of endometriosis. The combined effects of oxidative stress-induced damage and inflammatory responses may contribute to genetic instability, thereby accelerating disease progression. This study has several limitations that should be acknowledged. One important confounding factor is the timing of sample collection in relation to the menstrual cycle. Hormonal fluctuations throughout the cycle can influence inflammatory markers, oxidative stress levels, and gene expression patterns, potentially affecting the observed IL‑6, KRAS, and IL‑16 levels. Standardizing sample collection according to specific menstrual phases in future studies would help minimize variability and improve biomarker accuracy. Additionally, factors such as the heterogeneity of endometriosis cases, including variations in disease severity and lesion location, may have influenced the findings. The study also did not account for potential confounders such as prior hormonal treatmen ts or environmental exposures, which could affect inflammatory and oxidative stress responses. Future research should explore the mechanistic pathways linking IL‑16 and KRAS gene expression with oxidative stress and inflammation in endometriosis. Larger, multicenter studies involving diverse populations are needed to validate these findings and assess their clinical applicability. Furthermore, investigating potential therapeutic interventions targeting KRAS and oxidative stress markers may offer novel treatment strategies for endometriosis. 5. Conclusion This study highlights the synergistic role of IL‑16 and KRAS in endometriosis, linking their overexpression to disease progression. KRAS emerged as a significant independent predictor. Markers of oxidative stress, including reduced SOD, glutathione peroxidase, and vitamin C, together with elevated IL‑6, reflect a state of inflammation, oxidative imbalance, and genetic instability. These findings suggest that oxidative stress, IL‑6‑driven inflammation, and 365 IL-16, KRAS, and Oxidative Stress in Endometriosise Volume 11, April 2026 Journal of Obstetrics, Gynecology and Cancer Research KRAS‑mediated genetic alterations collectively contribute to the pathogenesis of endometriosis. In contrast to previous studies focused primarily on genetic polymorphisms, this study provides novel insights based on gene expression analysis. Future studies should validate these findings in larger populations and further explore therapeutic targets involving KRAS and oxidative stress–related pathways in endometriosis. 6. Declarations Acknowledgments We sincerely appreciate the support and resources provided by Meenakshi Academy of Higher Education and Research, Chennai, Tamil Nadu, India, and Genetika, Centre for Advanced Genetic Studies, Thiruvananthapuram, Kerala, India. Ethical Considerations Ethical approval (03/2022/IECG) was secured from the Institutional Ethics Committee of Genetika. Authors' Contributions Conceptualization: Deepthi S, N Muninathan, Dinesh Roy D, Data curation: Deepthi S, Sheeja M J, Jeena Jose, Nitha N P, Arun Dileep R C, Simi Skariah, Formal analysis: Deepthi S, A Suresh, P Mohana Lakshmi, Investigation: Deepthi S, Sheeja M J, Jeena Jose, Nitha N P, Arun Dileep R C, Simi Skariah, Methodology: Deepthi S, N Muninathan, A Suresh, Project administration: Dinesh Roy D, Resources: Deepthi S, N Muninathan, Supervision: N Muninathan, Dinesh Roy D, Validation: P Mohana Lakshmi, A Suresh, Visualizati on: Deepthi S, Writing – original draft: Deepthi S, Writing – review and editing: N Muninathan, Dinesh Roy D. Conflict of Interest All authors declare that they have no conflicts of interest. Fund or Financial Support There are no funding sources to report. 1. Taylor HS, Kotlyar AM, Flores VA. Endometriosis is a chronic systemic disease: clinical challenges and novel innovations. Lancet. 2021;397(10276):839 -52. [doi:10.1016/s0140-6736(21)00389-5] 2. Gajbhiye RK, Montgomery G, Pai MV, Phukan P, Shekhar S, Padte K, et al. Protocol for a case –control study investigating the clinical phenotypes and genetic regulation of endometriosis in Indian women: the ECGRI study. BMJ Open. 2021;11(8):e050844. [doi:10.1136/bmjopen-2021-050844] 3. Takeuchi M, Matsuzaki K, Harada M. Endometriosis, a common but enigmatic disease with many faces: current concept of pathophysiology, and diagnostic strategy. Jpn J Radiol. 2024;42(8):801 -19. [doi:10.1007/s11604-024-01569-5] 4. Oală IE, Mitranovici MI, Chiorean DM, Irimia T, Crișan AI, Melinte IM, et al. Endometriosis and the role of pro - inflammatory and anti -inflammatory cytokines in pathophysiology: a narrative review. Diagnostics (Basel). 2024;14(3):312. [doi:10.3390/diagnostics14030312] 5. Hall G, Cullen E, Sawmynaden K, Arnold J, Fox S, Cowan R, et al. Structure of a potential therapeutic antibody bound to interleukin -16 (IL-16). J Biol Chem. 2016;291(32):16840-8. [doi:10.1074/jbc.m115.709303] 6. Babah OA, Ojewunmi OO, Onwuamah CK, Udenze IC, Osuntoki AA, Afolabi BB. Serum concentrations of IL -16 and its genetic polymorphism rs4778889 affect susceptibility and severity of endometriosis in Nigerian women. BMC Womens Health. 2023;23(1):253. [ doi:10.1186/s12905-023- 02362-8] 7. Huang L, Guo Z, Wang F, Fu L. KRAS mutation: from undruggable to druggable in cancer. Signal Transduct Target Ther. 2021;6(1):386. [ doi:10.1038/s41392-021- 00780-4] 8. Orr NL, Albert A, Liu YD, Lum A, Hong J, Ionescu CL, et al. KRAS mutations and endometriosis burden of disease. J Pathol Clin Res. 2023;9(4):302 -12. [doi:10.1002/cjp2.317] 9. Yachida N, Yoshihara K, Suda K, Nakaoka H, Ueda H, Sugino K, et al. Biological significance of KRAS mutant allele expression in ovarian endometriosis. Cancer Sci. 2021;112(5):2020 -32. [doi:10.1111/cas.14871] 10. Clower L, Fleshman T, Geldenhuys WJ, Santanam N. Targeting oxidative stress involved in endometriosis and its pain.

References

Deepthi S, et al. 366 Volume 11, April 2026 Journal of Obstetrics, Gynecology and Cancer Research Biomolecules. 2022;12(8):1055. [doi:10.3390/biom12081055] 11. Udayana IGNB, Adnyana IBPP, Diningrat MA, Setiawan WA. Association of endometriosis and oxidative stress. Eur J Med Health Sci. 2022;4(5):109 -13. [doi:10.24018/ejmed.2022.4.5.1387] 12. Azimzadeh P, Khorram Khorshid HR, Akhondi MM, Shirazi A. Association of interleukin-16 polymorphisms with disease progression and susceptibility in endometriosis. Int J Immunogenet. 2016;43(5):297-302. [doi:10.1111/iji.12281] 13. Soliman MH, Amin AI. Association of two SNPs of IL -16 gene with development and grading of endometriosis: a case –control study. Egypt J Med Microbiol. 2018;27(4):19-25. [doi:10.21608/ejmm.2018.285637] 14. Suda K, Nakaoka H, Yoshihara K, Ishiguro T, Tamura R, Mori Y, et al. Clonal expansion and diversification of cancer -associated mutations in endometriosis and normal endometrium. Cell Rep. 2018;24(7):1777 -89. [doi:10.1016/j.celrep.2018.07.037] 15. Scutiero G, Iannone P, Bernardi G, Bonaccorsi G, Spadaro S, Volta CA, et al. Oxidative stress and endometriosis: a systematic review. Oxid Med Cell Longev. 2017;2017:7265238. [doi:10.1155/2017/7265238] 16. Huang L, Shi L, Li M, Yin X, Ji X. Oxidative stress in endometriosis: sources, mechanisms and therapeutic potential of antioxidants. Int J Mol Med. 2025;55(5): 72. [doi:10.3892/ijmm.2025.5513] 17. Amreen S, Kumar P, Gupta P, Rao P. Evaluation of oxidative stress and severity of endometriosis. J Hum Reprod Sci. 2019;12(1):40-6. [doi:10.4103/jhrs.jhrs_27_17] 18. Ekarattanawong S, Tanprasertkul C, Somprasit C, Chamod P, Tiengtip R, Bhamarapravatana K, et al. Possibility of using superoxide dismutase and glutathione peroxidase as endometriosis biomarkers. Int J Womens Health. 2017;9:711 -6. [doi:10.2147/ijwh.s141021] 19. Zwahlen M, Stute P. Impact of progesterone on the immune system in women: a systematic review. Arch Gynecol Obstet. 2024;309(1):37-46. [ doi:10.1007/s00404- 023-06996-9] 20. Lu X, Wu Z, Wang M, Cheng W. Effects of vitamin C on IVF -ET outcome in endometriosis: a randomized controlled study. J Int Med Res. 2018;46(11):4624 -33. [doi:10.1177/0300060518786918] 21. Sikora J, Smycz -Kubańska M, Mielczarek-Palacz A, Bednarek I, Kondera-Anasz Z. Involvement of TGF-β and related cytokines in pathogenesis of endometriosis. Immunol Lett. 2018;201:31-7. [doi:10.1016/j.imlet.2018.10.011] 22. Kashanian M, Sariri E, Vahdat M, Ahmari M, Moradi Y, Sheikhansari N. Comparison of serum IL -6 and CA125 in patients with endometriosis and controls. Med J Islam Repub Iran. 2015;29:280. How to Cite This Article: Deepthi S, Muninathan N, Suresh A, Mohana Lakshmi P, Aswathi R K, Sheeja M J , et al. Synergistic Effects of IL-16 and KRAS in Endometriosis with Emphasis on Oxidative Stress : A Randomized Controlled Trial. J Obstet Gynecol Cancer Res. 2026;11(4):358-366. Download citation: RIS | EndNote | Mendeley |BibTeX |

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: oa-pdf

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosisinfertility

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

openalex
last seen: 2026-06-28T06:02:12.919550+00:00
License: CC0 · commercial use OK