Nitrate Modulates Microbial Interaction and Biocorrosion Activities of Acid Producing Bacteria | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Nitrate Modulates Microbial Interaction and Biocorrosion Activities of Acid Producing Bacteria Tekle Tafese Fida, Taylor Rambo, Marie Hall, Rebekah Wilson, Scott Leleika, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6770932/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Acid-producing bacteria (APB) play a significant role in pipeline corrosion by producing corrosive metabolites. Current APB mitigation strategies are often not successful, or the effects are temporary, necessitating the need to identify alternate approaches. In this study, nitrate was used to manipulate microbial interaction and control the growth and activities of APB. Microbial diversity was manipulated by subsampling a microbial consortia pool, serially diluting subsamples, and culturing sufficient replicates of each dilution to allow random distribution in the absence or presence of nitrate. The interactomes were grown in the presence of C1018 carbon steel, and corrosion activities were evaluated by monitoring the change in pH of the culture media, the corrosion of carbon steel, and the production of organic acids. Microbial community composition and functional gene abundance were also monitored. The study identified a change in microbial community assemblage upon nitrate addition, resulting in differences of APB activities, such as acid production, change of pH, and corrosion rate. Nitrate addition inhibited APB-induced corrosion but did not affect microbial growth and abundance of metabolic genes, suggesting that the inhibitory effect is likely due to change in redox potential of culture media or increased growth of APB competitors. The study also identified the importance of nitrate addition as a novel approach to manipulate microbial community composition and mitigate corrosion induced by APB activities. This approach is economically viable and an environmentally sustainable strategy to control microbiologically influenced corrosion. Acid Producing Bacteria Interactomes Biocorrosion Nitrate organic acids pH Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Biocorrosion, also known as microbiologically influenced corrosion (MIC), is the deterioration of metals due to microbial (bacteria, archaea, fungi, and microalgae) activities that compromise the integrity, safety, and reliability of energy delivery or storage infrastructure. MIC can act as a catalytic process in accelerating anodic and/or cathodic corrosion reactions, and it initiates or accelerates other abiotic corrosion processes that impact routine treatments designed to ensure pipeline safety and integrity (Khouzani et al. 2019 ). These impacts include modification of the localized environment at the metal/solution interface, destabilization of protective films/coatings on the metal surface, localized galvanic corrosion, stress corrosion cracking, degradation of corrosion inhibitors, and/or the initiation of pitting attack when microbial adhesion (biofilm) takes place on a metal (Khouzani et al. 2019 ; Wang et al. 2022 ). MIC activities start with the attachment of planktonic cells to the steel infrastructure, where they grow, reproduce, consume nutrients, and produce an extracellular polymer substance known as biofilm (Balakrishnan et al. 2024 ; Kip and van Veen 2015 ). This metal-biofilm interface environment differs from the other interfaces in that the pH value is low while the concentration of dissolved oxygen and constituents of organic/inorganic species are high, aggravating pitting corrosion (Telegdi et al. 2020 ). In addition to the formation of biofilm, microbes also produce metabolic products, such as acids, sulfides, and other chemical intermediates, that attack the steel infrastructure. While general corrosion management has improved over the past several decades, MIC remains a very high-priority issue. If not monitored and controlled timely, MIC causes catastrophic steel infrastructure failures, health and safety concerns, and great economic losses. Global annual direct cost of corrosion has been estimated at US $ 2.9 trillion ( $ 276 billion in the United States alone) (Little et al. 2020 ). Corrosion due to MIC is estimated at about 20–50% of overall corrosion costs (Little et al. 2020 ; Omar et al. 2021 ). Therefore, there is a need to innovate effective, environmentally safe, and economically viable techniques for the prevention of biocorrosion. Acid-producing bacteria (APB) are one of the MIC-causing microorganisms that play a significant role in corrosion activities. APB produce corrosive metabolic byproducts, such as organic and inorganic acids (sulfuric, lactic, propionic, formic, butyric, and acetic acid), through oxidation or fermentation processes (Davis et al. 2024 ; Enning and Garrelfs 2014 ; Little et al. 2020 ). These organic acids are also often used as an electron donor for the reduction of sulfate to sulfide by sulfate reducing bacteria (SRB) (Demin et al. 2024 ). APB are the major culprit of corrosion in environments such as oil and gas transporting pipelines and storage facilities, industrial water systems, waste management, and marine infrastructure. The microbes attack metals by forming biofilms and creating localized acidic microenvironments (Javaherdashti 2023 ; Li et al. 2024 ; Ogawa et al. 2020 ). This acidic environment decreases the pH at the metal surface and causes aggressive general corrosion and site-specific pitting corrosion, dissolves protective oxide layers or passivation films, and exposes the underlying material to further chemical or electrochemical attacks (Balakrishnan et al. 2024 ; Dong et al. 2018 ; Javaherdashti 2023 ). MIC caused by APB can lead to pipeline leaks, structural failures, and costly repairs (Videla and Herrera 2005 ). Addressing MIC induced by APB requires a multidisciplinary approach, combining microbiology, materials science, and engineering to develop resilient systems resistant to both microbial colonization and acid-induced corrosion. The most commonly used APB mitigation strategies include pH-neutralizing agents, antimicrobial treatments, and protective coatings to disrupt biofilm formation (Jia et al. 2019 ; Little et al. 2020 ). However, these mitigation strategies are often not successful, or the impacts are temporary due to the formation of biocide-resistant or re-formation of resilient biofilms. This necessitates the need to identify effective, environmentally safe, and economically viable alternatives to prevent MIC activities. The use of inherent microbial interaction and manipulation of such interaction to redirect microbial activities and promote growth of non-corrosive communities are of particular interest. This approach is not only an economically viable solution but also an environmentally sustainable strategy. A microbial interactome is the interaction and relationship between two or more microbial species to act on substrate metabolism and biofilm formation (Geesink et al. 2024 ; Tshikantwa et al. 2018 ). It encompasses a complex network of interactions between microorganisms and their biotic and abiotic environments, and often involves metabolic exchanges, signaling pathways, genetic transfer, and symbiotic or competitive relationships (Geesink et al. 2024 ). In an environment with limited resources, microbial interaction helps the consortia to coordinate nutrient cycling through a process known as syntrophy, where the waste from one species is used as carbon and energy sources for another (Geesink et al. 2024 ). Microbial interaction is governed by ecological forces of dispersal, drift, selection, and speciation, resulting in over or under population of specific microorganisms (Bassler and Losick 2006 ; Justice et al. 2017 ). Microbial interactome studies are gaining momentum in fields such as medicine, agriculture, and biotechnology to optimize microbial activities for specific applications (de Lorenzo 2008 ; Tshikantwa et al. 2018 ). Studies indicate that highly reproducible communities could be formed from different inocula incubated under similar conditions, or similar inocula incubated under different conditions resulting in divergent or convergent community structure, supporting the evidence of niche-based processes and strong selective forces (Falk et al. 2009 ; Ofiţeru et al. 2010 ). We hypothesized that manipulation of such selective forces could result in promotion of microbial community interaction that could be synergistic to enhance growth of MIC competitors or antagonistic to inhibit MIC activities and biofilm formation on metal substrate as a sustainable APB mitigation strategy. In this regard, microbial diversity was manipulated by subsampling a given microbial consortia pool, serially diluting subsamples, and culturing sufficient replicates of each dilution in the presence of nitrate to allow random distribution and growth of microbes. This created many microbial communities with specific species that vary in their membership to act synergistically or antagonistically to modulate APB activities such as acid production and corrosion. Materials and Methods Sample Collection Samples were collected in 2022 from two different sources (sludge and corrosion debris) and later mixed in the lab to create inocula for enrichment of microbial interactome. An APB consortium was obtained from wet corrosion debris (1 gram) scraped from a failed oil and gas transporting pipeline in California, USA. The sample was collected in a sterile glass bottle with the potential presence of oxygen in the headspace. This sample had active biocorrosive microbial activities, including APB, and had not been treated with biocides. A sludge sample was obtained from a wastewater treatment plant in the Chicago area and used as a source of inoculum to enhance potential APB competitors or antagonists. This sample was collected in a sterile 1-liter Nalgene bottle filled to the brim to exclude air and maintain anaerobic conditions during transportation. The samples were aseptically collected and immediately transported to the lab on ice and stored at 4 o C until processing. Inoculation and Culture Enrichment The starting inoculum from the debris sample (1 gram) was enriched under anaerobic conditions to enhance the growth of APB using sterile Coleville synthetic brine medium K (CSBK) media (pH 7.6) (Callbeck et al. 2013 ) amended with dextrose (5 g/L). After 48 hours of growth, 10 mL of the enrichment culture was mixed with 10 mL of the sludge sample and used for inoculation. The mixed sample was serially diluted, and 200 µL from each dilution was inoculated into 2 microtiter plates (24-well plates each), each well containing 1,800 µL of CSBK medium amended with dextrose. This resulted in a five times serial dilution of the inoculum (10 − 1 , 10 − 2 , 10 − 3 , 10 − 4 , 10 − 5 ) after addition into the microtiter plate wells. This procedure was repeated for the same growth media but also containing nitrate (5 mM). The last columns of each microtiter plate wells were not inoculated with culture and hence used as abiotic controls. This resulted in an inoculation of 44 replicates (24 from the first microplate and 20 from the second plate) for each dilution and each media amended with or without nitrate. The experimental layout is shown in Fig. 1 . The plates were sealed with plate seals, covered with a microtiter plate cover, and incubated at 30°C without shaking for 1 week in a Coy anaerobic hood with an atmosphere of 90% N 2 and 10% CO 2 (N 2 -CO 2 ). Screening of Interactome At the end of the incubation period, growth of APB cultures was determined by measuring optical density (OD 600 ) using a BioTek Synergy LX plate reader (Agilent Technologies) and by monitoring changes in the pH of the culture media. Culture aliquots (200 µL) were transferred from the 24-well plates into 96-well plates to determine the OD and pH values. The remaining cultures were kept under anaerobic conditions for further screening of corrosion activities. The pH was visually determined by adding 30 µL Bromothymol Blue (BTB) indictor solution (Sigma Aldrich) to the cultures after the OD reading. This resulted in multiple color repertoires with the dominant colors indicating blue (pH > 7.5), green (pH 6-7.5), and yellow (pH < 6). BTB has been used to identify acid producing microbial activities in several studies (Jia et al. 2023 ; Kumari et al. 2023 ). Corrosion Activity Testing Multiple interactome cultures that showed either blue/green or yellow BTB color were further re-evaluated in a 24-well microtiter plate using the same media composition and inoculation procedures indicated above but in the presence of C1018 grade carbon steel ball bearings (2- beads per well). The beads (Grainger, hardness C60 to C67, Grade 200) were used to monitor corrosion activities of the interactome in the presence and absence of nitrate. Because of their small size (54.0 ± 0.3 mg, ∅ = 0.238 ± 0.001 cm, A = 0.178 cm 2 ) and increased surface area of exposure (Fida et al. 2021 ; Voordouw et al. 2016 ), these beads were ideal for large scale screening in small volume as they fit into the microtiter plate wells. To further evaluate the effect of nitrate addition on the corrosion rate induced by APB, studies were performed using C1018 carbon steel coupons in serum bottles (125 mL) containing 100 mL of CSBK with or without nitrate (5 mM). The serum bottles were inoculated with 1 mL of active APB consortia obtained from the enrichment culture mix indicated above, covered with a butyl rubber stopper and aluminum crimp seals, and purged with N 2 -CO 2 gas to create an anaerobic condition. A known isolate of APB culture ( Clostridium acetobutylicum ATCC 824) was also used as an inoculum to determine whether the effect of nitrate is specific to the source of inoculum used or has a broad effect on APB. CSBK media without APB inocula was used as an abiotic corrosion control, and each experiment was performed in triplicate. All cultures were incubated for 3 weeks at 30 o C under anaerobic conditions. Corrosion Beads or Coupon Processing The beads or coupons were treated according to the National Association of Corrosion Engineers (NACE) protocol RP0775-2005. The bead treatment involved briefly sanding with sandpaper (grit size 400) by rolling the beads between two sheets of sandpaper for 1–2 min to facilitate a rough surface for microbial attachment. The beads/coupons were cleaned by sonication in isopropyl alcohol for 2 minutes, air dried, weighed to determine the starting weight, and then fully immersed in the culture media indicated above. Coupons/beads placed in culture media without a microbial source were used as abiotic controls. At the end of the incubation period, the coupons/beads were removed from the culture media and cleaned of residual debris and moisture using tissue paper in the anaerobic chamber. The coupons/beads were further cleaned by sonicating in a 15% HCl solution containing 5 g/L of corrosion inhibitor (1,3-di-n-butyl-2 thiourea) for 2 minutes, sonicating in 1 M NaHCO 3 for 2 minutes, briefly submerging in deionized H 2 O to remove the residual NaHCO 3 solution, and sonicating in isopropyl alcohol for 2 minutes. The cleaned coupons and beads were then allowed to dry under air stream and weighed to obtain final weights. Organic Acids and pH analysis At the end of the incubation period, aliquot samples (1 mL) were withdrawn from the serum bottles and used to determine the composition of organic acid ions including acetate, butyrate, propionate, and lactate produced by the cultures. The samples were withdrawn using syringe needles and filtered using 0.2-µm nylon membrane filters (Fisher Scientific, NH) to remove cells and debris. The concentrations of organic acid ions were determined from the filtered samples (300 µL) using a high-performance liquid chromatography (HPLC) system equipped with a Vanquish Diode Array Detector at 210 nm and an Acclaim™ Organic Acid (250 x 4.0 mm) column (Thermo Fisher, WI) with a flow rate of 1.0 mL/min. Mobile phases were 25 mM KH 2 PO 4 (pH 2.5) and Acetonitrile. The samples were acidified with 20 µL of 1 M H 3 PO 4 prior to analysis. The pH of APB culture in the serum bottles was determined by using a Metrohm 914 pH/Conductometer (Metrohm, FL) according to the manufacturer’s protocol. This was used to determine the effect of nitrate addition on the acidity of culture media that aggravate corrosion of the carbon steel coupon. Microbial Community Analysis Genomic DNA was extracted from APB consortia grown on carbon steel coupons in the presence or absence of nitrate at the end of the incubation period. The samples (1 mL) were centrifuged at 17,000 X g for 5 min to pellet the cells. DNA was isolated from the pellet using the FastDNA extraction kit for soil (MP Biomedicals) according to the manufacturer’s instructions, quantified with a Qubit fluorimeter (Invitrogen) using the Quant-iT dsDNA HS Assay Kit (Invitrogen), and sent to LC Sciences (Houston, TX) for sequencing and microbial community analysis. Sequencing was performed by targeting the V3-V4 region of 16S rRNA genes. The 16S rRNA genes were amplified through two-step PCR reactions with nonbarcoded universal 16S rRNA forward primer (319F, ACTCCTACGGGAGGCAGCAG) and reverse primer (806R, GGACTACHVGGGTWTCTAAT) for 25 cycles followed by amplicon purification and PCR using sequencing adaptors and barcodes according to the company’s proprietary procedures. The purified PCR product (100 ng) was sequenced using Ilumina Miseq (PE300) platform to generate clusters. Bioinformatic analyses were performed by LC Science using the in-house script that can annotate the taxa to the species level. Microbial community abundances were expressed as total sequence read counts and percentage abundance of the reads belonging to each taxon within an individual sample. Quantitative PCR (qPCR) The abundance of APB genes implicated in acid production from APB consortia and isolate ( C. acetobutylicum ) samples were quantified using qPCR reaction according to the previously established methods (Fida et al. 2024 ; Zhu 2007 , 2008 ). The primers targeted 16S RNA, acetate kinase ( ackA ), and butyrate kinase ( buk ) genes in APB. The two genes ( ackA and buk ) are essential to APB metabolism for organic acid production. The same DNA used for microbial community analysis was used for the qPCR analysis. The DNAs were amplified using a QuantiTect* SYBR green* PCR kit (Qiagen GmbH, Hilden, Germany) and gene specific primers. Each qPCR run was performed in triplicate and included the diluted standards, known concentration of DNA from the pure bacterial isolates as positive controls, and non-template controls. Calibration curves, made with known quantity of purified PCR products of target genes serially diluted over a range magnitude, were used to determine gene copy numbers. Accession number(s). The 16S rRNA gene amplicon sequence reads of APB consortia triplicate samples grown on carbon steel coupons were deposited in the Sequence Read Archive (SRA) at NCBI with accession number PRJNA1269071. Results and Discussions In this study, the use of microbial interactome and nitrate addition was explored to mitigate corrosion caused by APB. Most studies of MIC have overwhelmingly focused on the corrosive effects of sulfate reducing bacteria (SRB), that usually use sulfate as a terminal electron acceptor to produce hydrogen sulfide, causing souring of oil and gas transportation pipelines, storage reservoirs, and other infrastructures. However, APB is the main culprit in pitting corrosion due to the production of corrosive metabolites, growth under anaerobic and aerophilic conditions, persistent biofilm formation, diverse microbial community assemblage, and persistence under adverse environmental conditions by forming spores, such as in the case of Bacillus , Thiobacillus , Clostridium , and Acidothiobacilli species (Gu and Galicia 2012 ; Gupta and Anand 2018 ; Kip and van Veen 2015 ; Ramos Monroy et al. 2019 ). The metabolic byproducts produced by APB result in localized lowering of pH and creation of acidic conditions that directly attack and corrode metallic surfaces. The pit depth and width caused by APB are often a magnitude of order higher than that of SRB (Gu and Galicia 2012 ). The present study was initiated to mitigate APB-induced corrosion by using microbial interactome and nitrate injection approaches. The hypothesis was that manipulation of microbial interactome could result in microbial community assemblage that could enhance growth of APB competitors or antagonistically inhibit APB growth and biofilm formation on a metal substrate as a sustainable APB mitigation strategy. In this regard, microbial diversity was manipulated by subsampling a given microbial consortia pool, serially diluting subsamples, and culturing sufficient replicates of each dilution in microtiter plates to allow random distribution of microbes in the presence and absence of nitrate. This created many microbial communities with specific species that vary in their membership and activities. Analysis of metabolite products, changes in pH conditions, changes in microbial community composition, and monitoring of corrosion activities suggested that the addition of nitrate resulted in microbial communities that vary in activities and metabolic gene functions. Interactome Screening The use of the microbial interactome approach and the addition of nitrate into culture media enabled the discovery of microbial community pools that inhibited production of corrosive APB metabolites or promoted growth of non-corrosive species that outcompeted the APB. Culturing serially diluted and replicated APB consortia resulted in microbial communities that varied in APB activities among the different dilution series as well as within the same dilution. This was reflected from differences in cell densities and in pH ranges based on BTB indicator color variations (Fig. 2 ). It is assumed that differences would not occur within inocula cultured from the same dilution series, as this is routinely used to determine cell densities and numbers. However, differences could happen due to the random distribution of microbes into the different wells of the same plate, representing random ecological distribution in the real environment. Differences in OD readings and pH ranges were also observed during growth in the presence and absence of nitrate. The differences were more prominent in the higher dilution series as well as in the absence of nitrate. More yellow BTB coloration (low pH) was observed in the absence of nitrate. According to the supplier’s database providing pH indicator color ranges, the observed BTB color repertoire include bright yellow (strongly acidic with pH < 6.0), yellow-green (slightly acidic with pH ~ 6.0), green (neutral with pH 6.5-7.0), blue-green (slightly basic with pH 7.0-7.6), light blue (weakly basic with pH 7.6-8.0), and deep blue (strongly basic with pH > 8.0). BTB has been used as a pH indicator to identify microbial activities, which turns the culture media yellow in an acidic environment, created by active APB growth, or into blue in a neutral or alkaline environment during growth of non-APB, thus allowing for visual detection of interactome activities (Jia et al. 2023 ; Kumari et al. 2023 ). None of the cultures in the microtiter plate wells showed bright yellow color in the presence of nitrate at any of the dilution series (second row of microtiter plates) whereas several wells showed this color in the absence of nitrate (first row of microtiter plates), suggesting the inhibitory effect of nitrate on acidification of the culture media. More acidic conditions were observed at increased cell dilutions than less diluted samples, suggesting a more random distribution of a specific species at increased dilutions. An increase in OD reading was also observed for less diluted samples than higher dilutions, possibly due to interferences from the sludge samples or due to availability of extra trace nutrients from the sludge that promoted higher cell growth. The high OD 600 reading observed in the presence of nitrate is not due to such effects as the samples were treated equally regardless of nitrate addition. The growth could be due to the competitive advantage of nitrate reducing bacteria (NRB) to overgrow APB or due to change in redox potential of the culture media in the presence of nitrate. A total of 29 interactomes from nitrate-amended and 60 from unamended cultures showing relatively green to bright blue colors and a high OD 600 reading were selected and re-evaluated for growth and BTB color indication using freshly prepared culture media. The incubation period was increased from one to two weeks to give the cells enough time for complete fermentation of dextrose and acidification of the media. Similar to the results of the initial observation, none of the selected interactome from the nitrate amended culture showed a bright yellow BTB coloration (Fig. 3 ). Nearly all the interactomes in the presence of nitrate also showed growth and light blue or blue green BTB coloration. Conversely, most of the selected interactomes (46 out of 60) showed bright yellow coloration in the absence of nitrate. About 13 of these interactomes showed growth and green or yellow green coloration whereas none of them (except one of the wells with no growth observed) showed deep blue or light blue coloration during growth in the absence of nitrate. Only one of the unamended interactomes (circled in red in Fig. 3 ) showed a high cell density and blue green BTB coloration in the absence of nitrate suggesting nitrate’s importance in controlling APB activities. Regardless of the presence or absence of nitrate, the APB interactome study showed heterogeneity in distribution of a microbial community from the same inoculum source. Heterogeneity in a microbial population from the same culture has been previously described by many authors (Almela et al. 2021 ; Davis and Isberg 2016 ; Kim et al. 2015 ). Such heterogeneity could be due to genotypic or phenotypic differences. Genotypic differences occur due to allelic variation whereas phenotypic differences could be due to differential gene expressions driven by stochastic fluctuations or due to environmental changes such as resource limitations or stress factors (Davis and Isberg 2016 ). The heterogeneity of APB interactomes in the present study could be due to phenotypic differences since such many allelic variations were not expected during the two weeks incubation times. Corrosion Analysis of Beads Corrosivity of the selected APB interactomes was monitored using carbon steel beads in microtiter plates. Carbon steel spherical beads, instead of coupons, are particularly ideal to monitor corrosion in small volumes due to their contact with the surrounding medium on all sides (Voordouw et al. 2016 ). A total of 20 interactomes were selected from each culture grown in the absence or presence of nitrate. The interactomes were named based on the dilution series, presence or absence of nitrate, plate number, and well number. For instance, 10-1NP1A5 represents an interactome obtained from 10 − 1 serial dilution in the presence of nitrate, in microtiter plate 1, and well number 5. The selected interactomes were mostly those cultures showing at least pH ~ 6.0 and above (yellow green to blue BTB coloration) as these are candidates that could counteract corrosive APB activities. Some interactomes showing pH < 6 (strongly acidic with bright yellow BTB color) were included as controls to compare corrosion activities with non-corrosive interactomes. These include interactomes 10-1P1A1, 10-3P1A5, 10-4P3D2, and 10-5P2A4, for culture media without nitrate. Only one interactome (10-3NP1B2) showing yellow green BTB color (slightly acidic with pH ~ 6.0) was included as control for culture media with nitrate since none of the interactome showed a strongly acidic condition. Weight loss corrosion analysis of the beads showed differences among the selected interactomes between and within each dilution. The interactomes with blue or green BTB colors showed less corrosion than those showing yellow BTB colors (Fig. 4 ). The highest weight loss corrosion (1.76 mg) was observed in interactome without a nitrate addition (10-5P2A4) (Fig. 4 a). This interactome produced a strongly acidic condition, with a bright yellow BTB color. The lowest weight loss corrosion (0.51 mg) among cultures grown in the absence of nitrate was obtained from interactome designated as 10-4P1D5. This is the only interactome that showed the highest OD 600 reading and green BTB coloration in the absence of nitrate as highlighted above in Fig. 3 . From cultures grown in the presence of nitrate, the highest weight loss corrosion (0.6 mg) was observed for interactomes designated as 10-3NP1B2, followed by 10-3NP1A2 and 10-3NP1A3 (Fig. 4 b). The lowest weight loss corrosion was observed for the culture designated as 10-2NP1D6 (no weight loss), followed by cultures 10-2NP2A1 (0.08 mg), 10-3NP1C2 (0.09 mg), 10-4NP2C1 (0.1 mg), 10-3NP1C1 (0.11 mg), and 10-3NP1B1 (0.12 mg). Generally, a higher weight loss from corrosion was observed in the absence of nitrate (1.02 average mg weight loss) compared to interactomes grown in the presence of nitrate (0.3 mg average weight loss) which is about 3.5-fold corrosion inhibition by nitrate. The corrosion data corroborates with the suppressed pH reduction detected in the presence of nitrate, supporting the importance of nitrate in controlling corrosivity from APB activities. Visual observation of the interactome activities in microtiter plates indicated more corrosion product deposits with interactomes that grew in the absence than in the presence of nitrate (Online resource 1). This is in agreement with the observed decrease in pH and higher corrosion activities of interactomes grown in the absence of nitrate. Corrosion product deposits are indicated by the precipitation of yellowish brown or brown corrosion products such as iron carbonate (Hussein 2023 ) in the culture media. Overall, nitrate addition resulted in a relatively neutral culture pH condition, low corrosion weight loss, and less corrosion product deposit. Corrosion Analysis of Coupons The calculated corrosion rates of C1018 carbon steel coupons were used to validate the inhibitory effect of nitrate on APB activities. The experiment was conducted in a bigger volume of the same culture media described above using either an APB consortium or a pure isolate of APB ( C. acetobutylicum ) in the presence or absence of nitrate. C. acetobutylicum is a model acid producing anaerobic bacteria used for monitoring corrosion activities induced by APB (Fida et al. 2024 ; Rouvre and Basseguy 2016 ; Zhu 2007 , 2008 ). The isolate is also used for industrial-scale production of organic acids through a process of fermentation (Herman et al. 2017 ). The acid produced by this isolate could cause a drop in the pH of culture media to as low as 4 during acidogenesis process (Gottwald and Gottschalk 1985 ; Monot et al. 1984 ; Wang et al. 2023 ). An average corrosion rate (mm/y) of 0.148 ± 0.004 and 0.085 ± 0.041 were observed in the absence of nitrate for APB consortia and C. acetobutylicum , respectively, whereas these were 0.037 ± 0.026 and 0.028 ± 0.001 in the presence of nitrate, respectively for APB consortia and C. acetobutylicum (Fig. 5 ). A higher corrosion rate was observed with APB consortia compared to the pure isolate in the absence of nitrate. Nitrate addition significantly inhibited the corrosion rate for both culture types. This corroborates with the weight loss inhibitory effect of nitrate observed with the beads indicated above. Cell Growth and pH Changes The pH values of the serum bottle samples were obtained at the end of the incubation period whereas OD values were recorded during active cell growth until a stationary growth phase was reached. Similar to the observations in microtiter plates indicated above, nitrate addition showed a significant inhibitory effect on acid production by both APB consortia and C. acetobutylicum . Average pH values of 5.38 ± 0.05 and 6.24 ± 1.12 were observed in the absence of nitrate for APB consortia and C. acetobutylicum , respectively, whereas these were 8.37 ± 0.10 and 8.4 ± 0.22 in the presence of nitrate, respectively for APB consortia and C. acetobutylicum (Fig. 6 a). The APB consortia showed a relatively lower pH value compared to C. acetobutylicum in the absence of nitrate. Cell growth was monitored in a separate but similar experiment during active growth stages to determine if nitrate is inducing lag phase in cell growth. Growth was not inhibited in the presence of nitrate for both culture types (Fig. 6 b) suggesting that the inhibitory effect of nitrate is at the stage of acidogenesis during growth of APB. The increased pH observed in the presence of nitrate for both cultures also corroborate with the decreased corrosion rate of carbon steel coupons. Analysis of Organic Acid Production Culture supernatant fluids were analyzed from the serum bottle studies to determine the concentration of organic acids produced during growth of APB in the presence and absence of carbon steel coupons or nitrate. Interestingly, nitrate significantly inhibited the accumulation of organic acids in both APB consortia and C. acetobutylicum cultures (Fig. 7 ). The inhibitory effect was more pronounced for C. acetobutylicum . An average accumulation (4,415 mg/L) of organic acids (2,623; 805; 707; 235; and 45 mg/L of lactate, formate, acetate, propionate and butyrate, respectively) was observed in the absence of nitrate during growth of APB consortia. This accounts for 88% of the dextrose added to the culture. In the presence of nitrate, a concentration of 1,624 mg/L total organic acids (1,178; 101; 264; 48; and 33 mg/L for lactate, formate, acetate, propionate, and butyrate, respectively) was observed during growth of APB consortia, accounting for 35.5% of the dextrose used. Lactate was the dominant organic acid observed during growth of APB consortia. For C. acetobutylicum , a total of 2,505 mg/L (420; 516; 1,185; and 384 mg/L lactate, formate, acetate and butyrate, respectively) was observed in the absence of nitrate, accounting for 50% of the dextrose added compared to 68 mg/L (32; 19; and 17 mg/L of lactate, acetate, and butyrate, respectively) in the presence of nitrate, accounting for about 1.4% of the dextrose added. Acetate was the dominant organic acid observed during growth of C. acetobutylicum. Propionate was not observed regardless of nitrate addition whereas formate was not observed in the presence of nitrate during growth of C. acetobutylicum . The decrease in organic acid production is in agreement with many studies showing decrease of volatile fatty acids, such as propionate and butyrate production, without microbiota growth inhibitory effect in ruminant animals fed with dietary nitrate (Farra and Satter 1971 ; Olijhoek et al. 2016 ; Vadroňová et al. 2023 ; Yang et al. 2016 ). The accumulation of organic acids is in agreement with the reduction of pH in the culture media and the increase in corrosion rates induced by APB activities. The organic acids produced by APB undergo reactions with metals by either the action of protons or chelation with metal ions. In combination with the biofilms formed by APB, these acids promote corrosion of metals through various mechanisms involving destabilizing the protective films/coatings formed on the material surface, modification of localized environment at the metal/solution interface, localized galvanic corrosion, stress corrosion cracking, removal or utilization of corrosion inhibitors as carbon and energy source for growth, and/or the initiation of pitting attack (Khouzani et al. 2019 ; Madirisha et al. 2022 ). Although the role of APB in combination with SRB in corrosive environments is still unclear, the produced organic acids by APB, if not controlled, could be used as electron donors for reduction of sulfate to sulfide by the surrounding SRB environment (Madirisha et al. 2022 ). This might aggravate MIC corrosion in environments where these two organisms are thriving. Microbial Community Analysis Microbial diversity decreased slightly in the presence of nitrate during biofilm growth on carbon steel coupons. The average Shannon diversity was 5.16 and 4.92 in the absence and presence of nitrate, respectively. Klebsiella (K aerogenes) and Pantoea (P. agglomerans) are the dominant taxa observed in the samples regardless of nitrate source (Fig. 8 and online resource 2). Both of these microbes have been identified as abundant within various environments including soil, wastewater treatment plants, and the human gastrointestinal tract (Kelly et al. 2021 ; Lorenzi et al. 2022 ; Sanmartín et al. 2021 ). However, the relative abundance of acid producing Clostridium increased to 15% in the samples incubated in the absence of nitrate compared to the relative abundance (1%) in presence of nitrate. This suggests and confirms the suppressive effect of nitrate on APB activities. Clostridium is a well-known APB capable of dropping the pH culture media and increasing corrosion of steel infrastructure (Gottwald and Gottschalk 1985 ; Herman et al. 2017 ; Madirisha et al. 2022 ). Sporolactobacillus was observed as one of the dominant microbes (13% relative abundance) in the presence of nitrate compared to the abundance (1%) in the absence of nitrate. This microbial taxa is known to produce antimicrobial agents, such as bacteriocin, which provide growth advantage by inhibiting the growth and reproduction of competing microbes (Guo et al. 2024 ; Yadav et al. 2019 ). The decreased relative abundance of Clostridium and the enrichment of microbes with the potential of producing inhibitory agents could partially explain the decreased corrosion rate observed in the presence of nitrate. qPCR Analysis The abundance of 16S rRNA and metabolic genes ( ackA and bukA ) were monitored and compared between APB consortia and C. acetobutylicum grown in the presence and absence of nitrate. 16S rRNA was used to estimate the number of cells per mL and to evaluate if there are differences in cell growth as the abundance of this gene is mostly related to cell biomass and is constitutively expressed. The ackA and bukA genes play roles in acetate and butyrate metabolism, respectively, during fermentation of organic carbons and are commonly used to detect APB activities involved in MIC (Davis et al. 2024 ; Mand et al. 2014 ; Zhu 2007 , 2008 ). 16S rRNA analysis indicated no significant differences in copy number between APB consortia grown in the presence (6.55 x 10 8 ± 7.67 x 10 7 copies/mL) and absence (4.04 x 10 8 ± 8.0 x 10 7 copies/mL) of nitrate (Fig. 9 ). However, the 16S rRNA copy number of C. acetobutylicum decreased in the presence of nitrate (8.82 x 10 6 ± 6.74 x 10 6 ) compared to the absence of nitrate (2.040 x 10 8 ± 1.68 x 10 8 copies/mL). No differences were observed in ackA and bukA copy number for the APB consortia grown in the presence or absence of nitrate. A higher copy number of ackA than bukA was observed in the APB consortia regardless of nitrate addition, possibly due to differences in gene copies in the genomes of the consortia. The copy number of ackA or bukA genes are significantly lower in APB consortia compared to that of 16S rRNA copy number. This is likely due to the enrichment of bacteria that do not have ackA or bukA genes or due to more copies of 16S rRNA per cell. In agreement with the 16S rRNA data, lower copy numbers of ackA and bukA were observed during growth of C. acetobutylicum in the presence than absence of nitrate. No differences were observed between ackA and bukA gene copy numbers in the presence or absence of nitrate. Similar to the APB consortia, the copy numbers of ackA and bukA genes are lower than that of 16S rRNA for C. acetobutylicum . Unlike the APB consortia all the cells of C. acetobutylicum are expected to have both genes. The increased copy number of 16S rRNA relative to the metabolic genes could be due to a greater number of gene copies in the genome. C. acetobutylicum contains about 11 copies of 16S rRNA in the genome (Feliu-Paradeda et al. 2023 ). Transcriptome analysis is suggested to compare the catabolic gene expression in the presence and absence of nitrate as targeting the DNA might not truly differentiate between actively growing and damaged or dead cells. Conclusion The present study identified the importance of nitrate in modulating microbial interaction and inhibition of APB activities. Multiple lines of evidence from the interactome studies suggest that nitrate has an inhibitory effect on the corrosivity of APB activities. The serum bottle and microtiter plate experiments showed that nitrate addition inhibited APB-induced corrosion by preventing acidic conditions without inhibiting cell growth. Regardless of nitrate addition, the APB interactome study also showed heterogeneity in microbial distribution from the same inoculum source. This is in agreement with many studies showing the heterogeneity of microbial population from the same sources during growth on the same culture media (Almela et al. 2021 ; Davis and Isberg 2016 ). Interestingly, the pH of culture media did not decrease (more blue or green BTB coloration) in the presence of nitrate as much as in the absence of nitrate. This is possibly due to the inhibitory effect of nitrate on APB activities or the competitive advantage of NRB community growth. Nitrate has been used to control oil and gas reservoir souring by SRB (Voordouw et al., 2009) but has not been reported as an inhibitor of APB activities. The mechanism of SRB inhibition of nitrate includes enrichment of NRB which inhibits SRB by outcompeting with them for electron donors and increasing the redox potential. NRB also produces nitrite as a metabolite product of nitrate reduction, which is an inhibitor of the dissimilatory sulfite reductase enzyme (Dsr) responsible for the reduction of sulfite to sulfide (Fida et al., 2016; Voordouw et al., 2009). The inhibitory effect of nitrite was not explored in this study. However, its accumulation was not observed in the culture media when tested using a nitrite assay Griess reagent according to the manufacturer’s instruction (Sigma Aldrich). Nitrate also has been reported as an inhibitor of methane production in ruminant animals and has no negative effects on rumen fermentation and microbial protein synthesis (Olijhoek et al. 2016 ; Vadroňová et al. 2023 ; Zhao et al. 2018 ). This is in agreement with the present study showing no inhibitory effect of nitrate on APB cell growth. Studies indicated that the methanogenesis inhibitory effect of nitrate is accompanied by accumulation of hydrogen as a fermentation product of acetate and butyrate producing bacteria (Klüber and Conrad 1998 ; Yang et al. 2016 ). The effect of hydrogen accumulation and methanogenesis inhibitory effect of nitrate has also been reported for soil slurries from rice fields (Klüber and Conrad 1998 ). The mechanism of nitrate’s inhibitory effect on APB or methanogenesis is poorly understood. The suggestion is that nitrate enriches NRB which competes with APB or methanogens for nutrients or biohydrogenation, that nitrate reduction is thermodynamically favorable over methanogenesis and biohydrogenation, and that nitrate results in an increase of redox potential in culture media (Klüber and Conrad 1998 ; Yang et al. 2016 ). In addition to this, the effects of interactomes on APB activities could also encompass a complex network of interactions between microorganisms and their biotic and abiotic environments, and often involves metabolic exchanges, signaling pathways, genetic transfers, and symbiotic or competitive relationships (Geesink et al. 2024 ). In an environment with limited resources, microbial interaction helps the consortia to coordinate nutrient cycling through syntrophy, where one species’ waste becomes another’s carbon and energy source (Geesink et al. 2024 ).This study identified that the addition of nitrate to APB culture decreased organic acid production, and hence inhibited APB-induced corrosion without inhibiting overall cell growth. Nitrate addition also proportionally decreased the abundance of NRB communities implicated in the pH drop of culture media. The findings from this study indicated the importance of nitrate addition to control APB activities as a novel, economically viable, and environmentally sustainable strategy. Further molecular studies, such as differential gene expressions are warranted to elucidate the molecular mechanisms of inhibition. Declarations Funding and Acknowledgement. This work was supported by the US Army Corp of Engineers Engineering Research and Development Center Construction Engineering Research Laboratory under Contract No. W9132T22C0023. Any opinions, findings and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the US Army Corp of Engineers Engineering Research and Development Center Construction Engineering Research Laboratory. Data availability. The datasets used in this manuscript are available from the corresponding author upon request. Ethics approval. This is not applicable. Consent to participate. This is not applicable. Consent to publish . This is not applicable. Competing Interests. The authors have no relevant financial or non-financial interests to disclose. Author Contributions. All authors contributed to the study conception and design. Conceptualization, methodology, writing original draft of the manuscript was done by TTF. Material preparation, data collection, and analysis were performed by TTF, TR, MH, SL, and KC. RW edited the manuscript. All authors reviewed and commented on previous versions of the manuscript. All authors read and approved the final manuscript. References Almela P, Justel A, Quesada A (2021) Heterogeneity of Microbial Communities in Soils From the Antarctic Peninsula Region. Front Microbiol 12. doi:10.3389/fmicb.2021.628792 Balakrishnan A, Govindaraj S, Dhaipule NGK, Thirumalaisamy N, Anne RS, Sublime N, Philip J (2024) Enhancing microbiologically influenced corrosion protection of carbon steels with silanized epoxy-biocide hybrid coatings. Environ Sci Pollut Res 31(9): 13302-13326. doi:10.1007/s11356-024-32014-9 Bassler BL, Losick R (2006) Bacterially speaking. Cell 125(2): 237-246. doi:10.1016/j.cell.2006.04.001 Callbeck C, Agrawal A, Voordouw G (2013) Acetate production from oil under sulfate-reducing conditions in bioreactors injected with sulfate and nitrate. Appl Environ Microbiol 79(16): 5059-5068. doi:10.1128/aem.01251-13 Davis JA, Chinthala SP, Monty-Bromer CN, Senko JM (2024) Electrochemical detection of carbon steel corrosion induced by fermentative bacteria from natural gas transmission lines. Environ Microbiol Rep 16(6): e70058. doi:10.1111/1758-2229.70058 Davis K, Isberg R (2016) Defining heterogeneity within bacterial populations via single cell approaches. BioEssays 38(8): 782-790. doi:https://doi.org/10.1002/bies.201500121 de Lorenzo V (2008) Systems biology approaches to bioremediation. Curr Opin Biotechnol 19(6): 579-589. doi:https://doi.org/10.1016/j.copbio.2008.10.004 Demin KA, Prazdnova EV, Minkina TM, Gorovtsov AV (2024) Sulfate-reducing bacteria unearthed: ecological functions of the diverse prokaryotic group in terrestrial environments. Appl Environ Microbiol 90(4): e01390-01323. doi:doi:10.1128/aem.01390-23 Dong Y, Jiang B, Xu D, Jiang C, Li Q, Gu T (2018) Severe microbiologically influenced corrosion of S32654 super austenitic stainless steel by acid producing bacterium Acidithiobacillus caldus SM-1. Bioelectrochemistry 123: 34-44. doi:https://doi.org/10.1016/j.bioelechem.2018.04.014 Enning D, Garrelfs J (2014) Corrosion of iron by sulfate-reducing bacteria: new views of an old problem. Appl Environ Microbiol 80(4): 1226-1236. doi:10.1128/AEM.02848-13 Falk MW, Song KG, Matiasek MG, Wuertz S (2009) Microbial community dynamics in replicate membrane bioreactors--natural reproducible fluctuations. Water Res 43(3): 842-852. doi:10.1016/j.watres.2008.11.021 Farra PA, Satter LD (1971) Manipulation of the ruminal fermentation. III. Effect of nitrate on ruminal volatile fatty acid production and milk composition. J Dairy Sci 54(7): 1018-1024. doi:https://doi.org/10.3168/jds.S0022-0302(71)85965-9 Feliu-Paradeda L, Puig S, Bañeras L (2023) Design and validation of a multiplex PCR method for the simultaneous quantification of Clostridium acetobutylicum, Clostridium carboxidivorans and Clostridium cellulovorans . Scientific Reports 13(1): 20073. doi:10.1038/s41598-023-47007-w Fida T, Austin L, Leleika S, Rambo T, Crippen K (2024) Development of Molecular Probe for Iron Reducing and Thiosulfate Reducing Bacteria. Paper presented at the AMPP CORROSION, New Orleans, Louisiana. Fida T, Sharma M, Shen Y, Voordouw G (2021) Microbial sulfite oxidation coupled to nitrate reduction in makeup water for oil production. Chemosphere 284: 131298. doi:10.1016/j.chemosphere.2021.131298 Geesink P, ter Horst J, Ettema TJG (2024) More than the sum of its parts: uncovering emerging effects of microbial interactions in complex communities. FEMS Microbiology Ecology 100(4). doi:10.1093/femsec/fiae029 Gottwald M, Gottschalk G (1985) The internal pH of Clostridium acetobutylicum and its effect on the shift from acid to solvent formation. Arch Microbiol 143(1): 42-46. doi:10.1007/BF00414766 Gu T, Galicia B (2012) Can acid producing bacteria be responsible for very fast MIC pitting? Paper presented at the CORROSION 2012, Salt Lake City, Utah. Guo X, Yu L, Xiao M, Zang X, Zhang C, Narbad A, Chen W, Tian F, Zhai Q (2024) Sporolactobacillus- a new functional genus with potential applications. Curr Res Food Sci 9: 100822. doi:10.1016/j.crfs.2024.100822 Gupta S, Anand S (2018) Induction of pitting corrosion on stainless steel (grades 304 and 316) used in dairy industry by biofilms of common sporeformers. Inte J Dairy Technol 71(2): 519-531. doi:https://doi.org/10.1111/1471-0307.12444 Herman NA, Kim SJ, Li JS, Cai W, Koshino H, Zhang W (2017) The industrial anaerobe Clostridium acetobutylicum uses polyketides to regulate cellular differentiation. Nat Commun 8(1): 1514. doi:10.1038/s41467-017-01809-5 Hussein A. (2023) Essentials of flow assurance solids in oil and gas operations. In Hussein A (Ed.), (pp. 199-296): Gulf Professional Publishing. Javaherdashti R (2023) Editorial: Microbiologically influenced corrosion (MIC): its mechanisms, technological, economic, and environmental impacts. Front Microbiol 14. doi:10.3389/fmicb.2023.1249565 Jia L, Sun W, Li W, Dong Y, Wu L, Saldaña MDA, Gao Y, Jin Y, Sun W (2023) A colour indicator film based on bromothymol blue/poly-L-lactic acid/polyvinylpyrrolidone for detecting bacteria. Packag Techn Sci 36(7): 549-556. doi:https://doi.org/10.1002/pts.2726 Jia R, Unsal T, Xu D, Lekbach Y, Gu T (2019) Microbiologically influenced corrosion and current mitigation strategies: A state of the art review. Int Biodeterior Biodegradation 137: 42-58. doi:https://doi.org/10.1016/j.ibiod.2018.11.007 Justice NB, Sczesnak A, Hazen TC, Arkin AP (2017) Environmental selection, dispersal, and organism interactions shape community assembly in high-throughput enrichment culturing. Appl Environ Microbiol 83(20): e01253-01217. doi:doi:10.1128/AEM.01253-17 Kelly JJ, London MG, McCormick AR, Rojas M, Scott JW, Hoellein TJ (2021) Wastewater treatment alters microbial colonization of microplastics. PLoS One 16(1): e0244443. doi:10.1371/journal.pone.0244443 Khouzani MK, Bahrami A, Hosseini-Abari A, Khandouzi M, Taheri P (2019) Microbiologically influenced corrosion of a pipeline in a petrochemical plant. Metals 9(4): 459. Kim M, Cho A, Lim HS, Hong SG, Kim JH, Lee J, Choi T, Ahn TS, Kim O-S (2015) Highly heterogeneous soil bacterial communities around Terra Nova Bay of Northern Victoria land, Antarctica. PLoS One 10(3): e0119966. doi:10.1371/journal.pone.0119966 Kip N, van Veen JA (2015) The dual role of microbes in corrosion. The ISME Journal 9(3): 542-551. doi:10.1038/ismej.2014.169 Klüber HD, Conrad R (1998) Effects of nitrate, nitrite, NO and N 2 O on methanogenesis and other redox processes in anoxic rice field soil. FEMS Microbiol Ecol 25(3): 301-318. doi:10.1111/j.1574-6941.1998.tb00482.x Kumari A, Mihooliya KN, Sahoo DK, Bhattacharyya MS, Prasad GS, Pinnaka AK (2023) Description of lipase producing novel yeast species Debaryomyces apis f.a., sp. nov. and a modified pH indicator dye-based method for the screening of lipase producing microorganisms. Scientific Reports 13(1): 11819. doi:10.1038/s41598-023-38241-3 Li J, Chen L, Wei B, Xu J, Wei B, Sun C (2024) Microbiologically influenced corrosion of circulating cooling systems in power plants – A review. Arab J Chem 17(2): 105529. doi:https://doi.org/10.1016/j.arabjc.2023.105529 Little BJ, Blackwood DJ, Hinks J, Lauro FM, Marsili E, Okamoto A, Rice SA, Wade SA, Flemming HC (2020) Microbially influenced corrosion-Any progress? Corros Sci 170: 108641. doi:https://doi.org/10.1016/j.corsci.2020.108641 Lorenzi AS, Bonatelli ML, Chia MA, Peressim L, Quecine MC (2022) Opposite sides of Pantoea agglomeran s and its associated commercial outlook. Microorganisms 10(10): 2072. Madirisha M, Hack R, van der Meer F (2022) The role of organic acid metabolites in geo-energy pipeline corrosion in a sulfate reducing bacteria environment. Heliyon 8(5): e09420. doi:10.1016/j.heliyon.2022.e09420 Mand J, Park HS, Jack TR, Voordouw G (2014) The role of acetogens in microbially influenced corrosion of steel. Front Microbiol 5(268): 1-14. doi:10.3389/fmicb.2014.00268 Monot F, Engasser J-M, Petitdemange H (1984) Influence of pH and undissociated butyric acid on the production of acetone and butanol in batch cultures of Clostridium acetobutylicum . Appl Microbiol Biotechnol 19(6): 422-426. doi:10.1007/BF00454381 Ofiţeru ID, Lunn M, Curtis TP, Wells GF, Criddle CS, Francis CA, Sloan WT (2010) Combined niche and neutral effects in a microbial wastewater treatment community. PNAS 107(35): 15345-15350. doi:doi:10.1073/pnas.1000604107 Ogawa A, Takakura K, Hirai N, Kanematsu H, Kuroda D, Kougo T, Sano K, Terada S (2020) Biofilm formation plays a crucial rule in the initial step of carbon steel corrosion in air and water environments. Materials 13(4): 923. Olijhoek DW, Hellwing ALF, Brask M, Weisbjerg MR, Højberg O, Larsen MK, Dijkstra J, Erlandsen EJ, Lund P (2016) Effect of dietary nitrate level on enteric methane production, hydrogen emission, rumen fermentation, and nutrient digestibility in dairy cows. J Dairy Sci 99(8): 6191-6205. doi:https://doi.org/10.3168/jds.2015-10691 Omar S, Khalil N, EL-Ahwany A, El-Sayed H, Arafat S (2021) Mitigation of microbiologically induced corrosion (MIC) and preventive strategies. . In (Vol. 3: pp. Vol. 3, 1-11): Res Trends Microbiol. Ramos Monroy OA, Ruiz Ordaz N, Hernández Gayosso MJ, Juárez Ramírez C, Galíndez Mayer J (2019) The corrosion process caused by the activity of the anaerobic sporulated bacterium Clostridium celerecrescens on API XL 52 steel. Environ Sci Pollut Res 26(29): 29991-30002. doi:10.1007/s11356-019-06064-3 Rouvre I, Basseguy R (2016) Exacerbation of the mild steel corrosion process by direct electron transfer between [Fe-Fe]-hydrogenase and material surface. Corros Sci 111: 199-211. doi:https://doi.org/10.1016/j.corsci.2016.05.005 Sanmartín P, Bosch-Roig P, Gulotta D, Fort R, Bosch I, Cappitelli F (2021) Klebsiella aerogenes and Comamonas testosteroni as bioremoval agents on graffiti-coated concrete and granite: Impact assessment through surface analysis. Int Biodeter Biodegr 161: 105244. doi:https://doi.org/10.1016/j.ibiod.2021.105244 Telegdi J, Shaban A, Trif L (2020) Review on the microbiologically influenced corrosion and the function of biofilms. Inter J Corros Scale Inhibi 9(1): 1-33. Tshikantwa TS, Ullah MW, He F, Yang G (2018) Current trends and potential applications of microbial interactions for human welfare. Front Microbiol 9. doi:10.3389/fmicb.2018.01156 Vadroňová M, Šťovíček A, Jochová K, Výborná A, Tyrolová Y, Tichá D, Homolka P, Joch M (2023) Combined effects of nitrate and medium-chain fatty acids on methane production, rumen fermentation, and rumen bacterial populations in vitro. Sci Rep 13(1): 21961. doi:10.1038/s41598-023-49138-6 Videla HA, Herrera LK (2005) Microbiologically influenced corrosion: looking to the future. Int Microbiol 8(3): 169-180. Voordouw G, Menon P, Pinnock T, Sharma M, Shen Y, Venturelli A, Voordouw J, Sexton A (2016) Use of homogeneously-sized carbon steel ball bearings to study microbially-influenced corrosion in oil field samples. Front Microbiol 7. doi:10.3389/fmicb.2016.00351 Wang X, Sun H, Wang Y, Wang F, Zhu W, Wu C, Wang Q, Gao M (2023) Feasibility of efficient, direct, butanol production from food waste without nutrient supplement by Clostridium saccharoperbutylacetonicum N1-4. Sustainability 15(7): 6061. Wang Z, Li Y, Ren J, Xu W, Yang L (2022) Investigating the effects of environment, corrosion degree, and distribution of corrosive microbial communities on service-life of refined oil pipelines. Environ Sci Pollut Res 29(34): 52204-52219. doi:10.1007/s11356-022-19556-6 Yadav MK, Singh B, Tiwari SK (2019) Comparative analysis of inhibition-based and indicator-independent colorimetric assay for screening of bacteriocin-producing lactic acid bacteria. Probiotics Antimicro 11(2): 687-695. doi:10.1007/s12602-018-9445-4 Yang C, Rooke JA, Cabeza I, Wallace RJ (2016) Nitrate and inhibition of ruminal methanogenesis: microbial ecology, obstacles, and opportunities for lowering methane emissions from ruminant livestock. Front Microbiol 7: 132. doi:10.3389/fmicb.2016.00132 Zhao L, Meng Q, Li Y, Wu H, Huo Y, Zhang X, Zhou Z (2018) Nitrate decreases ruminal methane production with slight changes to ruminal methanogen composition of nitrate-adapted steers. BMC Microbiol 18(1): 21. doi:10.1186/s12866-018-1164-1 Zhu X (2007) Rapid quantification of butyric acid-producing bacteria using real-time PCR. In: Google Patents: US7276358B1. Zhu X (2008) Rapid quantification of acetic acid-producing bacteria using real-time PCR. In: Google Patents US7384770B1. Supplementary Files SupplementaryInformation.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6770932","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":467458538,"identity":"4cd8e69b-ad16-4f25-b58f-1936adaeda3f","order_by":0,"name":"Tekle Tafese Fida","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxUlEQVRIiWNgGAWjYDAC5oMNEgwVDAxsROvgYUsEajnDIEGKlgQGCcY2Bgni3WXPxtx44+e82jo+BuZjDz7uqU1sIGwLY7Nl77bjQIexpRvOeHacCC3yjW0SvNuOAbXwmEnzHDhGlC1tkn/ngLTwf5P+Q6wWad6GGpAtbNIMB2qI0HKMsdla5tgByTZmNjPJngMHjAlqYW9jf3jzTU0dv3x78zOJHwfqZAlqgYLDwGQAYTgSq6UOzrAnUscoGAWjYBSMIAAAQJs57G6OsSUAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-2223-8522","institution":"GTI Energy","correspondingAuthor":true,"prefix":"","firstName":"Tekle","middleName":"Tafese","lastName":"Fida","suffix":""},{"id":467458539,"identity":"18e7e4bb-3793-458b-ba1c-3b05302aacf0","order_by":1,"name":"Taylor Rambo","email":"","orcid":"","institution":"GTI Energy","correspondingAuthor":false,"prefix":"","firstName":"Taylor","middleName":"","lastName":"Rambo","suffix":""},{"id":467458540,"identity":"f894a76c-5588-4de8-ae4b-d4ca69bf731a","order_by":2,"name":"Marie Hall","email":"","orcid":"","institution":"GTI Energy","correspondingAuthor":false,"prefix":"","firstName":"Marie","middleName":"","lastName":"Hall","suffix":""},{"id":467458541,"identity":"bdc6f3c9-cb0d-4236-8f7c-da0e82e34afc","order_by":3,"name":"Rebekah Wilson","email":"","orcid":"","institution":"CIV USARMY CEERD-CERL","correspondingAuthor":false,"prefix":"","firstName":"Rebekah","middleName":"","lastName":"Wilson","suffix":""},{"id":467458542,"identity":"b4d6a3d1-ad89-4d9c-b124-55041884a62d","order_by":4,"name":"Scott Leleika","email":"","orcid":"","institution":"GTI Energy","correspondingAuthor":false,"prefix":"","firstName":"Scott","middleName":"","lastName":"Leleika","suffix":""},{"id":467458543,"identity":"855f1f04-9f6e-4590-a4fb-456647aeb0d9","order_by":5,"name":"Karen Crippen","email":"","orcid":"","institution":"GTI Energy","correspondingAuthor":false,"prefix":"","firstName":"Karen","middleName":"","lastName":"Crippen","suffix":""}],"badges":[],"createdAt":"2025-05-28 20:26:41","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-6770932/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6770932/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":84217515,"identity":"c352fced-fe17-424e-917d-9435874799e8","added_by":"auto","created_at":"2025-06-09 10:56:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":346758,"visible":true,"origin":"","legend":"\u003cp\u003eMicrobial interactome study setup in microtiter plate wells for enrichment of APB in the presence or absence of nitrate\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6770932/v1/2204fa37523b960de406db81.png"},{"id":84217754,"identity":"af6b4967-a9bb-4cda-b070-aa9bbd164bae","added_by":"auto","created_at":"2025-06-09 11:04:03","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":621372,"visible":true,"origin":"","legend":"\u003cp\u003eDetection of pH changes using BTB color indicator (upper pictures) and OD\u003csub\u003e600\u003c/sub\u003e value (lower values) of APB interactome replicated from 10\u003csup\u003e-1\u003c/sup\u003e to 10\u003csup\u003e-5\u003c/sup\u003e culture dilution in the absence or presence of nitrate. OD\u003csub\u003e600\u003c/sub\u003e values were highlighted with gradient color indicating light blue for high growth and light red for low growth of culture. The top rows of each column were the control CSBK media not inoculated with cells\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6770932/v1/31664d1e483dff53cfb9e7b8.png"},{"id":84217755,"identity":"cb1f2e6f-f5fb-4264-ad4d-78393d440cb7","added_by":"auto","created_at":"2025-06-09 11:04:03","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":213021,"visible":true,"origin":"","legend":"\u003cp\u003eDetection of pH changes using BTB color indicator (upper pictures) and OD\u003csub\u003e600\u003c/sub\u003e value (lower values) of selected APB interactomes re-grown in the presence or absence of nitrate. OD\u003csub\u003e600\u003c/sub\u003e values were highlighted with gradient color indicating light blue for high cell densities and light red for low cell densities. The last column from each culture is CSBK media not inoculated with cells. An APB interactome that showed growth in the absence of nitrate but did not reduce the pH value is circled in red. Wells with blue color and no OD reading shows absence of growth\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6770932/v1/0ccdf6c64599872dee7f55fa.png"},{"id":84218491,"identity":"f17a9167-4e0e-40f0-b6a4-21548d4cf399","added_by":"auto","created_at":"2025-06-09 11:12:03","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":132147,"visible":true,"origin":"","legend":"\u003cp\u003eWeight loss corrosion of carbon steel beads exposed to selected APB interactomes grown in CSBK media in the absence (A) and presence (B) of nitrate\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6770932/v1/cd8a21d605029acdbbdc2b71.png"},{"id":84217509,"identity":"52556ffc-00fe-4bd2-9d56-200039aac083","added_by":"auto","created_at":"2025-06-09 10:56:03","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":49302,"visible":true,"origin":"","legend":"\u003cp\u003eInhibitory effect of nitrate on culture fluid pH (A) and carbon steel coupon corrosion (B) induced by APB consortia \u003cem\u003eC. acetobutylicum\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6770932/v1/751b02ec70ac75446ecba318.png"},{"id":84217514,"identity":"c232cd91-3252-4f5e-ad71-aaf7d9293a82","added_by":"auto","created_at":"2025-06-09 10:56:03","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":103246,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of nitrate on culture fluid pH (A) and cell growth (B) during growth of APB consortia C. acetobutylicum\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6770932/v1/f0c2e1e7585755f8a870e5d1.png"},{"id":84217756,"identity":"81cffae5-7460-48ce-876e-61df0d65a640","added_by":"auto","created_at":"2025-06-09 11:04:03","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":76904,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of nitrate on organic acid production by APB consortia and C. acetobutylicum during growth on CSBK media containing dextrose\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-6770932/v1/8e4eee5bb0b979f39428bd5b.png"},{"id":84217512,"identity":"f66333fe-f8dc-4152-ac0e-a4e702737dc7","added_by":"auto","created_at":"2025-06-09 10:56:03","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":44496,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of nitrate on the relative abundance of microbial genera determined by 16S rRNA sequencing\u003c/p\u003e","description":"","filename":"floatimage81.png","url":"https://assets-eu.researchsquare.com/files/rs-6770932/v1/027b00913b5b3c31929ab38b.png"},{"id":84217762,"identity":"2d83dbec-e7d3-4d17-9de3-8908d88c0306","added_by":"auto","created_at":"2025-06-09 11:04:04","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":157779,"visible":true,"origin":"","legend":"\u003cp\u003eGene copy number of APB consortia and C. acetobutylicum grown in CSBK media in the presence and absence of nitrate\u003c/p\u003e","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-6770932/v1/af702d70a3fa0a02561d701b.png"},{"id":85337660,"identity":"19629e93-ce69-43a0-8c7e-5e077fe8cce9","added_by":"auto","created_at":"2025-06-24 20:57:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2464857,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6770932/v1/0e1f55d2-7962-44d7-bea9-b5e3be4dfb08.pdf"},{"id":84218492,"identity":"8304fe79-83d3-4f8d-bf9c-0f857a6afa81","added_by":"auto","created_at":"2025-06-09 11:12:03","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":519469,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-6770932/v1/f5a8ebab38cdcdd3913c6f18.docx"}],"financialInterests":"","formattedTitle":"Nitrate Modulates Microbial Interaction and Biocorrosion Activities of Acid Producing Bacteria","fulltext":[{"header":"Introduction","content":"\u003cp\u003e Biocorrosion, also known as microbiologically influenced corrosion (MIC), is the deterioration of metals due to microbial (bacteria, archaea, fungi, and microalgae) activities that compromise the integrity, safety, and reliability of energy delivery or storage infrastructure. MIC can act as a catalytic process in accelerating anodic and/or cathodic corrosion reactions, and it initiates or accelerates other abiotic corrosion processes that impact routine treatments designed to ensure pipeline safety and integrity (Khouzani et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). These impacts include modification of the localized environment at the metal/solution interface, destabilization of protective films/coatings on the metal surface, localized galvanic corrosion, stress corrosion cracking, degradation of corrosion inhibitors, and/or the initiation of pitting attack when microbial adhesion (biofilm) takes place on a metal (Khouzani et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). MIC activities start with the attachment of planktonic cells to the steel infrastructure, where they grow, reproduce, consume nutrients, and produce an extracellular polymer substance known as biofilm (Balakrishnan et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Kip and van Veen \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). This metal-biofilm interface environment differs from the other interfaces in that the pH value is low while the concentration of dissolved oxygen and constituents of organic/inorganic species are high, aggravating pitting corrosion (Telegdi et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In addition to the formation of biofilm, microbes also produce metabolic products, such as acids, sulfides, and other chemical intermediates, that attack the steel infrastructure. While general corrosion management has improved over the past several decades, MIC remains a very high-priority issue. If not monitored and controlled timely, MIC causes catastrophic steel infrastructure failures, health and safety concerns, and great economic losses. Global annual direct cost of corrosion has been estimated at US\u003cspan\u003e$\u003c/span\u003e2.9 trillion (\u003cspan\u003e$\u003c/span\u003e276\u0026nbsp;billion in the United States alone) (Little et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Corrosion due to MIC is estimated at about 20\u0026ndash;50% of overall corrosion costs (Little et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Omar et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Therefore, there is a need to innovate effective, environmentally safe, and economically viable techniques for the prevention of biocorrosion.\u003c/p\u003e \u003cp\u003eAcid-producing bacteria (APB) are one of the MIC-causing microorganisms that play a significant role in corrosion activities. APB produce corrosive metabolic byproducts, such as organic and inorganic acids (sulfuric, lactic, propionic, formic, butyric, and acetic acid), through oxidation or fermentation processes (Davis et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Enning and Garrelfs \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Little et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). These organic acids are also often used as an electron donor for the reduction of sulfate to sulfide by sulfate reducing bacteria (SRB) (Demin et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). APB are the major culprit of corrosion in environments such as oil and gas transporting pipelines and storage facilities, industrial water systems, waste management, and marine infrastructure. The microbes attack metals by forming biofilms and creating localized acidic microenvironments (Javaherdashti \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Ogawa et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). This acidic environment decreases the pH at the metal surface and causes aggressive general corrosion and site-specific pitting corrosion, dissolves protective oxide layers or passivation films, and exposes the underlying material to further chemical or electrochemical attacks (Balakrishnan et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Dong et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Javaherdashti \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). MIC caused by APB can lead to pipeline leaks, structural failures, and costly repairs (Videla and Herrera \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Addressing MIC induced by APB requires a multidisciplinary approach, combining microbiology, materials science, and engineering to develop resilient systems resistant to both microbial colonization and acid-induced corrosion. The most commonly used APB mitigation strategies include pH-neutralizing agents, antimicrobial treatments, and protective coatings to disrupt biofilm formation (Jia et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Little et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, these mitigation strategies are often not successful, or the impacts are temporary due to the formation of biocide-resistant or re-formation of resilient biofilms. This necessitates the need to identify effective, environmentally safe, and economically viable alternatives to prevent MIC activities.\u003c/p\u003e \u003cp\u003eThe use of inherent microbial interaction and manipulation of such interaction to redirect microbial activities and promote growth of non-corrosive communities are of particular interest. This approach is not only an economically viable solution but also an environmentally sustainable strategy. A microbial interactome is the interaction and relationship between two or more microbial species to act on substrate metabolism and biofilm formation (Geesink et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Tshikantwa et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). It encompasses a complex network of interactions between microorganisms and their biotic and abiotic environments, and often involves metabolic exchanges, signaling pathways, genetic transfer, and symbiotic or competitive relationships (Geesink et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In an environment with limited resources, microbial interaction helps the consortia to coordinate nutrient cycling through a process known as syntrophy, where the waste from one species is used as carbon and energy sources for another (Geesink et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Microbial interaction is governed by ecological forces of dispersal, drift, selection, and speciation, resulting in over or under population of specific microorganisms (Bassler and Losick \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Justice et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Microbial interactome studies are gaining momentum in fields such as medicine, agriculture, and biotechnology to optimize microbial activities for specific applications (de Lorenzo \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Tshikantwa et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Studies indicate that highly reproducible communities could be formed from different inocula incubated under similar conditions, or similar inocula incubated under different conditions resulting in divergent or convergent community structure, supporting the evidence of niche-based processes and strong selective forces (Falk et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Ofiţeru et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). We hypothesized that manipulation of such selective forces could result in promotion of microbial community interaction that could be synergistic to enhance growth of MIC competitors or antagonistic to inhibit MIC activities and biofilm formation on metal substrate as a sustainable APB mitigation strategy. In this regard, microbial diversity was manipulated by subsampling a given microbial consortia pool, serially diluting subsamples, and culturing sufficient replicates of each dilution in the presence of nitrate to allow random distribution and growth of microbes. This created many microbial communities with specific species that vary in their membership to act synergistically or antagonistically to modulate APB activities such as acid production and corrosion.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSample Collection\u003c/h2\u003e \u003cp\u003eSamples were collected in 2022 from two different sources (sludge and corrosion debris) and later mixed in the lab to create inocula for enrichment of microbial interactome. An APB consortium was obtained from wet corrosion debris (1 gram) scraped from a failed oil and gas transporting pipeline in California, USA. The sample was collected in a sterile glass bottle with the potential presence of oxygen in the headspace. This sample had active biocorrosive microbial activities, including APB, and had not been treated with biocides. A sludge sample was obtained from a wastewater treatment plant in the Chicago area and used as a source of inoculum to enhance potential APB competitors or antagonists. This sample was collected in a sterile 1-liter Nalgene bottle filled to the brim to exclude air and maintain anaerobic conditions during transportation. The samples were aseptically collected and immediately transported to the lab on ice and stored at 4\u003csup\u003eo\u003c/sup\u003eC until processing.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eInoculation and Culture Enrichment\u003c/h3\u003e\n\u003cp\u003eThe starting inoculum from the debris sample (1 gram) was enriched under anaerobic conditions to enhance the growth of APB using sterile Coleville synthetic brine medium K (CSBK) media (pH 7.6) (Callbeck et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) amended with dextrose (5 g/L). After 48 hours of growth, 10 mL of the enrichment culture was mixed with 10 mL of the sludge sample and used for inoculation. The mixed sample was serially diluted, and 200 µL from each dilution was inoculated into 2 microtiter plates (24-well plates each), each well containing 1,800 µL of CSBK medium amended with dextrose. This resulted in a five times serial dilution of the inoculum (10\u003csup\u003e− 1\u003c/sup\u003e, 10\u003csup\u003e− 2\u003c/sup\u003e, 10\u003csup\u003e− 3\u003c/sup\u003e, 10\u003csup\u003e− 4\u003c/sup\u003e, 10\u003csup\u003e− 5\u003c/sup\u003e) after addition into the microtiter plate wells. This procedure was repeated for the same growth media but also containing nitrate (5 mM). The last columns of each microtiter plate wells were not inoculated with culture and hence used as abiotic controls. This resulted in an inoculation of 44 replicates (24 from the first microplate and 20 from the second plate) for each dilution and each media amended with or without nitrate. The experimental layout is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The plates were sealed with plate seals, covered with a microtiter plate cover, and incubated at 30°C without shaking for 1 week in a Coy anaerobic hood with an atmosphere of 90% N\u003csub\u003e2\u003c/sub\u003e and 10% CO\u003csub\u003e2\u003c/sub\u003e (N\u003csub\u003e2\u003c/sub\u003e-CO\u003csub\u003e2\u003c/sub\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eScreening of Interactome\u003c/h3\u003e\n\u003cp\u003eAt the end of the incubation period, growth of APB cultures was determined by measuring optical density (OD\u003csub\u003e600\u003c/sub\u003e) using a BioTek Synergy LX plate reader (Agilent Technologies) and by monitoring changes in the pH of the culture media. Culture aliquots (200 µL) were transferred from the 24-well plates into 96-well plates to determine the OD and pH values. The remaining cultures were kept under anaerobic conditions for further screening of corrosion activities. The pH was visually determined by adding 30 µL Bromothymol Blue (BTB) indictor solution (Sigma Aldrich) to the cultures after the OD reading. This resulted in multiple color repertoires with the dominant colors indicating blue (pH \u0026gt; 7.5), green (pH 6-7.5), and yellow (pH \u0026lt; 6). BTB has been used to identify acid producing microbial activities in several studies (Jia et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Kumari et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eCorrosion Activity Testing\u003c/h3\u003e\n\u003cp\u003eMultiple interactome cultures that showed either blue/green or yellow BTB color were further re-evaluated in a 24-well microtiter plate using the same media composition and inoculation procedures indicated above but in the presence of C1018 grade carbon steel ball bearings (2- beads per well). The beads (Grainger, hardness C60 to C67, Grade 200) were used to monitor corrosion activities of the interactome in the presence and absence of nitrate. Because of their small size (54.0 ± 0.3 mg, ∅ = 0.238 ± 0.001 cm, A = 0.178 cm\u003csup\u003e2\u003c/sup\u003e) and increased surface area of exposure (Fida et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Voordouw et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), these beads were ideal for large scale screening in small volume as they fit into the microtiter plate wells. To further evaluate the effect of nitrate addition on the corrosion rate induced by APB, studies were performed using C1018 carbon steel coupons in serum bottles (125 mL) containing 100 mL of CSBK with or without nitrate (5 mM). The serum bottles were inoculated with 1 mL of active APB consortia obtained from the enrichment culture mix indicated above, covered with a butyl rubber stopper and aluminum crimp seals, and purged with N\u003csub\u003e2\u003c/sub\u003e-CO\u003csub\u003e2\u003c/sub\u003e gas to create an anaerobic condition. A known isolate of APB culture (\u003cem\u003eClostridium acetobutylicum\u003c/em\u003e ATCC 824) was also used as an inoculum to determine whether the effect of nitrate is specific to the source of inoculum used or has a broad effect on APB. CSBK media without APB inocula was used as an abiotic corrosion control, and each experiment was performed in triplicate. All cultures were incubated for 3 weeks at 30\u003csup\u003eo\u003c/sup\u003eC under anaerobic conditions.\u003c/p\u003e\n\u003ch3\u003eCorrosion Beads or Coupon Processing\u003c/h3\u003e\n\u003cp\u003eThe beads or coupons were treated according to the National Association of Corrosion Engineers (NACE) protocol RP0775-2005. The bead treatment involved briefly sanding with sandpaper (grit size 400) by rolling the beads between two sheets of sandpaper for 1–2 min to facilitate a rough surface for microbial attachment. The beads/coupons were cleaned by sonication in isopropyl alcohol for 2 minutes, air dried, weighed to determine the starting weight, and then fully immersed in the culture media indicated above. Coupons/beads placed in culture media without a microbial source were used as abiotic controls. At the end of the incubation period, the coupons/beads were removed from the culture media and cleaned of residual debris and moisture using tissue paper in the anaerobic chamber. The coupons/beads were further cleaned by sonicating in a 15% HCl solution containing 5 g/L of corrosion inhibitor (1,3-di-n-butyl-2 thiourea) for 2 minutes, sonicating in 1 M NaHCO\u003csub\u003e3\u003c/sub\u003e for 2 minutes, briefly submerging in deionized H\u003csub\u003e2\u003c/sub\u003eO to remove the residual NaHCO\u003csub\u003e3\u003c/sub\u003e solution, and sonicating in isopropyl alcohol for 2 minutes. The cleaned coupons and beads were then allowed to dry under air stream and weighed to obtain final weights.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eOrganic Acids and pH analysis\u003c/h2\u003e \u003cp\u003eAt the end of the incubation period, aliquot samples (1 mL) were withdrawn from the serum bottles and used to determine the composition of organic acid ions including acetate, butyrate, propionate, and lactate produced by the cultures. The samples were withdrawn using syringe needles and filtered using 0.2-µm nylon membrane filters (Fisher Scientific, NH) to remove cells and debris. The concentrations of organic acid ions were determined from the filtered samples (300 µL) using a high-performance liquid chromatography (HPLC) system equipped with a Vanquish Diode Array Detector at 210 nm and an Acclaim™ Organic Acid (250 x 4.0 mm) column (Thermo Fisher, WI) with a flow rate of 1.0 mL/min. Mobile phases were 25 mM KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e (pH 2.5) and Acetonitrile. The samples were acidified with 20 µL of 1 M H\u003csub\u003e3\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e prior to analysis. The pH of APB culture in the serum bottles was determined by using a Metrohm 914 pH/Conductometer (Metrohm, FL) according to the manufacturer’s protocol. This was used to determine the effect of nitrate addition on the acidity of culture media that aggravate corrosion of the carbon steel coupon.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMicrobial Community Analysis\u003c/h3\u003e\n\u003cp\u003eGenomic DNA was extracted from APB consortia grown on carbon steel coupons in the presence or absence of nitrate at the end of the incubation period. The samples (1 mL) were centrifuged at 17,000 X \u003cem\u003eg\u003c/em\u003e for 5 min to pellet the cells. DNA was isolated from the pellet using the FastDNA extraction kit for soil (MP Biomedicals) according to the manufacturer’s instructions, quantified with a Qubit fluorimeter (Invitrogen) using the Quant-iT dsDNA HS Assay Kit (Invitrogen), and sent to LC Sciences (Houston, TX) for sequencing and microbial community analysis. Sequencing was performed by targeting the V3-V4 region of 16S rRNA genes. The 16S rRNA genes were amplified through two-step PCR reactions with nonbarcoded universal 16S rRNA forward primer (319F, ACTCCTACGGGAGGCAGCAG) and reverse primer (806R, GGACTACHVGGGTWTCTAAT) for 25 cycles followed by amplicon purification and PCR using sequencing adaptors and barcodes according to the company’s proprietary procedures. The purified PCR product (100 ng) was sequenced using Ilumina Miseq (PE300) platform to generate clusters. Bioinformatic analyses were performed by LC Science using the in-house script that can annotate the taxa to the species level. Microbial community abundances were expressed as total sequence read counts and percentage abundance of the reads belonging to each taxon within an individual sample.\u003c/p\u003e\n\u003ch3\u003eQuantitative PCR (qPCR)\u003c/h3\u003e\n\u003cp\u003eThe abundance of APB genes implicated in acid production from APB consortia and isolate (\u003cem\u003eC. acetobutylicum\u003c/em\u003e) samples were quantified using qPCR reaction according to the previously established methods (Fida et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Zhu \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2007\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The primers targeted 16S RNA, acetate kinase (\u003cem\u003eackA\u003c/em\u003e), and butyrate kinase (\u003cem\u003ebuk\u003c/em\u003e) genes in APB. The two genes (\u003cem\u003eackA\u003c/em\u003e and \u003cem\u003ebuk\u003c/em\u003e) are essential to APB metabolism for organic acid production. The same DNA used for microbial community analysis was used for the qPCR analysis. The DNAs were amplified using a QuantiTect* SYBR green* PCR kit (Qiagen GmbH, Hilden, Germany) and gene specific primers. Each qPCR run was performed in triplicate and included the diluted standards, known concentration of DNA from the pure bacterial isolates as positive controls, and non-template controls. Calibration curves, made with known quantity of purified PCR products of target genes serially diluted over a range magnitude, were used to determine gene copy numbers.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAccession number(s).\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe 16S rRNA gene amplicon sequence reads of APB consortia triplicate samples grown on carbon steel coupons were deposited in the Sequence Read Archive (SRA) at NCBI with accession number PRJNA1269071.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results and Discussions","content":"\u003cp\u003eIn this study, the use of microbial interactome and nitrate addition was explored to mitigate corrosion caused by APB. Most studies of MIC have overwhelmingly focused on the corrosive effects of sulfate reducing bacteria (SRB), that usually use sulfate as a terminal electron acceptor to produce hydrogen sulfide, causing souring of oil and gas transportation pipelines, storage reservoirs, and other infrastructures. However, APB is the main culprit in pitting corrosion due to the production of corrosive metabolites, growth under anaerobic and aerophilic conditions, persistent biofilm formation, diverse microbial community assemblage, and persistence under adverse environmental conditions by forming spores, such as in the case of \u003cem\u003eBacillus\u003c/em\u003e, \u003cem\u003eThiobacillus\u003c/em\u003e, \u003cem\u003eClostridium\u003c/em\u003e, and \u003cem\u003eAcidothiobacilli\u003c/em\u003e species (Gu and Galicia \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Gupta and Anand \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Kip and van Veen \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Ramos Monroy et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The metabolic byproducts produced by APB result in localized lowering of pH and creation of acidic conditions that directly attack and corrode metallic surfaces. The pit depth and width caused by APB are often a magnitude of order higher than that of SRB (Gu and Galicia \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). The present study was initiated to mitigate APB-induced corrosion by using microbial interactome and nitrate injection approaches. The hypothesis was that manipulation of microbial interactome could result in microbial community assemblage that could enhance growth of APB competitors or antagonistically inhibit APB growth and biofilm formation on a metal substrate as a sustainable APB mitigation strategy. In this regard, microbial diversity was manipulated by subsampling a given microbial consortia pool, serially diluting subsamples, and culturing sufficient replicates of each dilution in microtiter plates to allow random distribution of microbes in the presence and absence of nitrate. This created many microbial communities with specific species that vary in their membership and activities. Analysis of metabolite products, changes in pH conditions, changes in microbial community composition, and monitoring of corrosion activities suggested that the addition of nitrate resulted in microbial communities that vary in activities and metabolic gene functions.\u003c/p\u003e\u003ch2\u003eInteractome Screening\u003c/h2\u003e\u003cp\u003eThe use of the microbial interactome approach and the addition of nitrate into culture media enabled the discovery of microbial community pools that inhibited production of corrosive APB metabolites or promoted growth of non-corrosive species that outcompeted the APB. Culturing serially diluted and replicated APB consortia resulted in microbial communities that varied in APB activities among the different dilution series as well as within the same dilution. This was reflected from differences in cell densities and in pH ranges based on BTB indicator color variations (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). It is assumed that differences would not occur within inocula cultured from the same dilution series, as this is routinely used to determine cell densities and numbers. However, differences could happen due to the random distribution of microbes into the different wells of the same plate, representing random ecological distribution in the real environment. Differences in OD readings and pH ranges were also observed during growth in the presence and absence of nitrate. The differences were more prominent in the higher dilution series as well as in the absence of nitrate. More yellow BTB coloration (low pH) was observed in the absence of nitrate. According to the supplier’s database providing pH indicator color ranges, the observed BTB color repertoire include bright yellow (strongly acidic with pH \u0026lt; 6.0), yellow-green (slightly acidic with pH ~ 6.0), green (neutral with pH 6.5-7.0), blue-green (slightly basic with pH 7.0-7.6), light blue (weakly basic with pH 7.6-8.0), and deep blue (strongly basic with pH \u0026gt; 8.0). BTB has been used as a pH indicator to identify microbial activities, which turns the culture media yellow in an acidic environment, created by active APB growth, or into blue in a neutral or alkaline environment during growth of non-APB, thus allowing for visual detection of interactome activities (Jia et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Kumari et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). None of the cultures in the microtiter plate wells showed bright yellow color in the presence of nitrate at any of the dilution series (second row of microtiter plates) whereas several wells showed this color in the absence of nitrate (first row of microtiter plates), suggesting the inhibitory effect of nitrate on acidification of the culture media. More acidic conditions were observed at increased cell dilutions than less diluted samples, suggesting a more random distribution of a specific species at increased dilutions. An increase in OD reading was also observed for less diluted samples than higher dilutions, possibly due to interferences from the sludge samples or due to availability of extra trace nutrients from the sludge that promoted higher cell growth. The high OD\u003csub\u003e600\u003c/sub\u003e reading observed in the presence of nitrate is not due to such effects as the samples were treated equally regardless of nitrate addition. The growth could be due to the competitive advantage of nitrate reducing bacteria (NRB) to overgrow APB or due to change in redox potential of the culture media in the presence of nitrate.\u003c/p\u003e\u003cp\u003eA total of 29 interactomes from nitrate-amended and 60 from unamended cultures showing relatively green to bright blue colors and a high OD\u003csub\u003e600\u003c/sub\u003e reading were selected and re-evaluated for growth and BTB color indication using freshly prepared culture media. The incubation period was increased from one to two weeks to give the cells enough time for complete fermentation of dextrose and acidification of the media. Similar to the results of the initial observation, none of the selected interactome from the nitrate amended culture showed a bright yellow BTB coloration (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Nearly all the interactomes in the presence of nitrate also showed growth and light blue or blue green BTB coloration. Conversely, most of the selected interactomes (46 out of 60) showed bright yellow coloration in the absence of nitrate. About 13 of these interactomes showed growth and green or yellow green coloration whereas none of them (except one of the wells with no growth observed) showed deep blue or light blue coloration during growth in the absence of nitrate. Only one of the unamended interactomes (circled in red in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) showed a high cell density and blue green BTB coloration in the absence of nitrate suggesting nitrate’s importance in controlling APB activities. Regardless of the presence or absence of nitrate, the APB interactome study showed heterogeneity in distribution of a microbial community from the same inoculum source. Heterogeneity in a microbial population from the same culture has been previously described by many authors (Almela et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Davis and Isberg \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Kim et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Such heterogeneity could be due to genotypic or phenotypic differences. Genotypic differences occur due to allelic variation whereas phenotypic differences could be due to differential gene expressions driven by stochastic fluctuations or due to environmental changes such as resource limitations or stress factors (Davis and Isberg \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The heterogeneity of APB interactomes in the present study could be due to phenotypic differences since such many allelic variations were not expected during the two weeks incubation times.\u003c/p\u003e\u003ch2\u003eCorrosion Analysis of Beads\u003c/h2\u003e\u003cp\u003eCorrosivity of the selected APB interactomes was monitored using carbon steel beads in microtiter plates. Carbon steel spherical beads, instead of coupons, are particularly ideal to monitor corrosion in small volumes due to their contact with the surrounding medium on all sides (Voordouw et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). A total of 20 interactomes were selected from each culture grown in the absence or presence of nitrate. The interactomes were named based on the dilution series, presence or absence of nitrate, plate number, and well number. For instance, 10-1NP1A5 represents an interactome obtained from 10\u003csup\u003e− 1\u003c/sup\u003e serial dilution in the presence of nitrate, in microtiter plate 1, and well number 5. The selected interactomes were mostly those cultures showing at least pH ~ 6.0 and above (yellow green to blue BTB coloration) as these are candidates that could counteract corrosive APB activities. Some interactomes showing pH \u0026lt; 6 (strongly acidic with bright yellow BTB color) were included as controls to compare corrosion activities with non-corrosive interactomes. These include interactomes 10-1P1A1, 10-3P1A5, 10-4P3D2, and 10-5P2A4, for culture media without nitrate. Only one interactome (10-3NP1B2) showing yellow green BTB color (slightly acidic with pH ~ 6.0) was included as control for culture media with nitrate since none of the interactome showed a strongly acidic condition.\u003c/p\u003e\u003cp\u003eWeight loss corrosion analysis of the beads showed differences among the selected interactomes between and within each dilution. The interactomes with blue or green BTB colors showed less corrosion than those showing yellow BTB colors (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The highest weight loss corrosion (1.76 mg) was observed in interactome without a nitrate addition (10-5P2A4) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). This interactome produced a strongly acidic condition, with a bright yellow BTB color. The lowest weight loss corrosion (0.51 mg) among cultures grown in the absence of nitrate was obtained from interactome designated as 10-4P1D5. This is the only interactome that showed the highest OD\u003csub\u003e600\u003c/sub\u003e reading and green BTB coloration in the absence of nitrate as highlighted above in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. From cultures grown in the presence of nitrate, the highest weight loss corrosion (0.6 mg) was observed for interactomes designated as 10-3NP1B2, followed by 10-3NP1A2 and 10-3NP1A3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). The lowest weight loss corrosion was observed for the culture designated as 10-2NP1D6 (no weight loss), followed by cultures 10-2NP2A1 (0.08 mg), 10-3NP1C2 (0.09 mg), 10-4NP2C1 (0.1 mg), 10-3NP1C1 (0.11 mg), and 10-3NP1B1 (0.12 mg). Generally, a higher weight loss from corrosion was observed in the absence of nitrate (1.02 average mg weight loss) compared to interactomes grown in the presence of nitrate (0.3 mg average weight loss) which is about 3.5-fold corrosion inhibition by nitrate. The corrosion data corroborates with the suppressed pH reduction detected in the presence of nitrate, supporting the importance of nitrate in controlling corrosivity from APB activities.\u003c/p\u003e\u003cp\u003eVisual observation of the interactome activities in microtiter plates indicated more corrosion product deposits with interactomes that grew in the absence than in the presence of nitrate (Online resource 1). This is in agreement with the observed decrease in pH and higher corrosion activities of interactomes grown in the absence of nitrate. Corrosion product deposits are indicated by the precipitation of yellowish brown or brown corrosion products such as iron carbonate (Hussein \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) in the culture media. Overall, nitrate addition resulted in a relatively neutral culture pH condition, low corrosion weight loss, and less corrosion product deposit.\u003c/p\u003e\u003ch2\u003eCorrosion Analysis of Coupons\u003c/h2\u003e\u003cp\u003eThe calculated corrosion rates of C1018 carbon steel coupons were used to validate the inhibitory effect of nitrate on APB activities. The experiment was conducted in a bigger volume of the same culture media described above using either an APB consortium or a pure isolate of APB (\u003cem\u003eC. acetobutylicum\u003c/em\u003e) in the presence or absence of nitrate. \u003cem\u003eC. acetobutylicum\u003c/em\u003e is a model acid producing anaerobic bacteria used for monitoring corrosion activities induced by APB (Fida et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Rouvre and Basseguy \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Zhu \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2007\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The isolate is also used for industrial-scale production of organic acids through a process of fermentation (Herman et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The acid produced by this isolate could cause a drop in the pH of culture media to as low as 4 during acidogenesis process (Gottwald and Gottschalk \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1985\u003c/span\u003e; Monot et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e1984\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). An average corrosion rate (mm/y) of 0.148 ± 0.004 and 0.085 ± 0.041 were observed in the absence of nitrate for APB consortia and \u003cem\u003eC. acetobutylicum\u003c/em\u003e, respectively, whereas these were 0.037 ± 0.026 and 0.028 ± 0.001 in the presence of nitrate, respectively for APB consortia and \u003cem\u003eC. acetobutylicum\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). A higher corrosion rate was observed with APB consortia compared to the pure isolate in the absence of nitrate. Nitrate addition significantly inhibited the corrosion rate for both culture types. This corroborates with the weight loss inhibitory effect of nitrate observed with the beads indicated above.\u003c/p\u003e\u003ch2\u003eCell Growth and pH Changes\u003c/h2\u003e\u003cp\u003eThe pH values of the serum bottle samples were obtained at the end of the incubation period whereas OD values were recorded during active cell growth until a stationary growth phase was reached. Similar to the observations in microtiter plates indicated above, nitrate addition showed a significant inhibitory effect on acid production by both APB consortia and \u003cem\u003eC. acetobutylicum\u003c/em\u003e. Average pH values of 5.38 ± 0.05 and 6.24 ± 1.12 were observed in the absence of nitrate for APB consortia and \u003cem\u003eC. acetobutylicum\u003c/em\u003e, respectively, whereas these were 8.37 ± 0.10 and 8.4 ± 0.22 in the presence of nitrate, respectively for APB consortia and \u003cem\u003eC. acetobutylicum\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). The APB consortia showed a relatively lower pH value compared to \u003cem\u003eC. acetobutylicum\u003c/em\u003e in the absence of nitrate. Cell growth was monitored in a separate but similar experiment during active growth stages to determine if nitrate is inducing lag phase in cell growth. Growth was not inhibited in the presence of nitrate for both culture types (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb) suggesting that the inhibitory effect of nitrate is at the stage of acidogenesis during growth of APB. The increased pH observed in the presence of nitrate for both cultures also corroborate with the decreased corrosion rate of carbon steel coupons.\u003c/p\u003e\u003ch2\u003eAnalysis of Organic Acid Production\u003c/h2\u003e\u003cp\u003eCulture supernatant fluids were analyzed from the serum bottle studies to determine the concentration of organic acids produced during growth of APB in the presence and absence of carbon steel coupons or nitrate. Interestingly, nitrate significantly inhibited the accumulation of organic acids in both APB consortia and \u003cem\u003eC. acetobutylicum\u003c/em\u003e cultures (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). The inhibitory effect was more pronounced for \u003cem\u003eC. acetobutylicum\u003c/em\u003e. An average accumulation (4,415 mg/L) of organic acids (2,623; 805; 707; 235; and 45 mg/L of lactate, formate, acetate, propionate and butyrate, respectively) was observed in the absence of nitrate during growth of APB consortia. This accounts for 88% of the dextrose added to the culture. In the presence of nitrate, a concentration of 1,624 mg/L total organic acids (1,178; 101; 264; 48; and 33 mg/L for lactate, formate, acetate, propionate, and butyrate, respectively) was observed during growth of APB consortia, accounting for 35.5% of the dextrose used. Lactate was the dominant organic acid observed during growth of APB consortia. For \u003cem\u003eC. acetobutylicum\u003c/em\u003e, a total of 2,505 mg/L (420; 516; 1,185; and 384 mg/L lactate, formate, acetate and butyrate, respectively) was observed in the absence of nitrate, accounting for 50% of the dextrose added compared to 68 mg/L (32; 19; and 17 mg/L of lactate, acetate, and butyrate, respectively) in the presence of nitrate, accounting for about 1.4% of the dextrose added. Acetate was the dominant organic acid observed during growth of \u003cem\u003eC. acetobutylicum.\u003c/em\u003e Propionate was not observed regardless of nitrate addition whereas formate was not observed in the presence of nitrate during growth of \u003cem\u003eC. acetobutylicum\u003c/em\u003e. The decrease in organic acid production is in agreement with many studies showing decrease of volatile fatty acids, such as propionate and butyrate production, without microbiota growth inhibitory effect in ruminant animals fed with dietary nitrate (Farra and Satter \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e1971\u003c/span\u003e; Olijhoek et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Vadroňová et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Yang et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe accumulation of organic acids is in agreement with the reduction of pH in the culture media and the increase in corrosion rates induced by APB activities. The organic acids produced by APB undergo reactions with metals by either the action of protons or chelation with metal ions. In combination with the biofilms formed by APB, these acids promote corrosion of metals through various mechanisms involving destabilizing the protective films/coatings formed on the material surface, modification of localized environment at the metal/solution interface, localized galvanic corrosion, stress corrosion cracking, removal or utilization of corrosion inhibitors as carbon and energy source for growth, and/or the initiation of pitting attack (Khouzani et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Madirisha et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Although the role of APB in combination with SRB in corrosive environments is still unclear, the produced organic acids by APB, if not controlled, could be used as electron donors for reduction of sulfate to sulfide by the surrounding SRB environment (Madirisha et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). This might aggravate MIC corrosion in environments where these two organisms are thriving.\u003c/p\u003e\u003ch2\u003eMicrobial Community Analysis\u003c/h2\u003e\u003cp\u003eMicrobial diversity decreased slightly in the presence of nitrate during biofilm growth on carbon steel coupons. The average Shannon diversity was 5.16 and 4.92 in the absence and presence of nitrate, respectively. \u003cem\u003eKlebsiella (K aerogenes)\u003c/em\u003e and \u003cem\u003ePantoea (P. agglomerans)\u003c/em\u003e are the dominant taxa observed in the samples regardless of nitrate source (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e and online resource 2). Both of these microbes have been identified as abundant within various environments including soil, wastewater treatment plants, and the human gastrointestinal tract (Kelly et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Lorenzi et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Sanmartín et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, the relative abundance of acid producing \u003cem\u003eClostridium\u003c/em\u003e increased to 15% in the samples incubated in the absence of nitrate compared to the relative abundance (1%) in presence of nitrate. This suggests and confirms the suppressive effect of nitrate on APB activities. \u003cem\u003eClostridium\u003c/em\u003e is a well-known APB capable of dropping the pH culture media and increasing corrosion of steel infrastructure (Gottwald and Gottschalk \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1985\u003c/span\u003e; Herman et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Madirisha et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). \u003cem\u003eSporolactobacillus\u003c/em\u003e was observed as one of the dominant microbes (13% relative abundance) in the presence of nitrate compared to the abundance (1%) in the absence of nitrate. This microbial taxa is known to produce antimicrobial agents, such as bacteriocin, which provide growth advantage by inhibiting the growth and reproduction of competing microbes (Guo et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Yadav et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The decreased relative abundance of \u003cem\u003eClostridium\u003c/em\u003e and the enrichment of microbes with the potential of producing inhibitory agents could partially explain the decreased corrosion rate observed in the presence of nitrate.\u003c/p\u003e\u003ch2\u003eqPCR Analysis\u003c/h2\u003e\u003cp\u003eThe abundance of 16S rRNA and metabolic genes (\u003cem\u003eackA\u003c/em\u003e and \u003cem\u003ebukA\u003c/em\u003e) were monitored and compared between APB consortia and \u003cem\u003eC. acetobutylicum\u003c/em\u003e grown in the presence and absence of nitrate. 16S rRNA was used to estimate the number of cells per mL and to evaluate if there are differences in cell growth as the abundance of this gene is mostly related to cell biomass and is constitutively expressed. The \u003cem\u003eackA\u003c/em\u003e and \u003cem\u003ebukA\u003c/em\u003e genes play roles in acetate and butyrate metabolism, respectively, during fermentation of organic carbons and are commonly used to detect APB activities involved in MIC (Davis et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Mand et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Zhu \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2007\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). 16S rRNA analysis indicated no significant differences in copy number between APB consortia grown in the presence (6.55 x 10\u003csup\u003e8\u003c/sup\u003e ± 7.67 x 10\u003csup\u003e7\u003c/sup\u003e copies/mL) and absence (4.04 x 10\u003csup\u003e8\u003c/sup\u003e ± 8.0 x 10\u003csup\u003e7\u003c/sup\u003e copies/mL) of nitrate (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). However, the 16S rRNA copy number of \u003cem\u003eC. acetobutylicum\u003c/em\u003e decreased in the presence of nitrate (8.82 x 10\u003csup\u003e6\u003c/sup\u003e ± 6.74 x 10\u003csup\u003e6\u003c/sup\u003e) compared to the absence of nitrate (2.040 x 10\u003csup\u003e8\u003c/sup\u003e ± 1.68 x 10\u003csup\u003e8\u003c/sup\u003e copies/mL). No differences were observed in \u003cem\u003eackA\u003c/em\u003e and \u003cem\u003ebukA\u003c/em\u003e copy number for the APB consortia grown in the presence or absence of nitrate. A higher copy number of \u003cem\u003eackA\u003c/em\u003e than \u003cem\u003ebukA\u003c/em\u003e was observed in the APB consortia regardless of nitrate addition, possibly due to differences in gene copies in the genomes of the consortia. The copy number of \u003cem\u003eackA\u003c/em\u003e or \u003cem\u003ebukA\u003c/em\u003e genes are significantly lower in APB consortia compared to that of 16S rRNA copy number. This is likely due to the enrichment of bacteria that do not have \u003cem\u003eackA\u003c/em\u003e or \u003cem\u003ebukA\u003c/em\u003e genes or due to more copies of 16S rRNA per cell. In agreement with the 16S rRNA data, lower copy numbers of \u003cem\u003eackA\u003c/em\u003e and \u003cem\u003ebukA\u003c/em\u003e were observed during growth of \u003cem\u003eC. acetobutylicum\u003c/em\u003e in the presence than absence of nitrate. No differences were observed between \u003cem\u003eackA\u003c/em\u003e and \u003cem\u003ebukA\u003c/em\u003e gene copy numbers in the presence or absence of nitrate. Similar to the APB consortia, the copy numbers of \u003cem\u003eackA\u003c/em\u003e and \u003cem\u003ebukA\u003c/em\u003e genes are lower than that of 16S rRNA for \u003cem\u003eC. acetobutylicum\u003c/em\u003e. Unlike the APB consortia all the cells of \u003cem\u003eC. acetobutylicum\u003c/em\u003e are expected to have both genes. The increased copy number of 16S rRNA relative to the metabolic genes could be due to a greater number of gene copies in the genome. \u003cem\u003eC. acetobutylicum\u003c/em\u003e contains about 11 copies of 16S rRNA in the genome (Feliu-Paradeda et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Transcriptome analysis is suggested to compare the catabolic gene expression in the presence and absence of nitrate as targeting the DNA might not truly differentiate between actively growing and damaged or dead cells.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe present study identified the importance of nitrate in modulating microbial interaction and inhibition of APB activities. Multiple lines of evidence from the interactome studies suggest that nitrate has an inhibitory effect on the corrosivity of APB activities. The serum bottle and microtiter plate experiments showed that nitrate addition inhibited APB-induced corrosion by preventing acidic conditions without inhibiting cell growth. Regardless of nitrate addition, the APB interactome study also showed heterogeneity in microbial distribution from the same inoculum source. This is in agreement with many studies showing the heterogeneity of microbial population from the same sources during growth on the same culture media (Almela et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Davis and Isberg \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Interestingly, the pH of culture media did not decrease (more blue or green BTB coloration) in the presence of nitrate as much as in the absence of nitrate. This is possibly due to the inhibitory effect of nitrate on APB activities or the competitive advantage of NRB community growth. Nitrate has been used to control oil and gas reservoir souring by SRB (Voordouw et al., 2009) but has not been reported as an inhibitor of APB activities. The mechanism of SRB inhibition of nitrate includes enrichment of NRB which inhibits SRB by outcompeting with them for electron donors and increasing the redox potential. NRB also produces nitrite as a metabolite product of nitrate reduction, which is an inhibitor of the dissimilatory sulfite reductase enzyme (Dsr) responsible for the reduction of sulfite to sulfide (Fida et al., 2016; Voordouw et al., 2009). The inhibitory effect of nitrite was not explored in this study. However, its accumulation was not observed in the culture media when tested using a nitrite assay Griess reagent according to the manufacturer\u0026rsquo;s instruction (Sigma Aldrich). Nitrate also has been reported as an inhibitor of methane production in ruminant animals and has no negative effects on rumen fermentation and microbial protein synthesis (Olijhoek et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Vadroňov\u0026aacute; et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Zhao et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). This is in agreement with the present study showing no inhibitory effect of nitrate on APB cell growth. Studies indicated that the methanogenesis inhibitory effect of nitrate is accompanied by accumulation of hydrogen as a fermentation product of acetate and butyrate producing bacteria (Kl\u0026uuml;ber and Conrad \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Yang et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The effect of hydrogen accumulation and methanogenesis inhibitory effect of nitrate has also been reported for soil slurries from rice fields (Kl\u0026uuml;ber and Conrad \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1998\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe mechanism of nitrate\u0026rsquo;s inhibitory effect on APB or methanogenesis is poorly understood. The suggestion is that nitrate enriches NRB which competes with APB or methanogens for nutrients or biohydrogenation, that nitrate reduction is thermodynamically favorable over methanogenesis and biohydrogenation, and that nitrate results in an increase of redox potential in culture media (Kl\u0026uuml;ber and Conrad \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Yang et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In addition to this, the effects of interactomes on APB activities could also encompass a complex network of interactions between microorganisms and their biotic and abiotic environments, and often involves metabolic exchanges, signaling pathways, genetic transfers, and symbiotic or competitive relationships (Geesink et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In an environment with limited resources, microbial interaction helps the consortia to coordinate nutrient cycling through syntrophy, where one species\u0026rsquo; waste becomes another\u0026rsquo;s carbon and energy source (Geesink et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).This study identified that the addition of nitrate to APB culture decreased organic acid production, and hence inhibited APB-induced corrosion without inhibiting overall cell growth. Nitrate addition also proportionally decreased the abundance of NRB communities implicated in the pH drop of culture media. The findings from this study indicated the importance of nitrate addition to control APB activities as a novel, economically viable, and environmentally sustainable strategy. Further molecular studies, such as differential gene expressions are warranted to elucidate the molecular mechanisms of inhibition.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eFunding and Acknowledgement. This work was supported by the US Army Corp of Engineers Engineering Research and Development Center Construction Engineering Research Laboratory under Contract No. W9132T22C0023. Any opinions, findings and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the US Army Corp of Engineers Engineering Research and Development Center Construction Engineering Research Laboratory.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability.\u003c/strong\u003e The datasets used in this manuscript are available from the corresponding author upon request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval.\u003c/strong\u003e This is not applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate.\u003c/strong\u003e This is not applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publish\u003c/strong\u003e. This is not applicable.\u003c/p\u003e\n\u003cp\u003eCompeting Interests. The authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003eAuthor Contributions. All authors contributed to the study conception and design. Conceptualization, methodology, writing original draft of the manuscript was done by TTF. Material preparation, data collection, and analysis were performed by TTF, TR, MH, SL, and KC. RW edited the manuscript. All authors reviewed and commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAlmela P, Justel A, Quesada A (2021) Heterogeneity of Microbial Communities in Soils From the Antarctic Peninsula Region. Front Microbiol 12. doi:10.3389/fmicb.2021.628792\u003c/li\u003e\n\u003cli\u003eBalakrishnan A, Govindaraj S, Dhaipule NGK, Thirumalaisamy N, Anne RS, Sublime N, Philip J (2024) Enhancing microbiologically influenced corrosion protection of carbon steels with silanized epoxy-biocide hybrid coatings. Environ Sci Pollut Res 31(9): 13302-13326. doi:10.1007/s11356-024-32014-9\u003c/li\u003e\n\u003cli\u003eBassler BL, Losick R (2006) Bacterially speaking. Cell 125(2): 237-246. doi:10.1016/j.cell.2006.04.001\u003c/li\u003e\n\u003cli\u003eCallbeck C, Agrawal A, Voordouw G (2013) Acetate production from oil under sulfate-reducing conditions in bioreactors injected with sulfate and nitrate. Appl Environ Microbiol 79(16): 5059-5068. doi:10.1128/aem.01251-13\u003c/li\u003e\n\u003cli\u003eDavis JA, Chinthala SP, Monty-Bromer CN, Senko JM (2024) Electrochemical detection of carbon steel corrosion induced by fermentative bacteria from natural gas transmission lines. Environ Microbiol Rep 16(6): e70058. doi:10.1111/1758-2229.70058\u003c/li\u003e\n\u003cli\u003eDavis K, Isberg R (2016) Defining heterogeneity within bacterial populations via single cell approaches. BioEssays 38(8): 782-790. doi:https://doi.org/10.1002/bies.201500121\u003c/li\u003e\n\u003cli\u003ede Lorenzo V (2008) Systems biology approaches to bioremediation. Curr Opin Biotechnol 19(6): 579-589. doi:https://doi.org/10.1016/j.copbio.2008.10.004\u003c/li\u003e\n\u003cli\u003eDemin KA, Prazdnova EV, Minkina TM, Gorovtsov AV (2024) Sulfate-reducing bacteria unearthed: ecological functions of the diverse prokaryotic group in terrestrial environments. Appl Environ Microbiol 90(4): e01390-01323. doi:doi:10.1128/aem.01390-23\u003c/li\u003e\n\u003cli\u003eDong Y, Jiang B, Xu D, Jiang C, Li Q, Gu T (2018) Severe microbiologically influenced corrosion of S32654 super austenitic stainless steel by acid producing bacterium \u003cem\u003eAcidithiobacillus caldus\u003c/em\u003e SM-1. Bioelectrochemistry 123: 34-44. doi:https://doi.org/10.1016/j.bioelechem.2018.04.014\u003c/li\u003e\n\u003cli\u003eEnning D, Garrelfs J (2014) Corrosion of iron by sulfate-reducing bacteria: new views of an old problem. Appl Environ Microbiol 80(4): 1226-1236. doi:10.1128/AEM.02848-13\u003c/li\u003e\n\u003cli\u003eFalk MW, Song KG, Matiasek MG, Wuertz S (2009) Microbial community dynamics in replicate membrane bioreactors--natural reproducible fluctuations. Water Res 43(3): 842-852. doi:10.1016/j.watres.2008.11.021\u003c/li\u003e\n\u003cli\u003eFarra PA, Satter LD (1971) Manipulation of the ruminal fermentation. III. Effect of nitrate on ruminal volatile fatty acid production and milk composition. J Dairy Sci 54(7): 1018-1024. doi:https://doi.org/10.3168/jds.S0022-0302(71)85965-9\u003c/li\u003e\n\u003cli\u003eFeliu-Paradeda L, Puig S, Ba\u0026ntilde;eras L (2023) Design and validation of a multiplex PCR method for the simultaneous quantification of\u003cem\u003e Clostridium acetobutylicum, Clostridium carboxidivorans\u003c/em\u003e and \u003cem\u003eClostridium cellulovorans\u003c/em\u003e. Scientific Reports 13(1): 20073. doi:10.1038/s41598-023-47007-w\u003c/li\u003e\n\u003cli\u003eFida T, Austin L, Leleika S, Rambo T, Crippen K (2024) Development of Molecular Probe for Iron Reducing and Thiosulfate Reducing Bacteria. Paper presented at the AMPP CORROSION, New Orleans, Louisiana.\u003c/li\u003e\n\u003cli\u003eFida T, Sharma M, Shen Y, Voordouw G (2021) Microbial sulfite oxidation coupled to nitrate reduction in makeup water for oil production. Chemosphere 284: 131298. doi:10.1016/j.chemosphere.2021.131298\u003c/li\u003e\n\u003cli\u003eGeesink P, ter Horst J, Ettema TJG (2024) More than the sum of its parts: uncovering emerging effects of microbial interactions in complex communities. FEMS Microbiology Ecology 100(4). doi:10.1093/femsec/fiae029\u003c/li\u003e\n\u003cli\u003eGottwald M, Gottschalk G (1985) The internal pH of \u003cem\u003eClostridium acetobutylicum\u003c/em\u003e and its effect on the shift from acid to solvent formation. Arch Microbiol 143(1): 42-46. doi:10.1007/BF00414766\u003c/li\u003e\n\u003cli\u003eGu T, Galicia B (2012) Can acid producing bacteria be responsible for very fast MIC pitting? Paper presented at the CORROSION 2012, Salt Lake City, Utah.\u003c/li\u003e\n\u003cli\u003eGuo X, Yu L, Xiao M, Zang X, Zhang C, Narbad A, Chen W, Tian F, Zhai Q (2024) \u003cem\u003eSporolactobacillus-\u003c/em\u003ea new functional genus with potential applications. Curr Res Food Sci 9: 100822. doi:10.1016/j.crfs.2024.100822\u003c/li\u003e\n\u003cli\u003eGupta S, Anand S (2018) Induction of pitting corrosion on stainless steel (grades 304 and 316) used in dairy industry by biofilms of common sporeformers. Inte J Dairy Technol 71(2): 519-531. doi:https://doi.org/10.1111/1471-0307.12444\u003c/li\u003e\n\u003cli\u003eHerman NA, Kim SJ, Li JS, Cai W, Koshino H, Zhang W (2017) The industrial anaerobe \u003cem\u003eClostridium acetobutylicum\u003c/em\u003e uses polyketides to regulate cellular differentiation. Nat Commun 8(1): 1514. doi:10.1038/s41467-017-01809-5\u003c/li\u003e\n\u003cli\u003eHussein A. (2023) Essentials of flow assurance solids in oil and gas operations. In Hussein A (Ed.), (pp. 199-296): Gulf Professional Publishing.\u003c/li\u003e\n\u003cli\u003eJavaherdashti R (2023) Editorial: Microbiologically influenced corrosion (MIC): its mechanisms, technological, economic, and environmental impacts. Front Microbiol 14. doi:10.3389/fmicb.2023.1249565\u003c/li\u003e\n\u003cli\u003eJia L, Sun W, Li W, Dong Y, Wu L, Salda\u0026ntilde;a MDA, Gao Y, Jin Y, Sun W (2023) A colour indicator film based on bromothymol blue/poly-L-lactic acid/polyvinylpyrrolidone for detecting bacteria. Packag Techn Sci 36(7): 549-556. doi:https://doi.org/10.1002/pts.2726\u003c/li\u003e\n\u003cli\u003eJia R, Unsal T, Xu D, Lekbach Y, Gu T (2019) Microbiologically influenced corrosion and current mitigation strategies: A state of the art review. Int Biodeterior Biodegradation 137: 42-58. doi:https://doi.org/10.1016/j.ibiod.2018.11.007\u003c/li\u003e\n\u003cli\u003eJustice NB, Sczesnak A, Hazen TC, Arkin AP (2017) Environmental selection, dispersal, and organism interactions shape community assembly in high-throughput enrichment culturing. Appl Environ Microbiol 83(20): e01253-01217. doi:doi:10.1128/AEM.01253-17\u003c/li\u003e\n\u003cli\u003eKelly JJ, London MG, McCormick AR, Rojas M, Scott JW, Hoellein TJ (2021) Wastewater treatment alters microbial colonization of microplastics. PLoS One 16(1): e0244443. doi:10.1371/journal.pone.0244443\u003c/li\u003e\n\u003cli\u003eKhouzani MK, Bahrami A, Hosseini-Abari A, Khandouzi M, Taheri P (2019) Microbiologically influenced corrosion of a pipeline in a petrochemical plant. Metals 9(4): 459. \u003c/li\u003e\n\u003cli\u003eKim M, Cho A, Lim HS, Hong SG, Kim JH, Lee J, Choi T, Ahn TS, Kim O-S (2015) Highly heterogeneous soil bacterial communities around Terra Nova Bay of Northern Victoria land, Antarctica. PLoS One 10(3): e0119966. doi:10.1371/journal.pone.0119966\u003c/li\u003e\n\u003cli\u003eKip N, van Veen JA (2015) The dual role of microbes in corrosion. The ISME Journal 9(3): 542-551. doi:10.1038/ismej.2014.169\u003c/li\u003e\n\u003cli\u003eKl\u0026uuml;ber HD, Conrad R (1998) Effects of nitrate, nitrite, NO and N\u003csub\u003e2\u003c/sub\u003eO on methanogenesis and other redox processes in anoxic rice field soil. FEMS Microbiol Ecol 25(3): 301-318. doi:10.1111/j.1574-6941.1998.tb00482.x\u003c/li\u003e\n\u003cli\u003eKumari A, Mihooliya KN, Sahoo DK, Bhattacharyya MS, Prasad GS, Pinnaka AK (2023) Description of lipase producing novel yeast species \u003cem\u003eDebaryomyces apis\u003c/em\u003e f.a., sp. nov. and a modified pH indicator dye-based method for the screening of lipase producing microorganisms. Scientific Reports 13(1): 11819. doi:10.1038/s41598-023-38241-3\u003c/li\u003e\n\u003cli\u003eLi J, Chen L, Wei B, Xu J, Wei B, Sun C (2024) Microbiologically influenced corrosion of circulating cooling systems in power plants \u0026ndash; A review. Arab J Chem 17(2): 105529. doi:https://doi.org/10.1016/j.arabjc.2023.105529\u003c/li\u003e\n\u003cli\u003eLittle BJ, Blackwood DJ, Hinks J, Lauro FM, Marsili E, Okamoto A, Rice SA, Wade SA, Flemming HC (2020) Microbially influenced corrosion-Any progress? Corros Sci 170: 108641. doi:https://doi.org/10.1016/j.corsci.2020.108641\u003c/li\u003e\n\u003cli\u003eLorenzi AS, Bonatelli ML, Chia MA, Peressim L, Quecine MC (2022) Opposite sides of \u003cem\u003ePantoea agglomeran\u003c/em\u003es and its associated commercial outlook. Microorganisms 10(10): 2072. \u003c/li\u003e\n\u003cli\u003eMadirisha M, Hack R, van der Meer F (2022) The role of organic acid metabolites in geo-energy pipeline corrosion in a sulfate reducing bacteria environment. Heliyon 8(5): e09420. doi:10.1016/j.heliyon.2022.e09420\u003c/li\u003e\n\u003cli\u003eMand J, Park HS, Jack TR, Voordouw G (2014) The role of acetogens in microbially influenced corrosion of steel. Front Microbiol 5(268): 1-14. doi:10.3389/fmicb.2014.00268\u003c/li\u003e\n\u003cli\u003eMonot F, Engasser J-M, Petitdemange H (1984) Influence of pH and undissociated butyric acid on the production of acetone and butanol in batch cultures of \u003cem\u003eClostridium acetobutylicum\u003c/em\u003e. Appl Microbiol Biotechnol 19(6): 422-426. doi:10.1007/BF00454381\u003c/li\u003e\n\u003cli\u003eOfiţeru ID, Lunn M, Curtis TP, Wells GF, Criddle CS, Francis CA, Sloan WT (2010) Combined niche and neutral effects in a microbial wastewater treatment community. PNAS 107(35): 15345-15350. doi:doi:10.1073/pnas.1000604107\u003c/li\u003e\n\u003cli\u003eOgawa A, Takakura K, Hirai N, Kanematsu H, Kuroda D, Kougo T, Sano K, Terada S (2020) Biofilm formation plays a crucial rule in the initial step of carbon steel corrosion in air and water environments. Materials 13(4): 923. \u003c/li\u003e\n\u003cli\u003eOlijhoek DW, Hellwing ALF, Brask M, Weisbjerg MR, H\u0026oslash;jberg O, Larsen MK, Dijkstra J, Erlandsen EJ, Lund P (2016) Effect of dietary nitrate level on enteric methane production, hydrogen emission, rumen fermentation, and nutrient digestibility in dairy cows. J Dairy Sci 99(8): 6191-6205. doi:https://doi.org/10.3168/jds.2015-10691\u003c/li\u003e\n\u003cli\u003eOmar S, Khalil N, EL-Ahwany A, El-Sayed H, Arafat S (2021) Mitigation of microbiologically induced corrosion (MIC) and preventive strategies. . In (Vol. 3: pp. Vol. 3, 1-11): Res Trends Microbiol.\u003c/li\u003e\n\u003cli\u003eRamos Monroy OA, Ruiz Ordaz N, Hern\u0026aacute;ndez Gayosso MJ, Ju\u0026aacute;rez Ram\u0026iacute;rez C, Gal\u0026iacute;ndez Mayer J (2019) The corrosion process caused by the activity of the anaerobic sporulated bacterium \u003cem\u003eClostridium celerecrescens\u003c/em\u003e on API XL 52 steel. Environ Sci Pollut Res 26(29): 29991-30002. doi:10.1007/s11356-019-06064-3\u003c/li\u003e\n\u003cli\u003eRouvre I, Basseguy R (2016) Exacerbation of the mild steel corrosion process by direct electron transfer between [Fe-Fe]-hydrogenase and material surface. Corros Sci 111: 199-211. doi:https://doi.org/10.1016/j.corsci.2016.05.005\u003c/li\u003e\n\u003cli\u003eSanmart\u0026iacute;n P, Bosch-Roig P, Gulotta D, Fort R, Bosch I, Cappitelli F (2021) \u003cem\u003eKlebsiella aerogenes\u003c/em\u003e and \u003cem\u003eComamonas testosteroni\u003c/em\u003e as bioremoval agents on graffiti-coated concrete and granite: Impact assessment through surface analysis. Int Biodeter Biodegr 161: 105244. doi:https://doi.org/10.1016/j.ibiod.2021.105244\u003c/li\u003e\n\u003cli\u003eTelegdi J, Shaban A, Trif L (2020) Review on the microbiologically influenced corrosion and the function of biofilms. Inter J Corros Scale Inhibi 9(1): 1-33. \u003c/li\u003e\n\u003cli\u003eTshikantwa TS, Ullah MW, He F, Yang G (2018) Current trends and potential applications of microbial interactions for human welfare. Front Microbiol 9. doi:10.3389/fmicb.2018.01156\u003c/li\u003e\n\u003cli\u003eVadroňov\u0026aacute; M, \u0026Scaron;ťov\u0026iacute;ček A, Jochov\u0026aacute; K, V\u0026yacute;born\u0026aacute; A, Tyrolov\u0026aacute; Y, Tich\u0026aacute; D, Homolka P, Joch M (2023) Combined effects of nitrate and medium-chain fatty acids on methane production, rumen fermentation, and rumen bacterial populations in vitro. Sci Rep 13(1): 21961. doi:10.1038/s41598-023-49138-6\u003c/li\u003e\n\u003cli\u003eVidela HA, Herrera LK (2005) Microbiologically influenced corrosion: looking to the future. Int Microbiol 8(3): 169-180. \u003c/li\u003e\n\u003cli\u003eVoordouw G, Menon P, Pinnock T, Sharma M, Shen Y, Venturelli A, Voordouw J, Sexton A (2016) Use of homogeneously-sized carbon steel ball bearings to study microbially-influenced corrosion in oil field samples. Front Microbiol 7. doi:10.3389/fmicb.2016.00351\u003c/li\u003e\n\u003cli\u003eWang X, Sun H, Wang Y, Wang F, Zhu W, Wu C, Wang Q, Gao M (2023) Feasibility of efficient, direct, butanol production from food waste without nutrient supplement by \u003cem\u003eClostridium saccharoperbutylacetonicum\u003c/em\u003e N1-4. Sustainability 15(7): 6061. \u003c/li\u003e\n\u003cli\u003eWang Z, Li Y, Ren J, Xu W, Yang L (2022) Investigating the effects of environment, corrosion degree, and distribution of corrosive microbial communities on service-life of refined oil pipelines. Environ Sci Pollut Res 29(34): 52204-52219. doi:10.1007/s11356-022-19556-6\u003c/li\u003e\n\u003cli\u003eYadav MK, Singh B, Tiwari SK (2019) Comparative analysis of inhibition-based and indicator-independent colorimetric assay for screening of bacteriocin-producing lactic acid bacteria. Probiotics Antimicro 11(2): 687-695. doi:10.1007/s12602-018-9445-4\u003c/li\u003e\n\u003cli\u003eYang C, Rooke JA, Cabeza I, Wallace RJ (2016) Nitrate and inhibition of ruminal methanogenesis: microbial ecology, obstacles, and opportunities for lowering methane emissions from ruminant livestock. Front Microbiol 7: 132. doi:10.3389/fmicb.2016.00132\u003c/li\u003e\n\u003cli\u003eZhao L, Meng Q, Li Y, Wu H, Huo Y, Zhang X, Zhou Z (2018) Nitrate decreases ruminal methane production with slight changes to ruminal methanogen composition of nitrate-adapted steers. BMC Microbiol 18(1): 21. doi:10.1186/s12866-018-1164-1\u003c/li\u003e\n\u003cli\u003eZhu X (2007) Rapid quantification of butyric acid-producing bacteria using real-time PCR. In: Google Patents: US7276358B1.\u003c/li\u003e\n\u003cli\u003eZhu X (2008) Rapid quantification of acetic acid-producing bacteria using real-time PCR. In: Google Patents US7384770B1.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Acid Producing Bacteria, Interactomes, Biocorrosion, Nitrate, organic acids, pH","lastPublishedDoi":"10.21203/rs.3.rs-6770932/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6770932/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAcid-producing bacteria (APB) play a significant role in pipeline corrosion by producing corrosive metabolites. Current APB mitigation strategies are often not successful, or the effects are temporary, necessitating the need to identify alternate approaches. In this study, nitrate was used to manipulate microbial interaction and control the growth and activities of APB. Microbial diversity was manipulated by subsampling a microbial consortia pool, serially diluting subsamples, and culturing sufficient replicates of each dilution to allow random distribution in the absence or presence of nitrate. The interactomes were grown in the presence of C1018 carbon steel, and corrosion activities were evaluated by monitoring the change in pH of the culture media, the corrosion of carbon steel, and the production of organic acids. Microbial community composition and functional gene abundance were also monitored. The study identified a change in microbial community assemblage upon nitrate addition, resulting in differences of APB activities, such as acid production, change of pH, and corrosion rate. Nitrate addition inhibited APB-induced corrosion but did not affect microbial growth and abundance of metabolic genes, suggesting that the inhibitory effect is likely due to change in redox potential of culture media or increased growth of APB competitors. The study also identified the importance of nitrate addition as a novel approach to manipulate microbial community composition and mitigate corrosion induced by APB activities. This approach is economically viable and an environmentally sustainable strategy to control microbiologically influenced corrosion.\u003c/p\u003e","manuscriptTitle":"Nitrate Modulates Microbial Interaction and Biocorrosion Activities of Acid Producing Bacteria","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-09 10:55:59","doi":"10.21203/rs.3.rs-6770932/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"87178775-912d-4662-8933-b6eff452c01c","owner":[],"postedDate":"June 9th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-06-24T20:49:41+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-09 10:55:59","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6770932","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6770932","identity":"rs-6770932","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.